Nrf2 activator

Abstract

The present invention addresses the problem of providing an Nrf2 activator for preventing or treating diseases, the onset and symptom progression of such diseases being associated with oxidative stress. This Nrf2 activator is a means for solving the above problem and contains, as an active ingredient, a bisindole-type alkaloid represented by general formula (1) or a pharmaceutically acceptable salt thereof [In the formula, R1 is a hydroxyl group or is combined with R2 to represent −O−. R2 is combined with R1 to represent −O− or is combined with R3 to represent −O−. R3 is a hydrogen atom or is combined with R2 to represent −O−. R4 and R5 each represent a hydroxyl group or are combined to represent −O− or a bond.]

Description

Nrf2 activator

[0001] The present invention relates to an Nrf2 activator.

[0002] It is known that one of the defense mechanisms against oxidative stress in the body is the transcription factor Nrf2 (NF-E2 related factor 2), which plays a role in protecting cells by increasing the expression of genes that reduce oxidative stress. For this reason, in recent years, active efforts have been made to discover ingredients that activate Nrf2 to prevent or treat diseases in which oxidative stress is involved in the onset or progression of symptoms. For example, Patent Document 1 describes that an extract from wolfberry fruit (Lycium barbarum) has an Nrf2-activating effect. However, the search for ingredients that have an Nrf2-activating effect is still in a significant state.

[0003] Japanese Patent Application Laid-Open No. 2012-211107

[0004] Therefore, an object of the present invention is to provide an Nrf2 activator for preventing or treating diseases in which oxidative stress is involved in the onset or progression of symptoms.

[0005] In view of the above, the present inventors have conducted extensive research and found that conophylline, which is known as a bisindole alkaloid and has the following chemical structural formula, has Nrf2 activation activity.

[0006]

[0007] The Nrf2 activator of the present invention, which was developed based on the above findings, contains as an active ingredient a bisindole alkaloid represented by the following general formula (1) or a pharmaceutically acceptable salt thereof, as described in claim 1:

[0008]

[0009] [In the formula, R １ is a hydroxyl group or R ２ Together with R it represents -O-. ２ is R １ together with -O- or R ３ Together with R it represents -O-. ３is R ２ Together with R, they represent -O- or a hydrogen atom. ４ and R ５ represent a hydroxyl group or together represent —O— or a bond.]

[0010] According to the present invention, it is possible to provide an Nrf2 activator for preventing or treating diseases in which oxidative stress is involved in the onset or progression of symptoms.

[0011] 1 is a graph showing the Nrf2 activating effect of conophylline in an example.

[0012] The Nrf2 activator of the present invention contains as an active ingredient a bisindole alkaloid represented by the following general formula (1) or a pharmaceutically acceptable salt thereof:

[0013]

[0014] [In the formula, R １ is a hydroxyl group or R ２ Together with R it represents -O-. ２ is R １ together with -O- or R ３ Together with R it represents -O-. ３ is R ２ Together with R, they represent -O- or a hydrogen atom. ４ and R ５ represent a hydroxyl group or together represent —O— or a bond.]

[0015] Pharmaceutically acceptable salts of the bisindole alkaloid represented by the above general formula (1) include inorganic acid salts (hydrochloride, sulfate, nitrate, phosphate, etc.), organic acid salts (acetate, lactate, citrate, tartrate, maleate, fumarate, oxalate, etc.), etc.

[0016] Specific examples of bisindole alkaloids represented by the general formula (1) include conophylline (R １ is a hydroxyl group, R ２ and R ３ Together they form -O-, R ４ and R ５ together form -O-), conophyllidine (R １ is a hydroxyl group, R２ and R ３ Together they form -O-, R ４ and R ５ bonded together), conofolin (R １ and R ２ Together they form -O-, R ３ is a hydrogen atom, R ４ and R ５ together -O-), conophyllinine (R １ is a hydroxyl group, R ２ and R ３ Together they form -O-, R ４ and R ５ are hydroxyl groups). These compounds are known as plant-derived bisindole alkaloids having antitumor activity and can be isolated and purified from plants of the Apocynaceae family, such as Ervatamia microphylla and Tabernaemontana divaricata (see, for example, Japanese Patent No. 4696303, if necessary). However, these compounds used as active ingredients of the Nrf2 activator of the present invention are not limited to isolated and purified compounds, and may be in the form of a solvent extract containing these compounds. Furthermore, these compounds may be synthesized by organic chemical techniques, and may be stereoisomers (enantiomers or diastereoisomers) or racemates based on the presence of asymmetric carbons. Furthermore, these compounds may be a mixture of two or more compounds, or may be in the form of a solvent extract containing two or more compounds. Here, the term "solvent extract" refers to an extract extracted from, for example, the above-mentioned plants using water or an organic solvent (such as an alcohol, such as a monoalcohol exemplified by methanol, ethanol, or isopropanol, or a polyalcohol exemplified by 1,3-butylene glycol, ether, hexane, ethyl acetate, or acetonitrile, which may contain water) as an extraction solvent.

[0017] The Nrf2 activator of the present invention can be formulated into various dosage forms and administered or ingested as a pharmaceutical or health food, or can be incorporated into various foods and beverages for ingestion. The Nrf2 activator of the present invention can also be applied to the skin in the form of a topical preparation such as an ointment, cream, or lotion. The dosage, intake, or application amount can be determined appropriately based on the age, sex, weight, and severity of symptoms of the subject. By administering, ingesting, or applying an appropriate amount, its Nrf2 activating effect can be expected to provide preventive and therapeutic effects (including skin-beautifying and whitening effects) for diseases in which oxidative stress is involved in the onset or progression of symptoms, such as Alzheimer's disease, chronic obstructive pulmonary disease, asthma, atherosclerosis, multiple sclerosis, rheumatoid arthritis, and photo-induced skin damage and aging.

[0018] The present invention will be described in detail below with reference to examples, but the present invention should not be construed as being limited to the following description.

[0019] Experimental Example 1: Nrf2 activating effect of conophylline (Experimental Method) The Nrf2 activating effect of conophylline (crystals) isolated and purified from Ervatamia microphylla, a plant of the Apocynaceae family, by the method described in Japanese Patent No. 4696303 was evaluated by an ARE (Antioxidant Response Element)-luciferase reporter assay, which is known as a monitoring system for the Nrf2 antioxidant pathway. Specifically, a plasmid containing a polynucleotide consisting of two repeated ARE sequences (TAGCTTGGAAATGACATTGCTAATGGTGACAAAGCAACTTTTAGCTTGGAAATGACATTGCTAATGGTGACAAAGCAACTTT: SEQ ID NO: 1) inserted into the multicloning site of pNL2.2[NlucP / Hygro] Vector (Promega), a vector for luciferase reporter assay, was transfected using Cell Line Nucleofector Kit. HaCaT cells (DKFZ) were electroporated with ARE-luciferase V (Lonza). After 24 hours, hygromycin was added at a final concentration of 600 μg / mL to select for drug-resistant cells, establishing a hygromycin-resistant HaCaT cell line stably expressing an ARE-luciferase reporter. Approximately 10,000 cells per well of the ARE-luciferase reporter-stably expressing HaCaT cell line were seeded in 100 μL of medium (high-glucose DMEM (Sigma) supplemented with 10% FBS (Gibco) and 200 mmol / L L-glutamine solution (x100) (Fujifilm Wako Pure Chemical Industries), the same applies below) into a 96-well plate. The cells were incubated at 37°C and 5% CO ２ The cells were cultured in an incubator for 16 to 24 hours. The medium was then replaced with one containing conophylline dissolved in DMSO at various final concentrations (final DMSO concentration: 0.1%), and the cells were cultured for an additional 24 hours. After 24 hours, the Nrf2-activating effect of conophylline was evaluated by measuring luciferase activity using the Nano-Glo Luciferase Assay System (Promega) according to the protocol.

[0020] (Experimental Results) The luciferase activity when only DMSO was added at a final concentration of 0.1% as a control was set to 1, and the results are shown in Figure 1 as relative values ​​(CNP represents conophylline). As is clear from Figure 1, conophylline increased luciferase activity in a concentration-dependent manner. When conophylline was dissolved in DMSO to a final concentration of 1 μg / mL and added, and ML-385 (Cayman Chemical Co.), an Nrf2 inhibitor, was also dissolved in DMSO to a final concentration of 20 μM and added (final DMSO concentration: 0.1%), luciferase activity was significantly reduced. From these results, the Nrf2 activating effect of conophylline was confirmed.

[0021] Formulation Example 1: Tablets Tablets having the following component composition and Nrf2 activating activity were produced by a method known per se (unit: weight %): Conophylline 1 Lactose 80 Magnesium stearate 19

[0022] Formulation Example 2: Biscuits Biscuits having the Nrf2 activating effect and consisting of the following component composition were produced by a method known per se (unit: weight %): Conophylline 1 Soft flour 32 Whole eggs 16 Butter 16 Sugar 24 Water 10 Baking powder 1

[0023] Formulation Example 3: Jelly A jelly having the Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %): Conophylline 0.01 Gelling agent 1.3 Sugar 20 pH adjuster 2.5 Water 76.19

[0024] Formulation Example 4: Ointment An ointment having an Nrf2 activating effect and consisting of the following component composition was prepared by a method known per se (unit: weight %): Conophylline 5 White petrolatum 95

[0025] Formulation Example 5: Cream A cream having the Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %): Conophylline 5 White petrolatum 30 Cetanol 15 Sodium lauryl sulfate 1 Ethyl parahydroxybenzoate 0.1 Butyl parahydroxybenzoate 0.1 Water 48.8

[0026] Formulation Example 6: Lotion A lotion having an Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %): Conophylline 10 Polyoxyethylene (40) hydrogenated castor oil 0.5 Ethanol 5 Paraben 0.2 Water 84.3

[0027] INDUSTRIAL APPLICABILITY The present invention has industrial applicability in that it can provide an Nrf2 activator for preventing or treating diseases in which oxidative stress is involved in the onset or progression of symptoms.

Claims

1. An Nrf2 activator comprising as an active ingredient a bisindole alkaloid represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof: [In the formula, R １ is a hydroxyl group or R ２ Together with represents -O-. ２ is R １ Together with -O- or R ３ Together with represents -O-. ３ is R ２ Together with R, they represent -O- or a hydrogen atom. ４ and R ５ each represents a hydroxyl group or together represents --O-- or a bond.]

Images