Method for constructing plasmid containing tandem repeat sequence

Abstract

A method for constructing a plasmid containing a tandem repeat sequence, comprising: providing a first upstream primer and a first downstream primer, the first upstream primer and the first downstream primer each having a tandem repeat sequence, and the tandem repeat sequence of the first upstream primer is complementary to at least part of the tandem repeat sequence of the first downstream primer; annealing the first upstream primer and the first downstream primer under a gradient temperature condition to obtain a first double-stranded nucleic acid fragment having a tandem repeat sequence, wherein the tandem repeat sequence complementarily combined in the double strand is a first double-stranded tandem repeat sequence; and connecting the first double-stranded nucleic acid fragment to a first vector backbone having sticky ends, to construct a plasmid containing the first double-stranded tandem repeat sequence. The method can significantly improve the success rate of connection of tandem repeat sequences, thereby obtaining more positive clones, ensuring the success rate of experiments, and reducing the construction time.

Description

A method for constructing a plasmid containing tandem repeat sequences Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method for constructing a plasmid containing a tandem repeat sequence. Background Art

[0002] Tandem repeat sequences are short, relatively constant sequences of one or more bases, linked end-to-end in tandem. Plasmid construction with long tandem repeats has always been a challenge, as base additions or deletions can easily occur during the construction process, leading to discrepancies between the actual sequence and the intended sequence, potentially impacting application. Currently, tandem repeat templates are primarily constructed by first amplifying an existing template using PCR or gene synthesis to obtain the vector fragment and the target fragment (tandem repeat fragment), which are then ligated to the vector using homologous recombination or enzyme ligation. Both amplification and gene synthesis involve PCR amplification, a process during which tandem repeat fragment additions or deletions are very common. This often requires sequencing verification of numerous clones to identify a clone with the correct base sequence and length, followed by full-length sequencing of the vector backbone. These factors contribute to the high workload, high sequencing costs, and time-consuming nature of the construction process. This can be particularly challenging when encountering long tandem repeat fragments, such as constructing a plasmid with a polyA fragment containing 200 A bases.

[0003] Currently, the synthesis process of long tandem repeat fragments can be divided into two cases:

[0004] ① If a template is required for amplification during the experiment, PCR amplification is generally used. However, regardless of the high-fidelity PCR enzyme used, it is very easy to increase or lose the amplification of long tandem repeats, which in turn requires a lot of sequencing and result interpretation during the experiment, making it extremely inefficient.

[0005] ② If a template is not available during the experiment, gene synthesis is generally outsourced. Gene synthesis is often based on multiple primer bridges, and short primers are often used. Tandem repeats make their synthesis relatively difficult. Even when long primers are used for synthesis, the unique structure of tandem repeats can make it difficult for the long primers to bind correctly, resulting in a low success rate, long synthesis cycles, and high costs. This is especially true when gene sequences need to be kept confidential. After template synthesis is complete, there is the issue of base loss or addition during amplification.

[0006] After synthesizing tandem repeats, they are typically incorporated into a vector using homologous recombination or blunt-end ligation. This method significantly increases the risk of multi-segment gene loss or ligation errors, reducing the success rate of the experiment. Because blunt ends cannot guarantee the directionality of ligation, the addition of homologous recombination reagents also increases the probability of repeat sequence loss. Currently, the synthesis of long-segment primers has a synthesis limit, generally upper than 144 nt. To obtain long tandem repeats, multiple rounds of ligation are required. However, after the first round of ligation, the aforementioned scheme cannot further extend the tandem repeats indefinitely due to the presence of multi-segment repeat sequences in the vector.

[0007] Summary of the Invention

[0008] One object of the present invention is to provide an improved method for constructing a plasmid containing tandem repeats.

[0009] Another object of the present invention is to provide a constructed plasmid containing tandem repeat fragments.

[0010] In one aspect, the present invention provides a method for constructing a plasmid containing a tandem repeat sequence, comprising:

[0011] A first nucleic acid molecule and a second nucleic acid molecule are provided; wherein the first nucleic acid molecule and the second nucleic acid molecule each have a tandem repeat sequence, and the tandem repeat sequence of the first nucleic acid molecule is complementary to at least a portion of the tandem repeat sequence of the second nucleic acid molecule;

[0012] Annealing the first nucleic acid molecule and the second nucleic acid molecule under gradient temperature conditions to allow the complementary sequences of the first nucleic acid molecule and the second nucleic acid molecule to bind to obtain a first double-stranded nucleic acid fragment having a tandem repeat sequence, wherein the complementary tandem repeat sequence in the double strands is a first double-stranded tandem repeat sequence;

[0013] The first double-stranded nucleic acid fragment having the tandem repeat sequence is connected to a first vector backbone with sticky ends to construct a plasmid containing the first double-stranded tandem repeat sequence.

[0014] According to some specific embodiments of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence of the present invention, the first nucleic acid molecule and the second nucleic acid molecule are single-stranded, the first nucleic acid molecule is a first upstream primer, and the second nucleic acid molecule is a first downstream primer. The method for constructing a plasmid containing a tandem repeat sequence comprises:

[0015] Providing a first upstream primer and a first downstream primer; wherein the first upstream primer and the first downstream primer each have a tandem repeat sequence, and the tandem repeat sequence of the first upstream primer is complementary to at least a portion of the tandem repeat sequence of the first downstream primer;

[0016] Annealing the first upstream primer and the first downstream primer under gradient temperature conditions to allow the complementary sequences of the first upstream primer and the first downstream primer to bind to obtain a first double-stranded nucleic acid fragment having a tandem repeat sequence, wherein the complementary tandem repeat sequence in the double strands is the first double-stranded tandem repeat sequence;

[0017] The first double-stranded nucleic acid fragment having the tandem repeat sequence is connected to a first vector backbone with sticky ends to construct a plasmid containing the first double-stranded tandem repeat sequence.

[0018] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence, the first vector backbone with sticky ends is a linearized vector obtained by digesting a plasmid vector with a restriction endonuclease. Preferably, the sticky ends at both ends of the linearized vector are non-complementary sequences to prevent self-ligation of the vector.

[0019] According to a specific embodiment of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence, the plasmid vector includes a first restriction endonuclease cleavage site and a second restriction endonuclease cleavage site, and the plasmid vector is double-digested by the first restriction endonuclease and the second restriction endonuclease to obtain a vector backbone with sticky ends.

[0020] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence of the present invention, the first restriction endonuclease and the second restriction endonuclease are each independently a type II restriction endonuclease or a type IIS restriction endonuclease. Preferably, the type II restriction endonuclease is one of SalI, HindIII, BamHI, AgeI, PstI, and SacI. The type IIS restriction endonuclease is one of BSPQI, AarI, and SapI. Preferably, the first restriction endonuclease and the second restriction endonuclease are each independently a type IIS restriction endonuclease, and the type IIS restriction endonuclease can prevent the addition of additional base sequences to the vector after enzyme cleavage. The first restriction endonuclease and the second restriction endonuclease may be the same or different.

[0021] According to a specific embodiment of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence, the plasmid vector includes a visual screening marker gene sequence between the first restriction endonuclease cutting site and the second restriction endonuclease cutting site, and the plasmid vector can be double-digested with the first restriction endonuclease and the second restriction endonuclease to remove the visual screening marker gene sequence.

[0022] According to a specific embodiment of the present invention, the method of constructing a plasmid containing a tandem repeat sequence of the present invention further comprises:

[0023] Based on a plasmid containing a first double-stranded tandem repeat sequence, a second double-stranded tandem repeat sequence is added in series upstream or downstream of the first double-stranded tandem repeat sequence to construct a plasmid containing the first double-stranded tandem repeat sequence and the second double-stranded tandem repeat sequence;

[0024] In the plasmid containing the first double-stranded tandem repeat sequence, a third restriction endonuclease cleavage site is directly connected upstream or downstream of the first double-stranded tandem repeat sequence, and the plasmid containing the first double-stranded tandem repeat sequence has a fourth restriction endonuclease cleavage site; after the plasmid is double-digested with the third restriction endonuclease and the fourth restriction endonuclease, a second vector backbone with sticky ends is obtained, which is used to concatenate the second double-stranded tandem repeat sequence upstream or downstream of the first double-stranded tandem repeat sequence of the vector backbone.

[0025] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing tandem repeats of the present invention, the third restriction endonuclease and the fourth restriction endonuclease are each independently a Type II restriction endonuclease or a Type IIS restriction endonuclease. Preferably, the Type II restriction endonuclease is one of SalI, HindIII, BamHI, AgeI, PstI, and SacI. The Type IIS restriction endonuclease is one of BSPQI, AarI, and SapI. The third restriction endonuclease and the fourth restriction endonuclease may be the same or different. Preferably, the third restriction endonuclease and the fourth restriction endonuclease are different.

[0026] According to a specific embodiment of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence of the present invention, the third restriction endonuclease cutting site and the fourth restriction endonuclease cutting site are each independently a sequence possessed by the first double-stranded nucleic acid fragment (that is, the third restriction endonuclease cutting site and the fourth restriction endonuclease cutting site can be introduced into the plasmid vector by the first double-stranded nucleic acid fragment), or a sequence possessed by the first vector backbone with sticky ends.

[0027] According to a specific embodiment of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence of the present invention, a visual screening marker gene sequence is included between the restriction endonuclease cutting site of the third restriction endonuclease and the restriction endonuclease cutting site of the fourth restriction endonuclease of the plasmid vector, and the visual screening marker gene sequence can be removed by double enzyme digestion of the third restriction endonuclease and the fourth restriction endonuclease.

[0028] According to a specific embodiment of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence, the process of tandemly attaching a second double-stranded tandem repeat sequence upstream or downstream of a first double-stranded tandem repeat sequence comprises:

[0029] Providing a third nucleic acid molecule and a fourth nucleic acid molecule; wherein the third nucleic acid molecule and the fourth nucleic acid molecule each have a tandem repeat sequence, and the tandem repeat sequence of the third nucleic acid molecule is complementary to at least a portion of the tandem repeat sequence of the fourth nucleic acid molecule;

[0030] Annealing the third nucleic acid molecule and the fourth nucleic acid molecule under gradient temperature conditions to allow the complementary sequences of the third nucleic acid molecule and the fourth nucleic acid molecule to bind to obtain a second double-stranded nucleic acid fragment having a tandem repeat sequence, wherein the complementary tandem repeat sequence in the double strands is a second double-stranded tandem repeat sequence;

[0031] The second double-stranded nucleic acid fragment having the tandem repeat sequence is connected to a second vector backbone with sticky ends to construct a plasmid containing the first double-stranded tandem repeat sequence and the second double-stranded tandem repeat sequence.

[0032] According to some specific embodiments of the present invention, the third nucleic acid molecule and the fourth nucleic acid molecule of the present invention are single-stranded, the third nucleic acid molecule is the second upstream primer, and the fourth nucleic acid molecule is the second downstream primer.

[0033] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing tandem repeat sequences, after a first double-stranded tandem repeat sequence is inserted into a vector backbone, a second double-stranded tandem repeat sequence can be inserted again using the third and fourth restriction endonuclease sites on the vector backbone. If the vector into which the second double-stranded tandem repeat sequence was inserted still contains a pair of restriction endonuclease sites, these can be used to insert a further tandem repeat sequence, and so on, thereby extending the tandem repeat sequence, thereby obtaining a plasmid containing a longer tandem repeat sequence.

[0034] According to a specific embodiment of the present invention, in the method of the present invention for constructing a plasmid containing a tandem repeat sequence, the length of each nucleic acid molecule, i.e., each primer (first upstream primer, first downstream primer, second upstream primer, second downstream primer) is independently 60nt-200nt, preferably 60nt-144nt, and more preferably 90nt-136nt.

[0035] According to some specific embodiments of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence, the tandem repeat sequence includes a polyA sequence; the method of the present invention is used to construct a plasmid containing a polyA sequence. According to a preferred embodiment of the present invention, the polyA sequence contains at least 12 nt, at least 24 nt, at least 36 nt, or at least 48 nt of A bases and 0-24 nt or 0-12 nt of non-A bases. According to a preferred embodiment of the present invention, the full length of the polyA sequence is 60 nt to 144 nt, more preferably 90 nt to 136 nt.

[0036] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence, when annealing is performed under gradient temperature conditions, in the annealing reaction system: the concentration of the upstream primer is 10 pmol / μL-200 pmol / μL, preferably 50 pmol / μL-100 pmol / μL; the concentration of the downstream primer is 10 pmol / μL-200 pmol / μL, preferably 50 pmol / μL-100 pmol / μL. Preferably, in the annealing reaction system, the concentrations of the upstream primer and the downstream primer are the same. Using a higher primer concentration can form more correct double-stranded nucleic acid fragments containing tandem repeat sequences with sticky ends.

[0037] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence, the gradient temperature conditions for annealing are set based on the Tm value of the upstream primer and the Tm value of the downstream primer, with the highest annealing temperature being the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer, and the lowest annealing temperature being 12°C lower than the highest annealing temperature. The present invention employs a gradient annealing approach, enabling the gradient cooling process to find the optimal primer binding temperature within a temperature range, forming more correctly bound fragments, thereby enabling the primers to form the correct double-stranded tandem repeat fragments and avoiding mismatches.

[0038] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence, the gradient temperature comprises setting three or more gradient annealing temperatures within the annealing temperature range; preferably, setting 3-5 gradient annealing temperatures. Preferably, when annealing is performed under gradient temperature conditions, the difference between adjacent gradient annealing temperatures is 1-3°C. Preferably, when annealing is performed under gradient temperature conditions, the single annealing time is 30 seconds to 10 minutes; preferably, 5 minutes.

[0039] According to some specific embodiments of the present invention, in the method of constructing a plasmid containing a tandem repeat sequence of the present invention, the annealing program under gradient temperature conditions is:

[0040] Maintaining the mixture for 5 minutes at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer is reduced by 3° C.;

[0041] Maintaining the mixture for 5 minutes at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer is reduced by 5° C.;

[0042] Maintaining the mixture for 5 minutes at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer is reduced by 7° C.;

[0043] The mixture was maintained at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer was lowered by 9° C. for 5 minutes.

[0044] According to specific embodiments of the present invention, in the method for constructing a plasmid containing a tandem repeat sequence, it is understood that conventional PCR denaturation and cooling processes after annealing may be included before and after the annealing process. For example, a denaturation process at 92°C-94°C for approximately 5 minutes may be included before the annealing process, and a cooling process to approximately 25°C for approximately 5 minutes may be included after the annealing process.

[0045] According to a specific embodiment of the present invention, in the method for constructing a plasmid containing tandem repeat sequences, the operation of ligating the double-stranded nucleic acid fragment to the vector backbone with sticky ends can be performed according to conventional procedures in the art. The preferred ligation conditions in the present invention are 1-3 hours at 37°C.

[0046] The method of constructing a plasmid containing tandem repeat sequences of the present invention can significantly improve the efficiency of correct pairing between long-fragment tandem repeat primers and the successful efficiency of connecting double-stranded nucleic acid fragments containing tandem repeat sequences to the vector backbone, thereby obtaining more positive clones, ensuring the success rate of the experiment, and reducing construction time.

[0047] On the other hand, the present invention also provides a plasmid containing a tandem repeat sequence, which is constructed according to the method of the present invention.

[0048] According to some specific embodiments of the present invention, in the present invention, T4 DNA ligase is used to connect the double-stranded nucleic acid fragment to the linearized vector.

[0049] According to some specific embodiments of the present invention, in the methods for constructing plasmids containing tandem repeat sequences, the starting plasmid vector used can be a universal vector. It is only required that it contain the restriction sites that meet the requirements of the present invention or that it can be modified to insert the restriction sites that meet the requirements of the present invention. There are no special requirements for the other structures of the vector. Universal vectors generally include components such as enhancers, promoters, and resistance genes. In some more specific embodiments of the present invention, the starting plasmid vector includes, but is not limited to, pVAX1 or pcDNA3.1.

[0050] According to some specific embodiments of the present invention, in the method for constructing a plasmid containing tandem repeat sequences, the primers may include a portion of the vector to ensure the integrity of the vector backbone. The ends of the primers need to form specific sticky ends based on the restriction sites on the vector to ensure that no vector sequence is lost or added. Furthermore, it is important to note that if the vector backbone is removed during enzymatic digestion, this portion of the vector should be included during primer synthesis to ensure the integrity of the vector backbone.

[0051] According to a specific embodiment of the present invention, after constructing a plasmid containing a tandem repeat sequence, the plasmid containing the tandem repeat sequence can be further transformed into Escherichia coli for culture, and positive clones can be screened and sequenced to obtain a plasmid with correct sequencing.

[0052] In general, the present invention adopts long fragment primers (60nt-144nt) and gradient annealing to achieve the connection between the long tandem repeat fragment and the vector, and theoretically can achieve the construction of a plasmid with an infinite length of tandem repeat sequence. The method of the present invention effectively solves the problem of the difficulty of correctly pairing long fragment tandem repeat primers in traditional technology, can significantly improve the success efficiency of the connection, obtain more positive clones, ensure the success rate of the experiment, and reduce the construction time. The present invention plays a positive role in promoting both life science research and biomedicine development. For example, in the field of mRNA vaccines, the study of long polyA sequences has always been a hot spot and difficulty. PolyA has a significant impact on drugability. The proposal of the present invention will help solve the problem in the synthesis of longer polyA sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] FIG1 is a schematic diagram of the carrier structure of the present invention.

[0054] FIG2 is a schematic diagram of the sticky ends of the vector backbone after enzyme digestion in Example 1.

[0055] FIG3 is a schematic diagram of double-stranded DNA containing sticky ends in Example 1.

[0056] FIG4 shows the conversion results of Example 1 and Comparative Example 1; the left side shows the conversion result of Example (gradient annealing method), and the right side shows the conversion result of Comparative Example (Tm-5° C. method).

[0057] Figure 5 is a plasmid map in Example 2.

[0058] FIG6 is a schematic diagram of the sticky ends of the carrier skeleton w1 in Example 2.

[0059] FIG7 is a schematic diagram of the structure of polyA containing sticky ends obtained in Example 2.

[0060] Figure 8 is a map of the p-6woG vector in Example 3.

[0061] FIG9 is a schematic diagram of the sticky ends of the vector backbone after enzyme digestion in Example 3.

[0062] FIG10 is a schematic diagram of double-stranded DNA containing sticky ends in Example 3. DETAILED DESCRIPTION

[0063] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of implementation of the present invention.

[0064] All starting reagents (including enzymes, carriers, and other materials) used in the examples of this invention were commercially available. Primers and templates were designed and then synthesized on a commissioned basis. The endonuclease was from Thermo, the amplification enzyme was from Vazyme, and other biological reagents were from Sangon Biotechnology. Experimental procedures in the examples, where specific conditions are not specified, were performed according to conventional conditions in the art or as recommended by the manufacturer's instructions.

[0065] the term

[0066] As used herein, the term "sticky end" refers to a protruding portion of a nucleic acid strand that can freely base pair with the sticky ends of other DNA fragments or assembly vectors. In some embodiments of the present invention, the sticky end refers to the nick formed by restriction enzymes separating two single-stranded DNA strands, with several protruding nucleotide sequences. These protruding nucleotide sequences are complementary to each other, and such nicks are called sticky ends.

[0067] In the present invention, the term "restriction enzyme site" refers to a specific sequence of bases on DNA. Restriction endonucleases can recognize this sequence and cut the DNA into two segments.

[0068] In the present invention, the term "visual screening marker gene" refers to a type of gene that can be used to indicate whether the cloning is successful or not, and can be used to judge whether the target fragment has been successfully inserted into the plasmid based on the color or phenotype of the colony by the naked eye or simple equipment. In some specific embodiments of the present invention, there is a first visual screening marker gene sequence between the first restriction endonuclease cutting site and the second restriction endonuclease cutting site of the plasmid, and a second visual screening marker gene sequence between the third restriction endonuclease cutting site and the fourth restriction endonuclease cutting site. The first visual screening marker gene sequence and the second visual screening marker gene sequence may be the same or different. The plasmid vector can be double-digested by the first restriction endonuclease and the second restriction endonuclease, or by the third restriction endonuclease and the fourth restriction endonuclease, to remove the visual screening marker gene between the two restriction enzyme cutting sites.

[0069] Example 1

[0070] This embodiment provides a method for constructing a plasmid containing a long segment (A60×2-12nt) tandem repeat sequence. The long segment (A60×2-12nt) tandem repeat sequence is shown in SEQ ID NO.1.

[0071] SEQ ID NO.1:

[0072] The method comprises the following operations:

[0073] 1. Obtain vector backbone b containing sticky ends

[0074] Construction of a universal vector: Insert a visual screening marker gene (its nucleotide sequence is shown in SEQ ID NO.13) into the restriction site of the vector. The visual screening marker gene has AarI restriction sites at both ends. The structure of the universal vector after insertion of the visual screening marker gene is shown in Figure 1.

[0075] The universal vector shown in Figure 1 was cut with the IIS type endonuclease AarI (see Table 1 for the AarI digestion system) to obtain vector backbone b containing sticky ends. The sticky ends of vector backbone b are shown in Figure 2.

[0076] Table 1

[0077] 2. Obtain a long fragment (A60×2-12nt) product containing sticky ends (i.e. a)

[0078] (1) Synthesize long fragment primers

[0079] The long-fragment primers for the tandem repeat sequence are divided into an upstream primer, primeF1, and a downstream primer, primerR1. Both primers were synthesized by Beijing Qingke Co., Ltd. The sequence of the upstream primer, primeF1, is shown in SEQ ID NO. 2, and the sequence of the downstream primer, primerR1, is shown in SEQ ID NO. 3.

[0080] SEQ ID NO.2:

[0081] SEQ ID NO.3:

[0082] (2) Obtaining double-stranded DNA with sticky ends

[0083] The long-fragment primers synthesized in (1) were annealed under gradient conditions to obtain double-stranded DNA with sticky ends. The annealing reaction system is shown in Table 2.

[0084] Table 2

[0085] According to the Tm values ​​of primer synthesis of 68.26℃ / 68.19℃, three annealing temperatures were set: 63℃5min; 60℃5min; 58℃5min; and the annealing program was set as follows:

[0086] 94℃5min;

[0087] 63℃5min;

[0088] 60℃5min;

[0089] 58℃5min;

[0090] 25℃5min.

[0091] The structure of the double-stranded DNA fragment (i.e., a) containing sticky ends obtained after annealing is shown in FIG3 .

[0092] (3) Ligation, transformation, and sequencing

[0093] The double-stranded DNA fragment (i.e., a) containing sticky ends was ligated to the vector backbone (b) containing sticky ends. The ligation reaction used the T4 DNA ligase kit (Cat. No. EL0014) from Thermo. The ligation system is shown in Table 3. The ligation conditions were 37°C for 2 hours.

[0094] Table 3

[0095] After ligation, the ligation product was transformed into dh5α E. coli and cultured overnight.

[0096] The conversion involves the following steps:

[0097] Thaw the chemically competent cells for cloning on ice and label them;

[0098] Take 10ul of the ligation product and add it to 100ul of competent cells, mix gently, and incubate on ice for 30min;

[0099] After heat shock in a 42°C water bath for 90 seconds, immediately cool on ice for 2 minutes;

[0100] Add 500 μl of LB culture medium without antibiotics and shake at 37°C, 220 rpm for 1 h to recover.

[0101] Centrifuge at 5000 rpm for 1 min, retain the precipitate and 200 μl LB culture medium, mix gently, spread on a plate with the correct resistance (labeled with name and date), and culture upside down in a 37°C incubator for 12 to 16 hours.

[0102] The transformation results are shown in the left image of Figure 4. In this example, the gradient annealing method obtained a total of 196 positive clones (left image), and 40 clones were selected for sequencing. 15 clones were correct (37.5%) using the gradient annealing protocol.

[0103] Comparative Example 1

[0104] This comparative example provides a method for constructing a plasmid containing a long fragment (A60×2-12nt) tandem repeat fragment under Tm-5°C annealing conditions.

[0105] Except for the annealing temperature and PCR procedure, all operations in this comparative example were the same as those in Example 1.

[0106] Compared with Example 1, the steps of 2.(2) of this comparative example for obtaining double-stranded DNA containing sticky ends are as follows:

[0107] Anneal the long-fragment primers synthesized in 2.(1) at Tm-5°C. Based on the Tm values ​​of the synthesized primers, which are 68.26°C / 68.19°C, set the annealing temperature to 63°C for 5 minutes. The PCR program is then set as follows:

[0108] 94℃5min;

[0109] 63℃5min;

[0110] 25℃5min.

[0111] The structure of the synthesized double-stranded DNA containing sticky ends is shown in Figure 3.

[0112] (3) Ligation, transformation, and sequencing

[0113] The double-stranded DNA fragment containing sticky ends is ligated to a vector backbone containing sticky ends. After ligation, the ligation product is transformed into dh5α Escherichia coli and cultured overnight.

[0114] The transformation results are shown in the right picture of FIG4 . The Tm-5° C. test protocol of this comparative example obtained 135 positive clones, 40 clones were selected for sequencing, and 10 clones were correct (25%).

[0115] Example 1 of the present invention and comparative example 1 were carried out in the same batch of experiments for the convenience of comparison. Parallel experiments and repeated experiments were set up, and the results showed that the gradient annealing method of Example 1 of the present invention increased the positive rate by about 12.5% ​​compared with the Tm-5 method of comparative example 1. The reasons for this include: the primer Tm is calculated according to the corresponding formula, and the annealing temperature (TM-5°C) performed based on experience during the experiment is not necessarily the most suitable annealing temperature. It can only guarantee a relative success rate, especially for such repeated fragments, which often form a lot of mismatched consumption connection products, resulting in fewer connected clones; on the other hand, because the fragments are repeated bases, the incorrect connection between a very small number of bases between the fragments during the construction process will result in a low positive rate. The present invention uses the process of gradient annealing, and the primers will find a more suitable binding temperature in this process, forming more correct pairings, thereby improving the positive rate of Escherichia coli.

[0116] Example 2

[0117] This embodiment provides a method for constructing a plasmid containing a long fragment (fragment polyA) tandemly repeated fragment containing a repeating unit. The long fragment (fragment polyA) tandemly repeated fragment containing a repeating unit is shown in SEQ ID NO.4.

[0118] SEQ ID NO.4:

[0119] The method comprises the following operations:

[0120] 1. Obtain a vector backbone with sticky ends

[0121] (1) Micro-carrier primers were synthesized. The upstream primer ZtF of the carrier primer was shown as SEQ ID NO. 5, and the downstream primer ZtR was shown as SEQ ID NO. 6.

[0122] SEQ ID NO.5: CAGTAGTTTTGGGCCTTAAAAGAAGAGCCCGCTGATCAGC(5'→3');

[0123] SEQ ID NO. 6: CAGTAGCTCTTCGTTCAAAGACCACGGGGGTACGG (5'→3').

[0124] (2) Amplification to obtain universal vector

[0125] The vector was amplified using the above-mentioned vector primers (plasmid map shown in Figure 5) to obtain a universal vector backbone w with sapI restriction sites at both ends. PCR amplification conditions are shown in Table 4.

[0126] Table 4

[0127] (3) Enzyme digestion

[0128] The universal vector backbone w was digested with the endonuclease sapI. The digestion system is shown in Table 5 to obtain the vector backbone w1 with sticky CTT and AAA ends, see Figure 6.

[0129] Table 5

[0130] 2. Obtaining polyA with sticky ends

[0131] (1) Synthesize long fragment primers

[0132] The long-segment primers for the tandem repeat fragments are divided into an upstream primer, primeF1, and a downstream primer, primerR1. Both upstream and downstream primers were synthesized by Beijing Qingke Co., Ltd. The sequence of the upstream primer, primeF1, is shown in SEQ ID NO. 7, and the sequence of the downstream primer, primerR1, is shown in SEQ ID NO. 8.

[0133] SEQ ID NO.7:

[0134] SEQ ID NO.8:

[0135] (2) Obtaining double-stranded DNA with sticky ends (i.e., DNA fragments containing double-stranded repeat sequences)

[0136] The long-fragment primers synthesized in (1) were annealed under gradient conditions with 20 μL each of primeF1 (100 pmol / μL) and primerR1 (100 pmol / μL). Based on the Tm values ​​of the synthesized primers, which were 68.79°C / 68.7°C, three annealing temperatures were set: 68°C for 5 min; 66°C for 5 min; and 63.5°C for 5 min. The annealing program was then set as follows:

[0137] 95℃5min;

[0138] 68℃5min;

[0139] 66℃5min;

[0140] 63.5℃5min;

[0141] 25℃5min.

[0142] The structure of the synthesized polyA double-stranded fragment containing sticky ends is shown in Figure 7.

[0143] (3) Ligation, transformation, and sequencing

[0144] The polyA double-stranded fragment containing sticky ends was ligated to the vector backbone containing sticky ends. The ligation system is shown in Table 3. Ligation conditions: 37°C for 2 hours. After ligation, the ligation product was transformed into dh5α E. coli and cultured overnight.

[0145] The transformation results showed that there were two positive clones after gradient annealing, one of which was sequenced correctly.

[0146] Comparative Example 2

[0147] This comparative example provides a method for constructing a plasmid containing a tandem repeat of a long fragment (fragment polyA) containing a repeating unit under Tm-5°C annealing conditions.

[0148] Except for the annealing temperature and PCR procedure, all operations in this comparative example were the same as those in Example 2.

[0149] Compared with Example 2, the steps in 2.(2) of this comparative example are as follows:

[0150] Anneal the long-fragment primers synthesized in 2.(1) at Tm-5°C. Based on the Tm values ​​of the synthesized primers, which are 68.79°C / 68.7°C, set the annealing temperature to 63°C for 5 minutes. The PCR program is then set as follows:

[0151] 94℃5min;

[0152] 63℃5min;

[0153] 25℃5min.

[0154] The structure of the synthesized double-stranded DNA containing sticky ends is shown in Figure 7.

[0155] (3) Ligation, transformation, and sequencing

[0156] The double-stranded DNA fragment containing sticky ends is ligated to a vector backbone containing sticky ends. After ligation, the ligation product is transformed into dh5α Escherichia coli and cultured overnight.

[0157] The transformation results showed that no clones grew using the room temperature annealing method (Tm-5°C method).

[0158] Example 2 and Comparative Example 2 were performed in the same batch for easy comparison. Parallel experiments and repeated experiments were performed. The results showed that the method of Example 2 could generate positive clones with correct sequencing, while no clones grew using the method of Comparative Example 2.

[0159] Example 3

[0160] This example provides a method for constructing a plasmid containing an 8woG segment by extending the 6woG segment of the p-6woG vector (plasmid map shown in Figure 8). The 6woG sequence is shown in SEQ ID NO. 9, and the 8woG sequence is shown in SEQ ID NO. 10. The underlined portion of the 8woG sequence represents the extended sequence.

[0161] SEQ ID NO.9:

[0162] SEQ ID NO.10:

[0163] The method comprises the following operations:

[0164] 1. Obtain a vector backbone with sticky ends

[0165] The vector p-6woG was digested with the endonucleases sapI and salI to obtain a vector backbone with sticky ends. FIG9 is a schematic diagram of the vector backbone with sticky ends after digestion.

[0166] 2. Obtain sticky-end fragments (i.e., DNA fragments containing double-stranded repeat sequences)

[0167] (1) Synthesize long fragment primers

[0168] The long-segment primers for the tandem repeat fragment are divided into an upstream primer primeF1 and a downstream primer primerR1, both of which are synthesized using the PAGE method. The sequence of the upstream primer primeF1 is shown in SEQ ID NO.11, and the sequence of the downstream primer primerR1 is shown in SEQ ID NO.12.

[0169] SEQ ID NO.11:

[0170] SEQ ID NO.12:

[0171] (2) Obtaining double-stranded DNA fragments with sticky ends

[0172] The long-fragment primers synthesized in (1) were annealed under gradient conditions with 20 μL each of primeF1 (100 pmol / μL) and primerR1 (100 pmol / μL). Based on the Tm values ​​of the synthesized primers, which were 69.42°C / 70°C, four annealing temperatures were set: 65°C for 5 min; 63.5°C for 5 min; 60°C for 5 min; and 58°C for 5 min. The annealing program was thus set as follows:

[0173] 95℃5min;

[0174] 65℃5min;

[0175] 63.5℃5min;

[0176] 60℃5min;

[0177] 58℃5min;

[0178] 25℃5min.

[0179] The structure of the synthesized double-stranded DNA fragment containing sticky ends is shown in Figure 10.

[0180] (3) Ligation, transformation, and sequencing

[0181] The above-mentioned double-stranded DNA fragment containing the repeat sequence with sticky ends was ligated to the vector backbone containing sticky ends. The ligation system is shown in Table 3. The ligation condition was 37° C. for 2 hours.

[0182] After ligation, the ligation product was transformed into dh5α E. coli and cultured overnight.

[0183] The positive clones were selected for sequencing, and the results showed that the sequencing was correct.

Claims

1. A method for constructing a plasmid containing a tandem repeat sequence, comprising: Providing a first upstream primer and a first downstream primer; wherein the first upstream primer and the first downstream primer respectively have tandem repeat sequences, and the tandem repeat sequences of the first upstream primer are complementary to at least a portion of the tandem repeat sequences of the first downstream primer; Annealing the first upstream primer and the first downstream primer under gradient temperature conditions, so that the complementary sequences of the first upstream primer and the first downstream primer are combined to obtain a first double-stranded nucleic acid fragment having a tandem repeat sequence, wherein the tandem repeat sequence complementary to each other in the double strands is a first double-stranded tandem repeat sequence; The first double-stranded nucleic acid fragment having the tandem repeat sequence is connected to a first vector backbone having sticky ends to construct a plasmid containing the first double-stranded tandem repeat sequence.

2. The method according to claim 1, wherein: The first vector skeleton with sticky ends is a linearized vector obtained by digesting the plasmid vector with a restriction endonuclease; Preferably, the sticky ends at both ends of the linearized vector are non-complementary sequences; Further preferably, the plasmid vector comprises a first restriction endonuclease cleavage site and a second restriction endonuclease cleavage site, and the plasmid vector is double-digested by the first restriction endonuclease and the second restriction endonuclease to obtain a vector backbone with sticky ends; Further preferably, the first restriction endonuclease and the second restriction endonuclease are each independently one of a type II restriction endonuclease and a type IIS restriction endonuclease; Further preferably, the type II restriction endonuclease is one of SalI, HindIII, BamHI, AgeI, PstI, and SacI; the type IIS restriction endonuclease is one of BSPQI, AarI, and SapI; Further preferably, the plasmid vector includes a visual screening marker gene sequence between the first restriction endonuclease cutting site and the second restriction endonuclease cutting site, and the visual screening marker gene sequence can be removed by double digestion of the plasmid vector with the first restriction endonuclease and the second restriction endonuclease.

3. The method according to claim 1, further comprising: Based on the plasmid containing the first double-stranded tandem repeat sequence, the second double-stranded tandem repeat sequence is connected in series upstream or downstream of the first double-stranded tandem repeat sequence to construct a plasmid containing the first double-stranded tandem repeat sequence and the second double-stranded tandem repeat sequence; In the plasmid containing the first double-stranded tandem repeat sequence, the upstream or downstream of the first double-stranded tandem repeat sequence is directly connected to the restriction site of the third restriction endonuclease, and the plasmid containing the first double-stranded tandem repeat sequence has a restriction site of the fourth restriction endonuclease; the plasmid is double-digested by the third restriction endonuclease and the fourth restriction endonuclease Afterwards, a second vector backbone with sticky ends is obtained, which is used to connect the second double-stranded tandem repeat sequence in series upstream or downstream of the first double-stranded tandem repeat sequence of the vector backbone; Preferably, the third restriction endonuclease and the fourth restriction endonuclease are each independently a type II restriction endonuclease or a type IIS restriction endonuclease; further preferably, the third restriction endonuclease is different from the fourth restriction endonuclease; Preferably, the restriction endonuclease cleavage site of the third restriction endonuclease and the restriction endonuclease cleavage site of the fourth restriction endonuclease are each independently a sequence possessed by the first double-stranded nucleic acid fragment, or a sequence possessed by the first vector backbone with sticky ends.

4. The method according to claim 3, wherein: The process of connecting a second double-stranded tandem repeat sequence upstream or downstream of a first double-stranded tandem repeat sequence comprises: Providing a second upstream primer and a second downstream primer; wherein the second upstream primer and the second downstream primer respectively have tandem repeat sequences, and the tandem repeat sequences of the second upstream primer are complementary to at least a portion of the tandem repeat sequences of the second downstream primer; Annealing the second upstream primer and the second downstream primer under gradient temperature conditions, so that the second upstream primer binds to the complementary sequence of the second downstream primer to obtain a second double-stranded nucleic acid fragment having a tandem repeat sequence, wherein the tandem repeat sequence complementary to each other in the double strands is a second double-stranded tandem repeat sequence; The second double-stranded nucleic acid fragment having the tandem repeat sequence is connected to a second vector backbone with sticky ends to construct a plasmid containing the first double-stranded tandem repeat sequence and the second double-stranded tandem repeat sequence.

5. The method according to any one of claims 1 to 4, wherein: The length of each primer is independently 60nt-200nt, preferably 60nt-144nt, more preferably 90nt-136nt; Preferably, the tandem repeat sequence includes a polyA sequence; further preferably, the polyA sequence contains at least 12nt, at least 24nt, at least 36nt or at least 48nt of base A and 0-24nt or 0-12nt of non-A bases; further preferably, the full length of the polyA sequence is 60nt-144nt, more preferably 90nt-136nt.

6. The method according to any one of claims 1 to 5, wherein: When annealing is performed under gradient temperature conditions, in the annealing reaction system: The concentration of the upstream primer is 10 pmol / μL-200 pmol / μL, preferably 50 pmol / μL-100 pmol / μL; The concentration of the downstream primer is 10 pmol / μL-200 pmol / μL, preferably 50 pmol / μL-100 pmol / μL; Preferably, the upstream primer and the downstream primer have the same concentration.

7. The method according to any one of claims 1 to 6, wherein: The gradient temperature conditions of the annealing are set according to the Tm value of the upstream primer and the Tm value of the downstream primer, the highest annealing temperature is the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer, and the lowest annealing temperature is 12°C lower than the highest annealing temperature.

8. The method according to claim 7, wherein: The gradient temperature includes setting more than 3 gradient annealing temperatures within the annealing temperature range; preferably, setting 3-5 gradient annealing temperatures; Preferably, when annealing is performed under gradient temperature conditions, the difference between adjacent gradient annealing temperatures is 1-3°C; Preferably, when annealing is performed under gradient temperature conditions, a single annealing time is 30 s-10 min; preferably 5 min.

9. The method according to any one of claims 1 to 8, wherein: The annealing procedure under gradient temperature conditions is: Maintaining for 5 minutes at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer is reduced by 3°C; Maintaining for 5 min at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer is reduced by 5° C.; Maintaining for 5 minutes at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer is reduced by 7° C.; The mixture was maintained at a temperature at which the smaller of the Tm value of the upstream primer and the Tm value of the downstream primer was reduced by 9°C for 5 minutes.

10. A plasmid containing a tandem repeat sequence, which is constructed according to the method according to any one of claims 1 to 9.

Images