nanochromosome

Abstract

The present disclosure relates to the development of an artificial Komagataella chromosome, for expressing at least one gene of interest in a Komagataella species. There disclosure further relates to genetically modified Komagataella species comprising the artificial Komagataella chromosome, as well as methods of modifying the sequence of the said chromosome in a suitable Komagataella species and methods of expressing at least one gene of interest in a suitable Komagataella species.

Description

[0001] NANOCHROMOSOME FieldThe present disclosure relates to the development of an artificial Komagataella chromosome(also referred to herein as a “nanochromosome”), for expressing at least one gene of interestin a Komagataella species. There disclosure further relates to genetically modifiedKomagataella species comprising the artificial Komagataella chromosome, as well asmethods of modifying the sequence of the said chromosome in a suitable Komagataella species and methods of expressing at least one gene of interest in a suitable Komagataella species. Background Numerous platforms for producing heterologous proteins are deployed across the biotherapeutics-manufacturing sector. Often purpose-designed, proprietary and under continuous development, protocols chiefly rely on mammalian cells and can be expensive and complex. An economical, high-yielding, general-purpose microbial platform could lower barriers to entry and widen availability of vaccines and protein therapeutics globally. Robust evidence of efficacy and versatility would, however, be needed for it to supersede the biomanufacturing strategies to which much of the industry is now committed (Davy, Kildegaardet al., 2017). Prerequisites include strong promoters of gene expression, high-density low-costcell culture and, crucially, a toolbox for precise genetic manipulations of the protein-producing cells.Engineered yeast cells possess multiple attributes considered essential for industrial proteinproduction. Model yeast species such as Saccharomyces cerevisiae and non-conventionalyeast such as Hansenula polymorpha, Yarrowia lipolytica and Kluyveromyces lacti have beenused commercially but K. phaffii is the most prominent example (Bernauer, Radkohl et al.,2020). Advantages include its potential to achieve exceptionally high cell density in simple media, efficient protein-secretory machinery, ability to perform some post-translational modifications, strong natural promoters and track-record of pharmaceutical protein production(Barone, Emmerstorfer-Augustin et al., 2023). Note that the P. pastoris genus was reclassifiedas Komagataella, which includes the subspecies K. phaffii and K. pastoris. Widely used strainsare GS115 and K. phaffii CBS7435, as employed herein (Kurtzman, 2005).A hindrance to biomanufacture in K. phaffii and other yeasts is the need to integrate new genes into chromosomes. Hence sites within the native genome must serve as targets for theinsertion of extraneous double-stranded DNA. This drawback is compounded in K. phaffii bya shortage of established tools for genetic editing compared to S. cerevisiae (Fischer andGlieder, 2019), and the nature of its DNA-repair machinery. In K. phaffii, unlike S. cerevisiae,the process of non-homologous end joining (NHEJ) for double-strand break (DSB) repairdominates over homologous recombination (HR) (Naatsaari, Mistlberger et al., 2012).Compared to HR, NHEJ results in lower success rates for genetic deletions and insertions, and more off-target effects that can impact viability. On the positive side, lower efficiency ofHR makes unintended recombination less likely (Frigerio, Di Nisio et al., 2023).One study (Schwarzhans, Wibberg et al., 2016) assessed the success of an HR-driven GFP-gene insertion designed to knock out AOX1 (creating a MutS strain) in K. phaffii CBS7435.Fewer than half of 800 clones were, in fact, MutSstrains with a gene-copy number of 1. About 5% were multi-copy clones and some had a gene-copy number >10. Crucially, whole-genome sequencing (WGS) revealed non-canonical events including off-target gene disruption, co-integration of E. coli plasmid DNA and relocation of the AOX1 target locus to anotherchromosome (Schwarzhans, Wibberg et al., 2016). Such outcomes are acceptable for one-offgene insertions because screening numerous colonies is feasible while an elevated gene- copy number might boost yields. Since clonal variability per manipulation is multiplied by thenumber of manipulations, attempts to insert multiple genes in K. phaffii are laborious and risky.Attempts have been reported to use 1000+ base-pair (bp) recombination sequences to serveas long HR-promoting regions (LHRs), antimicrobial-resistance (AMR) markers, andgenotyping to screen multiple clones following each manipulation (Naatsaari, Mistlberger etal., 2012). However, reliance on LHRs restricts genomic sites suitable for integration, the setof available selection markers for K. phaffii is limited, and genotyping may fail to spotaccumulating off-target effects. Since damage-risk escalates with each inserted gene, resulting strains become progressively depleted of available selection markers and are less likely to grow quickly to high densities or yield as much product. These considerations hamper extensive engineering of the K. phaffii genome. Numerous strategies for facilitating genetic engineering in K. phaffii have been reported(Bernauer, Radkohl et al., 2020). Many involve deleting or overexpressing genes aimed atsuppressing NHEJ and enhancing HR. Shifting the balance of DSB repair towards HR also improved the efficacy of CRISPR / Cas9-type protocols in K. phaffii (Naatsaari, Mistlberger etal., 2012). Regardless of mechanisms exploited to improve the accuracy of editing and repair,genomic integration relies on identification of a suitable neutral chromosomal locus for insertion of each gene. This must be a region that is accessible to transcriptional apparatus and compatible with efficient gene expression and which can be disrupted without adverselyimpacting cellular physiology or metabolism (Cai, Gao et al., 2019).In S. cerevisiae (Kutyna, Onetto et al., 2022), and Y. lipolytica (Guo, Borsenberger et al., 2020)it was reported that multiple foreign genes could be incorporated into small, stable artificialchromosomes. We wondered if Komagataella phaffii, supplemented with a syntheticchromosome dedicated to genetic engineering, could meet the criteria for a general-purpose, cost-effective protein-production platform. Summary The present disclosure is based on the development of an artificial linear Komagataella chromosome (aka nanochromosome, which is used interchangeably throughout thisdisclosure). The native 9.4 million base pairs (Mb) of the K. phaffii genome consists of fourchromosomes of 1.8, 2.3, 2.4 and 2.9 Mb with modular centromeres reminiscent of those inhigher organisms (Roy and Sanyal, 2011), and telomeres consisting of 100 - 350 base pairs(bp) of homogenous repeated sequences (Bernauer, Radkohl et al., 2020). Noting theaforementioned limitations of conventional genetic manipulations of K. phaffii, it was hypothesised that an advantageous alternative, supplementary or complementary route togenetic engineering in K. phaffii would be to introduce a fifth, supernumerary, chromosome,containing an appropriate origin of replication, centromere and telomeres, to serve as a dedicated receptacle for new genes. In summary and by way of example, there is provided a framework plasmid containing a centromere and an autonomously replicating sequence (ARS) (as well as a bacterial origin ofreplication (ori), suitable for propagation in Escherichia coli cell culture). To this frameworkplasmid, has been added a future “landing pad” for new genes, and a pair of future telomeres (flanking an I–SceI cleavage site), to create a precursor plasmid. It was planned to transformK. phaffii cells with this precursor plasmid that could be I-SceI-linearized in vivo, but it wassubsequently decided to use in vitro (i.e. pre-transformation) linearization of I-SceI to create atiny (hence “nano”) prototype chromosome. It is demonstrated herein that genesoverexpressed from nanochromosomes described herein, supported production of hard-to- manufacture human proteins. Moreover, it is demonstrated herein that the nanochromosome can be further modified, for example by the incorporation of additional genes, in vivo.Thus, in a first aspect, there is provided an artificial linear Komagataella chromosome forexpressing at least one gene of interest in a Komagataella species, the artificial linearchromosome comprising:a. at least one autonomously replicating sequence (ARS);b. a centromere (CEN) sequence;c. at least one gene of interest; andd. first and second telomere (TEL) sequences at respective first and second ends of theartificial linear chromosome,wherein the CEN and TEL sequences are derived from native Komagataella centromere andtelomere sequences, respectively, and the ARS is derived from native Komagataella or yeast ARSs.As will be described in further detail herein, the artificial linear Komagataella chromosome maybe obtained by linearization of a plasmid, with components of the chromosome first introduced into the plasmid using suitable recombinant techniques.As such, the at least one gene of interest may be introduced into the plasmid in vitro (e.g in asuitable bacterial host). Alternatively, the artificial linear Komagataella chromosome may bepresent within a suitable Komagataella host species and the at least one gene of interestsubsequently introduced by way of a suitable recombination event in vivo (i.e in theKomagataella host species).As such, in a further aspect there is provided an artificial linear Komagataella chromosome forexpressing at least one gene of interest in a Komagataella species, the artificial linearchromosome comprising: a. at least one ARS;b. a centromere (CEN) sequence;c. at least one landing pad for receiving at least one gene of interest sequence, said atleast one gene of interest sequence encoding, at least one protein, the landing pad comprising, in order: i) a first recombination sequence region;ii) a region for receiving the at least one gene of interest; andiii) a second / closing recombination sequence region; andd. first and second TEL sequences at respective first and second ends of the artificiallinear chromosome;wherein the CEN and TEL sequences are derived from native Komagataella sequences, andthe ARS is derived from native Komagataella or yeast ARSs, and optionally region ii) includesan antimicrobial-resistance (AMR)-selection marker or other suitable selection marker gene. Typically, region ii) comprises an AMR-selection marker gene, or other suitable selection marker gene, to permit selection of transformant cells which comprise the artificial linear chromosome. Optionally region ii) comprises one or more genes of interest. In an optionally extended version of the landing pad, region ii) comprises: (x), one or more genes of interest; and (z), an AMR-selection marker gene, or other suitable selection marker gene; (x) and (z)being to either side of (y), a third recombination region; this AMR-selection marker gene, orother suitable selection marker gene can, in a single step, using the third and second / closing recombination regions, be replaced with one or more further genes of interest, a fourth / further recombination region and a different selection marker, to create a new gene-reception region. In this manner, the landing pad may be designed and tailored to accommodate sequential insertions of multiple genes of interest, as described further hereinbelow. Optionally the nanochromosome may comprise regions of non-coding DNA (ncDNA) to act as spacers and / or to increase its overall bulk, such regions may include the recombination sequence regions present in the landing pad or extended version of the landing pad.Unlike yeast artificial chromosomes for Saccharomyces cerevisiae which are large in size, theartificial linear chromosomes of the present disclosure, prior to introduction of the at least onegene of interest, are generally only between 11 – 35 kilo-base pairs (kb) in size.Advantageously and as described herein, the artificial linear Komagataella chromosomes ofthe present disclosure may be initially provided as a circular plasmid for propagation and genetic manipulation within bacterial cells, such as E. coli. As such, the plasmid typically includes a bacterial ori, so that the plasmid may conveniently be replicated and maintained within bacterial cells, prior to linearization. The plasmid may further comprise a selection-marker gene, such as an antibiotic-selection marker gene, which is suitable for use in a hostbacterial cell. Exemplary selection markers include a zeocin-resistance gene. Prior to use, ina suitable Komagataella species, the plasmid is linearized, using, for example, a suitablerestriction endonuclease. In one embodiment, the plasmid comprises a restriction- endonuclease site, such as the cleavage site recognised by i-SceI, which is located between the first and second TEL sequences, such that upon restriction digestion, the plasmid islinearized, resulting in generation of the artificial linear Komagataella chromosome with thefirst and second TEL sequences at respective ends of the artificial linear Komagataellachromosome. This linearized plasmid, which corresponds to a minimal artificial chromosome,is used to transform Komagataella species cells. The CEN and TEL sequences which are employed in the artificial linear Komagataellachromosomes of the present disclosure have been derived from native Komagataella speciessequences. The ARSs have been derived from native Komagataella species or yeast speciessequences, such as Saccharomyces cerevisiae or Candida boidinii. By “derived”, it isunderstood that the ARS, CEN and / or TEL sequences are similar to native Komagataella (oryeast) sequences and may be obtained from Komagataella (or yeast) by copying (using forexample PCR techniques) and cloning of the relevant sequences from Komagataella (oryeast) species, or by de novo synthesis of a nucleic acid corresponding approximately to the ARS, CEN and / or TEL native sequences. The ARS, CEN and / or TEL sequences of the disclosure may be identical or substantially identical to the entirety, or a portion, of native ARS,CEN and / or TEL Komagataella (or yeast) species sequences and be capable of functioningas an ARS, CEN or TEL sequence in a chosen Komagataella species. By “substantially”identical, in this context, is understood to mean that the ARS, CEN and / or TEL sequencesemployed in the artificial linear Komagataella chromosomes of the present disclosure shoulddisplay at least 85%, 90%, 95%, or 99% identity to the entirety, or a portion (such as three or more repeat sequences, found within a native CEN or TEL), of a respective native ARS, CENand / or TEL sequence from a Komagataella (or yeast) species."Sequence identity" or "% identity" refers to the percentage of residue matches between at least two aligned polynucleotide sequences using a standardized algorithm. Such an algorithm can insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize the alignment between two sequences and thus achieve a more meaningful comparison of the two sequences. For the purposes of the present invention, the sequenceidentity between two nucleotide sequences is determined using the NCBI BLAST programversion 2.2.29 (Jan 6, 2014) with blastn set to the following exemplary parameters: Word Size: 11; Expected value: 10; Hole costs: Existence = 5, Extension = 2; Filter = low complexity enabled; Coincidence / Disagreement Scores: 2-3; Filter Chain: L; m. The ARS, CEN and / or TEL sequences may be independently derived from any suitable Komagataella species, such as Komagataella phaffii, Komagataella pastoris and / or K. pseudopastoris. The ARS is the sequence of a segment of double-stranded DNA that serves as an origin of DNA replication and is required to initiate the duplication of the nanochromosome by native DNA-replicating enzymes and other native proteins. Suitable ARSs for use in accordance with the present disclosure are able to function as origins of replication when the artificial linearKomagataella chromosome is present in a suitable Komagataella species. For example, anARS from another yeast species, may be employed for use in Komagataella species. In one embodiment, only a single ARS is provided and in another embodiment, two or more ARSs are provided. ARSs are well known, easily identified by those skilled in the art and typically comprise GC-rich or AT-rich DNA sequences, (Liachko, Youngblood et al., 2014), the entire contents ofwhich are hereby incorporated by way of reference, describes how ARSs may be identified inKomagataella species and specifically identifies many ARSs from K. phaffii (previously namedPichia pastoris). Table 3 discloses exemplary ARSs identified from K. phaffii. Although notintending to be limiting, all the ARSs identified in may be suitable for use in accordance withthe present disclosure. In native K. phaffii, examples of AT-rich and GC-rich ARSs sequencesare present, for example one on either side of the centromere which is present on Chromosome 3. In one embodiment, two exemplary and suitable ARSs are ARS-A76(originating from native chromosome 1) and ARS-B413 (originating from native chromosome2), positioned either side of the CEN sequence, which are shown herein to facilitate DNA replication under conditions mimicking natural environments.The centromere is that part or region of the yeast chromosome that ensures chromosomalsegregation following replication during cell division. The CEN sequence may be any suitableCEN sequence derived from a Komagataella species. K. phaffii has 4 chromosomes andtherefore has 4 centromeres (CEN1, CEN2, CEN3 and CEN4), one from each chromosome.In one embodiment, the artificial linear Komagataella chromosome comprises a centromerederived from the CEN1, CEN2, CEN3, or CEN4 centromere sequence of K. phaffii.Komagataella centromeres are described as having a modular composition in which a core ormid-sequence of about 1 kb is bracketed by near-perfect inverted repeats of 2-2.7 kb (Coughlan et al., 2016). In one embodiment, the centromere differs from CEN3 by one nucleotide and comprises a mid-sequence of 883 bp flanked by 2,550-bp inverted repeats, identified herein below. In one embodiment, the, or each, ARS is located adjacent to the CEN sequence. Typically, the, or each, ARS is located within 0–400, or 0-200, nucleotides of the CEN sequence. Theartificial linear Komagataella chromosomes of the present invention may be considered ascomprising a CEN sequence with first and second chromosomal arms to either side, the first arm ending with the first TEL sequence and the second arm ending with the second TEL sequence. When one ARS is provided, this may be found within either the first or the second arm. When two, or more ARSs are provided, at least a first ARS is / may be located within the first arm and at least a second ARS is / may be located within the second arm. The first and second arms may be similar in size. By similar it is meant that each arm may have a size difference of between 0 kb and 1 kb. Alternatively, the first and second arms may be different in size, with one arm being longer, such as by more than 1 kb, than the other arm.Telomeres are the ends of the chromosome that allow stable maintenance and replication ofthe ends of linear DNA molecules in eukaryotes. The first and second TEL sequences may beinverted repeats of each other and comprise a plurality, such as between 8 – 40, between 10– 18, or 15, 16 repeat sequences. Each repeat sequence may comprise between 5 – 9, suchas 7 nucleotides. In one embodiment, the first TEL repeat sequence is GCATCCA and the second TEL inverted repeat sequence is TGGATGC.As mentioned above, prior to creating the artificial linear Komagataella chromosome, the firstand second TEL sequences may be found within a circular plasmid and positioned either sideof a restriction-endonuclease site. Cleavage of the circular plasmid, using a restrictionendonuclease, which is capable of recognising the restriction-endonuclease site, generatesthe artificial linear Komagataella chromosome with the first and second TEL sequenceslocated at respective ends of the artificial linear Komagataella chromosome.The at least one landing pad for receiving at least one gene of interest sequence is providedin the first and / or second arm of the artificial linear Komagataella chromosome. In oneembodiment, a first landing pad is provided in the first arm and a second landing pad isprovided in the second arm. The first and second landing pads may be the same or different in terms of sequence and / or features. The first and second landing pads may be used for theexpression of the same or different genes of interest. Conveniently, at least one landing padis located within at least one gene-reception zone lying between a TEL and CEN sequence.In one embodiment, the artificial linear Komagataella chromosome comprises 1, 2, 3 or morelanding pads, or extended landing pads as described herein. The, or each, landing pad independently comprises, in order: i) a first recombination sequence region; ii) a region for receiving the at least one gene of interest; and iii) a second / closing recombination sequence region. Typically, region ii) comprises a first AMR-selection marker gene, or other suitable first selection marker gene, which can be substituted with an optional second AMR-selection marker gene, or other suitable second selection marker gene, during a single recombination event that also introduces at least one gene of interest. In this manner it is possible to ensure that host cells containing the landing pad prior to attempting to introduce DNA comprising atleast one gene of interest, can be selected by growing the host cells in the presence of anappropriate first antimicrobial agent or selecting host cells due to expression of the first marker.In this manner it is also possible to select for cells in which the at least one gene of interesthas been successfully introduced, by growing host cells in the presence of an appropriate second antimicrobial agent or selecting host cells due to expression of the second marker.The, or each, landing pad may optionally be extended by replacing region (ii) (comprising afirst AMR-selection marker gene) with DNA comprising: at least one gene-of-interest sequence; a third recombination sequence region; and a second AMR-selection marker-gene or other suitable selection-marker gene sequence. In an optional subsequent step the second AMR-selection marker-gene sequence may be replaced (using the third and second / closing recombination sequences) with DNA comprising: a further at least one gene-of-interest sequence; a fourth recombination sequence region; and the first (or different) AMR-selection marker-gene sequence, or other suitable selection-marker gene. In optional, sequential, further steps, an existing AMR-selection marker-gene sequence, or other suitable selection- marker gene may be sequentially replaced with DNA comprising: further at least one gene-of- interest sequences; further (fifth, sixth and seventh etc.) recombination sequence regions; and an alternative (e.g. first, second or different, as appropriate) AMR-selection marker gene sequence, or other suitable selection-marker gene. Thus at each step of this sequential procedure, the gene-reception zone is extended to include one or more additional genes of interest, and the landing pad is translocated along the chromosome. In this manner, the nanochromosome inside a yeast cell may comprise a plurality of inserted genes of interest separated by suitable recombination (in order the first, third, fourth….., second / closing recombination) sequences. Thus, in a further aspect, there is provided a method whereby the region ii) for receiving the at least one gene of interest, which is situated within an existing landing pad and hence is flanked by first and closing recombination sequences, and comprises a first AMR-selection or other suitable selection marker gene (i.e. the gene-reception region), may be replaced by means of transforming cells that comprise the existing landing pad with a double-stranded DNA molecule having a sequence independently comprising, in order: c. i) the first recombination sequence region;ii) a region comprising (x) at least one gene-of-interest sequence, (y) a third recombination sequence region, and (z) a second AMR-selection marker-gene sequence, or other suitable selection-marker gene, wherein y is situated between x and z; iii) the closing recombination sequence region, in order to provide an extended landing pad. In a further step of the provided method, the region c. ii) comprising the second AMR-selection marker gene, or other suitable selection-marker gene and flanked by third and first or closing recombination sequences, may be replaced by transforming cells that comprise the extended landing pad with a double-stranded DNA molecule having a sequence independently comprising, in order: c. i) the third recombination sequence region;ii) a region comprising (x’) at least one gene-of-interest sequence, (y’) a fourth recombination sequence region, and (z’) the first (or a different) AMR-selection marker-gene sequence, or other suitable selection-marker gene, wherein y’ is situated between x’ and z’; iii) the first or closing recombination sequence region, in order to provide a further extended landing pad. In a further step of the provided method, the region c. ii) comprising the first AMR-selection marker gene, or other suitable selection-marker gene, and flanked by two recombination selection sequences, may be replaced by transforming cells that comprise the further extended landing pad with a double-stranded DNA molecule having a sequence independently comprising, in order: c. i) the fourth recombination sequence region;ii) a region comprising (x’’) at least one gene-of-interest sequence, (y’’) a fifth recombination sequence, and (z’’) the second (or different) AMR-selection marker-gene sequence, or other suitable selection-marker gene, wherein y” is situated between x” and z”; iii) the first, closing or third recombination sequence region, as appropriate. It will be appreciated that the order of the sequences x and z, or x’ and z’, or x” and z” within regions c. ii) in one or more of the steps of the provided method may optionally be reversed, in which case subsequent steps must take account of the need to employ the appropriate recombination sequences, i.e. those flanking (z, z’ or z’’) that comprises the AMR-selection marker-gene sequence, or other suitable second selection-marker gene. It will also be appreciated that a step could entail replacement of the AMR-selection marker- gene, or other suitable second selection-marker gene with a region comprising two previously unused recombination sequence regions interleaved with three gene sequences, namely: an alternative AMR selection marker sequence, or other suitable alternative selection-marker gene; a region comprising one or more genes of interest; and a second region comprising one or more genes of interest. In this manner, it is possible to introduce further genes of interest through subsequent rounds of recombination and expansion of the landing pad and selection using, over all rounds, a minimum total of two suitable selection-marker genes. It will be appreciated that due to the sequential nature of this process and through appropriate selection at each stage, it is possible to re-use, or re-cycle, AMR or other suitable selection genes, in subsequent rounds. This process of landing pad expansion may be repeated any number of times, using suitable additional (sixth, seventh, eighth etc.) recombination sequence regions and recycling and / or including further / different, or recycling of, AMR or other suitable selection genes, such that sequential inclusion of additional further genes of interest may be conducted. The first and second / closing (and any further) recombination sequence regions comprise sequences suitable for homologous recombination and / or site-specific recombination withinthe Komagataella species. The term "homologous recombination" refers to a type of geneticrecombination, a process of physical rearrangement that occurs between two different strands of DNA molecules and is employed by cells to repair double-strand breaks in DNA. Homologous recombination involves the alignment of identical or similar sequences, a crossover between the aligned homologous DNA strands of the two molecules, and double- strand DNA breaking and repair to produce an exchange of material between the strands. Homologous recombination is distinguished from other types of recombination. For example, "site-specific recombinations" as exemplified by invertible elements, resolvases and some phage integration events, are examples of non-homologous recombination. Although in many cases identical or similar sequences are required at the two recombination sites, the sequences are shorter than the stretches (hundreds of base pairs) typically used in homologous recombination. For homologous recombination, each homologous recombination sequence region typicallycomprises between 50 – 1200 bp, such as 400 – 1200bp. Although there is no demonstratedtheoretical minimum or maximum length for a homology to mediate homologous recombination, it is believed that homologous recombination efficiency generally increases with the length of the homologous region. Similarly, the recombination efficiency increases with the degree of sequence homology between a targeting construct homology region and the recipient target sequence. The choice of a suitable length of homologous recombination sequence for use in a landing zone is also dictated by the inherent efficiency or efficacy of the cellular machinery responsible for repair of dsDNA breaks by homologous recombination. It iswell known in the case of K. phaffii that the cellular machinery responsible for dsDNA-breakrepair by homologous recombination is less efficient than the equivalent cellular machinery operating in S. cerevisiae. To achieve a high efficiency of homologous recombination in K.phaffii requires homologous recombination sequences at the upper end of the above-mentioned size-range. Site-specific recombination systems are well known to those skilled in the art and typically involve the use of site-specific recombinases that perform rearrangements of DNA segments by recognizing and binding to short, specific DNA sequences (sites), at which they cleave the DNA backbone. Exemplary systems include the Cre-Lox, FLP-FRT and ATT-integrase systems known in the art (see for example Sambrook, J., 2001). Within the landing pad, the region for receiving said at least one exogenous nucleotide sequence, hereafter called the gene-receptor region, may comprise, prior to introduction of said at least one exogenous nucleotide sequence, a selection-marker gene, such as an AMR- selection marker gene (e.g. one endowing resistance to nourseothricin, kanamycin, zeocin and / or hygromycin, for example), to allow for retention and selection of cells, which comprisethe artificial linear Komagataella chromosome. This first AMR-selection marker is preferablyreplaced with a second AMR-selection marker at the same time as a gene or genes of interest are incorporated into the existing landing pad. Alternative selectable markers are wild-typealleles of genes that encode biosynthetic enzymes. Komagataella genes coding forbiosynthetic enzymes in, for example, the tryptophan, histidine and uracil pathways (namely, TRP1, HIS3 and URA3, respectively) can be used as convenient selectable markers in asuitable auxotrophic Komagataella species strain.In order to introduce, in the context of living Komagataella cells, the at least one gene ofinterest, a recombination event takes place - following introduction of a suitable donor DNAmolecule into the cells - between the pair of recombination sequence regions of the landingpad or extended landing pad that flank the gene-reception region (in the context of the donor DNA molecules used to transform the cells), so that the DNA within the gene-reception region, is swapped with the region for receiving the at least one gene of interest respectively, therebycreating an artificial linear Komagataella chromosome comprising at least one gene of interest.Thus, in a further aspect, there is provided an artificial linear Komagataella chromosome forexpressing at least one gene of interest in a Komagataella species, the artificial linearchromosome comprising: a. at least one autonomously replicating sequence (ARS);b. a centromere (CEN) sequence;c. i) a first recombination sequence region;ii) a region comprising the at least one gene or interest; andiii) a second recombination sequence region; andd. first and second telomere sequences (TEL) at respective first and second ends ofthe artificial linear chromosome,wherein the CEN and TEL sequences are derived from native Komagataella sequences andthe ARSs are derived from native Komagataella or yeast ARS sequences.Optionally, there may be other, previously inserted, genes of interest alternating with unique recombination sequences previously used for homologous recombination. Optionally one or more landing pads may be present each comprising suitable unique recombination sequence regions that are positioned to facilitate further insertions of DNA. The at least one gene of interest may encode any suitable protein, for example in various illustrative examples, the protein encoded by the gene of interest and operably linked to a promoter and terminator can be a protein such as a protein that endows antimicrobial- resistance on the host cells, a chaperonin, a toxin, an antibody (or fragment thereof) or nanobody, a hormone, an enzyme or proenzyme, a blood coagulation factor, a growth factor,a cytokine, a structural protein, an immunogenic protein (e.g., a vaccine antigen), a cell-signalling protein and a fluorescent protein such as green fluorescent protein or red fluorescent protein, or engineered variants, mutants, or modified forms of any of the aforementioned. Moreover, the protein may be a protein which can facilitate expression, translation, correct folding, secretion and / or post-translational modification of another protein produced from agene located in the nanochromosome or integrated into the host Komagataella strain’sgenome, as exemplified herein with respect to PDI (for protein disulfide isomerase) expressionprovided by an artificial linear Komagataella chromosome of the present disclosure and amouse CFH gene (for murine complement factor H) which has been integrated into the host’sgenome using conventional techniques. The sequence of the at least one gene of interest maybe modified to enhance expression levels in the Komagataella species. This may include theuse of codon optimisation methodology, known to those of skill in the art. Codons may beselected on the basis of frequency of use in the particular Komagataella species, but also onother criteria including optimisation of codon context, removal of cryptic translation initiation sequences, removal of nucleic acid and codon repeats, introduction of “ambush” stop codons (to terminate frame-shifted ribosomes), and a reduction of mRNA secondary structure, such as stem-loop structure, formation, for example. There are numerous computational tools andalgorithms for designing synthetic genes (Gould N., et al., 2014)As used herein, “operably linked” means functionally linked. As described herein, the promoter can be a “constitutive promoter”, or an “inducible promoter”, provided that the promoter isactive in a host Komagataella species strain. A “constitutive promoter” means a promoter thatregulates expression of a gene of interest. The term “constitutive promoter” is known in the art. A constitutive promoter can have some inducible activity, but the maximal activity obtained with the promoter is not inducible. The genes of interest may be expressed from their native promoters, or non-native promoters may be used. The strength of said promoters can vary between low and high in the host inwhich they are used. Promoters may be regulated or constitutive. Yeast promoters of interestinclude, but are not limited to, inducible promoters such as AOX1 / 2, DAS1 / 2, CAT1, FLD1,FMD, ADH1, PHO89, CUP1, tetO etc; repressible promoters as MET3, THI11, SER1, andconstitutive promoters such as GAP, GCW14, ILV5, TEF1, PGK1 etc. Optionally, genes of interest may be expressed using a bicistronic promoter system.Autonomously replicating yeast expression vectors containing promoters inducible byhormones such as glucocorticoids, steroids, and thyroid hormones are also known and include, but are not limited to, the glucorticoid responsive element (GRE) and thyroid hormone responsive element (TRE), see e.g., those promoters described in U.S. Pat. No.7,045,290.Vectors containing constitutive or inducible promoters such as PGK1 or AOX1 may be used.Additionally any promoter / enhancer combination (as per the Eukaryotic Promoter DatabaseEPD) or synthetic improved yeast promoters, could also be used to drive expression of genes of interest.As used herein “promoter” means a nucleotide sequence typically located upstream from the5′ end of a coding sequence for a protein that controls the transcription of RNA from DNA, in part, by interacting with various regulatory factors that control transcription. In oneembodiment, the promoter may be derived from the same species of yeast as the yeast hostcell used for protein expression. In another embodiment, the promoter may be derived from adifferent yeast species than the yeast host cell used for protein expression. In oneembodiment, a promoter may include a TATA box sequence that acts as a recognition site to direct initiation of transcription, including, but not limited to one or more transcriptional enhancer elements. The enhancer elements may be proximal or distal to the TATA box sequence and may be in a normal 5′ to 3′ orientation or may be in a 3′ to 5′ orientation. In another embodiment, an enhancer element may be an enhancer element native to the promoter sequence or it may be a heterologous enhancer element inserted intothe expression vector construct. An “enhancer element” as used herein is a regulatoryelement that can stimulate promoter activity.The gene of interest may further comprise a terminator sequence for transcription terminationderived from Komagataella species (e.g., the AOX1 or GAP terminator) or yeast species, suchas S. cerevisiae or Neurospora crassa (e.g., the CYC1 or TPI terminator). In anotherembodiment, the gene of interest has a 3′ untranslated region downstream from the proteincoding sequence with a polyadenylation site. As used herein, “3′ untranslated region” means nucleotide sequences that are not translated into protein and are located downstream from a coding sequence for a protein. Typically, a 3′ untranslated region includes regulatory sequences for mRNA processing. As used herein, “regulatory sequences” means nucleotide sequences that are typically upstream or downstream from the 5′ or 3′ end, respectively, of a protein-coding sequence. Regulatory sequences are not translated into protein. Regulatory sequences include, but are not limited to, sequences that affect RNA processing or stability, such as polyadenylation signal sequences, enhancers, repressor binding sites, and promoters. In some embodiments, residual DNA originating from the plasmid backbone (referred to herein as plasmid-derived (pd)DNA) may persist in the sequence of the nanochromosome. In some embodiments of the nanochromosome, it may be desirable to include additional non-codingDNA (ncDNA) sequences. These ncDNA sequences may serve as spacers between otherelements (e.g. the CEN, ARS, TEL, or landing pad elements) of the artificial linear chromosome and / or are included to increase the overall size of the artificial linear chromosome. They also provide the opportunity for manipulations of the nanochromosome other than insertions into the landing pads. Typically, the ncDNA sequence may be between100 and 2000 bp and typically they have been computationally designed to have anappropriate (for yeast) GC-content, to be non-coding and to avoid forbidden restriction sites.Artificial linear Komagataella chromosomes and pre-chromosomes prepared according to thepresent disclosure are identified herein as nChr 2A, nChr 2A.1, nChr 2A.2, nChr 2B or nChr2B.1, as identified in Figure 1. Scheme 1 (see below), shows a general representation of two exemplary artificial chromosomes (the first with a landing pad and the second with an extended landing pad) in accordance with the present invention: Gene-reception region* 1* The gene-reception regionoptionally comprises an AMR and First gene-landing pad optionally comprises one or moregenes of interest.Gene-reception region 1 Extended first gene-landing padGene-reception region 1 Gene-reception region 2TEL1 pdDNARSA GoI RSC(Extended) first gene -landing pad Second gene-landing padCEN = a centomere sequence RS1,etc. = first, etc. recombination sequences in secondARS1,2 = first, second autonomously replicating sequences landing padncDNA = non-coding DNA sequence RSB / x and RS2 / X = the second / closing recombinationpdDNA = template plasmid (pUC19)-derived DNA sequence in first and second landing pads, respectivelyTEL1,2 = first, second telomere sequences GoI = one or more genes of interestRSA,etc = first, etc. recombination sequence regions in first AMR1 and AMRA = an antimicrobial resistance gene or otherlanding pad (also referred to as LHRA etc. elsewhere herein) selection marker in first and second landing pads,respectively. Scheme 1 Top is a schematic diagram of a generic nanochromosome with a single (first) “landing pad” that was designed as a site for insertions of new genes-of-interest by double-crossover homologous recombination. The nanochromosome schematised in the middle panel has a gene-landing pad that was extended by replacing the original gene-reception region with a tripartite DNA segment comprising: a gene of interest; a new and unique recombination sequence (RS) region; and a new antimicrobial resistance (AMR) gene that subsequently serves as a new gene-reception region. In the bottom panel, a nanochromosome with an extended first gene-landing pad has an additional (second) gene-landing pad in the other armof the chromosome; this was formed (using homologous recombination) from ananochromosomal region of non-coding DNA. It could subsequently be extended in a similar manner to the first landing pad. This schematic also summarizes some nomenclature andterminology adopted elsewhere herein.An exemplary sequence of such an artificial chromosome is provided below:Telomere repeats (catccag) – lowercase, in italicsPlasmid-derived (pd) DNA sequence – lowercase, underlinedXXXX 1XXXX = landing pad or extended landing padARS (ARS-A76) – uppercase, underlinedCENTROMERE (CEN3) inverted repeats (IR) - uppercaseCEN2TROMERE (CEN3) core – uppercase grey shadedARS (ARS-B413) – uppercase, underlined and in italicsNon-coding (nc) DNA – lowercase, underlined and in italicsiiiiiiiii– I-SceI recognition site after linearization (in two parts, one at each end)pppppppp – a 60-bp cloning artefactiiiiiiiiicatccagcatccagcatccagcatccagcatccagcatccagcatccagcatccagcatccagcatccagca tccagcatccacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaac aacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcgga taaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtg ggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtc aggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagac caagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctc atgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgag atcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaag agctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgag aaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagc gcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcg atttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttg ctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtga gctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgccca atacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagttgtcattttgtttcttctcgtacgagcttgctcctg atcagcctatctcgcagXXXXXXXXXGACCTCCGCGACGGGGAATTGAACCCCGGTCTA CCGCGCGACAAGCGGTGGTTCTACCACTAAACTATCACGGATTTCGATGCTGC TTTCCCACTTCCTTACTTTACATTCTCTAGGCGTTTAGCCTGTAGAATAAAACCT TTTTTCAAGACTACAATACTGCTGCTAGTAATACCGAATTATTACATGTTTTAACA ACTTGAGAGCGGGTCGTATCCTGTCTTCCGATTGTAppppppppCAACTCAATGT TTTTGTTTCTCTCGACGAAACGTTTTTGCTTAGCATTTCGGTATCTTAAACCGTG TGATTTTAAGTCTCATAACCTTCTACATACAGGATCAATAATAATATTATTGTTGA TACAATATAGGATTAGAATACATAGATTCTGATGTTCGAATCAATCAATGTCTTAA TATTCACGTACTTGTATACCCTCTGATTCCACATTGGTCCAACGGAATCTTCTAG CAACAGCCAGTTGCACTAGATGTGGTTCTCCACCAGAAATTATAGTACTGACAG ATTTTTTGGTTTACGGTGAGAGGCTCCAATTTCCAAAGCTAAACCAATTTCTTCA TAAGCAACCTCCACGCGCGCTTTTAGTATGATGTAGAAACTGGACCTAAAGATC GACCAATACTTGCTTACACGGCAGCGCGAAATAAAAGACATTGATAATGTAGAG TAAGTACTATTTCTTCAAAAGATAGAACCACTCTCAGAGGCTAACTAGAAGATCT AAAACGGATGTACAGCTAATATGTTTCGAGGCAATCATGTTCAGGTGCGCCTCA AGTGGCTCTTAATCTATTTTAAAGCATAATCCACGAAAATTTCGATACAGAGAGA TACGTCATAAACTGAGAACGATAGTTAGAGGCATAGCTTCGGCAATGTTCGATA AACAAGTCAACGAGTCAGAATTTCATGTTTCTTTTTTTCTTGTAGTAATATGTAAT AACCGAATCAGATAACTTGCCAGTAATGACCTGAGCTCTATAAATTGAAACCGC TACAAAAAGTAAGGGATCGTGTTAAGGGCACAGAGAAGAAAGTGTAAAGAAGTA AGCTAGCGTTGTACAACAACTCAAAAGCATGGAGCCCGGTGGGTACTAGATAAT AAGAACAAGGTTTCAGTGAGTTTACAAGTTCATAAAACACGGAACCTGGCAACA TAGCATACCAGTAAATCGATTTGAAGAACTCTATTAGGCTGGCAGCCTCTCTCA ATCAATAGTCTAAAACGGTTAAGAGACACAATCATCTCTAGGTGTCGTTGTGGT CTACCATCGAAACACTGGAAATCAATCCAATGAACTTCAAGTGATATATTTTTCA AGAGTCTTCAAAGACCAAGCAATGTTCTTATTGATTGATAATTTTAAAGTTGAAG TCTAAATTTGTAGCAGTGAAGTCTGAGCAGGGGGAATGTTAAGCCATATCTAAT AGTACCTATTAGACGCTTGATTGCCGTTTGCAAATATGCCATGTTTCTTTGAAAC CAAAACCACGTAAGGGGGCTTAAGTTTTCGGCTTAGGATTGTTACGGAGCTCAA ACCAAATAAGGCAGAGAGCATACAAAACGTTTATTAAAAAGAACAACTACTTCTG GATAGCTCAATTATCTTTTGTTTCTTTTGAGGCGTGCCCTTCATGACATGACATT GCATCCATACAATTAATAGTAGATAGGGGAGGATAAGTTTGCTAGTGTGAGCAT TTAGAGCAAGGGGTCAGTTTCCTCCATCTGCCTACTCTGCTCCATTTAAAAGCG AGCCGATTGCCATAAGCTTGCTCACGTAGATAGGACTTCAAAAAGACGTTAAGA GGCTGCTCTCTAGAATACGATGGAATAAACAAATCTCGTTAGTTTCTTGAAACG GAAAGTACATGTAGGATAATTGCTGGATCATTCGGAAGCTAAAATTGGTCCTTT CCCCAAAGACAATCGACTATAGTTCCTGAAGCTTCCTGAGGTGAGCTGGATAGA ACCAGAAGATAGTACCTATAACGTCAACAACAACTGAAACTACAGATGGAAGAG CTAGGCATATCCATAGGGGATAGCCATAGAAAACTTTGATTGACGCAGCAAATC GAGACGTTAACCTGAAGCTGCCATAACTTCAGGAACTTGAACACAAGAGTGGCA TTAAAATTCCTATGTTGCATTTCAGAAATACCACAAGTAAACTGAGCAATTAACTT GTTCATACCGACACTACAAGTTAACTACAAACCGAGACCCTTATATGCAGACTG ATAATACAGAATGATACGTATCACTCCTAAGACTAGGAACATACAGAGCTTTTGA GCTTTTGGTATTTTCAAGTTATTTGAAAAATTAAATCTTTATACTAGGGACGAGGT TCGTGACAAAAGAAGACAATCATGAGACTCACCGTCTTGTCATCTACAAGTTTC AATAAGCTTCCAACTTGAGTAACCTAGCCATGTGATTAGTAACTTTCGAAGCATG ATTCAGAACGTTCTGCTCTGCCGCGTCAAAAAGGGCAGCTACTTGAAGTTAAAA GAAAGATCAAAAATTCCTGAGCATTGTTCAAACAGCTATAAATCAAAACAGAATA AGAAATAAGGCCATCACTTACCAAGGAAAAACAAAAAAGTTCGAGAGATCAACA ATGCACTTCAGGGACGCACCTGAACCTTTACATTAGTGTAAAAATAAATTATTAG ATTGTTCGGTTCGAGCGTTAGCCATATACAAAATGCGGCCTTCAAAGTCATTGG AAAAGAGCTGCTTTAGGACCTCTCCAAAAGCTAAATTGACAAACAGGCTACCTC ATATCTCCATCATCTTTGCCAACCTTTTCAGTAACAAAAAACAAAAGCAATATCG TTTATTTGTCCATTGGACGATCATCAAATATTGCTAGGTAGGCACTTTTTTCGGT AAGCGTGTCTGCCTCCTTTCTTCAGTAAGATCAATTGTCGCCGGATACTATGAA TCGATCATTGTAGAAACTAACATGCTTCTAATTACCCATTCAATCTTGTAGCACT GAGTGCATCTCGCGTGAGACAAATTGAACTCGCCTACTTGGGTAGGATAAACG GTTGGGTAACGTAGCTGCTTCATCCGGCTACTTGCTTGGTCTGCTGCGTGCTTT ACGCGCTGATTGGTGGTCGAATAAACCGGTACATTATTTGTTCTTATCCACGAC AATGAGACGAACAAGTAACAAACCAGAACTGGTAGCTCGATGATTACAGTTCCA CAATATCAGCCGAATACCCACACTTTTTCCAACCTGTGTCAATTGCCTTAGAAAT TGTATTAGCACAAAAATCATTTCGCTGACGGCTGAACATCCGATATTTACTATTC GTCAAGGTATTTAGAATTCTTGTGCGAACTTGTGGGTCGTGGTGAAAAAGACTA TTGTGAGTTGTTCGTAGCTGAGTCCTTGACTATACTGATACACATTAAAAGAAGC TGCCCTTTAAGCAACTAATGTATTTGTTATGCGTATATCTGTAGAAAGCAACAGT GCGACAGTTGAAGTGTTCGAACACACTTCTCAATTTTGAATCTTTCTCATTCTCA TTCAGTGAACGATGAACCAAGTACACAAATTTGGAGGTGAATAATTATGCTAGG GAGAGCTTGCTAGATCATTTCACAATTAGAATGTGAAACCAGACCTTTAGATGTA AATGCTAAGGCTAGGATAGGATCGTAATTAGTAGGATCAACAAACTTTATTGATT AGCCTCACCTAGACTAAGTTTGATCTTTTCTTCATCGTCCAATGGACAAATAAAC GATATTGCTTTTGTTTTTTGTTACTGAAAAGGTTGGCAAAGATGATGGAGATATG AGGTAGCCTGTTTGTCAATTTAGCTTTTGGAGAGGTCCTAAAGCAGCTCTTTTC CAATGACTTTGAAGGCCGCATTTTGTATATGGCTAACGCTCGAACCGAACAATC TAATAATTTATTTTTACACTAATGTAAAGGTTCAGGTGCGTCCCTGAAGTGCATT GTTGATCTCTCGAACTTTTTTGTTTTTCCTTGGTAAGTGATGGCCTTATTTCTTAT TCTGTTTTGATTTATAGCTGTTTGAACAATGCTCAGGAATTTTTGATCTTTCTTTT AACTTCAAGTAGCTGCCCTTTTTGACGCGGCAGAGCAGAACGTTCTGAATCATG CTTCGAAAGTTACTAATCACATGGCTAGGTTACTCAAGTTGGAAGCTTATTGAAA CTTGTAGATGACAAGACGGTGAGTCTCATGATTGTCTTCTTTTGTCACGAACCT CGTCCCTAGTATAAAGATTTAATTTTTCAAATAACTTGAAAATACCAAAAGCTCAA AAGCTCTGTATGTTCCTAGTCTTAGGAGTGATACGTATCATTCTGTATTATCAGT CTGCATATAAGGGTCTCGGTTTGTAGTTAACTTGTAGTGTCGGTATGAACAAGT TAATTGCTCAGTTTACTTGTGGTATTTCTGAAATGCAACATAGGAATTTTAATGC CACTCTTGTGTTCAAGTTCCTGAAGTTATGGCAGCTTCAGGTTAACGTCTCGATT TGCTGCGTCAATCAAAGTTTTCTATGGCTATCCCCTATGGATATGCCTAGCTCTT CCATCTGTAGTTTCAGTTGTTGTTGACGTTATAGGTACTATCTTCTGGTTCTATC CAGCTCACCTCAGGAAGCTTCAGGAACTATAGTCGATTGTCTTTGGGGAAAGGA CCAATTTTAGCTTCCGAATGATCCAGCAATTATCCTACATGTACTTTCCGTTTCA AGAAACTAACGAGATTTGTTTATTCCATCGTATTCTAGAGAGCAGCCTCTTAACG TCTTTTTGAAGTCCTATCTACGTGAGCAAGCTTATGGCAATCGGCTCGCTTTTAA ATGGAGCAGAGTAGGCAGATGGAGGAAACTGACCCCTTGCTCTAAATGCTCAC ACTAGCAAACTTATCCTCCCCTATCTACTATTAATTGTATGGATGCAATGTCATG TCATGAAGGGCACGCCTCAAAAGAAACAAAAGATAATTGAGCTATCCAGAAGTA GTTGTTCTTTTTAATAAACGTTTTGTATGCTCTCTGCCTTATTTGGTTTGAGCTCC GTAACAATCCTAAGCCGAAAACTTAAGCCCCCTTACGTGGTTTTGGTTTCAAAG AAACATGGCATATTTGCAAACGGCAATCAAGCGTCTAATAGGTACTATTAGATAT GGCTTAACATTCCCCCTGCTCAGACTTCACTGCTACAAATTTAGACTTCAACTTT AAAATTATCAATCAATAAGAACATTGCTTGGTCTTTGAAGACTCTTGAAAAATATA TCACTTGAAGTTCATTGGATTGATTTCCAGTGTTTCGATGGTAGACCACAACGA CACCTAGAGATGATTGTGTCTCTTAACCGTTTTAGACTATTGATTGAGAGAGGCT GCCAGCCTAATAGAGTTCTTCAAATCGATTTACTGGTATGCTATGTTGCCAGGTT CCGTGTTTTATGAACTTGTAAACTCACTGAAACCTTGTTCTTATTATCTAGTACC CACCGGGCTCCATGCTTTTGAGTTGTTGTACAACGCTAGCTTACTTCTTTACACT TTCTTCTCTGTGCCCTTAACACGATCCCTTACTTTTTGTAGCGGTTTCAATTTATA GAGCTCAGGTCATTACTGGCAAGTTATCTGATTCGGTTATTACATATTACTACAA GAAAAAAAAGAAACATGAAATTCTGACTCGTTGACTTGTTTATCGAACATTGCCG AAGCTATGCCTCTAACTATCGTTCTCAGTTTATGACGTATCTCTCTGTATCGAAA TTTTCGTGGATTATGCTTTAAAATAGATTAAGAGCCACTTGAGGCGCACCTGAA CATGATTGCCTCGAAACATATTAGCTGTACATCCGTTTTAGATCTTCTAGTTAGC CTCTGAGAGTGGTTCTATCTTTTGAAGAAATAGTACTTACTCTACATTATCAATG TCTTTTATTTCGCGCTGCCGTGTAAGCAAGTATTGGTCGATCTTTAGGTCCAGTT TCTACATCATACTAAAAGCGCGCGTGGAGGTTGCTTATGAAGAAATTGGTTTAG CTTTGGAAATTGGAGCCTCTCACCGTAAACCAAAAAATCTGTCAGTACTATAATT TCTGGTGGAGAACCACATCTAGTGCAACTGGCTGTTGCTAGAAGATTCCGTTGG ACCAATGTGGAATCAGAGGGTATACAAGTACGTGAATATTAAGACATTGATTGA TTCGAACATCAGAATCTATGTATTCTAATCCTATATTGTATCAACAATAATATTAT TATTGATCCTGTATGTAAAAGGTTATGAGACTTAAAATCACACGGTTTAAGATAC CGAAATGCTAAGCAAAAACGTTTCGTCGAGAGAAACAAAAACATTGAGTTGpppp ppppCAACAATACTACGGAAACGACCCATAACGCTGAAACAGCCGTGGAACTCG ATGGAACTTTCTTGCCGATTTGTTGCCCAATGTGCTCCAAAACGGAGGGAAGTC TTTCCGCGGACAGTCTGGCTTGAACGGGCTAGAGATGGCAGAGATCGGTTTGA CTTAGCACTCTTAAATTCATGCTTTAGGGTTATGTCGCGAGACATTAATATTGGG CAAGCCAGGGCAGATTTGGCTATATTCAGGCTGGTTTAGGCGATCCAAAAAGG ATTATGTAAGGGATTTTGACTGGGATGGATAAAATAGTTCTGATTGGGGCTTAAT GGGGCTCAAGTGGCTGTGTTTTCTGATTGATATTGGAACCTGCTGTCATTTCGA CAATTAATATTTACTTATTTTGGTCAACCCCAAATAGGTTGATTTCATACTTGGTT CATTCAAAAATAAGTAGTCTTTTGAGATCTTTCAATATTATAATAAATATACTATAA CAGCCGACTTGTTTCATTTTCGCGAATGTTCCCCCAGCTTATCggatcccgagctcgaa ttcgctagccagatcggcttaagacaaccaaacccagaactagtcgaatagtctgtgctaaaaaaccaatcggttaa aactagaatcgatctttaagtttaagattcaggcttgttgttaaacctattgccagaaaggacagttgactttggaacaaa ctcagctaacttgaaactcaaacaacagttttgttacttgccggcttacctcacttgctcagctagtctagcaagaaaac agtgtttcttgtcaacttagaactaatagcagagttaagcagaatcttgaaggctactctgtatttgaaaaccaattgactt gctttttacttagccttacttgctagtcaatcttcagggcagaagtaacttgaaaagttagaaaccaagtttaaaaagaca acaagaaacttgcacacaggactgagaaagtaactaagatttgaaactgagtagactaactctaccagtggttcaca agggttccaccctactttaacttttgacaagagttcaaagtcgaactttaaactgagcttacctctgtggactgtaaactctt gagttaccaaacttttgagctagcctctcagactgttactggttagctctacacagtcttttactattctaacgtaagcttaga ctagttcttggaataagtgaatctaagaagttgaggctaaactctcaaatagtgtagactaggcacgaactagaagtta gtttcttacgttggtagaaaaaaacagttgagtaggctgaaaaggtcaactaagccaaacaagtttcttgtcagaagtc taactgagtgaatacagttgtattcagaaactgtagctagttcgtcttctcaaaccaacttaccagacttttttaaacttgca gtttttactgtacgagacagtttgttactcttcacagtcagttagacgtaaagtaacttgaataagctgaatactaacgtcc acgaggtaggcagactatcctgttactgtcttttttagtctgcagtacaaaaagttaaactgttagcaatcctcggttaggc aactttgagttaacttagaagttaccactgcaagctcaatagattcgccctgcagattctaaaaacaaaagctgagcta aagctgctaactgcagttaggtttagatttgagaatagacttggtaaactgcagtaacttacgagaaagtaactaaaac tacagttttcaacttcagttttcgaactgtagttgtcttagtctgagttgaaagactgagttaagtaagttaactcactaggtt acgctaaagtgtagctactttggattcaggctcactctgcactagcatatggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatcc gcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgag acgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttc ggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctg ataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcatt ttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggtt acatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcactttt aaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctc agaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt gctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacg acgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcctggcgtaatagcgaagaggcccgcaccg atcgtggatgctggatgctggatgctggatgctggatgctggatgctggatgctggatgctggatgctggatgctggatg ctggatgctggatgctggatgctggatgctggatgctggatgctggatgctggatgctggatgiiiiiiii Suitable landing pads are bounded by recombination sites, which as described herein may be site-specific recombination sites, or sites for homologous recombination. Examples of long homologous recombination sequences (used in landing pads as described herein, are provided below) RS1 CTGTGTTAAACCGTCTTTAAGTCAACCCACAGTCTACTGCAATCGTATTCAGAAC TAGCCACTAGACTGTTACAAGTCGAAACCTCAGTTAACCAACTAGAAACTCTAG TTACCAAGTTAGAACTGTGAGTACGAAAAGTCTGAAAAGCAGAAAGATTCAATA GATTTGTCTGTGTTACACAAGAGTTCAACAAGTAGCTGCGTTCGTGCTAGTTGT CTAGGTTTAAACGTTTAAAAAGACAACTAGTAGTTTACTTCACCTCTGTATTACT GACGGTTTGTGCCTCAACAGTTTACGTTAACAAACTAGTAAGCGTCTACTTCGT GGACTTGTACTTTTAGTAGAAAGATTGAGTGTCTGGCAGTTTTAAACCTAAGTCA GTTAGAATCTCAATCCTCTGCCTTTGGTTTAGAAACAGTGTAGCTGTTTTGACCT AGACTGAGTACAACTGTTCTTGCTGCTTATTCGAAACTTGCCTAACTCACTGCAA CAGACAAGTCTAGTTTAGAATAAAGTAGGCTCAGTTATTCAAGTCTAACTTCAGA CAGTGTTTCTCAGATTTGACTTAAGTAGACAGTAGTGTGTGAAAAACCAGACTA GTTTGAATCTTAGCCTGTTCAGAAAAAACTAACTGACTTGTGTCAGGCCTCCCA AAAAAACTAACTTCAATCCTCTGTACTATTCCACAACTATTAGTTGTTGCAAGTCT GAAGCCTAGTCTTGCTTTGACCTTACAGGATAGAGGTTGGCTCACAACTGAGTC TGTGTGAAAACAAAAGTAAAGATTGCCACAAGAAGTCTATTCTAGTTAGTCCTTT TACGTTGGATAGCAATAGTCCAATCTTAGTTTG RS2CGTTTGGTGCTAACTCTTACAACAGCTACTAGTGAGTTCACAAAAACTGTTAAG GCTAAAAAAGCTGCGTAAGTTTCTACAGTTTTACGTTTGTTTTCACTGGAGTTCG AACTCAGTAATACAGTTGTAAGCTAAACGTCTGTGTTGAATAGACAGCAATACTG TACAGTCTGCAATCCTCAAGTAGCTCTTCAAGGTGAACAAGTACAACCGTAAAA AAAGTTAGAATACTGGTAAAGTTCAAAGTTAACGCAGGATACGAACTTGAATCTC GTTAGAAGCTGCTTAGTCTACTAAACTAGCTCACACTAGTCAACCGTGGCTTGC AGTTCTTCGTGGATTCAAAAACTGAACTCAGCTTGGTAACTGTAAGAATAACTAA GTTTGGATTGCTAACTAGAGTTTGTTAAACTTCTACCGTGAGACTTACTTACTTT AGTACTAAAGGTGTGTAAGTAACACTGACAGGTCGAATAAGAATCGACAAGGAC AGACTAAAAGTTTGTCTAACCAGACTTTCGTAGAGAGTTGCACTGCAACCGCTA GAGGTTTAGATTGAACTTAGTTTTAGATCGTAAAGTTAGTCTTACAACAGTAGTT AGATTGCTACCCGTTGAAGGTGAAAAGCTACTGTAAACCTATTGAGATTTGTTTT GAGTTGACTTAGCTCAGTACAAAGTGAACTGTGCTGCTTAAGACTAGAGGTAAG TTTACTTTAGTTTTAGGACCAATTGCGATCGATTTGAGTACAAGAAAGTTGCCTT GTCTGTAGGTTTCTTACTTGTATTCAAAAGCAAGTAGCAGTTACAGTTAACCTAC TCTCTCTCACTTTAAGCACCAGTAGAAACCTCTGCGGTAAG RS3GACAGCAACCTAACCGACTTTTACAGTGTTAACGGTTGCTGTTAGAGTTAGTCC ACCAGTATTCGCAGAGACTTTGAATAGCAGCTATCCACTTACAGACAACTGTAG CAGTTTTAGCTCTTTAACTCTGGTCCACCCGTTTGTCTAGCTAGCAAGTTTCTTA ACTTTTGAATACTGGCAAGAATAGAGCTAACTGTGGTTTAGCTCTTATTCAACTA ATACAAGCCTACTCAGTTGTCTTGTAGAAACAAAACCAGTTACTTCAAACTTAAC AACAGTTTCGTCAATCTGTCTTAAGCAACAGAGGCAGCTTCAAATACGGCAATA AGTTTAACTTTCTAAACTAGTAGTGTAGCCAATCTTAGCCACGCTTCTAACTTCT AGCTTCTTAACCCACTAGTCGAATCTGCTGTAATACAAAGCAGACGAACTAGAC TCAATCCAGTTGTTTTTTGAACTATTCTAAAACAGACTTGACGTGCAACGTTCAA TCCAATATTCAGAATATCCACCTGACTTTCAAAGACAGTAACCGTGGACTTTTTG TACACTGTTTTGACTTAACCCAACCAAAGTAACAGAGCTAGCTAGGTTTAGAAG GTGTCTGTAAAACTAAAACTAAAAGCTAAGTTAGTTTTCAAAAGTTTCCTGCGTT GCACACTAGCTGAGTACAAGCTCAAGCACGGTTTTGTTGTATTGAACTTACTAG TAAGTTTGAATACAGTTCTTGCGCTCACACTTGAACTCTGCAATAGTTCTACTTA GTAGTTAACTTAAGTCTGTGCAAGTACGGCAATCCTGTACTCTGCAATCTGTCTA AAACAACTATTTGGAACTCTTAGTTGACTTAACTCTTGGCTAAAGTGGAGTTTGT ACAGTCAGGTTAAGTAGAACTATTCTAACAGTTTAACCACAAACCTCGTTGAGTT GCCCTTAAAACTAGGTTTGTTTTTGGGAGATTCCCAGACGTAGGACTACTGTTG AGATTGGATAGAGCTAGACTAAAGTTGAAACTCAAGTAACCTGAGAGTAACTTA GCCACCCACCCTACTGAACTTAAACTCGTCTTTCACGAGGACTG RS4GACTTACCTCGTTTTAACTTAGTCGGTTAGTGAAGTTTAAGTCTAAGTTAGTTCA GACCTTTATTGCAGATTCGTCTTACTGTCTACTTAGCCCTGCGTTTGACTTGCCT ATTAGCTACTCAACTTAAAACAGTTAAACTCACAGACTTTACGATTGAAAACAAG TTGACTTGAACCCCAGTGGACGAACTCCACAAGTCTAGTTTGGCTTAGAGTTTC TACTTTACCTCTATTCTACCGCAGTAACTTTCAACCTGAAGTAAGTTCAAGTGAA ACTTAGAGTGAAGCTTGTGATCGACTACAAGCTCAATACAAACTTCTAGACCTTA GAACTAGCTTAGTTGCTTAACCTAGTGAATCCAACAACAAAGTTACCAAGAATAG ACAGTACGACAACTGGTTACGAGTGTAACTAAGAATCTTACACTCTAGTTCTGC CTTGCTGCTTATTCACCTTTTAGCTTTTGTTGTTTTTAGTTTTAGCCAACCAAAGG TGGAGGTTTAAACCCTTGAACTAAGCTTAGGTTCAACTGAAAGTCTGTCTGCCT TACAGACTTGTACAGACAAAAGTTAAACCTCTAAAGCAACCAGTCTACTAGTTTT CGTCTTTCTACGTAACTATTACCACGAGAGTAACAAGTTTCTAACACAAGTCTGT TGAGCCAAATCCAAATCTTTAAACCCTTGAGTTAGTTGAGTTTCGACGTTAGAAC TAGCTTTTTGTAGTAAGCTTATTCACAAACCTACTTAAGTTTAGACTGTAGTTACC GTACTGAAAAGATTGCTGACTTTTCTACTTTTACGTTTACAACAGCTGTGTAGCG TGCAACAGACGTGAGATTCAAGGCTGACGCTTAGTTAAACTTGT RS5CGCAGCAGACCTGTAACTCTACAGTTACACAGTCCTTTAAAAACCAACTTCTCG TTTCCACTGGGAACTTACAGTAGCTAACGTTTAGAACTGTTTTAGAAGTACAACT GTTAAGCTACGCCTAGTCTGGTCCTTTTGTACACTCTCACTTACTTTTGAACACA GACTTTTTAACACAACTAAGTAGACTAAGTAGCTGTGAGTTACACTCTAGTCTGT TCTACTTCTTCTGGGAACCTGTGGAATCTACTGGCTTTTAGGTTTAGAAACTCAC TAGTTTTGAGTGCGACTAAAGTTGGCGAAACGAGGCGTCTAAGTTTAACTTAGA CAGTTGTAGAAACTTGTTAGTGTTAACCAAGAGTTTACTGTTTTGTTACAGTCAA ACGCTACTCTCGTTAGACTAAGTTTGTTACCAAGTGAATAGATTGAATAACAGTT CTTAGTAGCTAGAAGTTACCAAACCTGCACACTTGCTCAATATTCTAGATTGGTC TGGTTTTTAAAAGAGAGATCACAGTACTAGTTTTTAACTCACGAAGTGTGAGAAC AACAAAACTGTAACTCTAGTGAGTATCCCAAGTTGGTGTTACAGTTCTCGTTACT AGTTGCCTCACTCAATAGTTCTGCTTGGGACTCTAACAGCTACAGTAGTTTTTAA AAGTTAACACTGGGAAACTTTTAAGATTCTTGCCTCTGTAGTTTCACTTAGTTTA GAAGACTGACAACTGACTTGTAACTACCAGTATTACAACTGTCTAGCCTTTCTAA AGCAGACTAATACAAGAGTTCAGTTAGCAGCTGCCGTCTAACTAGCTACGTAGA GGATTCAGTTTTAAACTTGAACTAGGCACAAGGTCTGTTCTAACTACTAAGAATA GATTCGAAGTAACGGGTTAGTGTCAGTAAAGGACTAGTGAAGTTAGTCTTCTGA GAAACTTAAACGTTCAAAAGTTGGACACACTTTTAAGTCTAGTCAAGCTAGTAGC AATATTGCAACGTCTAGTCAACGTAGCGTGCAGAATCACAGTCTCTTTATTGCTA CTAAGTTCAGATTGGTTACTGGTTCTAGTACGGC RS6CCGTGTAGGTCTACAAACTGGTATTCTCGTTTGTTGTGAATCTTGTCTTTTCTGC TTACTTTCTAATAGATTGAGTGAGTTAGGTCTGTATTTGACGGCTAAAGTTAAAC TTAACTGTTGTGTGGGATAGTTGTTAGCTGTCAAGAAACCGTTAAACGTAGAAA GAGTAACTTTTCTAAACCGTAGTGTCTACTCAATATTGAGACAAGCAGCTAGTTT AAGAGCAGAAGCTGAAGTCTGTGAGTTTGGAAACTAAAAGGTCTGTGAACAGCT AACTAGAACTAGGCTTGCTTTTAGTATTAGAATAACAACAAACGAGGTCTATTAG TTGTGGGATCTAGCTAGTTGCCTAAGAACAAAGGACTAAGTCTGCAGAAAAACG AGTTTCAATAGGTCTGTGTGTAACAGTGTTAAGGCTACTAGCAGAACTGCCACC TAAGTTTCGTAAGTTCCACCTCAGCCTTCAATATTCCAGACTTGACCAACTTTCA GTTTTTAAACTCTACCGTACTAGTAGTTTCTGCACAGTATTAGACCTACTTACAC TGTCTGTGCTTGCACCACAAACCAAATAGTAGAATCTCTTTTAAGTAGAACAGTC TTTTCTTGTTAGACTAAAACAACGAGAGACAACTGAGTGTAGGGTTACAGTTAAA AAACTGTACAGTCTGCTGTACAGACGTTACACGGCAGTCCTGTTCCAAACTTCA CTTAAGGGTTAGATTGGCTAAGTTCAACTTGTCCTTTTAAGTTAGTTCAGACCTA GTTAGCAGACTTAGGTGGGTAAGCTGAGCTACAAGAGTTAAAAACAACTGCTAA GACTAAAGTAAGTGTACGTAAGCTTCAAACTAGTAAGTTAAACTTAGAAACAGCT AACGTCTAAAGCTAGAAGTAAGCTCAATCTTAGTACTGTTAACCTAAGTTGCTCA CGCACCTTCGCCAACTCAIn a further aspect, there is provided a method of expressing genes in a Komagataella speciesas described herein, comprising introducing an artificial linear Komagataella chromosome,comprising the at least one gene of interest, as described herein into the Komagataella species and expressing the at least one gene of interest.In a further aspect, there is provided a Komagataella species comprising an artificial linearKomagataella chromosome as described herein. In one embodiment, the species is K. phaffiior K. pastoris or K. pseudopastoris.In order to facilitate with stable maintenance of the artificial linear Komagataella chromosomesas described herein in the Komagataella species, it may be desirable to reduce non-homologous end joining (NHEJ) activity within the Komagataella species. This is exemplifiedherein by use of Komagataella species, which have a deletion of the KU70 gene (ΔKU70).Alternatives to the use of ΔKU70 Komagataella strains for reducing NHEJ includeoverexpression of RAD51 and RAD 52, or the deletion of MPH1; and deletion of the gene forDNA ligase IV (Dnl4p). Thus, in one embodiment, the Komagataella species comprisingan artificial linear Komagataella chromosome as described herein is a Komagataella species,which has been modified in order to reduce NHEJ activity. Using such modified species, the present investigators have managed to create stable strains, which are capable of growth and subsequent gene of interest expression and protein production. In accordance with thisdisclosure, a stable Komagataella species comprising an artificial linear Komagataellachromosome as described herein is capable of surviving for at least 25, 30, 50 or more generations and gene of interest expression and protein production, following induction.In a further aspect, there is provided a bioreactor comprising a stable Komagataella speciescomprising an artificial linear Komagataella chromosome as described herein. A bioreactormay be any size and includes small-scale (e.g. 500 ml – 50 l) fermentation receptacles up tolarge-scale (100s to 1000s litres) industrial fermenters. Detailed description The present disclosure will be further described by way of example and with reference to the figures, which show: Figure 1 Nanochromosome construction and engineering(a) In vitro and in E. coli, we assembled a centromeric, K. phaffii ARS-containing, framework.We added an initial integration array (the future landing pad) and future (proto-) telomeres, creating nanochromosome (nChr)-precursor version (v)1. We cleaved this between its proto-telomeres, and used the linear product - nChr 1 - to transform K. phaffii cells. To subsequentlyimprove nanochrosome stability, we extended nChr-precursor v1 and added a second ARS (for precursor v2), then replaced the initial integration array with new ones, creating precursorsv2A and v2B. These yielded nChr 2A and nChr 2B, which were stable only in a ΔKU70 strain.Finally we explored the feasibility of engineering nChr 2A and nChr 2B (to Chr 2A.1 etc.) invivo. Plasmids are not drawn to scale. (b) Schematic representations (drawn approximatelyto scale) of the synthetic, linear nanochromosomes as constructed in the current study. Listsof oligos, plasmids and strains may be found in Tables 1, 2 and 3 respectively. Promoters andterminators are not shown. CEN = centromere, ncDNA = non-coding DNA, LHR = long HR-compatible region (referred to as a recombination sequence (RS) region in the Summary andClaims), mCH = mCherry gene cassette, GFP:FH = gene cassette coding for a GFP-Factor Hfusion. Figure 2 Preparation of key parts(a) Preparation of CEN3, from K. phaffii gDNA. Left-hand gel: PCR amplicons of segment(Seg) 1 (oligos 197 / 198), and Seg 2 (oligos 199 / 200). This approach introduces one extra, functionally silent, base pair (G:C) in the core region (see Figure 8). DNA bands of expected sizes (boxed) were extracted and digested with appropriate restriction enzymes before sequential cloning into pUC19 to yield eDA24. Right-hand gel: restriction digestion of eDA24confirming presence of 6.3-kb CEN3 (IR = inverted repeats). (b) Assembly of frameworkplasmid in a pUC19-derived scaffold (ori = bacterial origin of replication) (eDA53 validationshown in Figure 8). (c) The oligos used to construct the telomeres (TEL) part (Tel, Fig. 10).Each proto-telomere contains 16 copies of TGGATGC and the two are linked by the 18-bp I-SceI-recognition site. Lower schematic: cloning of Tel into eDA40 (eDA131 validation shownin Figure 11). Figure 3 Production and testing of precursor plasmid v1 and nChr 1(a) Incorporation of an initial, one-off, gene-landing pad into the precursor plasmid. Work oneDA83 was halted due to leaky I-SceI expression in E. coli. (b) Following deletion of I-SceI ineDA83 by insertion of KanR(creating eDA110), Tel was inserted to yield eDA137, theprecursor plasmid (v1) of nChr 1. The plasmid was linearized in vitro and used to transformCBS7435 K. phaffii cells creating strain yDA122. The agarose gel shows I-SceI digestion ofTel-containing eDA137 (vs control, i.e. no-Tel, eDA110). Lanes on the gel: L DNA ladder; 1eDA110 (undigested); 2 i-SceI-treated eDA110; 3 eDA137 (undigested); 4 i-SceI-treatedeDA137. *L&T = linearise and then transform wild-type K. pfaffii cells C Despite nChr 1appearing stable in chromosome-loss assays performed on yDA122, whole-genome sequencing (WGS) (and subsequently, colony PCR, see gel) revealed major chromosomal rearrangements as indicated in the schematic. nChr 1 = linearised eDA137; nChr 1’ = modified nChr 1. Lanes on the gel: 10.99-kb PCR product (372 / 375); 21.0-kb PCR product (372 / 370); 30.94-kb PCR product (372 / 374); L = ladder 1 kb (NEB). Note, in yDA122, the loss of PCR- product 3 (of nChr 1), but retention of PCR-product 2 of the suspected translocation productnChr 1* (i.e. nChr 1(p):Chr 3(q)).Figure 4Observed aberrations of an extended nanochromosome (nChr 2) in wild-type cells(a) The shorter (p) arm of nChr 1 was extended with non-coding (nc)DNA, and a second ARSadded, by cloning components into precursor v1 to create v2. (b) Agarose gel showing I-SceIdigestion products for eDA146 (control) and eDA155. Lanes in gel: 1 eDA146 undigested; 2 I-SceI-treated eDA146; 3 eDA155 undigested; 4 I-SceI-treated eDA155; L 1-kb DNA ladder.(c) Validation of nChr 2 by PCR before K. phaffii transformation (for oligonucleotides sets seeTable 1). (d) De novo assembly analysis of the WGS for the resultant strains (yDA174 andyDA175) revealed a preponderance of fused chromosomes indicating instability (see Figure5). Strain yDA174 carries a triple-fusion between a nChr 2 q-arm (i.e. lacking its p-arm),another nChr 2 q-arm; and a copy of nChr 2 lacking the p-arm telomere; the junction formed between q-arms involves the inverted-repeat regions (IRs, 99% sequence identity) of thecentromeres but it was not possible to ascertain the nature of this fusion event. In strainyDA175 an additional copy of nChr 2, lacking its p-arm telomere, appears fused to the triple- fusion structure seen in yDA174. Figure 5Whole-genome sequencing coverage data for wild-type and ΔKU70 K. phaffii cells containingnanochromosomes The y-axes show “normalised coverage” values, obtained by dividing the coverage of each bp by the mean coverage of all bps in the respective sample. This allows comparisons, and identification of duplicated segments or deletions. The x-axes show the genomic coordinate of each bp in its respective chromosome (values in kb for native chromosomes). Each nanochromosome is shown as a schematic, drawn to the same scale as the x-axis in each case. * Indicates centromere. (.) Indicates anomalies attributable to native genomerearrangements (e.g. duplicated loci) or artifacts due to repetitive regions such as found intelomeres. (X) Indicates a ~1-kb duplicated region of Chr 2 corresponding to an ORF encodingan unknown protein. Red boxes, drawn on nanochromosome schematics, indicate CEN3 coreregions characterised by the signature presence of an extra GC base pair. Upper panel: For yDA175 (wild-type background) a plot of normalized coverage indicates two-four copies of nanochromosomal sequence suggesting multiple copies per cell of nChr 2 DNA. The highcopy-number for the Chr 3 centromere correlates with a high copy-number of nChr 2,supporting the existence of chimeric multi-centric nanochromosomes. This observation iscompatible with yDA175 and yDA177 de novo assembly results obtained from long-readWGS. Middle and lower panels: Both these ΔKU70-background strains are consistent with a single copy per cell of its nanochromosome: yDA253 with a single copy of nChr 2A; andyDA275 with a single copy of nChr 2A.2 (i.e. after the inch-worming proof-of-principleexperiment). Figure 6 New versions of precursor plasmids created by swapping out the original integration array PCR products (see agarose gel) from eDA197 or eDA227, digested with AfeI and XhoI were ligated into appropriately digested eDA155. Precursors v2A and v2B were linearized with I-SceI then used to transform wild-type or ΔKU70 cells to create a total of four strains.Figure 7 Gene expression from the nanochromosome supports production of a traditionally integrated extraneous gene, or can be used directly to produce recombinant protein(a) Expression of PDIH on nChr 2A could help form the 40 disulfide bonds of mouse factor H(mFH) encoded by DNA integrated into Chr 4. (b) SDS-PAGE (Coomassie stained) of cell-culture media (30 µL, reducing conditions, treated with Endo Hf) before (d0), or three days after (d3), methanol induction. Co-expression of PDIHlocated on either nChr 2A or (as a control) a native chromosome, is required for detectable quantities of secreted mFH. (c) Western blot was used to demonstrate PDIHproduction in cells containing nChr 2A three dayspost-induction. (d) A 165-kDa fusion GFP:factor H (GFP:FH) fusion protein is detectable threedays after induction in the culture media from two strains containing nChr 2A.2 carrying both PDIHand GFP:FH. In each lane 40 µL of Endo Hf–treated crude culture medium (after cell removal) was loaded under reducing conditions. Bands were detected with Coomassie blue and by Western blot using an anti-green fluorescent (GFP) antibody that also revealed the presence of a GFP-containing proteolytic fragment. (e) Both mFH and GFP:FH produced herein are cofactors for (30 nM) complement factor I (FI)-catalysed cleavage of the 110-kDa α’-chain of complement protein C3b into 63-kD and 39-kDa fragments. In each case 12 µL of crude culture medium (at d(ay) 3 or, as a control, at d(ay) 0) was assayed. Control reactions lacked FI. Figure 8 Confirmation of distinction between nanochromosomal CEN3 (containing additional G) and the native centromere of Chr 3(a) A screenshot showing SnapGene representation of core region of CEN3 from precursorplasmid v2A, with a G inserted to create an EcoRI-recoginition site (see Fig. 2) (b)Visualization (IGV) derived from whole-genome sequencing (WGS) of nChr 2A CEN3 coreregion (from strain yDA253). The black bar shows the region containing the *inserted guanosine (see also Figure 8) (c) Visualisation (IGV) derived from WGS of the core region of the native Chr 3 centromere (from strain yDA253). The black bar indicates the sequence thatdistinguishes between native (CAAAAT) and nanochromosomal (CAAGAAT) centromeres.Figure 9 Preparation of framework plasmid eDA53 (see also Figure 2)(a) The DNA parts (annotated by SnapGene Viewer) used for Gibson assembly. Fragment 1:eDA24 (source of CEN3) linearized with blunt-end restriction enzymes. Fragment 2: PCR-amplified ZeoR, ex eDA40. Fragment 3: PCR-amplified PARS-A76, ex eDA26 (see Table 1 foroligo sequences). (b) Purified fragments 1-3 ran as expected on an agarose gel. (c) Map ofeDA53 with location of primer-pairs used for verification by PCR. Of five E. coli coloniesselected on plates with 50 µg / mL zeocin and 100 µg / ml ampicillin, only one colony (4,highlighted) was verified, and Sanger sequencing confirmed the expected sequence of theextracted plasmid. Figure 10 Construction of the telomeres part (Tel) The upper schematic shows the proto-telomere[i-SceI-recognition site]proto-telomerestructure expected after annealing and then ligation of four oligos as color-coded in the lowerschematic. Grey boxes represent some of the seven-base pair telomere repeats. The PvuI-recognition site allows Tel excision from, and insertion into, plasmids. The confirmatory gelshows expected bands for the individual oligos (see schematic for numbering) and theproducts of annealing. Figure 11 Validation of Tel-carrying plasmid eDA131(a) Map of the eDA131 showing the locations of the various sequences targeted by oligos (redtext and arrows) used for colony PCR-based screening of E. coli transformants, followingligation between cleaved eDA40 and Tel. (b) Among zeocin-resistant and ampicillin-sensitivestrains, colony-PCR using oligos 280 / 282 generates bands corresponding to the expected(584-bp) amplicon in clones 1, 3 and 6, only. (c) Plasmids isolated from clones 1, 3 and 6,following digestion with FspI / PvuII and gel electrophoresis, yielded a pattern of bands closeto the one predicted (by SnapGene). The Tel part could thus be digested with blunt-endrestriction enzymes PvuII and FspI, then gel-extracted prior to ligation with framework-plasmideDA53. Figure 12 Insertion and integration arrays(a) Various strategies for integration via double-crossover HR of genes, delivered within an invitro-assembled insertion array, into a K. phaffii nanochromosome-resident integration array.(b) An example of array assembly. PCR-amplified parts digested with BsmBI were gel-purifiedthen ligated pairwise. Products were gel-purified and ligated into BsmBI-linearised pUC19.Resultant plasmids were used to transform E. coli then Sanger sequenced. In preparation fordeployment, arrays were subsequently excised with AsiSI, or amplified by PCR. Table 2contains a list of insertion and integration arrays. Figure 13Whole-genome sequencing coverage data for wild-type and ΔKU70 K. phaffii cells containingnanochromosomes (This is an extended version of Figure 5)See legend of Figure 5 for an explanation of axes and symbols. (a) and (b): For strains onwild-type background, plots of normalized coverage indicate two-four copies ofnanochromosomal sequences per cell. Note in (a) that nChr 1 of yDA122 lacks a p-arm, whilehigh coverage suggests there are between two and four copies, per cell, of a majority of thenChr 1 sequence. This result is compatible with de novo assembly (details described in theResults section, sequences provided below) suggesting fusion between nChr1 q-arm and the ~34-kb Chr 3 p-arm. A vertical arrow in the Chr 3 plot indicates data consistent with duplication of the Chr 3 p-arm and its centromere. In (b), the values (>2) for normalised coverage for nChr 2 suggest multiple copies per cell of its DNA content. The high copy-number for the Chr 3centromere correlates with a high copy-number of nChr 2 and supports the existence ofchimeric multi-centric nanochromosomes. This observation is compatible with yDA175 andyDA177 de novo assembly results obtained from long-read WGS. (c)-(g): Strains on a ΔKU70background are each consistent with a single copy per cell of its nanochromosome,specifically: (c), yDA253 with a single copy of nChr 2A; (d), yDA260 with mFH gene integratedinto (native) Chr 4 and a single copy of nChr 2A; (e), yDA263 with a single copy of nChr 2A.1(i.e. after replacing HygR in nChr 2A with GFP-ZeoR); (f) and (g), yDA275 and yDA277(biological replicates) with single copies of nChr 2A.2 (i.e. after the inch-worming proof-of-principle experiment). Figure 14 Validating the KU70-knockout K. phaffii strain employed in this study to host nanochromosomes(a) Upper box: Annotated visualisation (IGV) of WGS results confirms deletion of CGdinucleotide spanning codons for KU7025His-Ala26. The KU70 start codon is indicated with ablack rectangle. Lower box: Annotated SnapGene screenshot showing the sequence of KU70(on Chr 3) and highlighting the dinucleotide (GC) deleted in our ΔKU70 strain. (b) Serialdilution to compare viabilities of wild-type and ΔKU70 strains under various conditions.CBS7435 (WT) cells and two ΔKU70 isolates, yDA208 (ΔKU70-1) and yDA210 (ΔKU70-2)were inoculated into YPD and grown for 24 hours at 30 °C. Cultures were adjusted to A600= 0.1, then subjected to a series of tenfold dilutions for plating onto YPD or YPG (glycerol) agar. Plates were incubated at 30 °C for two days, or 37 °C for four days. Figure 15Verification of nChr 1 and nChr 2 stability in ΔKU70 cells growing in YPD medium for 20generations PCR-based genotyping confirms integrity of extended version (nChr 2) in contrast to shorter(nChr 1) version for which one or more crucial bands are absent from each strain. (a) Primerswere designed to target regions linking CEN3 and the q-arm of both nanochromosomes(370 / 372; primers set 1) or the p-arm of either nChr 1 (372 / 374; set 2) or nChr 2 (372 / 443; primers set 3). Primer set 4 (292 / 295) validates the p-arm telomere of bothnanochromosomes. (b) Note the absence of an amplicon corresponding to the p-arm telomereof nChr 1, in contrast to nChr 2. An amplicon for set 2 is missing or weak in two out of three colonies transformed with nChr 1. Figure 16 Comparison of PCR-based genotyping of nChr 2A and nChr 2B on wild-type and ΔKU70 K. phaffii backgrounds Missing amplicons in the cases of yDA232 (oligo pair 4) and yDA177 (oligo pairs 1 and 3) are consistent with the instability of both these extended nanochromosomes on wild-typebackgrounds. Conversely, candidate bands are evident for all four targets in both the ΔKU70strains, i.e. yDA253 and yDA218. Analysis was performed on strains inoculated and cultivated on YPD medium, without antibiotic, for 24 hours. These data are in good agreement with WGS. Figure 17 Engineering a nanochromosome in the context of wild-type (CBS7435) or ΔKU70 strains of K. phaffii These proof-of-principle experiments were designed to assess the feasibility of replacing genes within the landing zones of nanochromosomes with different ones, in vivo, by doublecross-over HR. (a) Attempted replacement of GFP-ZeoR in the landing zone of nChr 2B withmCH-HygR. (b) Attempted replacement of HygR in the landing zone of nChr 2A with GFP andZeoR. Note the higher success rate obtained with ΔKU70 strains in terms of selected colonies.Figure 18 Assessment of nChr 2A persistence in K. phaffii strain yDA260(a) Cells grown for 12 hours (12 h) in YPD were used to inoculate YPG as indicated; thepresence or absence of hygromycin is indicated by a + or a – symbol. After 24 hours (24 h) ofexponential growth in YPG, cells were spun down then re-suspended in YPM (no antibiotic). After 36 hours (36 h) of methanol-induction, calls were streaked out on YPD plates, with or without hygromycin. An assessment of the retention of HygR(and, by extension, nChr 2A)was made by comparing colony counts with, versus without, hygromycin. The results (right-hand panels, white numerals are colony counts derived from ImageJ software) were expressed as % of colonies that were no longer-hygromycin resistant (note: yDA260 carries nChr 2A; yDA264 is a control in which the HygRcassette is integrated into the native genome; yDA140, contains only (telomere-null / centromere-null) eDA37 (see Table 5). (b)Representative genotyping by colony PCR of P. pastoris strain yDA260 recovered from YPDplate after the chromosome-loss assay. The (numbered) sites targeted by oligo-pairs (see Table 2) are indicated on the schematic of nChr 2A. Figure 19 Illustration of the use of an “inch-worming” strategy for in vivo gene integration into the nanochromosome that requires a ΔKU70 backgroundThe wild-type and ΔKU70 strains shown were transformed with an integration array,schematized in the figure, which was designed to replace HygRin nChr 2A with GFP:FH- LHRD-ZeoR. Single colonies that grew on zeocin-containing agar plates were screened for zeocin resistance and hygromycin sensitivity following by PCR genotyping. Only KU70- compromised strains tested positive.Figure 20 Validation of inch-wormingHere, nChr 2A was engineered, in vivo, into nChr 2A.2, by gene integration accompanied by simultaneous extension of the landing pad (anticipating a further round of gene integration)and by exchange of selection-markers. ΔKU70 K. phaffii cells carrying nChr 2A weretransformed with the insertion array LHRE-GFP:CFH-LHRD-ZeoR-LHRZ. Transformants (growing on Zeocin) were transferred to YPD agar plates, then screened for zeocin resistance and hygromycin sensitivity. An attempt was made to validate nChr2A.2 by PCR-based genotype mapping. The amplicon numbers shown in the carton arise from the following ten oligo pairs (see Table 1): (1) 369 / 235; (2) 23 / 25; (3) 394 / 372; (4) 370 / 372; (5) 443 / 372; (6) 382 / 374; (7) (394 / 338); (8) 394 / 272; (9) 274 / 278; (10) 40 / 345. Figure 21 Schematic of two sequential steps of the “inchworming” strategy for sequential gene insertions. Insertion I converted nChr 2A to nChr 2A.2 as previously described. For insertion II, yDA277(CBS7435 ΔKU70 carrying nChr 2A.2) was transformed with (eDA283) the insertion arrayLHRD-mCh-LHRF-HygR-LHRZ). Key: LHR = long homology repeat; PDI = protein disulfideisomerase gene cassette; CEN = centromere; mCh = mCherry gene cassette; GFP:CFH =GFP:complement factor H gene cassette; Tel = telomere; ARS = autonomous replicationsequence. ZeoR and HygR = antimicrobial resistance-selection markers.Figure 22 Summary of the three steps involved in assembly of the insertion array used for the second (sequential) step of the inchworming strategy. Sources of parts were as follows. PART 1 was PCRed using oligos 346 / 347 from template eDA9: Fwd oligo 1 = LHRD_BsmBI_GGGA_AsiSI (346); Rev oligo 1 = LHRD_BsmBI_GACA (347). PART 2 was PCRed using oligos 515 / 516 from template eDA199: Fwd oligo 2 = Ptef_XhoI_BsmBI_GACA (515); Rev oligo 2 = Tcyc_XhoI-BsmBI_TCAG (516). PART 3 was PCRed using oligos 490 / 491 from template eDA9: Fwd oligo 3 = LHRF_BsmBI_TCAG (490); Rev oligo 3 = LHRF_BsmBI_GTAG (491). PART 4 was PCRed using oligos 306 / 317 from template eDA115: Fwd oligo 4 = HygR_SalI BsaI_GTAG (306); Rev oligo 4 = LHRZ_KpnI_BsaI_CGCG_AsiSI (317). Step 1 used T7 DNA ligase. Step 2 entailed re- amplification by PCR followed by ligation with T7 DNA ligase. Fd-oligo = forward primer for PCR; Rv-oligo = reverse primer for PCR; for other arrays examples see Table 4. Figure 23 Results for assembly of insertion array summarised in Figure 22A Shows a gel of the four Parts sourced as described in Figure 22. B The outcome of ligationof parts 1+2 and parts 2+3; bands were excised from the gels as shown. C Shows a gel of theligation products as in panel B, and linearized pUC19 (to supply a backbone for the carrierplasmid) – these three components were ligated to create the plasmid eDA283. Lanes on thegel: 1- Parts 1 + 2 (Esp3I); 2- Parts 3 + 4 (BsaI); 3- pUC1 (Esp3I); L- 1-kb DNA ladder DColony PCR, interrogating regions a (422 / 4601kb), b (353 / 3540.4 kb) and c (528 / 3740.4 kb)was used to pre-validate eDA283 – five colonies were deemed successful. Lanes on gel: (left-to-right) Clones 1-7 and 41-47 interrogated for a; clones 2, 6, 45, 46, 47 interrogated for b andc. E Whole-plasmid sequencing confirmed the sequence of insertion array-carrier plasmid,eDA283. Figure 24 Linearisation of eDA283 prior to its use in transformation of yeast cells The restriction enzyme AsiS1 was used to linearise eDA283. The larger linearized product (see gel in right-hand panel) was used to transform the strain yDA277 (see Figure 21). Figure 25 Validation of the second “inchworming” step by PCR. Schematic maps of nanochromosomes showing the locations of sets of primers used in thescreening. Primary screening confirmed six of 14 transformants were HygR-plus and ZeoR-negative, as hoped. Following the secondary screening with additional oligo pairs, clone 9 (called yDA322) was taken forward for whole-genome sequencing (despite false-negative in left-hand gel). Figure 26Production of recombinant proteins – fluorescence detection testStrains that carry genes coding for fluorescent proteins (mCherry (mCh), GFP, and the fusion protein GFP:CFH) were tested. Flask fermentation was performed on a 50-mL scale. In upperpanel (media – no cells): A- Empty Eppendorf tube (plastic autofluorescence test); B- YPMmedium (medium-autofluorescence test); C- Strain yDA322 in YPG (i.e. non-inducingmedium); D- Strain yDA322 in YPM (inducing medium); E- Strain yDA277, i.e. host strain(published in Abramczyk et al., 2023) in YPM. In lower two panels cell pellets were collectedfrom spinning down 1.0 mL of medium: A- Strain yDA277, host strain (Abramczyk et al., 2023)in YPD (non-inducing medium); B- Strain yDA277, in YPG (non-inducing medium); C- StrainyDA277, in YPM; D- Strain yDA322 in YPD; Strain yDA322 in YPG; F-G- Strains yDA322 inYPM (1st day after induction); H-I. Strains yDA322 in YPM (3rd day after induction); J- StrainyDA177, a fluorescence control (GFP) (Abramczyk et al., 2023). Figure 27 The concept: a generic schematic of a minimal nanochromosome that has a gene-landing pad in each arm The original landing pad has a gene of interest (GoI) already present. The new landing pad is ready for insertion of a gene of interest. For most abbreviations, see Figure 1. Note that hereRS1, RS2 etc. stand for recombination sequence 1, 2 etc. and are synonymous with long-homology regions (LHRs such as LHRA, LHRBetc.) in the original landing pad (in Figure 1 for example) while RSA, RSBetc. are used to denote recombination sequences (long-homology regions) in the new landing site. AMRAwould be either ZeoRor HygR; AMRBwould be eitherNAT or G418 where Nat and G418 genes code for resistance to antibiotics nourseothricin(NTC) and kanamycin (Kan) respectively. Figure 28 Incorporation of second landing pad by transformation of P. pastoris cells Strain yDA253 (contains nChr2A.3, which is a product of “inch-worming” performed on nChr 2, and shown to be highly stable, as published in Abramczyk et al., 2023) was transformedwith a “second landing-pad” template to create yDA304 carrying nChr 2A.3 / 1A that possessestwo gene-landing pads. *This is a region of non-coding (nc)DNA which has a unique sequence that was exploited as a site for insertion of the second landing-pad template using homologousrecombination. Note that: (a) nChr 2A was also used in the current project as a host forinsertion of second landing pad templates; and (b) Two second landing pad templates werecreated - containing either Nat or G418 selection markers flanked by recombinationsequences / LHRs. Both of these were employed in the case of nChr 2A to create nChr 2A / 1A and nChr 2A / 1B. Figure 29 The construction of the two second landing-pad templates.A Plasmid eDA145 (containing 761-bp ncDNA-B) served as a template for both (i) the G418cassette that was amplified from eDA17 using oligo 497 (Fw-NheI-G418) and oligo 498 (Rv-NheI-BstZI17I-G418) (product = 1493 bp); and (ii) the Nat cassette that was amplified fromeDA23 with oligo 502 (Fw-NheI-Nat) and oligo 501 (Rv-NheI-BstZI17I-Nat) (product = 1151 bp). It was important to verify insertions (that yield (i) eDA276 and (ii) eDA275) had the correctorientations (using colony PCR, see the two gels). B The 580-bp non-coding (nc)DNA-A wasinserted into digested eDA276 and eDA275 (both approx.3.8 kb, see gel below. Lanes in gels:1- eDA275 EcoRI / Bst717I; 2- eDA276 EcoRI / BstZ17I; 3- ncDNA-A EcoRI / BstZ17I; 4- DNAladder) to yield eDA279 and eDA277; colony PCR (right-hand gels) confirmed 13 / 14 positive clones for both plasmids. Figure 30 Sanger sequencing results confirmed the second landing pads Results are shown for the plasmid eDA279 (ncDNA-A-KanR-ncDNA-B) and plasmid eDA277 (ncDNA-A-Nat-ncDNA-B). A ncDNA-A is renamed as LHR1, and ncDNA-B is renamed as LHR2(see Figure 28). Figure 31Strains created by transformation of cells with the PCR-amplified second landing padtemplates, and their validation using PCR The two templates were amplified from their respective carrier plasmids (eDA277 andeDA279, see Figure 29) using oligo numbers 506 and 507 to generate 2.5- and 2.8-kbamplicons that were gel purified (not shown). The upper panel summarises some of the new strains created from the various host strains / nanochromosomes. The strategy used here was to create strains with different pairs of antimicrobial resistance markers in the two landing sites(see Figure 27) to generate easily distinguishable, i.e. diagnostic, phenotypes. The nChr 2A.3was chosen as an example of a nanochromosome that had already been geneticallymanipulated (by an inch-worm style insertion) in a P. pastoris host and hence it exemplifiesthe suitability of the nanochromosome for multiple genetic manipulations that might entailnumerous generations and relatively stressful conditions (e.g. for further transformations). Thelower panel shows examples of the colony-PCR verification of transformants. Lanes in gels:1- yDA310; 2- yDA311; 3- yDA312 [ncDNA(A)-Nat-ncDNA(B)]; 4- yDA313; 5- yDA314[ncDNA(A)-Nat-ncDNA(B)]; 6- yDA315 [ncDNA(A)-G418-ncDNA(B)].Figure 32 Cell-serial dilutions as a test of chromosomal loss Some example data are shown for strains yDA313 and yDA314 (see Figure 31 upper panel) indicating a high retention of antibiotic-resistance markers (and, by inference, the respective landing pads) over approximately 50 generations / duplications in liquid culture. Similar data (not shown) were obtained for the other strains listed in Figure 31, including strains created by transformation with the G418-containing second landing pad template. Strains: yDA313 = yDA304 + [ncDNA-A / Nat / ncDNA-B] (clone 1); yDA314 = yDA304 + [ncDNA-A / Nat / ncDNA-B](clone 2); superscripts indicate the liquid medium (YPD, YPG etc. with or without added NTC +zeocin, as stated) from which the cells were transferred onto the plates prepared with themedia indicated to the side (YPD etc. with or without NTC or Zeocin (as stated)). Note thatboth yDA313 and yDA314 are Zeocin- resistant owing to the presence of the first landing pad.Figure 33Strains after the chromosome-loss (serial dilution) assay – PCR genotyping confirmsnanochromosome integrity Strains recovered from YPD medium after the chromosome-loss assay were re-streaked on YPD plates and subjected to genotyping, using the pairs of oligonucleotides stated in the gellabels, and interrogating the regions on the schematic drawings labelled a, b, c, and d. On thegel: lanes 1, 2 and 3 are for the nCh22A / 1A-containing strains yDA310, yDA311 and yDA312, respectively; lanes labelled 4 are for the nChr 2A.3 / 1A-containing strain yDA313; lanes labelled 5 are for the nChr 2A / 1B-containing strain yDA315. Figure 34 Assembly of a double-landing pad nanochromosome precursor in vitro / in E. coli Upper panel, Step A. Creation of a 14.5-kb NdeI-digested segment from eDA217 (a previously prepared nChr precursor containing an iLov-expression cassette). This comprises most of the nanochromosome components but is missing ARS2-ncDNA. Middle panel, Step B. The 3-kb second landing pad template (from eDA277) was PCR amplified (oligos 379 / 381) for ligation with the aforementioned 14.5-kb segment, thereby producing nChr3 (containing the secondlanding pad, i.e. ncDNA-A:Nat:ncDNA-B). Lower panel, Step C. Verification using colony PCRof the resultant plasmid eDA285 that serves as a linear precursor of nChr 3, a double-landing pad nanochromosome. Figure 35 Final step in creation of nChr 3 and colony-PCR validation after transformation of K. phaffii cells Following validation by whole-plasmid sequencing, linearisation and gel purification (see topgel), eDA285 / nChr 3 (with its two landing pads) was used to transform ΔKU70 yeast cells.Screening (not shown) was performed on agar plates with zeocin or NTC. Primary and secondary screening by colony PCR (lower gels) was used to validate the strains (the regions interrogated by the named oligonucleotide pairs are indicated in the schematic drawing of nChr3, and expected amplicon sizes are indicated below the gels). Colonies 1, 4 and 7 are positive. METHODS Materials The following were sourced from New England Biolabs (NEB): type II and type IIS restriction enzymes, Q5 high-fidelity DNA polymerase, T4 and T7 DNA ligases, T4 DNA polynucleotide kinase and Antarctic phosphatase. Synthetic genes were ordered from GeneArt and plasmids purchased from Thermo Fisher Scientific. Oligonucleotides (oligos) (Table 1) were orderedfrom Integrated DNA Technologies. E. coli TOP10 cells purchased from Thermo FisherScientific were used for sub-cloning. Wild type K. phaffii cells were sourced from the ATCC strains library. Non-coding DNA segments of nanochromosomes, used for HR and as fillers or spacers, were derived from a proprietary library of 8-kb synthetic DNA chunks deposited in a GeneArt plasmid (ordered from Thermo Fisher Scientific) that was custom designed for construction of yeast synthetic chromosomes (unpublished). Gibson Assembly Gibson-assembly reactions were performed according to manufacturer’s (NEB) protocols. Sanger sequencing allowed verification of all DNA constructs and gel-extracted PCR products (Azenta Life Sciences). Plasmidsaurus (SNPsaurus) performed full-length sequencing of plasmids. All DNA constructs sequences are provided in the attached sequence listing. TransformationsRubidium chloride-preparation of chemically competent TOP10 E. coli cells (Thermo FisherScientific), and their heat-shock transformations with DNA, was conducted according tostandard protocols (Sambrook J., 2001). Transformed E. coli cells were selected on LB agarmedium with an appropriate antibiotic. Transformations by electroporation of K. phaffii cellswith precursor plasmids were performed according to a modification of a published protocol(Wu and Letchworth 2004). Briefly, 1-10 µg of DNA in 10 µL were added to 90 µL of pretreatedcompetent K. phaffii cells prior to electroporation, and the volume adjusted to 1.0 mL with yeast extract peptone dextrose (YPD) medium containing 1.0 M sorbitol (YPDS). Following recovery (four hours, 30 °C), cells were spread on YPDS agar plates with a suitable antibiotic and incubated (30 °C) for between two and (exceptionally) five days. Single colonies were then transferred to fresh YPD agar plates in preparation for PCR-based genotype screening. Finally, verified strains were grown on YPD medium ahead of the next experimental step or for deep-freeze storage in glycerol. Cell culturesCultures of E. coli were performed (30 °C) on LB medium supplemented with antibiotic at 50µg / mL in the cases of zeocin and ampicillin or 100 µg / mL for hygromycin. Plasmid- and DNA-gel extractions were done with kits (Qiagen) as per manufacturer’s protocols. Yeast cells were cultivated on yeast extract, peptone with a carbon source that depended on the desired outcome (glucose for propagation; glycerol or methanol for induction). This was supplemented with 0.3 mg / mL zeocin or hygromycin. Yeast genomic DNA extraction Extraction of genomic DNA (gDNA) from K. phaffii cells was carried out according to a protocolsupplied with the Epicentre MasterPure Yeast DNA-Purification Kit from BioresearchTechnologies, but modified by inclusion of an additional RNase A treatment and a purificationstep using Zymo-Spin III columns (Zymo-Research). Purity of gDNA was assessed usingeither a Denovix DS-11 spectrophotometer or the Qubit 3 fluorometer (Thermo Fisher Scientific) and dsDNA Broad Range Assay Kit (Thermo Fisher Scientific). PCR-based genotyping of K. phaffii strainsYeast-colony PCR was performed using green GoTaq Master Mix (Promega) as per themanufacturer’s protocol and employing oligos (Table 1) as forward and reverse primers to target appropriate regions of nanochromosomes or their precursors. The sizes of the resulting amplicons were confirmed on agarose gels.qPCR for gene-copy number estimationEstimates of gene-copy number were obtained using qPCR reactions, and according to theLuna Universal qPCR Master Mix protocol (NEB). Reaction volumes of 10 µL, in 96-well plates,were analysed using the StepOnePlus real-time PCR System (Thermo Fisher Scientific). Values for CTwere inferred from two biological repeats with three technical duplicates, and calculated using StepOnePlus software. gene-copy number values were inferred bycomparisons with two “housekeeping” genes, ACT1 and PDH-PDA, assumed to be single-copy. Chromosome-loss assaysA protocol similar to one reported previously (Fernius and Marston 2009) enabledquantification of nanochromosome loss over multiple mitotic events. Briefly, K. phaffii cells with the nanochromosome were initially inoculated into rich media containing the appropriateantimicrobial and incubated (30 °C) overnight in a shaking incubator. Cells were thentransferred to a medium [1% w / v yeast extract (Sigma-Aldrich), 2% w / v peptone (Sigma- Aldrich), 0.7% w / v yeast nitrogen base without amino acids (Formedium Ltd) with 2% v / v glycerol and 1% v / v methanol], to emulate inducible recombinant protein production, with no antibiotic, and incubated (30 °C) for at least ten cell divisions. Then triplicate aliquots (500-600 cells) were spread on agar plates with or without antibiotic. Retention of AMR was equatedto retention of the nanochromosome (on which the AMR gene had been delivered into thecell). Hence the numbers of colonies growing on the two plates were counted and compared.Note that this assay does not distinguish between scenarios in which (i) the AMR generemains on the nanochromosome versus (ii) its integration into the native genome.Whole-genome sequencing Illumina NextSeq (Novogene) performed WGS to generate “short” 150-nucleotide paired-end reads. Samples of gDNA were prepared as above. WGS-library preparation, and bioinformatic analysis, were performed by Novogene. The Integrative Genome Viewer 2.12.2 software (Broad Institute) was used for visualization, in Genome Browser, of mapped WGS data. Alternatively, BigWigs-formatted files were created from bedGraph files. Coverage plots were generated with custom R scripts based on data extracted from BAM files. Values were normalized to the mean in order to visualize relative coverage. To smoothen graphs a moving- window average function was deployed with a window of 2.5 kb and a step size of 200 bp.For longer reads, WGS was performed using a MinION Mk1B device (Oxford NanoporeTechnologies). Briefly, gDNA was obtained using the NucleoBond HMW DNA kit (Macherey-Nagel) as per manufacturer’s guidelines, using lyticase (Sigma) for cell lysis and incubated(one hour, 37 °C) in Y1 buffer (1.0 M sorbitol, 100 mM EDTA, pH 8.0, 14 mM ^-mercaptoethanol). DNA quality and concentration were assessed using a Qubit 3 Fluorimeter.Library preparation for Nanopore sequencing was performed using the Ligation SequencingKit SQK-LSK109 with Native Barcoding Kits EXP-NDB104 and EXP-NDB114 for multiplexing(Oxford Nanopore Technologies). Kits were used according to the manufacturer’s guidelines,except that DNA shearing was not applied and hence input DNA was increased fivefold tomatch the molarity expected in the protocol. Sequencing on the MinION Mk1B used MinIONFlow Cells [FLO-MIN111 (R10)] or Flongle Cells [FLO-FLG001 (R9.4.1)]. Base calling wasperformed using Guppy [version:6.0.1+652ffd179] and reads mapped against the referenceusing minimap2 [version: 2.17-r941]. Canu [version: 2.2] was used for de novo assembly. Anoverview of de novo assembly sequenced strains may be found in Table 3 and sequencesbelow. Small-scale protein production Cell culture for small-scale tests of recombinant protein production was performed asdescribed (Kerr, Herbert et al., 2021). To assess production of GFP:FH, samples were takenfrom the culture medium, after spinning out cells, and Endo Hf-treated to trim back yeast N- glycans. Then SDS-PAGE loading buffer was added and gel electrophoresis performed under reducing, denaturing conditions using 4-12% w / v Bis-Tris NuPAGE gels (Thermo Fisher Scientific) with Coomassie Blue staining. Bands of appropriate size were verified by Western blot (electrophoretic wet transfer performed on nitrocellulose membranes, in Tris-CAPS buffer using, the BioRad Mini-PROTEAN system) with anti-GFP primary antibody (Abcam, ab38689) and IRDye 800CW donkey anti-mouse IgG as a secondary (Li-COR Biosciences). Samples of secreted mFH were similarly prepared and analysed, but gel bands were identified by reference to a sample of human plasma-derived FH (Complement Technologies). To identifyrecombinant His-tagged PDI, cell pellets were lysed in SDS-PAGE-loading prior to gelelectrophoresis. Bands were verified by Western blot, using anti-His tag monoclonal Ab, H1029 (Scientific Labs) as a primary, and IRDye 800CW as a secondary antibody. Signal was detected on the Odyssey CLx Imaging System (Li-COR Biosciences). Assay of FH cofactor activity Recombinant mFH was assayed for its activity as a cofactor for cleavage of the human C3b α-chain by human FI. The 21-µL reaction volume contained 1.7 µM C3b, 14 nM FI (Complement Technology) in PBS buffer, pH 7.0, and various volumes of culture medium. The reaction mixture was incubated (one hour, 37 °C), before addition of SDS-PAGE loading buffer. After boiling (five minutes), electrophoresis was performed on NuPAGE (4-12%) gelsand stained with Coomassie Brilliant Blue G250. Densitometry values inferred using ImageLab software (Bio-Rad). Plasma-derived human FH, at 10-80 nM, served as positive control and for calibration. The construction of parts Note that all DNA parts used for assembly of nanochromosome precursors are free of restriction sites for SalI and / or XhoI (needed to produce compatible cohesive ends), as wellas AsiSI, BsaI and / or BsmBI (used in Golden Gate-like assembly). Oligonucleotides (oligos,see Table 1). Plasmids are listed in Table 2. Selected plasmids were sequenced; DNA sequences are provided below.To create the centromere part (CEN3), a DNA sequence corresponding to the centromere ofK. phaffii Chr 3 was generated initially as two segments, in separate PCRs, using K. phaffiigenomic DNA as a template. The 3.2-kb segment 1 was amplified (oligos 197 / 198) and ligatedbetween pUC19 KpnI and EcoRI sites, generating plasmid eDA10. The 3.1-kb segment 2 wasamplified (oligos 199 / 200) and ligated into eDA10 between EcoRI and NdeI sites. This generated plasmid eDA24 carrying the 6.3-kb CEN3.Based on previous reports, two K. phaffii ARSs ( Sturmberger, Chappell et al., 2016) (Love,Shah et al., 2016) were eventually selected to serve as origins of replication, one pernanochromosome arm. A 233-bp DNA segment corresponding to PARS-A76 was PCR-amplified from K. phaffii gDNA (oligos 217 / 218) and inserted into the BamHI site of pUC19creating eDA26. Separately, a 530-bp molecule equating to PARS-B413 was likewise PCRamplified (oligos 238 / 239) and inserted into pUC19 yielding eDA41. Expression cassettes for AMR selection-marker were amplified from commercial vectors. ZeoR, between PTEF1 and TCYC1, was PCR-amplified from pGS-GnT-I (oligos 308 / 309), digested with SalI and BamHI and inserted into SalI / BamHI-linearized eDA26, creating eDA40. HygR, between PTEF1 and TTEF1, was amplified from pGS-GnT-II (oligos 306 / 307),digested with SalI and BamH1 and inserted into SalI / BamH1-linearised eDA26 yieldingeDA37.The telomeres part (Tel) comprises an 18-bp I-SceI-cleavage site flanked by arrays of 16inverted telomere repeats (Love, Shah et al., 2016). To construct it, two pairs of complementary oligos were annealed separately: (i) Oligo 246 (127-nt) with oligo 247 (120-nt); (ii) oligo 248 (121-nt) with oligo 249 (128-nt). In each case, oligos (100 µM) were incubated(30 minutes, 37 °C) with five units of T4 polynucleotide kinase in T4 polynucleotide kinasebuffer supplemented with 2.5 mM ATP. Then, NaCl was added to 50 mM and the mixture heated (300 s, 95 °C), then cooled to room temperature. The oligos were designed so that annealing would yield two ds-DNA molecules with mutually complementary overhangs that,upon ligation, form the Tel with overhangs at its distal ends compatible with PvuI. Thus,products of processes (i) and (ii), together with PvuI-linearized eDA40 (deleting its AmpR gene)were ligated (T4 ligase) to yield eDA131. After transformation of E. coli with eDA131, zeocin(50 µg / mL)-resistant, ampicillin (100 µg / mL)-sensitive cells were verified (colony PCR, not shown), and eDA131 confirmed (by Sanger sequencing) as the Tel-donor plasmid from whicha blunt-ended Tel could be excised by FspI / PvuII for insertion into nanochromosome precursorplasmids. Codon-optimised for K. phaffii genes encoding fluorescent proteins were delivered in plasmids pM-GFP and pM-mCH (Thermo Fisher Scientific). Constitutive expression cassettes for GFP and mCherry (mCH) were PCR-amplified (oligos 302a / 303a, targeting PTEF1 and TCYC1), and overhangs released after BsmBI digestion. The products were ligated into plasmid eDA40, replacing the ZeoRgene between PTEF1 and TCYC1. The resultant plasmids (eDA189 for GFP and eDA191 for mCH) were used to transform E. coli. Cells were selected on LB plates with ampicillin.To prepare the PDI (coding for His-tagged protein disulfide isomerase) component, apreviously synthesised K. phaffii-codon optimized K. phaffii PDI gene was re-amplified (oligos447 / 448) from the in-house plasmid pPIC3.5K-PDI (Kerr, Herbert et al.2021). The primer 448 introduces six His-codons followed by the TAA stop-codon. After excision with NotI and MfeI, the 1.64-kb DNA (PDIH) fragment was cloned into NotI and MfeI-digested pPICZ A (between PAOX1 and TAOX1) forming plasmid eDA226. A gene cassette (PAOX1)GFP:CFH(TAOX1) for the GFP:FH fusion protein was prepared asfollows: PCR-amplified GFP (from pM-GFP using oligos 276 / 277), digested with NsiI wasinserted into PstI (NsiI- and PstI-recognition sites are compatible)-linearized pPICZα “B-cFH”plasmid prepared previously (Schmidt, Slingsby et al., 2011) forming eDA89. The DNAsequence for a flexible seven-amino acids linker (GGGGSNA) between fusion partners was delivered by oligo 277. Assembly of arrays Integration (receptor) and insertion (donor) arrays contain LHRs alternating with gene- expression cassettes. Examples include LHRn-GoI-AMR-LHRZand LHRn-GoI-LHRm-AMR-LHRZ, wherein (as described above): LHRs are unique sequences from a library, LHRsA-Z; GoIcontains a gene plus promoter and terminator regions; and AMR is HygR or ZeoR (with its ownpromoter and terminator).Arrays were built from the following pre-prepared components: (i) one or two different LHRs(other than LHRZ); (ii) the GoIs; and (iii) (common to all arrays) either HygR-LHRZ or ZeoR-LHRZ tandem pairs. These components were prepared as follows. (i) LHRs were amplifiedfrom source plasmids e.g. 0.87-kb LHRE from eDA9, and amplicons digested with BsmBI orBsaI to release overhangs. (ii) Synthetic GoIs were amplified from their delivery plasmid, thendigested with restriction enzymes before insertion into pUC19. (iiia) For the ZeoR-LHRZtandem pair, LHRZwas amplified by PCR from eDA8 and inserted into pUC19, to generate eDA101. The ZeoRwas PCR-amplified from eDA40 for adjacent insertion into eDA101, to create eDA105. The resultant ZeoR-LHRZconstruct was re-amplified and digested with BsmBI.(iiib) To make the HygR-LHRZ pair, LHRZ was generated by PCR and inserted into pUC19,yielding eDA99. The HygRcassette was PCR-amplified from eDA37 for insertion into eDA99 to create eDA103. An unwanted AsiSI-recognition site in HygRwas modified by site-directed mutagenesis to generate the AsiSI-null plasmid eDA115. Then HygR-LHRZwas re-amplified and digested for subsequent assembly steps.The integration array carrying constitutively expressed GFP and ZeoR, i.e. LHRE-(PTEF1)GFP(TCYC1)-ZeoR-LHRZ, was assembled by ligation of LHRE, a GFP-expressioncassette from eDA189, and ZeoR-LHRZ pair from eDA105. Assembly was instigated by ligatingLHREwith GFP. The gel-extracted (LHRE-GFP) product and the ZeoR-LHRZpair were then ligated tandemly into pUC19 forming eDA197.Insertion array LHRE-(PTEF)mCH(TCYC1)-HygR-LHRZ - carrying mCH paired with HygR - wasassembled, by ligation, from LHRE, the mCH-expression cassettes from eDA191, and the HygR-LHRZpair from eDA103. LHREwas first ligated with the mCH-expression cassettesforming LHRE-mCH, which was gel extracted. Then LHRE-mCH plus HygR-LHRZ were ligatedinto pUC19 forming eDA199. A longer array, LHRA-PDIH-LHRE-HygR-LHRZwas assembled from: LHRA; PDIH(encoding His- tagged K. phaffii PDI under PAOX1); LHRE; and HygR-LHRZ. First LHRA-(PAOX1)PDIH(TAOX1) and LHRE-HygR-LHRZwere prepared by pairwise ligations and gel purification. Then the two ligated parts were inserted, sequentially, into pUC19 forming eDA227.Another triple-LHR array LHRE-GFP:FH-LHRD-ZeoR-LHRZ was formed from: LHRE; anexpression cassette (PAOX1)GFP:FH(TAOX1) encoding GFP:FH (see above) amplified fromeDA89; LHRDamplified from eDA9 and suitably digested; and ZeoR-LHRZprepared as above.In two separate reactions, LHRE was ligated to GFP:FH and LHRD was ligated with ZeoR-LHRZ. Subsequently, gel-purified products, i.e. LHRE-GFP:FH and LHRD-ZeoR-LHRZ, werefurther ligated into pUC19 forming eDA250. Array LHRD-(PTEF)mCH(TCYC1)-LHRF-HygR-LHRZwas formed from: LHRD; the mCH- expression cassettes originated from eDA191; LHRFwas amplified from eDA9 and suitably digested; and HygR-LHRZwas prepared as above. In two separate reactions, LHRDwas ligatedto mCh and LHRF was ligated with HygR-LHRZ. Subsequently, gel-purified products, i.e.LHRDE-mCh and LHRF-HygR-LHRZ, were further ligated into pUC19 forming eDA283.Array LHRE- (PAOX1)iLOV(TAOX1)-ZeoR-LHRZ was formed from ligation of LHRE-(PAOX1)iLOV(TAOX1) and ZeoR-LHRZ (described as above). In the first round, LHRE-(PAOX1)iLOV(TAOX1) was ligated from two PCR products: LHRE, derived from eDA9 in a PCRreaction with oligos 335 / 338; and (PAOX1)iLOV(TAOX1) amplified from eDA209 using oligos302 / 349. Both PCR products, digested with BsmBI, and purified as described above,,wereutilised to make the final ligated product LHRE- (PAOX1)iLOV(TAOX1)-ZeoR-LHRZ in pUC19vector. Assembly of parts into framework and precursor plasmids A circular, telomere-null, framework plasmid (eDA53, 10.5-kb) was constructed by Gibsonassembly from: (i) a 1.46-kb part corresponding to ZeoR that was PCR amplified (oligos253 / 254) using eDA40 as a template; (ii) a 0.57-kb PARS-76 part that was generated by PCR(oligos 255 / 256) from eDA26; and (iii) the 8.63-kb centromeric plasmid eDA24 linearized bySmaI / PvuII. We initially engineered into eDA53 an integration array consisting of LHRA-I-SceI-ZeoR-LHRZwhere I-SceI (encoding the meganuclease, I-SceI) was under control of PAOX1. This initialintegration array was not pre-assembled in the same way as the arrays described above, but was introduced in the following steps that converted eDA53 into 14.5-kb eDA83. (i) PvuII-linearized eDA53 was ligated with PCR-generated 0.8-kb LHRA(from eDA8 template, oligos 264 / 273) carrying PvuII restriction site yielding 11.3-kb eDA71, which was BsmBI- linearized creating -CCCT and -CGCG overhangs on antisense and sense strands, respectively.(ii) An I-SceI-expression cassette was made by amplifying the I-SceI gene from plasmideDA22 (oligos 223 / 224, carrying EcoRI and SacII sites), and inserting it into EcoRI / SacII- linearized pPICZα B forming eDA27. Then, using eDA27 as a template, a 2.2-kb (PAOX1)I- SceI(TAOX1) cassette was PCR-amplified (oligos 267 / 268) and BsmBI-digested, creating – GGGA and –CCAA overhangs on sense and antisense strands, respectively.(iii) A 0.95-kb LHRZ part was PCR-generated from eDA9 (oligos 269 / 270) and BsmBI -digested, creating –GGTT and –GCGC overhangs on sense and antisense strands, respectively.(iv) Purified BsmBI-digested PCR products from steps (ii) and (iii) were ligated, using T7 DNAligase, with gel-purified, linearized, eDA71 from step (i). After E. coli transformation, theproduct (eDA83) was verified by restriction-enzyme digestion and DNA sequencing. The next step would have been to introduce a pair of proto-telomeres into eDA83. With this inmind, a blunt-ended 0.46-kb DNA segment containing the telomeres part (Tel) was gel-purifiedfrom PvuII / FspI-digested eDA131. Tel was then ligated with FspI-linearised eDA83 (therebydeleting a blaRgene in eDA83). However, the ligation product was consistently lost when attempting propagation in E. coli. Creation of nanochromosomesThe PAOX1 (in addition to ~50-bp of the I-SceI open reading frame) in eDA83 was replaced withthe bacterial kanamycin-resistance (KanR) cassette to create 14.5-kb eDA110, containing the modified integration array we called LHRA-KanR(ΔI-SceI)-ZeoR-LHRZ. To achieve this, the 13.5-kb SphI-digested and gel-extracted eDA83 was ligated with a 980-bp PCR-amplified KanR(using oligos 321 / 322 and vector pUC57-Kan (Addgene) as a template). Followingextraction from kanamycin-resistant E. coli cells, plasmid eDA110 was verified by Sangersequencing. A blunt-ended 0.46-kb DNA segment containing the Tel was gel-purified fromPvuII / FspI-digested eDA131, as before, but this time it was ligated with FspI-linearisedeDA110 to yield 14.9-kb eDA137. Plasmid eDA137, verified by Sanger sequencing, was re-amplified in E. coli cells, linearized in vitro by I-SceI and used to transform K. phaffii (wild type).Transformants were selected on YPDS plates with 0.3 mg / ml zeocin.The plasmid eDA110 was extended by tandem insertion of (i) a second ARS - the 529-bp K.phaffii ARS-B413 - and (ii) an extended (1.3-kb) non-coding spacer segment of DNA (ncDNA),as follows (See Fig 3). PARS-B413 was generated by PCR (oligos 238 / 239) from gDNA, and BamHI-digested then ligated into the multi-cloning site of pUC19 forming eDA41. Meanwhile,ncDNA was amplified (oligos 379 / 380) from eDA9 and then NdeI / EcoRI-digested for insertionimmediately downstream of PARS-B413 in eDA41, generating intermediate plasmid eDA144.Subsequently, the combined 1.9-kb ARS-B413-ncDNA part was amplified from eDA144(oligos 379 / 381), digested by NdeI, and inserted into the NdeI site of eDA110, yielding eDA146(16.8 kb). The Tel was inserted into FspI-linearized eDA146, generating eDA155. PlasmideDA155, verified by Sanger sequencing, was propagated in E. coli and then isolated andlinearised with I-SceI in vitro. The linear product was used to transform K. phaffii strainCBS7435 using zeocin for selection. The modified integration array (LHRA-KanR(ΔI-SceI)-ZeoR-LHRZ) of eDA155 was excised with PvuI and SalI, releasing 5’-blunt and 3’-SalI / XhoI compatible ends. Subsequently, the PCR-amplified integration arrays (i) 4.5-kb LHRE-GFP-ZeoR-LHRZ (from template eDA197 witholigos 397 / 409), or (ii) 7.3-kb LHRA-(PAOX1)PDIH(TAOX1)-LHRE-HygR-LHRZ (from templateeDA227 with oligos 384 / 409), were digested with AfeI and XhoI / SalI, then ligated with thePvuI / SalI-treated eDA155. The products ((i) eDA201 or (ii) eDA229) were used to transformE. coli cells. Following sequence verification, these nanochromosome-precursor plasmidswere linearized in vitro by I-SceI and the products used to transform K. phaffii cells, withselection on YPDS plates with 0.3 mg / mL hygromycin or zeocin. Proofs of principle(i) The insertion array LHRE-(PTEF)mCH(TCYC1)-HygR-LHRZ was amplified by PCR (oligos409 / 397) from eDA199, and used to transform K. phaffii cells (creating yDA177 on the CBS7435 background, or yDA218 on the CBS7435::ΔKU70 background) already carryingnChr 2B (i.e. linearised eDA201). The aim here was to replace GFP-ZeoR (in LHRE-GFP-ZeoR-LHRZ) with mCH-HygR.(ii) The insertion array LHRE-(PTEF)GFP(TCYC1)-ZeoR-LHRZ was amplified by PCR (oligos397 / 409) from eDA197 and used to transform K. phaffii cells (strains CBS7435 (to createyDA232) and CBS7435::ΔKU70 (to create yDA253) carrying nChr 2A (i.e. linearised eDA229).In this case the aim was to replace HygR(in LHRA-(PAOX1)PDIH(TAOX1)-LHRE-HygR-LHRZ) with GFP-ZeoR.Transformed cells (strains yDA218 and yDA253 for (i) and (ii), respectively) were selected onYPDS plates containing 0.3 mg / ml zeocin or 0.3 mg / ml hygromycin. Thus, efficiency of gene replacement was estimated from the number of colonies that were fluorescent protein- producing, and resistant or sensitive to the expected antimicrobial. To test our “inch-worming” strategy for gene insertion and landing zone extension, LHRE- GFP:FH-LHRD-ZeoR-LHRZwas excised from eDA250 using AsiSI. Following concentration byisopropanol precipitation, the array was used to transform K. phaffii cells containing nChr 2Aso as to replace HygR(in LHRA-(PAOX1)PDIH(TAOX1)-LHRE-HygR-LHRZ) with GFP:FH-LHRD- ZeoR. Transformed cells were selected on YPDS plates with zeocin. Gene integration / replacement efficiency was estimated from the number of colonies that were green-fluorescent, zeocin-resistant, and hygromycin-sensitive. LIST of ABBREVIATIONSAb – antibody; AmpR - β-Lactamase (bla) resistance cassette; AMR – antimicrobial resistance;ARS – autonomously replicating sequence; CEN3 – the centromere of (native) Chr 3 thatdoubles as the centromere part of all nanochromosomes; DSB – double-strand break; FI –complement factor I; eDA(x) –plasmids created for this study; gDNA – genomic DNA; GFP –green fluorescent protein; GFP:FH – A GFP-human complement factor H fusion protein; GoI– gene of interest plus promoter and terminator; HR – homologous recombination; FH or mFH- human or murine complement factor H; HygR - hygromycin resistance, hph gene; KanR –kanamycin resistance, neo gene; LHRs – long homologous recombination-promoting regions;mCH – mCherry; nCHr 1 etc – nanochromosome 1 etc; NHEJ – non-homologous end joining;ncDNA – non-coding DNA used as neutral spacer; nt – nucleotides; oligos –oligonucleotides;PDI - protein disulfide isomerase; PNK - polynucleotide kinase; PTMs – posttranslationalmodifications; Tel – telomeres part; v1, v2 etc – version 1, 2 etc of precursor plasmids; WGS– whole-genome screening; yDA(x) – K. phaffii strains created in this study; YPD – yeastextract peptone dextrose; YPDS - YPD-sorbitol; ZeoR – zeocin resistance, ble gene.Tables ContentsTable 1 List of oligonucleotides used in this studyTable 2 List of plasmids used in this studyTable 3 List of K. phaffii strains referred to in the current workTable 4 List of insertion and integration arraysTable 5 Results of (nano)chromosome-loss assays.Table 6 Estimation of gene-copy number: (A) Validation of primers sets for qPCR assays;(B) Values of CTand gene-copy numbers

[0002] Table 1 List of oligonucleotides used in this study Table 2 List of plasmids used in this study

[0003] Table 3 List of K. phaffii strains referred to in the current work

[0004] Table 4 List of insertion and integration arrays Table 5 Results of nanochromosome-loss assays performed for various strains * Transformed cells were cultured for at least ten generations in the absence of any selection, then an assay based on counting colonies on agar plates was performed to assess retention of antibiotic-resistance. The values listed here were calculated from the total number of colonies counted growing on antibiotic-resistance selection medium, divided by the number of colonies counted growing on antibiotic- resistance non-selection medium. At least three biological replicates were performed for each strain. Standard deviations are illustrated by bars.Table 6A Validation of primers sets for qPCR assays. Slope andefficiency (%) values calculated from sample dilution using StepOnePlus software (Thermo Fisher) 1– gene codon optimized Table 6(B) Estimated GCN (normalised to GCN for ACT1 = 1) Average CT(cycle threshold) values were assayed from two biological sample repeats in three technical replicates. GCNs were calculated by normalizing CT values separately with respect to the housekeeping gene ACT1. PDHPDA is an additional control; both ACT1 andPDHPDA are assumed to be present as single copies. The HPH gene encodes hygromycin Bphosphotransferase.

[0005] RESULTS Outline of the design and construction phase Our goal was a stripped-down K. phaffii “nano”chromosome consisting only of a dedicated gene-landing zone plus those components essential for survival within the nucleus, for efficient and accurate duplication, and for reliable mitotic segregation. As reported below, we first ligated a K. phaffii autonomously replicating sequence (ARS) and a centromere part, along with an AMR gene, into pUC19 to create a framework plasmid (Figure 1a). We added an initial version of the gene-landing zone and a proto-telomeres part, creating a nanochromosome- precursor plasmid. This was linearised by cleavage between the future telomeres, creating nanochromosome 1 (nChr 1) (Figure 1b) that we used to transform K. phaffii cells.Subsequently we had to redesign our precursor plasmids (Figure 1a) to improvenanochromosome stability, and switch to an NHEJ-deficient host strain of K. phaffii. In parallel, we established an assembly line for arrays of DNA segments (herein called integration andinsertion arrays) designed to facilitate in vivo engineering of nanochromosomes throughdouble-crossover HR. A centromeric, ARS-containing framework plasmidWe selected DNA corresponding to the centromere of K. phaffii Chr 3 as the nanochromosomecentromere (henceforth, CEN3). When creating the EcoRI-cleavage site, an additionalnucleotide, G, was introduced in the CEN3 core region (Figure 2a and 8). This subsequentlyaided distinction between the native centromere and (nanochromosomal) CEN3 whenanalysing WGS results. Two segments were generated by PCR, from K. phaffii genomic(g)DNA, prior to combination by sequential cloning to create CEN3 in plasmid pUC19, yieldingplasmid eDA24 (Figure 2a). We selected DNA corresponding to PARS-A76 on K. phaffii Chr1 (Liachko, Youngblood et al., 2014) to supply a yeast origin of replication, and inserted thisinto pUC19 creating eDA26. We amplified zeocin- (ZeoR, ble) and hygromycin-resistance(HygR, hph) genes from commercial plasmids and inserted them into eDA26, forming eDA40 (ZeoR) and eDA37 (HygR). Gibson assembly of the following yielded the centromeric ARS-containing 10.5-kb framework plasmid, eDA53 (Figure 2b): (i) a 1.4-kb ZeoR part; (ii) 0.51-kbARS-76; and (iii) the linearized, 8.85-kb, centromeric, plasmid eDA24 that thereby contributesCEN3, some pUC19-derived scaffolding DNA, a bacterial origin of replication and an ampicillin resistance (AmpR, bla) gene. Construction of the telomeres part (Tel)We used a “telomerator”-inspired approach (Mitchell and Boeke 2014) entailing insertion intothe framework plasmid of a DNA sequence, which we called the telomeres part (Tel), comprised of proto-telomeres flanking a restriction site. In our case, two sets of 16 invertedtelomere-repeats bracketed an I-SceI-cleavage site (Figure 2c and Figure 10). Thus I-SceIcan linearise the DNA molecule, yielding telomeres at either end. We constructed Tel byannealing each of two pairs of similar-length synthetic oligos, to form its 5’- and 3’-halves withcomplementary overhangs. The two halves were tandemly ligated into eDA40, forming eDA131 (Figure 2c). An assembly line for integration and insertion arrays We built insertion arrays (donors) and integration arrays (acceptors) to allow precise nanochromosome engineering in K. phaffii cells. Each array includes HygRor ZeoRandfeatures genes-of-interest (GoIs) flanked by LHRs. GoIs are expression cassettes containinga gene plus its promoter and terminator regions. LHRA, LHRB etc. are unique sequences of~1000 bp from a library (LHRsA-Z), with LHRZ reserved for the terminus / closing of each array.Thus, it should be possible to (for example) swap HygR within the nanochromosome-residentintegration array LHRA-GoI1-LHRE-HygR-LHRZfor GoI2-LHRD-ZeoRby transforming cells with insertion array LHRE-GoI2-LHRD-ZeoR-LHRZ(Figure 12). Subsequently, ZeoRwould be available for exchange with GoI3-LHRE-HygR, and so forth. Theoretically, repeated cycles of this “inch-worming” process would generate a string of evenly spaced genes (and their regulatory sequences). Recycling of a single pair of selection markers (HygRand ZeoR) is inherent to this strategy. The following parts were deployed in ligase-assisted directional assembly of arrays within digested pUC19 (Figure 12): LHRsA-Z; synthetic codon-optimised GoIs; and HygRor ZeoRfused to LHRZ. The assembled arrays were: (i) PCR-amplified using primers carrying 5’-blunt-end and 3’-SalI / XhoI restriction-enzyme sites to create integration arrays; or (ii) digested withAsiSI or FspI for insertion arrays. Introduction of the initial gene-landing zone into the precursor plasmidWe introduced into our CEN3- and ARS-containing framework plasmid (eDA53) an initialintegration array, LHRA-ZeoR-(PAOX1)I-SceI(TAOX1)-LHRZ. The gene I-SceI encodes arestriction enzyme that recognises the cleavage site (Fernandez-Martinez and Bibb, 2014) located between proto-telomeres within Tel. Thus we anticipated that a future plasmidcontaining both I-SceI and Tel would self-linearise in vivo after I-SceI induction. This one-offintegration array (unlike those used subsequently) was not preassembled, but was introducedstepwise by: (i) inserting LHRA into eDA53 (yielding eDA71); (ii) constructing (PAOX1)I-SceI(TAOX1) in pPICZ^ B and amplifying by PCR; (iii) amplifying LHRZ by PCR; and (iv) ligatingthe purified, BsmBI-digested products from step (ii) and (iii) with BsmBI-linearized, gel-purified,eDA71, yielding eDA83 (Figure 3a).A prototype nanochromosomeWe aimed to make a nanochromosome-precursor plasmid by excising Tel from eDA131 andinserting it into eDA83’s AmpRsite. Disappointingly, the ligation product was unstable in E.coli due to leaky (PAOX1)I-SceI expression. We abandoned in vivo plasmid linearization infavour of in vitro linearization by I-SceI, while opting to salvage our initial integration array. Tothis end, we replaced, in eDA83, PAOX1 and part of the I-SceI ORF, with a bacterial KanRexpression cassette, yielding eDA110 containing the array: LHRA-ZeoR-KanR(ΔI-SceI)-LHRZ.We inserted Tel into eDA110, deleting AmpR and yielding I-SceI-cleavable eDA137 (Figure3b). Unlike eDA83, eDA137 (with I-SceI effectively deleted) could be propagated in E. coli.We called this nanochromosome-precursor plasmid version 1 (precursor v1). We transformed wild-type K. phaffii cells with I-SceI-linearized precursor v1 creating our prototype nanochromosome (nChr 1). We re-plated colonies that grew on zeocin, and based on colony-PCR, selected yDA122 for liquid culture in the presence of zeocin and used it to make a glycerol stock. We took cells from the stock and cultured them, to assay zeocin resistance after about ten generations on zeocin-free media, providing an indication of nChr 1 mitotic stability. Nine out of ten cells remained zeocin-resistant (Table 5). For a more direct test of nChr 1 integrity, we submitted yDA122 cells, recovered from glycerol stock and culturedovernight, for WGS. Analysis by de novo assembly and visualization (Thorvaldsdottir,Robinson et al., 2013) revealed that nChr 1 had undergone a substantial, rearrangement(Figure 3c and Figure 15) entailing fusion of the p-arm of nChr 1 with a copy of the Chr 3 ~34- kb p-arm. While this conflicted with the PCR-based genotyping performed shortly after transformation, it agreed with PCR-based genotyping of yDA122 after multiple generations with no antimicrobial selection (Figure 3c). Instability of nChr 1 was likewise evident from WGS of two other colonies, similarly prepared. Extension of backbone failed to improve integrity We wondered whether the telomere-to-centromere proximity within the p-arm of nChr 1 mightimpair maintenance, or promote chromosomal aberrations (Stimpson, Matheny et al.. 2012).We also conjectured that a second ARS might expedite duplication and / or segregation(Sturmberger, Chappell et al., 2016). To address these possibilities, we reverted to eDA110and inserted K. phaffii PARS-B413 (Liachko, Youngblood et al.. 2014) in tandem with some(1.3-kb) ncDNA, into the future p-arm of the precursor plasmid to yield eDA146 (Figure 4a).The AT-rich PARS-B413 is less efficient than the GC-rich PARS-A76 already present in theq-arm. The resultant arrangement was designed to resemble (native) Chr 3 in which thecentromere is sandwiched between (stronger) GC-rich PARS-C2204 and (weaker) AT-richPARS-C2216 (Love, Shah et al., 2016). Into eDA146 we inserted Tel to create I-SceI-cleavable eDA155 (precursor v2) (Figure 4a,b). PCR mapping of linearized eDA155 (i.e. nChr2, Figure 4c) validated its integrity.Thus, we linearized precursor v2 / eDA155 in vitro and used the product, nChr 2, to transformK. phaffii cells. From colonies growing on zeocin, we picked yDA174 and yDA175.Chromosome-loss assays (Table 5) were promising and the integrity of nChr 2 in these strains was supported initially by superficial analysis of PCR-based genotyping. However, an unanticipated PCR amplicon was noted while subsequent WGS (Figure 5) and coverageanalysis revealed fused end-to-end, di- or tricentric DNA molecules, consistent with thisanomaly, in which telomere repeats occur exclusively at termini (Figure 4d). Switch to an NHEJ-deficient host strain While HR events could occur between telomeres, these should lead to elongation or shortening rather than fusion, provided that telomere length exceeds a threshold value(Lundblad and Blackburn, 1993). Given that HR repair is, in any case, inefficient in K. phaffii,we suspected that the observed end-to-end fusion of nanochromosomes in wild-type cells was a result of NHEJ. Multicentric nanochromosomes are regarded as unstable and, if not resolved, a source of further genomic abnormalities. Although, our multicentric entities appeared to persist over generations, they were deemed unsuitable as expression platforms. We therefore explored the use of a host strain in which NHEJ is impaired by KU70-knockout(Naatsaari, Mistlberger et al., 2012, Dalvie, Leal et al., 2020) (Figure 14a) but which remainedviable in cultures over multiple days at 30 °C (Figure 14b).Attempts to maintain nChr 1 in ΔKU70 cells proved no more successful than they had been inwild type, whereas nChr 2 appeared to be stable the NHEJ-compromised cells (Figure 15).We therefore focused on nChr2. To better compare nanochromosome engineering in wild-type vs ΔKU70 strains, we chose to create more useful, versatile versions. We thereforeexcised the integration array (LHRA-ZeoR-KanR(ΔI-SceI)-LHRZ) of precursor v2 and replacedit with either: (i) a triple-LHR integration array expressing a methanol-inducible PDI gene, andHygR, i.e. LHRA-PDIH-LHRE-HygR-LHRZ (for precursor v2A); or (ii) a double-LHR array carryingconstitutively expressed (PTEF1)GFP(TCYC1) paired with ZeoR, i.e. LHRE-GFP-ZeoR-LHRZ (forprecursor v2B) (Figure 6). The rationale for introducing the PDIHgene, encoding His-tagged protein disulfide isomerase (PDI), into the first array is explained below. We linearized precursor v2B (creating nChr 2B), and precursor v2A (creating nChr 2A), and transformedboth wild-type and ΔKU70 K. phaffii cells with the products. Colony PCRs (on freshlytransformed cells growing on agar plates) and chromosome-loss assays (Table 5) suggested initial stability of nChrs 2A and 2B in both strains. Subsequently, however, WGS and PCRgenotyping revealed that nChrs 2A and 2B were stable, longer term, in ΔKU70 strains(yDA253 and yDA218) (Figure 5, Figure 13 and Figure 16) but were unstable on the wild-type background. Moreover, after protracted cell culture, the wild-type background strains that initially passed PCR-based genotyping, failed (Figure 16) despite performing well in chromosome-loss assays, suggesting integration of the marker into the genome. The ability to engineer nanochromosomes depended on knocking out KU70 To exemplify nanochromosome engineering, we sought to replace GFP and ZeoRwithin theintegration array (LHRE-GFP-ZeoR-LHRZ) of nChr 2B, by mCH (codes for mCherry) and HygRdelivered to the cell within an insertion array. We thus transformed yDA177 (despite subsequently emerging evidence for low nChr stability on the wild-type background) andyDA218 (^KU70 background) with the array LHRE-mCH-HygR-LHRZ, aiming to create nChr2B.1 (Figure 17a), and we selected colonies (34 from the wild-type, and 16 from ^KU70strains, in two independent experiments) on hygromycin-agar plates. We screened these fora combination of hygromycin resistance / zeocin sensitivity, and for red fluorescence / lack of green fluorescence, and then by PCR genotyping (data not shown). A total of 15 of 16 colonieson the ΔKU70 background (including yDA226) were positively verified, but only 1 of 34colonies on the wild-type background, passed all tests. This is consistent with the subsequently analysed PCR genotyping results and WGS analysis (data not shown) foryDA177 showing that the nChr 2B had already been compromised by aberrant fusions (Figure16 and Figure 17 a). A qPCR analysis of yDA226 (ΔKU70) indicated one copy of nChr 2B.1 per cell (Table 6). In related proof-of-principle experiments we swapped HygRin LHRA-PDIH-LHRE-HygR-LHRZof nChr 2A - in yDA232 (wild-type) and yDA253 (ΔKU70) - for the tandem pair GFP-ZeoRwithin insertion array LHRE-GFP-ZeoR-LHRZ, aiming to produce nChr 2A.1 with an extended landing zone (Figure 17b). We obtained no positively verified colonies on the wild-type background but validated (zeocin-resistant / hygromycin-sensitive, GFP-producing) elevencolonies (Figure 17) for ΔKU70 strains (including yDA263). Subsequent WGS of yDA263confirmed integrity of nChr 2A.1 (Figure 13e) while qPCR was consistent with a single copy per cell (Table 6). Nanochromosomes support methanol-induced protein production We investigated the potential of a nanochromosome-resident chaperonin-coding gene to facilitate protein production from a methanol-inducible heterologous gene that was integrated (using classical techniques) into the native K. phaffii genome (Figure 6a). We had previouslyfound, in K. phaffii cell cultures, that overexpression of PDI as well as a gene (mFH) for murinecomplement factor H (mFH) (both of which were genome-integrated and under control ofPAOX1) was required for detectable levels of secretion of mFH, which has 40 disulfide bonds(Kerr, Herbert et al., 2021). Hence, we tested if (PAOX1)PDIH(TAOX1) on nChr 2A could enhancemFH production in a similar manner, which would require the nanochromosome to persist throughout both growth and induction phases of the culture. We created as a positive control,nanochromosome-null strain yDA264, in which both PDIH and mFH are integrated into thenative genome of the ^KU70 parental strain. For the experimental strain we took yDA250, inwhich only mFH had been integrated into the native genome, and transformed it with nChr 2Agenerating strain yDA260. Integrity and stability of nChr 2A in yDA260 and yDA250 was verified by PCR-based genotyping (Figure 18) and chromosome-loss assay (Table 5) and WGS (Figure 13c,d). We used yDA250 (expressing mFH at a low yield, without PDI support) as a negative control. Small-scale mFH-production tests were performed in baffled flasks, with methanol induction at day 3 (Figure 7b). As expected, Coomassie staining of SDS-PAGE gels revealed no mFH- candidate bands for yDA250, which lacks PDIH(Figure 7b). Conversely, a band for mFH was detected in the culture medium of mFH+strains providing its production is supported by PDIHand regardless of whether PDIHis carried within the genome (yDA264) or on nChr 2A (yDA260) (Figure 7b). The presence of His-tagged PDI in cultures of these strains was confirmed by Western blotting (Figure 7c). Note that qPCR assay showed single copies ofmFH and PDIH genes in both yDA260 and yDA264 strains (Table 6). The recombinant mFH,secreted into the yDA264 / yDA260 culture medium but not purified, is functionally active in an assay in which it acts as a cofactor for complement factor I (FI)-catalysed cleavage of the ^’- chain of the complement protein, C3b, generating cleavage products detectable on an SDS- PAGE gel (Figure. 7e). No cleavage products were obtained in the absence of FI or when testing pre-induction cultures. Importantly, WGS validated the stability of nChr 2A (Figure 13c,d), in cells even after the induction phase, as well as the presence of a single copy of the mFH-expression cassette integrated into the PAOX1site on (native) Chr 4, in agreement with qPCR. Demonstration of “inch-worming” for gene integration and protein production We excised the insertion array LHRE-GFP:FH-LHRD-ZeoR-LHRZ(from eDA250) that includesthe 4.4-kb GoI (pAOX1)GFP:FH. This GoI encodes a fusion protein in which green fluorescentprotein (GFP) is fused to the N-terminus of human complement factor H (FH). Like mFH, thisis a challenging protein to produce (Kerr, Herbert et al., 2021) recombinantly because itcontains 40 disulfides. We used this insertion array to transform strains yDA232 (wild-type)and yDA253 (ΔKU70), both containing nChr 2A carrying the integration array LHRA-PDIH-LHRE-HygR-LHRZ. Double-crossover HR should preserve PDIHbut promote insertion into nChr2A of GFP:FH as well as ZeoR (replacing HygR), yielding nChr 2A.2 (Figure 19). It should alsointroduce a new landing site between LHREand LHRZ. We selected for transformed cells with zeocin, and then screened for single colonies possessing dual zeocin resistance / hygromycin sensitivity. We then screened colonies using PCR-genotyping (Figure 19) and chromosome- loss assays (Table 5). No colonies were obtained on the wild-type background but in ΔKU70 strains, ten colonies passed screening (Figure 19). Two of these, yDA275 and yDA277 were submitted for WGS, and data analysis showed a stable, single copy of nChr 2A.2 (Figure 5 and Figure 13f,g), also confirmed by qPCR (Table 6). We cultured yDA275 and yDA277 in small-scale trials of methanol-induced GFP:FH production. Yields of protein (resolved, after treatment with EndoHf, on SDS-PAGE, and verified by Western blot) (Figure. 7d) werecomparable with those obtained previously from strains of K. phaffii where PDIH and FH wereintegrated into the native genome (data not shown). Moreover, the recombinant GFP:FH secreted into the yDA275 / 7 culture medium is functionally active in FI-cofactor assays (Figure 7e). Crucially, the newly created landing site in Chr 2A.2, between LHREand LHRZ, would be available for the next of what could be multiple rounds of sequential gene insertions and hence an “inchworming” mode of nanochromosome extension. Second round of “inchworming”Inherent to the potential advantages of a synthetic chromosome is its “landing pad”, a regiondesigned as a dedicated site for precise insertion of one or multiple genes spaced out evenly over a contiguous stretch of the chromosome. New genes can be inserted in an “inch-worm” fashion, whereby each insertion creates a new gene-reception site, and expands the landing pad. Each insertion relies on the nanochromosome remaining stable throughout and followingthe previous insertion (e.g. that it is not integrated into the native genome and retains a copynumber of one per cell). We have now undertaken a second sequential insertion in the same landing pad using the inchworm principle. Figure 21 is a schematic showing the two insertions, the first of which is described above. To achieve this second insertion a suitable insertion array (containing a gene of interest and anantimicrobial resistance selection marker, see Figure 21) was assembled in vitro and in E. coli cells. Figure 22 summarises the methods used to assemble the insertion array and Figure 23shows the results of validation processes that confirmed its sequence. K. phaffii cellscontaining the host nanochromosome (nChr 2A.2 – see Figure 1) were transformed with thelinearized insertion array (Figure 24), and transformants (i.e. cells that have an antimicrobial-resistance phenotype consistent with insertion of the array at the expected site) were selected on the basis of their resistance or susceptibility to the relevant antimicrobial agents. Selected colonies were validated by PCR (Figure 25) and whole-genome sequencing (WGS) (data not shown). These cells produced a fluorescent protein as expected (Figure 26). In summary these further experiments provide additional evidence that an extremely small(nano) chromosome of a suitable design may be introduced into K. phaffii cells where itpersists over multiple generations and is therefore suitable for genetic manipulations. By including a dedicated landing pad for genes in the nanochromosome, new genes can be inserted precisely and sequentially without any impact on the native genome. The new genes are transcribed and the encoded proteins are produced and are biologically functional. An additional landing pad An advantage of a synthetic chromosome is the opportunity to incorporate design features that will extend its potential capabilities, versatility and utility. Native chromosomes carry protein-coding genes along their length and in both arms, but the nanochromosome prototypes we have published to date rely on a single locus for gene expression. While it should be possible to sequentially insert multiple genes into the same landing pad this would mean that the centromere would become increasingly “acentric”. While there are many chromosomes with acentric centromeres in nature, all of them support at least some expression of gene from theirs shorter arm. We sought to make our nanochromosome morenative-like by adding a second gene-landing pad, on the other side of the centromere to theoriginal landing pad. To accomplish this (Figure 27) we used two strategies. In strategy (i) a landing pad template was pre-assembled with the plan of using homologous recombination to insert it into an extended non-coding segment of DNA (that had been included in the original design of the p-arm of our nanochromosomes to serve as a neutral spacer between centromere and telomere). In strategy (ii) a minimal nanochromosome with two landing padswas assembled in circular-precursor form in vitro and in E. coli cells, and this was linearizedand used to transform a wild-type (but KU70-knockout) host cell strain. The assembly of two landing pad templates (with different antimicrobial resistance genes) within carrier plasmids, used in both strategies (i) and (ii), is summarised in Figures 28 and 29. Validation of these key plasmids by Sanger sequencing is shown in Figure 30. In strategy (i), the templates were excised from their plasmids and successfully inserted into nanochromosomes 2A and 2A.3 as demonstrated in Figure 31.Chromosome-loss assays (e.g. Figure 32), showed excellent retention of antimicrobialresistance (and by inference, persistence over multiple generations of both the original and the second landing pad). The chromosome-loss assay does not, however, reveal whether the selection markers have remained in their original nanochromosomal locations (as opposed to becoming integrated into the native genome) and hence it was essential to perform furthervalidation on cells after the chromosome-loss assay. The results of colony PCR (Figure 33)and WGS (data not shown) are entirely consistent with the sustained integrity of these double-landing pad nanochromosomes, and further suggest that the native genome of these strains remains uncompromised. Assembly of a pre-made, double-landing pad, chromosome (strategy (ii)) proceeded in three steps: in step 1 (Figure 34), the following two DNA fragments were ligated: (i) NdeI-linearized nChr 2 precursor (that has the original landing pad, LHRE:Paox1:iLOV:ZeoR:LHRZ): and (ii) a PCR-amplified 3-kb segment comprising PARS:ncDNA(A):Nat:ncDNA(B) with NdeI- compatible ends. In step 2 (Figure 34), iSceI was used to linearize this plasmid, and in step 3(Figure 35) the product was used to transform P. pastoris cells (using a ΔKU70 but otherwisewildtype host strain). Transformants were validated (Figure 35) and then submitted for WGS(data not shown) that confirmed success of strategy (ii).In summary these further experiments provide additional evidence that one can add asupernumerary (fifth, nano-)chromosome of a suitable design into P. pastoris cells where itpersists for many generations, and that it can contain two strategically positioned dedicated gene-reception sites within landing pads on either side of ARSs that flank the centromere. The inclusion of a second landing pad provides additional opportunities for genetic manipulation of the nanochromosome and a move away from dependency on inchworming at a single site, which would result in an increasingly acentric centromere. DISCUSSION We have demonstrated stable protein production from DNA on a supernumerary chromosomein a ΔKU70 strain of the “biotechnology” yeast K. phaffii. This miniscule synthetic linearchromosome persists even after growing cells to high density on glucose followed by transfer to methanol-rich media for induction of heterologous gene expression. At 15-25 kb, it issmaller than even the smallest S. cerevisiae chromosome (250 kb), while so-called“microchromosomes” of birds and reptiles contain > 1000 kb (Waters, Patel et al., 2021). Hence, we adopted the term “nano” chromosomes for our constructs. Telomere-capped gene- sized DNA molecules in the macronucleus of some single-celled ciliates were also callednanochromosomes, but lack centromeres and do not segregate (Zheng, Dou et al., 2022). InS. cerevisiae, which has highly efficient HR-based DSB-repair mechanisms, “yeast artificial chromosomes” were developed as vehicles for Mb-sized segments of foreign DNA and used early in the human genome project and for generating transgenic animals (Li andBlankenstein, 2013).Recent work, demonstrated the feasibility of introducing centromeric and telomere-protected“neo”chromosomes into S. cerevisiae and then exploiting this organism’s highly efficient HRmachinery to assemble multiple-gene orthogonal expression platforms (Postma, Dashko etal., 2021). A study in Y. lipolytica achieved a similar goal despite this organism being lessefficient at HR than S. cerevisiae and more efficient at NHEJ. In the case of Y. lipolytica, HRproceeded more efficiently on the synthetic neochromosome than in native chromosomes(Guo, Borsenberger et al., 2020).To our knowledge, ours is the first report of a stable synthetic chromosome in K. phaffii, and the first WGS-verified example that survives without selective pressure or the possession of essential genes. We did not establish how many copies of the nanochromosome exist per cell immediately following transformation or how many reach and enter the nucleus, but our WGS and qPCR suggest an average of one copy per cell in cultures after a few dozen generations. During mitosis, its small size will restrict the number of cohesin molecules that can encircle a nanochromosome, which might cause premature separation of sister chromatids and spindledetachment (Brooker and Berkowitz, 2014). Hence it will be important to check copy numbersover time, and retain the option of transferring an essential gene onto the nanochromosome. The presence of an ARS in both arms of the nanochromosome (flanking CEN3) enhanced stability but we did not explore relationships between persistence and the number, spacing, sequence or positioning of ARS in a rigorous or systematic way. We have not explored nanochromosome behaviour during meiosis but this could be relevant to future prospects forusing mating as a strategy for transferring it between strains. Of note is that K. phaffii has beensuggested as a model organism for research on eukaryotic molecular cell biology. For example, its large, modular centromeres are reminiscent of those of higher organisms, unlikethe 125-bp centromeres of S. cerevisiae (Bernauer, Radkohl et al., 2020). Hence these andother studies of the nanochromosome (e.g. of chromatin structure and remodelling, andstructure-function relationships of telomeres, and subtelomeric and pericentromeric regions) might have relevance for chromosome biology more widely.On a wild-type background, analysis of WGS suggested nanochromosomes undergotranslocation or fusion, creating aberrant new chromosomes. In the case of nChr 1 we observed translocation with the acrocentric K. phaffii Chr 3, reminiscent of centric translocation(Figure 3). We found that nChr 1 was also unstable in ΔKU70 strains. Compared to nChr 1,nChr 2 has a longer p-arm containing the second ARS (Figure 1b). Interpretation of WGSresults revealed that - on a wild-type background - nChr 2 formed chromosomes with morethan one centromere (Figure 4). In the breakage-fusion-bridge (BFB) cycle (Guerin andMarcand, 2022), chromosomes that lose telomeres may, following duplication and duringanaphase, form end-to-end bridged dimeric chromatids (Potapova and Gorbsky, 2017).Indeed, NHEJ-mediated formation of dicentric chromosomes has been reported in yeast(Marcand, 2014, Guerin and Marcand, 2022). Multimeric chromosomes are normally resolved,over multiple BFB cycles, because two centromeres on a mutual chromatid have a 50%chance of being pulled towards opposing spindle poles (Brock and Bloom, 1994), inducing aDSB and hence opportunities for repair via various mechanisms. In our fused nanochromosomes, the centromeres (~10 kb apart) may be too close together for attachmentto different kinetochores, so are not resolved in this way (Potapova and Gorbsky, 2017). Nofused versions of nChr 2 were identified in the ΔKU70 strain. We did not yet try restoring KU70once the nanochromosome has become established in the nucleus. Thus, a current limitation of our platform is the need to delete KU70, which encodes a DNA-binding protein, within Ku70 / Ku80, that is important for NHEJ. It was reported that ΔKU70strains of K. phaffii might lack robustness and be prone to large genome deletions ordepressed colony numbers when attempting genetic manipulations (Cai, Duan et al., 2021).Moreover, deletion- or insertion-promoting alternative DSB-repair mechanisms, such asmicrohomology-mediated end joining or single-strand annealing, might prevail when neither NHEJ (due to knockout) nor HR (due to inherent low efficiency) are adequate (Shaltz andJinks-Robertson, 2023). We encountered no such issues with our strains (Figure 14B), but didnot test stability in a commercial setting, so alternatives to Ku70 depletion might be needed, and there are numerous possibilities. Recognition of DSBs by Ku70 / Ku80 both recruits other NHEJ-critical proteins and blocks 5’-resection. Removing this block, by Ku70 depletion, allows resection to commence. Rapid binding of the resultant single-stranded DNA by recombinaseRad51, and its facilitator Rad52, launches HR and shuts down NHEJ (Symington, 2016).Interestingly, in K. phaffii, genes for Ku70 / Ku80 are more strongly expressed than the genefor Rad52 (Cai, Duan et al., 2021), while the inverse pertains in S. cerevisiae (Daley, Palmboset al., 2005). Consistently, overexpression of RAD51 and RAD52, or deletion of the gene forMPH1 (that unwinds D-loops made by Rad51) enhances HR in K. phaffii and improvessuccess rates of CRISPR / Cas9-assisted gene integration (Cai, Duan et al., 2021). A further gain in HR-mediated repair, post-Cas9 cleavage, was obtained by fusing Cas9 with endogenous Mre11 that (as part of Mre11-Rad50-Xsr2) trims back one of the strands at a DSB to create 3’-tails. Deletion of the gene fo NHEJ-related protein, DNA ligase IV (Dnl4p),also improved HR efficiency in K. phaffii (Ito, Watanabe et al.2018) and the ΔDnl4p strain wasamenable to in vivo assembly of DNA fragments with concurrent integration at target sites(Nishi, Ito et al., 2022). Thus multiple alternatives, or complements, to deprivingnanochromosome-possessing cells of Ku70 could be explored. Despite the limitations of this study, our nanochromosome design has significant potential as a future robust and versatile protein-production platform. The small size of precursor plasmids required for nanochromosome construction ensures easy assembly. Insertion arrays aremodular and readily constructed (Figure 12). In both cases, the process could be automated.The landing-zone design allows for effectively indefinite expansion using just two selection markers accompanied by the positioning of defined non-coding, DNA spacers between integrated genes, could facilitate metabolic engineering in K. phaffii. We further showed thata second landing-pad could be easily added. There is also potential to employ, forconvenience, shorter LHRs / spacers, while the prospect of in vivo sequential assembly, viatransformation with overlapping insertion arrays, could be tested. The use of IRES-like sequences or bi-directional promoters to co-express multiple genes could be explored as could editing of the nanochromosome with CRISPR-Cas9. The chemically defined nature of nanochromosomes could enhance the precision with which artificial genetic circuits and networks are assembled, facilitate progress in biocatalyst design, and improve quantitative comparisons of genetic variants. But K. phaffii strains containing supernumerary chromosomes will probably be most useful in biotherapeutics and vaccines applications that require expression of multiple foreign genes and where there is a mandate to cost-effectively biomanufacture large quantities of homogenous high-quality materials. Examples might include proteins with complex and extensive post-translational modifications (PTMs) such as disulfides and N-glycans, multi-protein or multi-subunit complexes (Lundbladand Blackburn 1993) and virus-like particles (Brock and Bloom, 1994). For example, a libraryof selectively inducible genes for chaperonins and PTM-pathway enzymes, such asglycosyltransferases (Hamilton and Zha, 2015), could be installed on an adjunct or “supporter”nanochromosome. Subsequently, a codon-optimised gene coding for a protein of choice could be integrated into the native genome, using classical techniques. Alternatively, a bespoke array of heterologous genes could be positioned in the nanochromosome’s landing zone without engineering the native genome at all. We demonstrated minimalist versions of both strategies in the current study. Secreted yields of mFH, from a codon-optimised gene withinthe native genome, became detectable following PDI expression from a supportingnanochromosome, while human (GFP-tagged) FH and (His-tagged) PDI were co-produced from adjacent genes on a bespoke nanochromosome. To maximise yields of recombinant proteins, the following could be varied and optimised, potentially in an automated fashion, with more control and precision compared to equivalent investigations in native chromosomes: promoter selection, synonymous codon usage, gene-copy numbers, spacing between genes, and the positioning of landing zone(s) relative to centromere, ARS, and telomeres. CONCLUSIONSIn conclusion, we have added the biotech-friendly yeast K. phaffii to a small but growing list oforganisms in which a synthetic linear chromosome serves as a stable source of genetic information that is orthogonal to the native genome. While further development and optimisation may be optional, we have demonstrated a potential application ofnanochromosome-containing strains of K. phaffii for the manufacture of challenging-to-makeproteins. REFERENCES Abramczyk, D., et.al. (2023). “A supernumerary synthetic chromosome in Komagataella phaffii as a repository for extraneous genetic material.” Microb Cell Fact 22(1):259. Barone, G. D., et al. (2023). "Industrial Production of Proteins with Pichia pastoris- Komagataella phaffii." Biomolecules 13(3). Bernauer, L., et al. (2020). "Komagataella phaffii as Emerging Model Organism in Fundamental Research." Front Microbiol 11: 607028. Brock, J. A. and K. Bloom (1994). "A chromosome breakage assay to monitor mitotic forces in budding yeast." J Cell Sci 107 ( Pt 4): 891-902. Brooker, A. S. and K. M. Berkowitz (2014). "The roles of cohesins in mitosis, meiosis, and human health and disease." Methods Mol Biol 1170: 229-266. Cai, P., et al. (2021). "Recombination machinery engineering facilitates metabolic engineering of the industrial yeast Pichia pastoris." Nucleic Acids Res 49(13): 7791-7805. Cai, P., et al. (2019). "CRISPR-mediated genome editing in non-conventional yeasts for biotechnological applications." Microb Cell Fact 18(1): 63. Coughlan, A.Y., et al. (2016). “Centromeres of the yeast Komagataella phaffii (Pichia pastoris) have a simple inverted-repeat structure.” Genome Biol Evol 8(8):2482-2492 Daley, J. M., et al. (2005). "Nonhomologous end joining in yeast." Annu Rev Genet 39: 431- 451. Dalvie, N. C., et al. (2020). "Host-Informed Expression of CRISPR Guide RNA for Genomic Engineering in Komagataella phaffii." ACS Synth Biol 9(1): 26-35. Davy, A. M., et al. (2017). "Cell Factory Engineering." Cell Syst 4(3): 262-275. Fernandez-Martinez, L. T. and M. J. Bibb (2014). "Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes." Sci Rep 4: 7100. Fernius, J. and A. L. Marston (2009). "Establishment of cohesion at the pericentromere by the Ctf19 kinetochore subcomplex and the replication fork-associated factor, Csm3." PLoS Genet 5(9): e1000629. Fischer, J. E. and A. Glieder (2019). "Current advances in engineering tools for Pichia pastoris." Curr Opin Biotechnol 59: 175-181. Frigerio, C., et al. (2023). "The Chromatin Landscape around DNA Double-Strand Breaks in Yeast and Its Influence on DNA Repair Pathway Choice." Int J Mol Sci 24(4). Guerin, T. M. and S. Marcand (2022). "Breakage in breakage-fusion-bridge cycle: an 80- year-old mystery." Trends Genet 38(7): 641-645. Guo, Z. P., et al. (2020). "An artificial chromosome ylAC enables efficient assembly of multiple genes in Yarrowia lipolytica for biomanufacturing." Commun Biol 3(1): 199. Gould N., et al. (2014). ‘Computational tools and algorithms for designing customized synthetic genes. Front Bioeng Biotechnol.6(2):41 Hamilton, S. R. and D. Zha (2015). "Progress in Yeast Glycosylation Engineering." Methods Mol Biol 1321: 73-90. Ito, Y., et al. (2018). "Deletion of DNA ligase IV homolog confers higher gene targeting efficiency on homologous recombination in Komagataella phaffii." FEMS Yeast Res 18(7). Kerr, H., et al. (2021). "Murine Factor H Co-Produced in Yeast With Protein Disulfide Isomerase Ameliorated C3 Dysregulation in Factor H-Deficient Mice." Front Immunol 12: 681098.Kurtzman, C. P. (2005). "Description of Komagataella phaffii sp. nov. and the transfer ofPichia pseudopastoris to the methylotrophic yeast genus Komagataella." Int J Syst Evol Microbiol 55(Pt 2): 973-976. Kutyna, D. R., et al. (2022). "Construction of a synthetic Saccharomyces cerevisiae pan- genome neo-chromosome." Nat Commun 13(1): 3628. Li, L. and T. Blankenstein (2013). "Generation of transgenic mice with megabase-sized human yeast artificial chromosomes by yeast spheroplast-embryonic stem cell fusion." Nat Protoc 8(8): 1567-1582. Liachko, I., et al. (2014). "GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris." PLoS Genet 10(3): e1004169. Love, K. R., et al. (2016). "Comparative genomics and transcriptomics of Pichia pastoris." BMC Genomics 17: 550. Lundblad, V. and E. H. Blackburn (1993). "An alternative pathway for yeast telomeremaintenance rescues est1- senescence." Cell 73(2): 347-360.Marcand, S. (2014). "How do telomeres and NHEJ coexist?" Mol Cell Oncol 1(3): e963438. Mitchell, L. A. and J. D. Boeke (2014). "Circular permutation of a synthetic eukaryotic chromosome with the telomerator." Proc Natl Acad Sci U S A 111(48): 17003-17010. Naatsaari, L., et al. (2012). "Deletion of the Pichia pastoris KU70 homologue facilitates platform strain generation for gene expression and synthetic biology." PLoS One 7(6): e39720. Nishi, T., et al. (2022). "One-Step In Vivo Assembly of Multiple DNA Fragments and Genomic Integration in Komagataella phaffii." ACS Synth Biol 11(2): 644-654. Postma, E. D., et al. (2021). "A supernumerary designer chromosome for modular in vivo pathway assembly in Saccharomyces cerevisiae." Nucleic Acids Res 49(3): 1769-1783. Potapova, T. and G. J. Gorbsky (2017). "The Consequences of Chromosome Segregation Errors in Mitosis and Meiosis." Biology (Basel) 6(1). Roy, B. and K. Sanyal (2011). "Diversity in requirement of genetic and epigenetic factors for centromere function in fungi." Eukaryot Cell 10(11): 1384-1395.Sambrook J., (2001). Molecular Cloning : a Laboratory Manual. Cold Spring Harbor, N.Y.Schmidt, C. Q., et al. (2011). "Production of biologically active complement factor H in therapeutically useful quantities." Protein Expr Purif 76(2): 254-263. Schwarzhans, J. P., et al. (2016). "Integration event induced changes in recombinant protein productivity in Pichia pastoris discovered by whole genome sequencing and derived vector optimization." Microb Cell Fact 15: 84. Shaltz, S. and S. Jinks-Robertson (2023). "Genetic control of the error-prone repair of a chromosomal double-strand break with 5' overhangs in yeast." Genetics. Shen, Y., et al. (2017). "Deep functional analysis of synII, a 770-kilobase synthetic yeast chromosome." Science 355(6329). Stimpson, K. M., et al. (2012). "Dicentric chromosomes: unique models to study centromere function and inactivation." Chromosome Res 20(5): 595-605. Sturmberger, L., et al. (2016). "Refined Pichia pastoris reference genome sequence." J Biotechnol 235: 121-131. Symington, L. S. (2016). "Mechanism and regulation of DNA end resection in eukaryotes." Crit Rev Biochem Mol Biol 51(3): 195-212. Thorvaldsdottir, H., et al. (2013). "Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration." Brief Bioinform 14(2): 178-192. Waters, P. D., et al. (2021). "Microchromosomes are building blocks of bird, reptile, and mammal chromosomes." Proc Natl Acad Sci U S A 118(45): e2112494118 Wu, S. and G. J. Letchworth (2004). "High efficiency transformation by electroporation of Pichia pastoris pretreated with lithium acetate and dithiothreitol." Biotechniques 36(1): 152- 154. Zheng, W., et al. (2022). "Comparative Genome Analysis Reveals Cis-Regulatory Elements on Gene-Sized Chromosomes of Ciliated Protists." Front Microbiol 13: 775646.

Claims

Claims1. An artificial linear Komagataella chromosome for expressing at least one gene ofinterest in a Komagataella species, the artificial linear chromosome comprising:a. at least one autonomously replicating sequence (ARS);b. a centromere (CEN) sequence;c. at least one landing pad for receiving at least one gene of interest sequence,said at least one gene of interest sequence encoding, at least one protein, the landing pad comprising, in order: i) a first recombination sequence region; ii) a region for receiving the at last one gene of interest; and iii) a second / closing recombination sequence region; and d. first and second telomere (TEL) sequences at respective first and second endsof the artificial linear chromosome, wherein the CEN and TEL sequences are derived from native Komagataella centromere and telomere sequences, respectively, and the ARS is derived from native Komagataella or yeast ARS sequences.

2. The artificial linear Komagataella chromosome according to claim 1, comprising atleast one gene of interest within the region c. ii)3. The artificial linear Komagataella chromosome according to claims 1 or 2, whereinregion c. ii) comprises an antimicrobial resistance (AMR)-selection marker gene, or othersuitable selection marker gene, to permit selection of transformant cells which comprise the artificial linear chromosome.

4. The artificial linear Komagataella chromosome according to claims 1 or 2, whereinregion c. ii) comprises: (x), one or more genes of interest; and (z), an AMR-selection marker gene, or other suitable selection marker gene; (x) and (z) being to either side of (y), a third recombination region; wherein the AMR-selection marker gene, or other suitable selection marker gene can, in a single step, be replaced with one or more further genes of interest, a fourth recombination region and a different selection marker, to create a new gene-reception region.

5. The artificial linear Komagataella chromosome according to any preceding claimwherein the CEN sequence has been derived from the centromere of chromosomes 1, 2, 3, or 4 (CEN1, 2, 3, or 4), such as CEN3 of Komagataella phaffii.

6. The artificial linear Komagataella chromosome according to any preceding claim,wherein each TEL sequence comprises a plurality of repeat sequences, wherein the repeated sequences (typically of a 7-nucleotide repeat) within the first TEL sequence are found as inverted repeated sequences in the second TEL sequence, optionally wherein there arebetween 8-48 repeat sequences, within each TEL sequence, preferably between 10 – 18repeat sequences.

7. The artificial linear Komagataella chromosome according to any preceding claim,wherein the at least one ARS is located adjacent to the CEN sequence.

8. The artificial linear Komagataella chromosome according to any preceding claim,comprising first and second ARSs, optionally, wherein said first and second ARSs are located adjacent to and either side of the CEN sequence, respectively.

9. The artificial linear Komagataella chromosome according to claim 8, wherein said firstand second ARSs are A76-ARS and B413-ARS, or B413-ARS and A76-ARS.

10. The artificial linear Komagataella chromosome according to any preceding claim,wherein said at least one landing pad, is located between a TEL and an ARS.

11. The artificial linear Komagataella chromosome according to any preceding claim,wherein the first and second recombination sequence regions (and optional further recombination sequence regions when present) comprise sequences suitable for homologousrecombination or site-specific recombination within cells of the Komagataella species.

12. The artificial linear Komagataella chromosome according to any preceding claim,wherein the at least one gene of interest encodes a protein that endows antimicrobial-resistance on the host cells, a chaperonin, a toxin, an antibody (or antibody fragment), a nanobody, a hormone, an enzyme or proenzyme, a blood coagulation factor, a protein belonging to the complement system, an extracellular matrix protein, a growth factor, a cytokine, a structural protein, an immunogenic protein (e.g., a vaccine antigen), a cell- signalling protein and / or a fluorescent protein such as green fluorescent protein or red fluorescent protein, or engineered variants, mutants, or modified forms of any of the aforementioned.

13. The artificial linear Komagataella chromosome according to claim 12, wherein thesequence of the at least one gene of interest has been modified (such as by codonoptimisation techniques) to enhance expression levels in the Komagataella species.

14. The artificial linear Komagataella chromosome according to any preceding claim,wherein the Komagataella species is K. phaffii or K. pastoris or K. pseudopastoris.

15. The artificial linear Komagataella chromosome according to any preceding claim,further comprising one or more non-coding DNA (ncDNA) sequences, which act as spacers between other elements (for example the CEN sequence, ARS, AMR-selection marker gene, landing pad, and / or TEL sequence) of the chromosome or are included to increase the overall size of the chromosome.

16. The artificial linear Komagataella chromosome according to any preceding claim,wherein the size of the artificial linear Komagataella chromosome prior to inclusion of said atleast one gene of interest is 11000 – 35000 base pairs.

17. The artificial linear Komagataella chromosome according to any preceding claim,comprising, in order: the first TEL sequence; a landing pad; a first ARS; the CEN sequence; a second ARS; optionally a ncDNA sequence; optionally a second landing pad; and the second TEL sequence.

18. The artificial linear Komagataella chromosome according to any preceding claimobtained by linearization of a single plasmid.

19. A method of preparing an artificial linear Komagataella chromosome according to claim3 wherein the region c. (ii) of claim 3 for receiving the at least one gene of interest within an existing landing pad and comprising a first AMR-selection or other suitable selection marker gene is replaced by means of transforming cells that comprise the existing landing pad with a double-stranded DNA molecule having a sequence independently comprising: d. i) the first recombination sequence region;ii) a region comprising (x) at least one gene-of-interest sequence, (z) a second AMR-selection marker-gene sequence, or other suitable selection-marker gene; and (y) (situated between (x) and (z)) a third recombination sequence region; and iii) the second / closing recombination sequence region,in order to provide an extended landing pad, optionally further comprising the step of replacing the region of the extended landing pad originating from c. ii) comprising the second AMR- selection marker gene, or other suitable selection-marker gene and flanked by third and first or third and second / closing recombination sequences, by transforming cells that comprise the extended landing pad with a double-stranded DNA molecule having a sequence independently comprising: c. i) the third recombination sequence region;ii) a region comprising (x’) at least one gene-of-interest sequence, (z’) the first (or a different) AMR-selection marker-gene sequence, or other suitable selection- marker gene and (y’) (situated between (x’) and (z’)) a fourth recombination sequence region; iii) the first or second / closing recombination sequence region as appropriate,(wherein c. ii) is situated between c. i) and c. iii)) to provide a further extended landing pad.

20. The method according to claim 19 further comprising the step of replacing the regionof the extended landing pad originating from c. ii) of claim 24 and comprising the first AMR- selection marker gene, or other suitable selection-marker gene, and flanked by two recombination selection sequences, by transforming cells that comprise the further extended landing pad with a double-stranded DNA molecule having a sequence independently comprising: c. i) the fourth recombination sequence region;ii) a region comprising (x’’) at least one gene-of-interest sequence, (z’’) the second (or different) AMR-selection marker-gene sequence, or other suitable selection-marker gene and (y’’) a fifth recombination sequence (located between (x’’) and (z”); iii) the first or second / closing or third recombination sequence region as appropriate, (wherein c. ii) is situated between c. i) and c. iii)).

21. A stable Komagataella species comprising an artificial linear Komagataellachromosome according to any of claims 1 – 18 or an artificial linear Komagataellachromosome prepared in accordance with any of claims 19 - 20, optionally wherein thespecies is K. phaffii or K. pastoris or K. pseudopastoris.

22. The stable Komagataella species according to claim 21, which has been geneticallymodified so as to reduce double-strand break repair of DNA by a process of non-homologous end joining (NHEJ), and / or to enhance the process of homologous recombination, optionallywherein the species is a ΔKU70 strain or ^DNL4 strain.

23. Use of an artificial linear Komagataella chromosome according to any of claims 1 – 18,an artificial linear Komagataella chromosome prepared in accordance with any of claims 19 –20, or a Komagataella species according to any of claims 21 – 22, for the production of oneor more proteins.

24. A bioreactor comprising an artificial linear Komagataella chromosome according to anyof claims 1 – 18, an artificial linear Komagataella chromosome prepared in accordance withany of claims 19 – 20, or a Komagataella species according to any of claims 21 – 22.

25. A method of expressing one or more genes in a Komagataella species comprisingintroducing an artificial linear Komagataella chromosome according to any of claims 2 – 18,or comprising an artificial linear Komagataella chromosome prepared in accordance with anyof claims 19 – 20 into the Komagataella species and expressing the one or more genes thatare located within the artificial linear Komagataella chromosome,optionally wherein thespecies is K. phaffii or K. pastoris or K. pseudopastoris.

26. The method according to claim 25, wherein the Komagataella species has beengenetically modified so as to reduce double-strand break repair of DNA by a process of non- homologous end joining (NHEJ), and / or to enhance the process of homologousrecombination, optionally wherein the species is a ΔKU70 strain or ^DNL4 strain.

Images