Anticancer cell therapy technique targeting pericytes of tumor microenvironment by using natural killer cells in which chimeric antigen receptor is expressed, and technology for producing tumor microenvironment organoid model for evaluating therapeutic efficacy

Abstract

The present invention relates to an anticancer cell therapy technique targeting pericytes of tumor microenvironment by using natural killer cells in which a chimeric antigen receptor is expressed, and a technique for producing a tumor microenvironment organoid model for evaluating therapeutic efficacy, and, more specifically, provides: a pharmaceutical composition for preventing or treating cancer, comprising natural killer cells in which a CD19 chimeric antigen receptor is expressed; a glioblastoma-vascular fusion organoid prepared by co-culturing a vascular organoid and glioblastoma spheroids; a microcirculation chip on which the glioblastoma-vascular fusion organoid is mounted; and an animal model to which the glioblastoma-vascular fusion organoid is xenografted.

Description

Anticancer cell therapy targeting pericytes in the tumor microenvironment using natural killer cells expressing chimeric antigen receptors and technology for producing tumor microenvironment organoid models for evaluating therapeutic efficacy

[0001] The present invention relates to an anticancer cell therapy technique targeting pericytes of a tumor microenvironment using natural killer cells expressing a chimeric antigen receptor and a technique for producing a tumor microenvironment organoid model for evaluating therapeutic efficacy. More specifically, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising natural killer cells expressing a CD19 chimeric antigen receptor, a glioblastoma-vascular fusion organoid produced by co-culturing a vascular organoid and a glioblastoma spheroid, a microcirculation chip equipped with the glioblastoma-vascular fusion organoid, and an animal model in which the glioblastoma-vascular fusion organoid is xenografted.

[0002] Recently, chimeric antigen receptor (CAR)-T cell-based immunotherapy, a cell-based immunotherapy that targets specific antigens using CAR technology, has been attracting attention as a next-generation anticancer agent due to its high therapeutic efficacy against malignant B-lymphoma. Research is currently underway to apply CAR-T to various tumors. However, excessive toxicity to non-tumor targets has emerged as a major side effect of CAR-T immunotherapy. This becomes even more problematic when applied to solid tumors with complex tumor microenvironments. Therefore, CAR-NK immunotherapy, which relies on NK cells with tumor-specific cytotoxic mechanisms, is being proposed as an alternative immunotherapy for solid tumors.

[0003] Glioblastoma (GBM) is the most aggressive form of primary brain tumor, and despite comprehensive treatment strategies including surgery, radiotherapy, and chemotherapy, it is characterized by a high mortality rate due to the lack of effective treatments. The intratumoral heterogeneity and complex tumor microenvironment of glioblastoma are major factors that make treatment difficult. In particular, interactions between tumor cells and the perivascular niche amplify intratumoral heterogeneity.

[0004] As reported in non-patent literature 1 and 2, existing glioblastoma immunotherapy using CAR technology targeted receptors such as HER2 and EGFR expressed in glioblastoma, but showed limited efficacy due to high heterogeneity.

[0005] Against this backdrop, the present invention aimed to treat glioblastoma by targeting the tumor microenvironment using an anti-CD19 CAR to overcome the resistance to targeted therapeutics due to the heterogeneity of glioblastoma, thereby approaching pericytes in the perivascular niche, and using NK cells as a cell source to minimize toxicity to normal cells. In addition, to evaluate the therapeutic efficacy of the anti-CD19 CAR-expressing NK cells produced in the present invention, in vitro modeling of the glioblastoma tumor microenvironment through vascular organoid fusion and xenograft modeling technology were developed, which allowed for the analysis of candidate drug efficacy by reproducing the structural and functional characteristics of the human glioblastoma tumor microenvironment.

[0006] [Prior Art Literature]

[0007] [Non-patent literature]

[0008] (Non-patent literature 0001) DM Haynik et al., Appl. Immunohistochem. Mol. Morphol. 15 (1) (2007) 56-58.

[0009] (Non-patent literature 0002) T. Nakazawa et al., Anticancer Res. 40 (6) (2020) 3231-3237.

[0010] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating cancer using natural killer cells expressing an anti-CD19 chimeric antigen receptor (CAR) and a method for preventing or treating cancer using the same.

[0011] Another object of the present invention is to provide a use of natural killer cells expressing anti-CD19 CAR for preparing a drug for preventing or treating cancer.

[0012] Another object of the present invention is to provide a glioblastoma-vascular fusion organoid that reproduces a tumor microenvironment expressing CD19 positive pericytes.

[0013] Another object of the present invention is to provide a microcirculation chip loaded with the glioblastoma-vascular fusion organoid and an animal model in which the glioblastoma-vascular fusion organoid is xenotransplanted.

[0014] To solve the above-described problem, the present invention provides a pharmaceutical composition for the prevention or treatment of solid cancer that exhibits a tumor microenvironment including pericytes, including natural killer cells expressing anti-CD19 CAR.

[0015] In addition, the present invention provides a natural killer cell expressing an anti-CD19 CAR or a composition comprising the same for use in the prevention or treatment of a solid tumor exhibiting a tumor microenvironment including pericyte cells.

[0016] Additionally, the present invention provides a method for preventing or treating a solid tumor exhibiting a tumor microenvironment including pericytes, comprising administering to a subject in need thereof a natural killer cell expressing an anti-CD19 CAR or a composition comprising the same.

[0017] Furthermore, the present invention provides the use of natural killer cells expressing anti-CD19 CAR or a composition comprising the same for the manufacture of a drug for the prevention or treatment of solid tumors exhibiting a tumor microenvironment including pericyte cells.

[0018] In the present invention, the anti-CD19 CAR may be a CAR comprising an anti-CD19 antibody or an antigen-binding fragment thereof that specifically binds to CD19.

[0019] In the present invention, the antigen-binding fragment of the anti-CD19 antibody may be selected from the group consisting of Fab, Fab', F(ab')2, xFab, scFab, dsFv, Fv, scFv-Fc, scFab-Fc, diabody, minibody, scAb, dAb, half-IgG, and combinations thereof.

[0020] In the present invention, the natural killer cells expressing the anti-CD19 CAR may be differentiated from pluripotent stem cells expressing the anti-CD19 CAR.

[0021] In the present invention, the pluripotent stem cell expressing the anti-CD19 CAR can be differentiated into a natural killer cell expressing the anti-CD19 CAR through the following steps a) to c):

[0022] a) A step of culturing pluripotent stem cells expressing anti-CD19 CAR in a medium containing mesoderm-inducing factors to obtain mesoderm;

[0023] b) culturing the mesoderm in a hematopoietic progenitor cell differentiation medium to obtain hematopoietic progenitor cells; and

[0024] c) A step of culturing the above hematopoietic progenitor cells in a natural killer cell differentiation medium to induce differentiation into natural killer cells expressing anti-CD19 CAR.

[0025] In the present invention, the step a) can be performed by first culturing for 1 to 4 days by treating with a GSK-3β inhibitor, BMP4, and VEGF, then replacing the medium and second culturing for 1 to 4 days by treating with a TGF-β inhibitor, VEGF, and stem cell factor.

[0026] In the present invention, step b) can be performed by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, and FIT3 ligand and culturing for 5 to 15 days.

[0027] In the present invention, the step c) may be performed by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, FIT3 ligand, IL7, IL15 and IL3, performing primary culture for 4 to 8 days, then replacing the medium and treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, FIT3 ligand, IL7 and IL15, and culturing for 20 to 40 days.

[0028] In the present invention, the anti-CD19 CAR can specifically target pericytes in the microenvironment of solid tumors that represents a tumor microenvironment including pericytes, thereby enhancing the ability to migrate and penetrate into tumor cells and enhancing the ability to specifically destroy tumor cells.

[0029] In the present invention, the solid tumor exhibiting a tumor microenvironment including the above-mentioned pericytes may be glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, metastatic brain tumor, colon cancer, non-small cell lung cancer, Lewis lung cancer, liver cancer, melanoma, or breast cancer.

[0030] In addition, the present invention provides a glioblastoma-blood vessel fusion organoid produced by co-culturing a blood vessel organoid (BVO) and a glioblastoma spheroid.

[0031] In the present invention, the glioblastoma-vascular fusion organoid can implement a tumor microenvironment expressing CD19 positive pericytes and simulate the phenomenon of tumor metastasis through perivascular gaps.

[0032] In the present invention, the glioblastoma-vascular fusion organoid can be produced through the following steps a) and b):

[0033] a) a step of culturing pluripotent stem cells and differentiating them into vascular organoids with formed vascular networks; and

[0034] b) A step of producing a glioblastoma-vascular fusion organoid by co-culturing a vascular organoid in which the above vascular network is formed and a glioblastoma spheroid.

[0035] In the present invention, the vascular organoids and glioblastoma spheroids in which the vascular network of step b) is formed can be co-cultured in a medium in which a medium for culturing vascular organoids and a medium for culturing glioblastoma spheroids are mixed.

[0036] In the present invention, the medium for culturing the vascular organoid may be any one selected from the group consisting of StemPro-34 SFM and EGM-2 (Endothelial Cell Growth Medium-2), and the medium for culturing the glioblastoma spheroid may be any one selected from the group consisting of DMEM (Dulbeco's Modified Eagle's Medium), IMDM (Iscove's Modified Dulbecco's Medium), a-MEM (Alpha Modification of Eagle's Medium), F12 (Nutrient Mixture F-12), RPMI 1640, Williams's medium E, McCoy's 5A, and DMEM / F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12).

[0037] In the present invention, step b) may be performed for 4 days or more.

[0038] Furthermore, the present invention provides a microcirculation chip loaded with the aforementioned glioblastoma-vascular fusion organoid and an animal model into which the aforementioned glioblastoma-vascular fusion organoid is xenografted.

[0039] In the present invention, an animal model in which a glioblastoma-vascular fusion organoid is xenografted can be produced through the following steps a) and b):

[0040] a) a step of manufacturing a glioblastoma-vascular fusion organoid with a vascular network formed by inserting vascular organoids and glioblastoma spheroids into an extracellular matrix and then treating with serum, VEGF-A, and FGF-2; and

[0041] b) A step of transplanting the above glioblastoma-vascular fusion organoid into an immunodeficient animal model.

[0042] The anti-CD19 CAR-expressing natural killer cells of the present invention have the advantage of specifically targeting pericytes within the tumor microenvironment of solid cancers, thereby overcoming the limitations of existing tumor-specific targeted therapies due to tumor heterogeneity. Therefore, they can be effectively applied to the treatment of not only glioblastoma but also other solid cancers in which a tumor microenvironment containing pericytes is formed. Furthermore, the glioblastoma-vascular fusion organoids of the present invention recapitulate the human glioblastoma tumor microenvironment, and can be utilized for evaluation of drug delivery in a perfusion environment by mounting them on a microcirculation chip or xenografting them into immunodeficient animal models, respectively, and for evaluation of glioblastoma drug candidates in preclinical studies.

[0043] Figure 1 is a schematic diagram showing the CD19 CAR structure.

[0044] Figure 2 is a schematic diagram illustrating the differentiation of iNK cells.

[0045] Figure 3A is a representative flow cytometry analysis result showing KDR, CD34, CD31, CD43, and CD45 expression on day 14, and Figure 3B is a representative flow cytometry analysis result of CD56, CD3, NKG2A, NKG2D, NKp30, NKp44, and NKp46 expression gated by forward and area scatter plots of iNK cells.

[0046] Figure 4a is a representative flow cytometry analysis result for CD19 CAR expression in control or CD19 CAR-iNK cells, Figure 4b is a flow cytometry analysis result for quantifying iNK cells expressing CD19 CAR (n=5), Figure 4c is a LDH assay for cytotoxicity of control or CD19 CAR-iNK cells against CD19-positive Raji cells and CD19-negative K562 cells (n=3), Figure 4d is a representative flow cytometry analysis result for CD107a and IFN-γ expression in control or CD19 CAR-iNK cells after co-culture with CD19-positive Raji cells for 5 hours, Figure 4e is a flow cytometry analysis result for quantifying IFN-γ expression in iNK cells co-cultured with Raji cells (n=3), and Figure 4f is a flow cytometry analysis result for quantifying CD107a expression in iNK cells co-cultured with Raji cells (n=3). Error bars are SEM of the mean (*p<0.05, ***p<0.001, ****p<0.0001).

[0047] Figure 5 illustrates a schematic of GBVA production. On day 11, BVO began co-culture with GBM spheroids, and vascular networks were observed sprouting before vascular self-assembly (arrows). GBM spheroids, shown in blue, were embedded in GBVA (scale bar = 1 mm).

[0048] Figures 6a to 6d show the immunostaining results of GBVA. Figure 6a shows that blue-labeled GBM cells express the GBM markers EGFR and IDH1, and Figure 6b shows that GBVA represents blue-labeled GBM cells that express the GSC markers CD44 and SOX2. A population of blue-labeled GBM cells that do not express these markers was also observed (arrows). Figure 6c shows the observation of PDGFRβ-positive surrounding cells surrounding GBM cells. CD31-positive endothelial tubes surrounded by pericytes infiltrated into the GBM spheroids (arrows). Figure 6d shows that GBVA expresses GFAP, an astrocyte marker, and IBA1, a macrophage marker, adjacent to blue-labeled GBM cells (scale bar = 100 μm).

[0049] Figures 7a to 7d show GBM migration and pericyte self-assembly in GBVA. Figure 7a is a bright-field microscopic image of GBVA on days 15 and 23. Newly formed blue-labeled GBM colonies (arrows) were observed around GBM spheroids (dotted lines) that had previously fused with BVO. Figure 7b is a representative Z-stack confocal image of whole-mount stained GBVA for PDGFRβ on days 15–23, Figure 7c is a representative confocal image of sectioned GBVA for PDGFRβ on days 15 and 23, and Figure 7d shows the co-localization coefficient values ​​of GBM-PDGFRβ in PDGFRβ-positive areas on days 15 and 23.

[0050] Figure 8a shows the relative mRNA levels of CD19 in HUVEC, U87MG, BVO, GBVA, K562, and Raji cells (n=3), Figure 8b is a representative confocal image of GBVA immunostained for PDGFRβ and CD19, Figure 8c is the result of quantifying the mean fluorescence intensity of CD19 in BVO and GBVA on day 23, Figure 8d is an enlarged photograph of areas A and B in Figure 8b, and Figure 8e shows the co-localization coefficient values ​​of CD19-PDGFRβ in the PDGFRβ-positive area of ​​GBVA on day 23, the co-localization coefficient values ​​of CD19-PDGFRβ in the CD19-positive area, and the co-localization coefficient values ​​of GBM-CD19-PDGFRβ in the CD19-positive area (scale bar = 100 μm). Error bars are SEM of the mean (**p<0.01, ***p<0.001, ****p<0.0001).

[0051] Figure 9 is a schematic diagram of a co-culture assay.

[0052] Figure 10a shows representative confocal images of cross-sectional immunostaining of GBVA cells co-cultured with control and CD19 CAR-iNK cells for PDGFRβ. CD19 CAR-iNK cells, labeled in green, migrated into GBM cells surrounded by pericytes. Figure 10b shows the results of particle analysis of cross-sectional staining images to quantify iNK cell migration into GBM (n=5) (scale bar = 100 μm). Error bars represent SEM of the mean (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Figure 10c shows the co-localization coefficient values ​​of CD19-iNK in the iNK region of GBVA co-cultured with control iNK or CD19 CAR iNK, and Figure 10d shows representative confocal images of CD19 expression in GBVA co-cultured with CD19 CAR-iNK cells.

[0053] Figure 11a shows representative confocal images of NKp44 expression in GBVA co-cultured with iNK, Figure 11b shows the co-localization coefficient of NKp44-iNK in the iNK region of GBVA co-cultured with control or CD19 CAR iNK cells, and Figure 11c shows the results of quantifying the mean fluorescence intensity of NKp44 in GBVA co-cultured with control or CD19 CAR iNK cells.

[0054] Figure 12 shows modeling of CD19 CAR iNK cell infiltration into the GBM microenvironment after injection using GBVA loaded onto a microcirculation chip. A of Figure 12 is a schematic of the microcirculation chip assay, B is a representative maximum intensity projection of time-lapse confocal images for 1000 s of the GBVA microcirculation chip injected with CD19 CAR-iNK cells, and C is a magnified time-lapse image of the GBVA microcirculation chip injected with CD19 CAR-iNK. CD19 CAR-iNK cells (arrows) migrated and attached to GBM cells during time-lapse imaging. D of Figure 12 is a representative flow cytometry analysis result for PI / Cell Tracker Blue double-positive expression in GBVA, and E is the quantification result of iNK cell cytotoxicity using the microcirculation chip assay (n=3) (scale bar = 100 μm). Error bars are SEM of the mean (**p<0.01, ***p<0.001).

[0055] Figure 13a is a schematic diagram of in vivo modeling of the GBM microenvironment, and Figure 13b is a photograph of GBVA subcutaneously transplanted into the left flank of a mouse.

[0056] Figure 14a is a representative confocal image of human CD31 and mouse CD31 expression in xenograft GBVA and GBM spheroids, and Figure 14b is a representative confocal image of PDGFRβ and CD19 expression in tumor tissues of GBVA or GBM spheroid xenograft mice.

[0057] Figure 15 shows a schematic diagram of the in vivo experiment of GBVA xenograft mice.

[0058] Figure 16a shows tumor bioluminescence images of xenograft mice monitored 21 to 34 days after GBVA transplantation, Figure 16b shows total flux of xenograft mice in the GBVA transplantation group monitored -1 to 12 days after iNK injection, and Figure 16c shows total flux of xenograft mice in the GBM spheroid transplantation group monitored -1 to 12 days after iNK injection.

[0059] Figure 17a is a representative confocal image of PDGFRβ expression in tumor tissues of GBVA or GBM spheroid xenograft mice. Green-labeled iNK cells migrated from the tumor tissues were detected (scale bar = 100 μm). Error bars represent the SEM of the mean (** p < 0.01). Figures 17b and 17c show the quantification of the area of ​​green-labeled iNK cells in the tumor tissues 13 days after iNK injection.

[0060] Figure 18A is a representative confocal image of PDGFRβ expression in tumor tissue 13 days after iNK injection. Z-stack images were volume-scaled in a 3D view (scale bar = 100 μm). Error bars represent SEM of the mean (**p<0.01, ***p<0.001). Figure 18B is a representative confocal image showing green-labeled iNK cells accumulating around pericytes. iNK cells found near PDGFRβ-expressing pericytes are indicated by arrows. Figure 18C is a representative confocal image confirming that NKp44, an NK activating receptor, is expressed in iNK cells that have infiltrated into tumor tissue by PDGF-DD secreted from pericytes.

[0061] Figure 19 shows the results of evaluating the therapeutic efficacy according to the number of CD19 CAR iNK administrations in the GBVA transplant group after iNK injection. A shows the total flux of xenograft mice according to the number of CD19 CAR iNK administrations in the GBVA transplant group monitored from day -1 to 14 after iNK injection, and B shows the results of confirming the tumor diameter according to the number of CD19 CAR iNK administrations.

[0062] Figure 20 shows the results of evaluating the therapeutic efficacy according to the CD19 CAR iNK dosage in the GBVA transplant group after iNK injection. A shows the total plus of xenograft mice according to the CD19 CAR iNK dosage in the GBVA transplant group monitored from -1 to 28 days after iNK injection, and B shows the results of confirming the tumor diameter according to the CD19 CAR iNK dosage.

[0063] Figure 21 shows the results of cross-sectional immunostaining to confirm the presence of NK cells that have infiltrated the tissue.

[0064] Figure 22 shows modeling of CD19 CAR iNK cell infiltration into the GBM microenvironment after injection using GBVA loaded onto a microcirculation chip.

[0065] Hereinafter, the present invention will be described in more detail.

[0066] All technical terms used in this invention, unless otherwise defined, have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of this invention.

[0067] As mentioned above, existing glioblastoma immunotherapy using CAR technology targets receptors such as HER2 and EGFR expressed in glioblastoma, but shows limited efficacy due to high heterogeneity, and the development of new therapeutic agents is necessary. Accordingly, the present invention seeks to solve the above-mentioned problem by producing anti-CD19 CAR-expressing natural killer cells that can treat glioblastoma by targeting the tumor microenvironment and approaching pericytes in the perivascular niche, and by developing glioblastoma-vascular fusion organoids that can verify the efficacy of these cells.

[0068] Accordingly, the first aspect of the present invention relates to a pharmaceutical composition for the prevention or treatment of solid tumors comprising CD19 pericytes, which comprises natural killer cells expressing anti-CD19 CARs and which create a tumor microenvironment.

[0069] In this regard, the present invention provides a natural killer cell expressing an anti-CD19 CAR or a composition comprising the same for use in the prevention or treatment of a solid tumor exhibiting a tumor microenvironment including pericyte cells.

[0070] Furthermore, the present invention provides the use of natural killer cells expressing anti-CD19 CAR or a composition comprising the same for the manufacture of a drug for the prevention or treatment of solid tumors exhibiting a tumor microenvironment including pericyte cells.

[0071] Additionally, the present invention provides a method for preventing or treating a solid tumor exhibiting a tumor microenvironment including pericytes, comprising administering to a subject in need thereof a natural killer cell expressing an anti-CD19 CAR or a composition comprising the same.

[0072] As used herein, the term "natural killer (NK) cell" refers to a key innate immune cell that performs the body's first line of defense (innate immunity) by eliminating infections caused by viruses, bacteria, and parasites, as well as abnormal self-cells (e.g., cancer cells). NK cells have been proven effective in preventing the occurrence, proliferation, metastasis, and recurrence of various cancers, including not only hematological cancers but also solid tumors, and are thus attracting attention as a valuable cell resource for anticancer therapeutics and recurrence inhibitors.

[0073] In the present invention, a chimeric antigen receptor (CAR) may include an extracellular domain comprising an antibody domain, a cell membrane-penetrating domain, and an intracellular domain. For the purposes of the present invention, the CAR may be an anti-CD19 CAR comprising an anti-CD19 antibody or an antigen-binding fragment thereof.

[0074] In the present invention, the anti-CD19 CAR may be selected from the group consisting of, but not limited to, an antigen-binding fragment of an anti-CD19 antibody that specifically binds to CD19, Fab, Fab', F(ab')2, xFab, scFab, dsFv, Fv, scFv, scFv-Fc, scFab-Fc, diabody, minibody, scAb, dAb, half-IgG, and combinations thereof.

[0075] "Antibody fragment" or "antigen-binding fragment" refers to a molecule other than an intact antibody, which comprises a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Immunologically functional immunoglobulin fragments include, but are not limited to, Fab, Fab', F(ab')2, xFab, scFab, dsFv, Fv, scFv-Fc, scFab-Fc, diabodies, minibodies, scAbs, dAbs, anti-IgGs or combinations thereof. The term "Fab" as used in Fab, Fab', F(ab')2, xFab and scFab can include conventional Fab fragments and chimeric Fab-like domains as described in PCT / CN2018 / 106766 (Wuxibody). Additionally, it can be derived from any mammal, including but not limited to a human, mouse, rat, camelid, or rabbit. A functional portion of an antibody, such as one or more of the CDRs described herein, can be covalently linked to a second protein or small molecule compound, thereby enabling it to be used as a targeted therapeutic for a specific target. The term "antibody fragment" includes aptamers, spiegelmers, and diabodies. The term "antibody fragment" also includes any synthetic or genetically engineered protein that acts like an antibody by binding to a specific antigen and forming a complex.

[0076] Antibody fragments can be prepared by a variety of techniques, including but not limited to proteolytic digestion of intact antibodies as described herein, as well as production in recombinant host cells, such as E. coli or phage.

[0077] Papain digestion of intact antibodies produces two identical antigen-binding fragments, called "Fab" fragments, which contain the heavy and light chain variable domains and the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Therefore, as used herein, the term "Fab fragment" refers to a light chain fragment comprising the VL domain and the constant domain (CL) of the light chain, and an antibody fragment comprising the VH domain and the first constant domain (CH1) of the heavy chain. A Fab' fragment differs from a Fab fragment in that it adds several residues to the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region. Fab'-SH is a Fab' fragment in which the cysteine ​​residue(s) of the constant domains have a free thiol group. Pepsin treatment produces an F(ab')2 fragment, which has two antigen-binding sites (two Fab fragments) and part of the Fc region. As used herein, the "F(ab')2 fragment" comprises, as described above, two light chains and two heavy chains comprising a variable region, CH1, and a portion of a constant region between the CH1 and CH2 domains, thereby forming an intrachain disulfide bond between the two heavy chains. Accordingly, the F(ab')2 fragment is composed of two Fab' fragments, and the two Fab' fragments are linked to each other by a disulfide bond therebetween.

[0078] The term "cross-Fab fragment" or "xFab fragment" or "crossover Fab fragment" refers to a Fab fragment in which the variable or constant regions of the heavy and light chains are exchanged. Two different chain compositions of crossover Fab molecules are possible and are included in the bispecific antibodies of the invention: on the one hand, the variable regions of the Fab heavy and light chains are exchanged, i.e. the crossover Fab molecule comprises a peptide chain composed of a light chain variable region (VL) and a heavy chain constant region (CH1), and a peptide chain composed of a heavy chain variable region (VH) and a light chain constant region (CL). Such a crossover Fab molecule is also called CrossFab (VLVH). In contrast, when the constant regions of the Fab heavy and light chains are exchanged, the crossover Fab molecule comprises a peptide chain composed of the heavy chain variable region (VH) and the light chain constant region (CL), and a peptide chain composed of the light chain variable region (VL) and the heavy chain constant region (CH1). Such a crossover Fab molecule is also called CrossFab(CLCH1).

[0079] A "single chain Fab fragment" or "scFab" is a polypeptide comprising an antibody heavy chain variable domain (VH), an antibody constant domain 1 (CH1), an antibody light chain variable domain (VL), an antibody light chain constant domain (CL) and a linker, wherein the antibody domains and the linker have one of the following sequences from N-terminus to C-terminus: a) VH-CH1-linker-VL-CL, b) VL-CL-linker-VH-CH1, c) VH-CL-linker-VL-CH1 or d) VL-CH1-linker-VH-CL; and wherein the linker is a polypeptide having at least 30 amino acids, preferably 32 to 50 amino acids. The single chain Fab fragment is stabilized by a natural disulfide bond between the CL domain and the CH1 domain. Additionally, these single-chain Fab molecules can be further stabilized by the creation of interchain disulfide bonds through insertion of cysteine ​​residues (e.g., at position 44 in the variable heavy chain and position 100 in the variable light chain according to Kabat numbering).

[0080] A "crossover single chain Fab fragment" or "x-scFab" is a polypeptide comprising an antibody heavy chain variable domain (VH), an antibody constant domain 1 (CH1), an antibody light chain variable domain (VL), an antibody light chain constant domain (CL) and a linker, wherein the antibody domains and the linker have one of the following sequences from N-terminus to C-terminus: (a) VH-CL-linker-VLCH1 and (b) VL-CH1-linker-VH-CL; wherein the VH and VL together form an antigen-binding domain that specifically binds to an antigen, and wherein the linker is a polypeptide having at least 30 amino acids. Additionally, these x-scFab molecules can be further stabilized by formation of an interchain disulfide bond through insertion of a cysteine ​​residue (e.g., at position 44 in the variable heavy chain and position 100 in the variable light chain according to the Kabat numbering).

[0081] An "Fv region" is an antibody that includes the variable regions of each heavy and light chain, but not the constant region. An scFv is an Fv linked by a flexible linker. An scFv-Fc is an Fc linked to an scFv. A minibody typically has a CH3 fragment linked to an scFv, but a minibody according to the present invention may have a CH1 fragment linked to an scFv. A diabody includes two molecules of an scFv. A "single-chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin. In some embodiments, the regions are linked to a short linker peptide having from about 10 to about 25 amino acids. The linker can be glycine-rich for flexibility, serine-rich for solubility, or threonine-rich for solubility, and can link the N-terminus of the VH to the C-terminus of the VL, or vice versa. These proteins retain the specificity of the native immunoglobulin despite the removal of the constant region and the introduction of the linker. ScFv molecules are known in the art and are described, for example, in U.S. Patent No. 5,892,019.

[0082] A "short-chain antibody (scAb)" is a single polypeptide chain comprising one heavy chain variable region or one light chain constant region, with the heavy and light chain variable regions connected by a flexible linker. For single-chain antibodies, see, for example, U.S. Patent No. 5,260,203, which is incorporated herein by reference.

[0083] A "domain antibody (dAb)" is an immunologically functional immunoglobulin fragment comprising only the variable region of a heavy chain or the variable region of a light chain. In one embodiment, two or more VH regions are covalently linked by a peptide linker to form a bivalent domain antibody. The two VH regions of such a bivalent domain antibody may target the same or different antigens.

[0084] The term "full-length IgG" according to the present invention is defined as comprising essentially complete IgG, but does not necessarily have all the functions of a complete IgG. For the avoidance of doubt, a full-length IgG contains two heavy chains and two light chains. Each chain contains constant (C) and variable (V) regions, which can be divided into domains designated CH1, CH2, CH3, VH, and CL, VL. IgG antibodies bind to antigens through the variable region domains contained in the Fab portion, and after binding, can interact with cells and molecules of the immune system through the constant domains, mostly through the Fc portion. The terms 'variable region domain', 'variable region', 'variable domain', 'VH / VL pair', 'VH / VL', 'Fab portion', 'Fab arm', 'Fab' or 'arm' are used interchangeably herein. A full-length antibody according to the present invention includes an IgG molecule that may have mutations that provide the desired characteristics. Such mutations must not result in the deletion of a significant portion of any region. However, an IgG molecule in which one or more amino acid residues are deleted without substantially altering the binding properties of the resulting IgG molecule is included within the term "full-length IgG". For example, such an IgG molecule may have one or more deletions of 1 to 10 amino acid residues, preferably in a non-CDR region, wherein the deletion of the amino acid is not essential for the binding specificity of the IgG.

[0085] As used herein, the term "antigen binding domain" or "antigen-binding site" refers to the portion of an antibody or antibody fragment that specifically binds to an antigenic determinant. More specifically, the term "antigen binding domain" refers to the portion of an antibody that specifically binds to and is complementary to part or all of an antigen. When the antigen is large, the antibody or antibody fragment may bind only to a specific portion of the antigen, which portion is called an epitope. The antigen binding domain may be provided, for example, by one or more variable domains (also referred to as variable regions). Preferably, the antigen binding domain comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH). In one aspect, the antigen binding domain can bind to its antigen and block or partially block its function. Antigen binding domains that specifically bind to CD19 include antibodies and fragments thereof as further defined herein. Additionally, the antigen binding domain may comprise a scaffold antigen binding protein, e.g., a binding domain based on a designed repeat protein or a designed repeat domain (see e.g. WO 2002 / 020565).

[0086] In the present invention, the term "single chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin. In some embodiments, the regions are linked to a short linker peptide having 10 to about 25 amino acids. The linker may be glycine-rich for flexibility and serine or threonine-rich for solubility, and may link the N-terminus of the VH to the C-terminus of the VL, or vice versa. Such proteins retain the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker.

[0087] In a specific embodiment of the present invention, the FMC63 single chain variable fragment (scFv) was used as the anti-CD19 antibody.

[0088] In the present invention, the transmembrane domain is provided between the antigen-binding region and the signal transduction region of the CAR. The transmembrane domain allows the CAR to be anchored to the cell membrane of a cell expressing the CAR, while the antigen-binding region is present in the extracellular space and the signal transduction region is present within the cell. The transmembrane region of the CAR may be derived from a transmembrane region sequence for a membrane-binding protein. Examples include, but are not limited to, CD28 and CD8.

[0089] The signal transduction domain comprises an amino acid sequence required for activation of immune cell function. The CAR signal transduction domain may comprise an amino acid sequence from the intracellular domain of CD3 zeta, which provides an immunoreceptor tyrosine-based activation motif (ITAM) for phosphorylation and activation of CAR-expressing cells. Signal transduction domains comprising sequences from other ITAM-containing proteins, such as those comprising the ITAM-containing region of FcγRI, have also been utilized in CARs (Haynes et al., 2001 J Immunol 166(1):182-187). CARs comprising a signal transduction domain derived from the intracellular domain of CD3-zeta are often referred to as first-generation CARs.

[0090] The signaling domain of a CAR typically also includes the signaling domain of a costimulatory protein (e.g., CD28, 4-1BB, etc.) to provide the costimulatory signals necessary to enhance immune cell activation and effector function. CARs with signaling domains that include additional costimulatory sequences are referred to as second-generation CARs. In some cases, CARs are engineered to allow costimulation of different intracellular signaling pathways. For example, CD28 costimulation preferably activates the phosphatidylinositol 3-kinase (P13K) pathway, while 4-1BB costimulation triggers signaling via the TNF receptor-associated factor (TRAF) adaptor protein. Therefore, the signaling domain of a CAR sometimes contains costimulatory sequences derived from the signaling domains of one or more costimulatory molecules. CARs that include a signaling domain along with multiple costimulatory sequences are referred to as third-generation CARs.

[0091] An optional hinge or spacer region may provide separation between the antigen-binding domain and the membrane-penetrating domain, or may act as a flexible linker. Such a region may be or include a flexible region that allows the binding moiety to be oriented in different directions, such as may be derived from the CH1-CH2 hinge region of IgG.

[0092] By engineering NK cells to express a CAR specific for a particular target antigen, they can be directed to kill cells expressing the target antigen.

[0093] In the present invention, since the anti-CD19 CAR is expressed in natural killer cells, various known forms of CAR can be used regardless of the structure of the CAR, unlike T cells that are affected by the CAR structure.

[0094] The CAR of the anti-CD19 CAR according to a specific embodiment of the present invention may include, but is not limited to, a CD8 hinge, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3 zeta signaling domain.

[0095] According to a specific embodiment of the present invention, a genetic construct encoding an anti-CD19 CAR may comprise or consist of the base sequence of SEQ ID NO: 1.

[0096] GCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCT TCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACA ACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCC GTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA (SEQ ID NO: 1)

[0097] Considering variants having biologically equivalent activity, the gene encoding the anti-CD19 CAR of the present invention is interpreted to also include sequences that exhibit substantial identity with the sequences listed in the sequence listing. The substantial identity refers to a sequence that exhibits at least 60% identity, more preferably 70% identity, even more preferably 80% identity, and most preferably at least 90% identity when the sequence of the present invention and any other sequence are aligned to the greatest extent possible and the aligned sequences are analyzed using an algorithm commonly used in the art.

[0098] According to a specific embodiment of the present invention, the gene encoding the anti-CD19 CAR or the anti-CD19 CAR encoded by the gene may comprise a polynucleotide or polypeptide having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the base sequence defined above or the amino acid sequence encoded thereby.

[0099] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for comparison purposes. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of positions shared by the sequences that are identical or homologous. An "unrelated" or "non-homologous" sequence shares less than 40% identity, and preferably less than 25% identity, with one of the sequences of the present disclosure.

[0100] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a given percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" to another sequence means that when two sequences are aligned, the bases (or amino acids) are the same by that percentage.

[0101] The term "polynucleotide" refers to an isolated nucleic acid molecule or structure, such as messenger RNA (mRNA), virally derived RNA, or plasmid DNA (pDNA). A polynucleotide may comprise conventional phosphodiester linkages or non-conventional linkages (e.g., amide linkages, such as those found in peptide nucleic acids (PNA). The term "nucleic acid molecule" refers to any one or more nucleic acid segments, such as DNA or RNA fragments, present in a polynucleotide.

[0102] The term "polypeptide" refers to any chain or chains of two or more amino acids, and does not refer to a product of a specific length. Thus, terms such as peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain or chains of two or more amino acids are included within the definition of "polypeptide," and the term "polypeptide" may be used in place of or interchangeably with any of these terms. The term "polypeptide" is also intended to refer to the product of post-expression modification of a polypeptide, including, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-naturally occurring amino acids. Polypeptides may be derived from natural biological sources or produced by recombinant techniques, but are not necessarily translated from a designated nucleic acid sequence. They may be produced by any means, including chemical synthesis. The term "polypeptide" also encompasses variants and derivatives of polypeptides. Furthermore, the term "polypeptide fragment" refers to a polypeptide having, compared to the full-length protein, a deletion of the amino-terminal amino acid sequence, a deletion of the carboxyl-terminal amino acid sequence, and / or an internal deletion. Such fragments may also contain altered amino acids compared to the full-length protein.

[0103] In the present invention, the natural killer cells expressing the anti-CD19 CAR may be differentiated from pluripotent stem cells expressing the anti-CD19 CAR.

[0104] In this paper, the term "pluripotent stem cell" may refer to a cell that has the ability to differentiate into all cells that constitute the body, and may include induced pluripotent stem cells (iPSCs) and embryonic stem cells (ES cells), which generally have the common characteristic of differentiating into multiple potent cells. More specifically, embryonic stem cells are derived from the inner cell mass of a blastocyst in the preimplantation stage. The induced cells are maintained in a specific environment and are capable of unlimited culture and pluripotent differentiation. Furthermore, induced pluripotent stem cells may refer to pluripotent differentiated cells created by dedifferentiation from somatic cells, and are formed by making somatic cells into a state very similar to embryonic stem cells through a process called reprogramming, such as cell fusion, nuclear transfer, and overexpression of pluripotency regulatory factors. Furthermore, pluripotent stem cells are not limited to embryonic stem cells and induced pluripotent stem cells, and may include any cell possessing both differentiation pluripotency and self-renewal capacity. However, pluripotent stem cells are preferably mammalian cells, and more preferably human-derived induced pluripotent stem cells.

[0105] In the present invention, the pluripotent stem cell expressing the anti-CD19 CAR can be differentiated into a natural killer cell expressing the anti-CD19 CAR through the following steps a) to c):

[0106] a) A step of culturing pluripotent stem cells expressing anti-CD19 CAR in a medium containing mesoderm-inducing factors to obtain mesoderm;

[0107] b) culturing the mesoderm in a hematopoietic progenitor cell differentiation medium to obtain hematopoietic progenitor cells; and

[0108] c) A step of culturing the above hematopoietic progenitor cells in a natural killer cell differentiation medium to induce differentiation into natural killer cells expressing anti-CD19 CAR.

[0109] In the present invention, step a) is a step for differentiating pluripotent stem cells into mesoderm, and may be performed using a medium containing various mesoderm-inducing factors. In a specific embodiment of the present invention, the mesoderm-inducing factors may include, but are not limited to, Bmp4.

[0110] The term "medium" used herein refers to a mixture for the growth and proliferation of cells, such as stem cells, in vitro, containing essential elements for the growth and proliferation of cells, such as sugars, amino acids, various nutrients, serum, growth factors, and minerals.

[0111] According to a specific embodiment of the present invention, step a) may be performed by first culturing for 1 to 4 days by treating with a GSK-3β inhibitor, BMP4, and VEGF, then replacing the medium and second culturing for 1 to 4 days by treating with a TGF-β inhibitor, VEGF, and stem cell factor.

[0112] The above GSK-3β (Glycogen Synthase Kinase 3 beta, Glycogen Synthase Kinase-3β) inhibitor refers to a substance that inhibits or suppresses the activity of glycogen synthase kinase 3 beta. In the primary culture of step a), the GSK-3β inhibitor may be at least one selected from the group consisting of CHIR99021, CP21R7, CHIR98014, LY2090314, Kenpaulon, AR-AO144 18, TDZD-8, SB216763, BIO, TWS-119, and SB415286, but is not limited thereto. The GSK-3β inhibitor may be treated at a concentration of 0.5 to 2 μM. In a specific embodiment of the present invention, CHIR99021 was used as the GSK-3β inhibitor.

[0113] In the primary culture of step a), BMP4 can be treated at a concentration of 60 to 100 ng / ml, and VEGF can be treated at a concentration of 60 to 100 ng / ml.

[0114] In the secondary culture of step a), the TGF-β inhibitor may be at least one selected from the group consisting of SB431542, A-83-01, and RepSox, but is not limited thereto. The TGF-β inhibitor may be treated at a concentration of 0.5 to 2 μM. In a specific embodiment of the present invention, SB431542 was used as the TGF-β inhibitor.

[0115] In the secondary culture of step a), VEGF can be treated at a concentration of 60 to 100 ng / ml, and stem cell factor (SCF) can be treated at a concentration of 20 to 50 ng / ml.

[0116] In the present invention, the medium used for the primary culture in step a) may be Essential 8, and the medium used for the secondary culture in step a) may be Essential 6, but is not limited thereto.

[0117] In the present invention, the primary culture and secondary culture of step a) may each be performed for 1 to 4 days, preferably 1 to 3 days.

[0118] In the present invention, the step b) is a step of differentiating mesoderm into hematopoietic progenitor cells, and can be performed using a medium containing various chemokines and cytokines.

[0119] According to a specific embodiment of the present invention, step b) may be performed by culturing in 5 medium for 15 days by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, and FIT3 ligand.

[0120] In the culture of step b), β-mercaptoethanol can be treated at a concentration of 0.5 to 2 μM, sodium selenite can be treated at a concentration of 1 to 5 ng / ml, ethanolamine can be treated at a concentration of 30 to 60 μM, ascorbic acid can be treated at a concentration of 10 to 20 mg / L, stem cell factor can be treated at a concentration of 20 to 50 ng / ml, and FIT3 ligand can be treated at a concentration of 20 to 50 ng / ml.

[0121] In the present invention, the medium used in step b) may be Stepmpro™-34 SFM medium, but is not limited thereto.

[0122] In the present invention, step b) can be performed for 5 to 15 days, preferably 5 to 12 days.

[0123] In the present invention, the step c) is a step of differentiating hematopoietic progenitor cells into natural killer cells, and can be performed using a medium containing various chemokines and cytokines.

[0124] According to a specific embodiment of the present invention, the step c) may be performed by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, FIT3 ligand, IL7, IL15 and IL3, performing primary culture for 4 to 8 days, then replacing the medium and treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, FIT3 ligand, IL7, IL15 and p38 MAP kinase inhibitor, and culturing for 20 to 40 days.

[0125] The above p38 MAP kinase inhibitor may be any one or more selected from the group consisting of, but not limited to, SB203580, SB239063, VX-702, and BIRB 796.

[0126] In the primary culture of step c), β-mercaptoethanol can be treated at a concentration of 0.5 to 2 μM, sodium selenite can be treated at a concentration of 1 to 5 ng / ml, ethanolamine can be treated at a concentration of 30 to 60 μM, ascorbic acid can be treated at a concentration of 10 to 20 mg / L, stem cell factor can be treated at a concentration of 10 to 30 ng / ml, FIT3 ligand can be treated at a concentration of 5 to 20 ng / ml, IL7 can be treated at a concentration of 10 to 30 ng / ml, IL15 can be treated at a concentration of 5 to 20 ng / ml, and IL3 can be treated at a concentration of 2 to 5 ng / ml.

[0127] In the secondary culture of step c), β-mercaptoethanol can be treated at a concentration of 0.5 to 2 μM, sodium selenite can be treated at a concentration of 1 to 5 ng / ml, ethanolamine can be treated at a concentration of 30 to 60 μM, ascorbic acid can be treated at a concentration of 10 to 20 mg / L, stem cell factor can be treated at a concentration of 10 to 30 ng / ml, FIT3 ligand can be treated at a concentration of 5 to 20 ng / ml, IL7 can be treated at a concentration of 10 to 30 ng / ml, IL15 can be treated at a concentration of 5 to 20 ng / ml, IL3 can be treated at a concentration of 2 to 5 ng / ml, and p38 MAP kinase inhibitor can be treated at a concentration of 1 to 5 μM.

[0128] In the present invention, the medium used in the first and second cultures of step c) may be Stepmpro™-34 SFM medium, but is not limited thereto.

[0129] In the present invention, the primary culture of step c) may be performed for 4 to 12 days, preferably 6 to 10 days, and the secondary culture of step c) may be performed for 20 to 40 days, preferably 25 to 35 days.

[0130] In the present invention, the anti-CD19 CAR can specifically target pericytes in a tumor microenvironment, thereby enhancing the ability to migrate and penetrate into tumor cells, and can enhance the ability to specifically destroy tumor cells.

[0131] In the present invention, the solid tumor exhibiting a tumor microenvironment including the above-described pericyte may be, but is not limited to, glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, or metastatic brain tumor.

[0132] In the present invention, the term “prevention” means any act of suppressing or delaying the occurrence of cancer by administering the composition.

[0133] In the present invention, the term “treatment” means any act in which symptoms of cancer are improved or beneficially changed by administration of the composition.

[0134] The pharmaceutical composition of the present invention may be in the form of a “cell therapeutic agent.”

[0135] In the present invention, the term "cell therapy" refers to a medicine (as defined by the US FDA) used for the purposes of treatment, diagnosis, and prevention by separating, culturing, and manufacturing cells and tissues from an individual through special manipulation, and by performing a series of actions such as proliferating and selecting living autologous, allogeneic, or xenogeneic cells in vitro to restore the function of cells or tissues, or by changing the biological characteristics of cells through other methods.

[0136] For the purpose of the present invention, the cell therapeutic agent may include natural killer cells expressing an anti-CD19 CAR manufactured according to the present invention, and exhibits efficacy in preventing or treating cancer.

[0137] The above cell therapy is 1 X 10 5 1 x 10 pcs / kg 12 It can be administered per kg, preferably 1 X 10 6 1 x 10 pcs / kg 10 It can be administered in units of one to one kg, but is not limited thereto.

[0138] The above cell therapy agent can be administered by formulating a pharmaceutical preparation in a unit dosage form suitable for administration into the patient's body according to a conventional method in the pharmaceutical field, and the preparation contains an effective dosage amount through one or more administrations. Suitable dosage forms for this purpose include parenteral administration preparations such as injections such as injection ampoules, infusions such as infusion bags, and sprays such as aerosol preparations. The injection ampoules can be mixed and prepared with an injection solution immediately before use, and the injection solution can be physiological saline, glucose, mannitol, Ringer's solution, etc. In addition, the infusion bag can be made of polyvinyl chloride or polyethylene, and examples thereof include infusion bags from Baxter, Becton Dickinson, Medcep, National Hospital Products, and Terumo.

[0139] In addition to the active ingredient, the above pharmaceutical preparation may further include one or more pharmaceutically acceptable conventional inert carriers, for example, in the case of injections, a preservative, analgesic, solubilizer, or stabilizer, and in the case of topical administration preparations, a base, excipient, lubricant, or preservative.

[0140] The cell therapy composition of the present invention manufactured in this way or the pharmaceutical preparation thereof can be administered together with other cells used for cancer treatment or in the form of a mixture with such cells using an administration method commonly used in the art, preferably by direct engraftment or transplantation into the diseased site of a patient requiring treatment or direct transplantation or injection into the abdominal cavity, but is not limited thereto. In addition, the administration can be both non-surgical administration using a catheter and surgical administration methods such as injection or transplantation after incision of the diseased site. In addition to parenteral administration according to a conventional method, for example, direct administration to the lesion, transplantation by intravascular injection is also possible.

[0141] The above cell therapy composition may be administered at a dosage of 0.0001 to 1000 mg / kg per day, specifically 0.001 to 100 mg / kg, and the administration may be administered once a day or in several divided doses. However, it should be understood that the actual dosage of the active ingredient should be determined in light of various related factors such as the disease to be treated, the severity of the disease, the route of administration, the patient's weight, age, and sex, and therefore, the above dosage does not limit the scope of the present invention in any way.

[0142] The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, excipient or diluent commonly used in the manufacture of pharmaceutical compositions, and the carrier may comprise a non-naturally occuring carrier. Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0143] In addition, the pharmaceutical composition may be formulated and used in the form of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, transdermal absorbents, gels, lotions, ointments, creams, patches, cataplasmas, pastes, sprays, skin emulsions, skin suspensions, transdermal delivery patches, drug-containing bandages, or suppositories, each according to a conventional method.

[0144] Specifically, when formulating, it can be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants that are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, and capsules. These solid preparations can be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. In addition to liquids for oral administration and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives can be added to prepare the preparation. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include withepsol, macrogol, Tween 61, cocoa butter, laurin butter, and glycerogelatin.

[0145] The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined according to factors including the type and severity of the individual, age, sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. For example, the pharmaceutical composition can be administered at a dosage of 0.0001 to 1000 mg / kg per day, specifically 0.001 to 100 mg / kg, and the administration can be administered once a day or in several divided doses.

[0146] The above pharmaceutical composition can be administered as an individual treatment or in combination with other treatments, and can be administered sequentially or simultaneously with conventional treatments. It can be administered singly or in multiple doses. Taking all of the above factors into account, it is important to administer the amount that achieves maximum effect with the minimum amount possible without causing side effects, a decision that can be readily made by those skilled in the art.

[0147] The above "administration" means introducing the composition of the present invention into a subject by any suitable method, and the route of administration of the composition may be through any common route as long as it can reach the target tissue. Examples of administration include, but are not limited to, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, and intranasal administration.

[0148] The above "subject" refers to any animal, including a human, monkey, cow, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, or guinea pig, that has developed or may develop cancer. The type of subject may be included without limitation, as long as the disease can be effectively prevented or treated by administering the pharmaceutical composition of the present invention to the subject.

[0149] A second aspect of the present invention relates to a glioblastoma-vascular fusion organoid produced by co-culturing a vascular organoid and a glioblastoma spheroid.

[0150] In the present invention, the glioblastoma-blood vessel-assembloid organoid may also be referred to as a “glioblastoma-blood vessel-assembloid (GBM-blood vessel-assembloid, GBVA).”

[0151] In the present invention, the term "spheroid" refers to a densely packed state of cells, which may be in a tissue state or a single-cell state. For the purposes of the present invention, the spheroid may be a densely packed state of cancer cells, and the cancer spheroid may exist as a cancer tissue itself, a portion of the cancer tissue, or an aggregate of single cancer cells.

[0152] The above cancer spheroid may refer to a three-dimensional object having a geometric three-parameter model (e.g., depth, height, width or X, Y, Z dimensions) rather than a two-dimensional object, and generally refers to a three-dimensional cancer cell structure in which cancer cells are aggregated to the extent that the cross-section may appear circular or oval. The above cancer spheroid may refer to a three-dimensional culture, that is, a cancer spheroid that is detached from a culture vessel and cultured in a floating state, and has a three-dimensional spherical shape as the cells proliferate, and may refer to an artificial three-dimensional spheroid formed by tissue engineering technology.

[0153] In the present invention, the term "organoid" refers to a small cultured organism that reproduces both the form and function of a tissue or organ. More specifically, an organoid must contain one or more cell types among the various cell types that constitute an organ or tissue, be able to reproduce the specific functions of each organ, and be spatially organized into a form similar to an organ by clumping together cells. Organoids differ from spheroids in that they are not simply aggregates of cells but rather form a system. They can be utilized as patient-specific models for new drug development, artificial organs, disease treatments, and disease therapies.

[0154] In the present invention, the glioblastoma-vascular fusion organoid can implement a tumor microenvironment expressing pericytes, for example, CD19 positive pericytes, and can simulate the phenomenon of tumor metastasis through perivascular gaps in vitro.

[0155] In the present invention, a glioblastoma-vascular fusion organoid can be produced through the following steps a) and b):

[0156] a) a step of culturing pluripotent stem cells and differentiating them into vascular organoids with formed vascular networks; and

[0157] b) A step of producing a glioblastoma-vascular fusion organoid by co-culturing a vascular organoid in which the above vascular network is formed and a glioblastoma spheroid.

[0158] The above step a) can be applied without limitation to any known protocol that can differentiate pluripotent stem cells into vascular organoids with formed vascular networks.

[0159] For example, the above step a) may be performed by the following steps a-1) to a-4):

[0160] a-1) A step of forming cell aggregates by culturing pluripotent stem cells in a medium containing a ROCK inhibitor;

[0161] a-2) A step of culturing the cell aggregate in a mesoderm induction medium containing a GSK-3β inhibitor and BMP-4;

[0162] a-3) A step of inducing vascular differentiation by culturing in a medium containing VEGF-A and forskolin; and

[0163] a-4) A step of forming a vascular network by inserting cell aggregates induced to undergo vascular differentiation into a mixture of collagen and extracellular matrix and treating them with fetal bovine serum, VEGF-A, and FGF-2.

[0164] The pluripotent stem cells of step a-1) above are the same as described above, so their description is omitted.

[0165] The ROCK inhibitor of step a-1) may be at least one selected from the group consisting of Fasudil, Y-27632, HA-1077, Y-39983, and Wf-536, but is not limited thereto. The ROCK inhibitor may be administered at a concentration of 30 μM to 70 μM. In a specific embodiment of the present invention, Y-27632 was used as the ROCK inhibitor.

[0166] The GSK-3β inhibitor of step a-2) is the same as described above, so its description is omitted. The GSK-3β inhibitor can be treated at a concentration of 8 μM to 16 μM, and BMP-4 can be treated at a concentration of 10 to 50 ng / ml. In a specific embodiment of the present invention, CHIR99021 was used as the GSK-3β inhibitor.

[0167] VEGF-A in the above step a-3) can be treated at a concentration of 50 to 150 ng / ml, and forskolin can be treated at a concentration of 0.5 to 4 μM.

[0168] In the present invention, the term "extracellular matrix (ECM)" refers to a support for the development of a three-dimensional tissue structure that plays a crucial role in providing signals that influence various cellular metabolic pathways, such as cell proliferation, differentiation, and apoptosis. The extracellular matrix can store and supply biochemical factors necessary for cell growth and differentiation, while also providing a physical environment that cells can recognize. The extracellular matrix is ​​a product produced by the cells that make up each tissue as needed, and includes structural proteins such as collagen and elastin, polysaccharides such as glycosaminoglycan (GAG), adhesive proteins that help cell adhesion, and growth factors. This extracellular matrix is ​​composed of different components depending on the tissue and cell from which it is derived, and has special physical properties.

[0169] The collagen of the above step a-4) may be type 1 collagen, and the extracellular matrix may include laminin, type 4 collagen, heparin sulfate proteoglycan, entactin, nidogen, and growth factors. Preferably, the extracellular matrix may be matrigel.

[0170] As used herein, the term "Matrigel" refers to a protein complex extracted from Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells (a product name of BD Bioscience), which contains extracellular matrix (ECM) such as laminin, collagen, and heparin sulfate proteoglycan, and growth factors such as fibroblast growth factor (FGF), epidermal growth factor (EFG), insulin-like growth factor (IGF), transforming growth factor-beta (TGF-β), and platelet-derived growth factor (PDGF). The complex constituting Matrigel provides a complex extracellular environment found in many tissues, and is used as a substrate for cell culture.

[0171] The serum of the above step a-4) may be at least one selected from the group consisting of fetal bovine serum (FBS), human platelet lysate (hPL), human serum (HS), platelet-rich plasma (PRP), platelet poor plasma (PPP), calf serum, horse serum, porcine serum, and sheep serum, but is not limited thereto, and serum replacements may be used instead of serum.

[0172] In the above step a-4), serum can be treated at a concentration of 10 to 20% (v / v), VEGF-A can be treated at a concentration of 50 to 150 ng / ml, and FGF-2 can be treated at a concentration of 50 to 150 ng / ml.

[0173] In the present invention, the vascular organoids and glioblastoma spheroids in which the vascular network of step b) is formed can be co-cultured in a medium in which a medium for culturing vascular organoids and a medium for culturing glioblastoma spheroids are mixed.

[0174] In the present invention, the medium for culturing the vascular organoid may be any one selected from the group consisting of StemPro-34 SFM and EGM-2 (Endothelial Cell Growth Medium-2), and the medium for culturing the glioblastoma spheroid may be any one selected from the group consisting of DMEM (Dulbeco's Modified Eagle's Medium), IMDM (Iscove's Modified Dulbecco's Medium), a-MEM (Alpha Modification of Eagle's Medium), F12 (Nutrient Mixture F-12), RPMI 1640, Williams's medium E, McCoy's 5A, and DMEM / F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12).

[0175] In the present invention, the mixing ratio of the vascular organoid culture medium and the glioblastoma spheroid culture medium can be adjusted depending on the number of glioblastoma spheroids to be co-cultured with the vascular organoids.

[0176] In the present invention, step b) may be performed for 4 days or more, preferably 4 to 20 days.

[0177] In addition, the present invention provides a glioblastoma-vascular fusion organoid produced by the method for producing a glioblastoma-vascular fusion organoid described above.

[0178] In the present invention, the glioblastoma-vascular fusion organoid can implement a tumor microenvironment expressing pericytes, preferably CD19 positive pericytes, and can simulate the phenomenon of tumor metastasis through perivascular gaps in vitro.

[0179] A third aspect of the present invention relates to a microcirculation chip loaded with the aforementioned glioblastoma-vascular fusion organoid and an animal model into which the aforementioned glioblastoma-vascular fusion organoid is xenografted.

[0180] In the present invention, the microcirculation chip may be provided with a chamber as a platform for 3D tissue culture; and a first channel and a second channel communicating with the chamber. A glioblastoma-vascular fusion organoid may be placed in the chamber, and a medium and / or a drug may be injected into each of the first and second channels. Here, the amount of medium injected into one of the first and second channels is greater than the amount of medium injected into the other channel, and this difference in the amount of medium may cause a step to form a flow of medium. Accordingly, a drug may be injected into a channel into which a greater amount of medium has been injected, and the drug may be delivered to the glioblastoma-vascular fusion organoid according to the flow of medium.

[0181] In the present invention, the drug may be an anticancer agent candidate, including a cell therapy agent. In a specific embodiment of the present invention, the therapeutic efficacy of the drug was demonstrated in a microcirculation chip equipped with glioblastoma-vascular fusion organoids using natural killer cells expressing the anti-CD19 CAR produced in the present invention.

[0182] An animal model in which the glioblastoma-vascular fusion organoid of the present invention is xenografted can be produced through the following steps a) and b):

[0183] a) a step of manufacturing a glioblastoma-vascular fusion organoid with a vascular network formed by inserting vascular organoids and glioblastoma spheroids into an extracellular matrix and then treating with serum, VEGF-A, and FGF-2; and

[0184] b) A step of transplanting the above glioblastoma-vascular fusion organoid into an animal model other than human.

[0185] In the process of manufacturing an animal model in which the glioblastoma-vascular fusion organoid of the present invention is xenografted, the vascular organoid of step a) may be obtained by performing steps a-1) to a-3) in the differentiation protocol for vascular organoids with a vascular network formed as described above, and since the description of each step is the same as described above, the description thereof is omitted.

[0186] In the process of manufacturing an animal model in which the glioblastoma-vascular fusion organoid of the present invention is xenotransplanted, step a) is identical to step a-4) in the differentiation protocol for vascular organoids with a vascular network formed as described above, and therefore, description thereof is omitted.

[0187] In the process for producing an animal model in which the glioblastoma-vascular fusion organoid of the present invention is xenografted, the glioblastoma spheroid of step a) may have a bioluminescent substance overexpressed so as to enable in vivo tracking. A preferred bioluminescent substance is, but is not limited to, luciferase. For example, when a glioblastoma spheroid overexpressing luciferase is used, the survival and migration of the glioblastoma can be confirmed in vivo.

[0188] In the process for producing an animal model in which the glioblastoma-vascular fusion organoids of the present invention are xenografted, the glioblastoma-vascular fusion organoids of step a) can be cultured to a volume suitable for animal model transplantation. For example, a plurality of vascular organoids and a plurality of glioblastoma organoids can be fused to produce a spherical fusion organoid having a diameter of approximately 2 mm.

[0189] In the process of manufacturing an animal model in which the glioblastoma-vascular fusion organoid of the present invention is xenografted, the glioblastoma-vascular fusion organoid of step a) may be inserted into an extracellular matrix such as Matrigel before being transplanted into the animal model.

[0190] In the process for producing an animal model in which the glioblastoma-vascular fusion organoid of the present invention is xenografted, the animal model of step b) may be a mammal other than a human. The mammal other than a human is preferably a vertebrate, such as a mammal, a reptile, a bird, an amphibian, or a fish. A terrestrial vertebrate is particularly preferred. In one embodiment of the present invention, the mammal is particularly preferably a mouse, a cow, a horse, a cat, a dog, or a non-human primate. In a specific embodiment of the present invention, a tumor microenvironment expressing pericytes was established in vivo by transplanting the glioblastoma-vascular fusion organoid into an immunodeficient mouse.

[0191] The glioblastoma-vascular fusion organoid xenograft model according to the present invention can replicate a tumor microenvironment expressing human pericytes in the body, and can be utilized to evaluate the efficacy of cell therapies or drugs delivered via the circulatory system. Furthermore, producing glioblastoma-vascular fusion organoids using patient-derived cells enables patient-specific modeling. Furthermore, xenografting into immunodeficient mice can be used to create an in vivo model for preclinical evaluation of glioblastoma treatment candidates.

[0192] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0193] [Example 1]

[0194] Differentiation of NK cells derived from anti-CD19 CAR-expressing induced pluripotent stem cells

[0195] 1-1. Cell culture

[0196] Human iPSC lines used to generate induced pluripotent stem cell-derived NK (iNK) cells were characterized as previously reported [GP Cribaro et al., Acta Neuropathol. Commun. 9 (1) (2021) 24.]. iPSCs were maintained on vitronectin (Gibco, USA)-coated plates in Essential 8 medium (Gibco), with daily medium changes. Passaging was performed using ReLeSR reagent (STEMCELL Technologies, Canada).

[0197] 1-2. Lentivirus production and transduction of iPSCs using CD19 CAR

[0198] To generate the virus, 24 ml Convoy (ACTGene, USA), 4 mg pSLCAR-CD19-28z (Addgene, USA), 2 mg VSV-G, and 2 mg Gag-Pol were mixed and incubated at 25°C for 10 min. This mixture was 2 Х10 6293FT cells were added and cultured overnight at 37°C in 5% CO2. The supernatant containing the virus was collected 24 and 48 hours after transduction and stored at 4°C. To concentrate the virus, the supernatant was passed through a 0.45 μm filter, mixed at a 1:3 ratio using a Retro-X concentrator (Clontech, USA), and incubated overnight at 4°C. The mixture was centrifuged at 4000 rpm for 60 min at 4°C. The supernatant was discarded, and the virus-containing pellet was resuspended in PBS (HyClone, USA), aliquoted, and stored at -80°C until further use. The thawed virus was introduced into iPSCs overnight at a multiplicity of infection (MOI) of 10. Seven days later, fluorescent cells were mechanically separated and passaged. Fluorescent cells were passaged weekly to produce stable cell lines. A schematic diagram of the functional domain of the anti-CD19 CAR gene is shown in Figure 1. Expression of the introduced anti-CD19 CAR was also indicated by the expression of enhanced green fluorescent protein (EGFP).

[0199] 1-3. iNK cell production

[0200] Following the protocol described in Figure 2, anti-CD19 CAR transduced induced pluripotent stem cells were differentiated into NK cells. Referring to Figure 2, anti-CD19 CAR-expressing NK cells on day 50 can be produced through the differentiation process of induced pluripotent stem cells (iPSCs) → mesoderm → hematopoietic stem cells (HPCs) → NK cells.

[0201] The specific method was as follows. iPSCs or CAR-iPSCs were seeded onto SphericalPlate 5D (Kugelmeiers, Germany) and cultured for 1 day. The spheroids were then transferred to T-flasks and cultured for 4–5 days to promote cell attachment and further expansion. Mesoderm differentiation was initiated by treating the cells with a special medium containing mesoderm-inducing factors for 0–4 days. After mesoderm induction, the cells were cultured for 4–14 days in hematopoietic progenitor cell (HPC) differentiation medium. This step included the application of specific chemokines and cytokines to induce HPC development. NK cell differentiation was then initiated by introducing NK cell differentiation medium supplemented with chemokines and cytokines for 14–50 days. iNK cells were cultured in NK differentiation medium and treated with 500 U / ml IL-2 every other day.

[0202] 1-4. Flow cytometry

[0203] To determine the HPC differentiation efficiency, flow cytometry analysis was performed. Results showed that approximately 60% of day-14 cells expressed HPC markers (Fig. 3a), and approximately 20% of day-50 differentiated cells were lymphocytes, exhibiting high expression of NK cell markers (Fig. 3b).

[0204] Flow cytometry analysis of anti-CD19 CAR expression in 50-day induced pluripotent stem cell-derived NK cells revealed a significant increase in anti-CD19 CAR expression compared to the non-transduced control NK cell group (Figures 4a and 4b). Anti-CD19 CAR expression in induced pluripotent stem cell-derived NK cells showed differences in cytotoxicity in the CD19-positive B lymphoma cell line Raji and the CD19-negative chronic myelogenous leukemia cell line K562 (Figure 4c). In addition, when a cytotoxic response was induced through co-culture with Raji cells, the expression of CD107a, a cytotoxic granule secretion marker, and the secretion of interferon gamma (IFN-γ), a cytotoxic cytokine, increased in the anti-CD19 CAR-expressing NK cell group compared to the control NK cell group (Figures 4d to 4f).

[0205] The results of this example demonstrate that the anti-CD19 expressing induced pluripotent stem cell-derived NK cells produced exhibit a CD19-specific cytotoxic response.

[0206] [Example 2]

[0207] In vitro modeling of the glioblastoma tumor microenvironment using glioblastoma-vascular fusion organoids.

[0208] 2-1. Creation of glioblastoma-vascular fusion organoids

[0209] Upon fusion of glioblastoma-vascular organoids, vascular organoids were generated as follows. iPSC aggregates were seeded onto low-attachment plates in aggregation medium containing 50 μM Y-27632. The following day, the medium was replaced with N2B27 medium supplemented with 12 μM CHIR99021 (Peprotech) and 30 ng / ml BMP4 (Peprotech). The medium was changed daily for 3 days. On day 3, the medium was replaced with N2B27 supplemented with 100 ng / ml VEGF-A (R&D Systems, MN USA) and 2 μM forskolin (Sigma). On day 5, the aggregates were embedded in Col1-Mat solution and cultured in BVO medium (StemPro-34 SFM medium (Gibco) containing 15% FBS, 100 ng / ml VEGF-A, and 100 ng / ml FGF2). The vascular network was formed on the 10th day through the vascular differentiation process. The vascular network on the 11th day was co-cultured with glioblastoma spheroids prepared two days prior in an ultra-low attachment U-bottom 96-well plate according to the protocol described in Fig. 5. At this time, the co-culture medium was used by mixing vascular organoid medium (StemPro-34 SFM medium (Gibco) supplemented with 15% fetal bovine serum (FBS, Gibco), 100 ng / ml VEGF-A, and 100 ng / ml FGF2) and RPMI-10 medium (RPMI 1640 medium (Gibco) supplemented with 10% FBS (Gibco)) in a 1:1 ratio. Glioblastoma spheroids were prepared by seeding 5,000 U87MG cells per well of an ultra-low attachment U-bottom 96-well plate labeled with 30 μM CellTracker™ Blue (Invitrogen) reagent for 30 minutes, centrifuging the plate at 2,000 rpm for 5 minutes, and culturing for 48 hours without changing the medium.Co-cultured glioblastoma spheroids up to day 15 were internalized along with the self-assembly process of vascular organoids, and then an additional week of culture was performed to confirm glioblastoma metastasis within the fused organoids.

[0210] Within the glioblastoma-vascular fusion organoids, glioblastoma cells expressed epidermal growth factor receptor (EGFR) and isocitrate dehydrogenase-1 (IDH1), which are glioblastoma markers (Fig. 6a), and a population expressing glioblastoma stem cell markers CD44 and SOX2 was also found (Fig. 6b). In addition, expression of the pericyte marker platelet-derived growth factor receptor-beta (PDGFRβ) was observed around the glioblastoma cells, and some of the vasculature of the vascular organoids had infiltrated into the glioblastoma cells (Fig. 6c). In addition, expression of the astrocyte marker glial fibrillary acidic protein (GFAP) and the tumor-associated macrophage marker ionized calcium-binding adapter molecule-1 (IBA1) was observed around the glioblastoma cells (Fig. 6d).

[0211] During the differentiation of glioblastoma-vascular fusion organoids, intra-organoid metastasis of glioblastoma cells was observed from day 15 (Fig. 7a). Furthermore, from day 15, the expression of the pericyte marker PDGFRβ increased around glioblastoma cells, and the co-localization value between PDGFRβ and glioblastoma cells also increased (Figs. 7b-7d).

[0212] CD19, expressed on pericytes, was also confirmed to be expressed in glioblastoma-vascular fusion organoids (Fig. 8a), and CD19 expression in fused organoids was significantly increased compared to non-fused blood vessel organoids (Fig. 8b). The co-localization value of CD19 expression within pericytes and glioblastoma cells was very high at 80%, confirming that CD19 in glioblastoma-vascular fusion organoids was mostly expressed in glioblastoma stem cell-derived pericytes (Fig. 8c).

[0213] The results of this study demonstrate that the glioblastoma-vascular fusion organoids produced structurally and functionally mimic the glioblastoma tumor microenvironment. Furthermore, CD19 expression was demonstrated in pericytes in the glioblastoma perivascular niche.

[0214] [Example 3]

[0215] Method for destroying glioblastoma using NK cells derived from anti-CD19 CAR-expressing induced pluripotent stem cells

[0216] This example aimed to evaluate the effect of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells on the destruction of glioblastoma in an in vitro glioblastoma tumor microenvironment model through glioblastoma-vascular organoid fusion produced in Example 2 and the CD19-targeted glioblastoma treatment of NK cells through this. To this end, the CD19-targeted NK cells of anti-CD19 CAR-expressing induced pluripotent stem cells produced in Example 1 were evaluated for 1) enhanced migration ability and 2) tumor cell-specific destruction ability.

[0217] To evaluate the migratory ability of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells, NK cells were labeled with 10 μM Vybrant™ CFDA SE (Intivrogen) reagent for 30 minutes. 5,000 induced pluripotent stem cell-derived NK cells and one glioblastoma-vascular fusion organoid (GBVA) per well were co-cultured in ultra-low attachment U-bottom 96-well plates for 48 hours using the method of Figure 9. The locations of the labeled NK cells were confirmed by examining the cross-section of the organoids.

[0218] Anti-CD19 CAR-expressing iPSC-derived NK cells inside glioblastoma-vascular fusion organoids infiltrated the glioblastoma tumor microenvironment and migrated toward glioblastoma cells, whereas control iPSC-derived NK cells showed less infiltration and migration (Figs. 10a and 10b). The increased co-localization value of CD19 and NK cells confirmed that the migration of anti-CD19 CAR-expressing iPSC-derived NK cells was CD19-dependent (Fig. 10c), and serial section immunostaining of organoids confirmed that CD19 was expressed on glioblastoma stem cell-derived pericytes, allowing anti-CD19 CAR-expressing iPSC-derived NK cells to effectively access glioblastoma cells (Fig. 10d).

[0219] Platelet-derived growth factor-DD (PDGF-DD), whose secretion is promoted by the interaction between glioblastoma cells and the perivascular niche, is a ligand not only for PDGFRβ but also for NKp44, a cytotoxic-activating receptor of NK cells. Immunostaining of cross-sections of fusion organoids confirmed that NKp44 expression was increased in NK cells that had migrated into the glioblastoma tumor microenvironment (Figs. 11a and 11b). In the anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cell population, increased migration toward the pericyte-expressing tumor microenvironment resulted in increased NKp44 expression (Fig. 11c).

[0220] [Example 4]

[0221] Microcirculation chip assay

[0222] In this example, a method was devised to simulate the in vivo environment by mounting glioblastoma-vascular fusion organoids on a microcirculation chip (Fig. 12A). An organiX (AIM biotech) microcirculation chip was used, and a single glioblastoma-vascular fusion organoid was injected into the central gel port together with collagen gel (2.5 mg / ml, pH 7.4), and gel polymerization was induced in a 37°C incubator for 1 hour. Afterwards, the medium channel was hydrated with culture medium, and 300 μl of RPMI-10 medium was added to both reservoirs of the chip. The next day, all the medium in the reservoirs was removed, and 2 X 10 5 NK cells were resuspended in 150 μl of NK cell medium containing 500 U / ml IL-2 and injected into one medium channel. 150 μl of NK cell medium was added to both reservoirs to maintain blood flow within the microcirculation chip. The glioblastoma-vascular fusion organoids mounted on the microcirculation chip were live-imaged using a confocal microscope for 30 min after NK cell injection, and co-cultured for an additional 24 h to ensure sufficient reaction between the injected NK cells and the fused organoids. For analysis, the fused organoids in the central gel port were harvested using an organiX Extractor (AIM biotech), and the collagen gel was separated using a pipette tip to remove non-invading NK cells. The isolated fused organoids were digested with a mixture of 5 U / ml type I collagenase (Sigma) and 3 U / ml dispase (Sigma) for 20 minutes in a 37°C incubator to single cells, and then NK cells that had infiltrated into the fused organoids were quantified by flow cytometry, and dead glioblastoma cells were quantified.

[0223] Time-lapse live imaging confirmed that NK cells within the microcirculation chip migrated along the media flow (Figure 12B). Furthermore, NK cells were observed migrating toward glioblastoma cells within the chip (Figure 12C). Flow cytometry analysis confirmed the enhanced infiltration and cell filtration capacity of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells into glioblastoma cells (Figure 12D).

[0224] [Example 5]

[0225] Modeling the Glioblastoma Tumor Microenvironment Xenograft Using Glioblastoma-Blood Vessel Fusion Organoids

[0226] 5-1. Creation of an in vivo animal model using xenografted glioblastoma-vascular fusion organoids.

[0227] This example aims to establish a technique for in vivo modeling of a glioblastoma tumor microenvironment through xenografting of the glioblastoma-vascular fusion organoids produced in Example 2, and to evaluate a method for testing the destruction of glioblastoma by anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells in the produced glioblastoma tumor microenvironment xenograft model, and the effect of CD19-targeting glioblastoma treatment by NK cells through the method.

[0228] First, we devised a method to create an in vivo model by xenografting glioblastoma-vascular fusion organoids into immunodeficient mice (Fig. 13a). Glioblastoma spheroids produced from luciferase-expressing U87MG cells and vascular organoids on day 5 of differentiation were prepared by placing them in the Col1-Mat solution described in the literature [WIMMER, Reiner A., ​​et al., Nature Protocols, 14.11: 3082-3100 (2019)]. Four glioblastoma spheroids and six vascular organoids per well of an ultra-low-suspending U-bottom 96-well plate were placed with 200 μl of Col1-Mat solution and incubated at 37°C for gel polymerization. The cells were then cultured in co-culture medium for 7 days. For comparison with glioblastoma-vascularized organoids, four glioblastoma spheroids were gel-polymerized with 200 μl of Col1-Mat solution and cultured in co-culture medium for 7 days. The fabricated glioblastoma-vascularized organoids and glioblastoma spheroids were cultured in 8-week-old male NOD / Shi-scid / IL-2Rγ null After subcutaneous transplantation on the left flank of the mouse, it was sutured with 10-0 nylon thread (Fig. 13b).

[0229] After 3 weeks, the xenografted glioblastoma-vascularized organoids showed expression of the human endothelial cell marker hCD31 and the mouse endothelial cell marker mCD31, and the transplanted human blood vessels were connected to the mouse blood vessels. In contrast, the glioblastoma spheroids showed almost no expression of human endothelial cell markers (Fig. 14a). In addition, the human pericyte markers PDGFRβ and CD19 were expressed inside the transplanted glioblastoma-vascularized organoids, whereas in the transplanted glioblastoma spheroids, PDGFRβ and CD19 were expressed only in the outer region and not inside (Fig. 14b).

[0230] 5-2. Evaluation of the Glioblastoma Growth Inhibitory Efficacy of Anti-CD19 CAR-Expressed NK Cells Derived from Induced Pluripotent Stem Cells

[0231] In this example, we evaluated the inhibitory efficacy of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells on glioblastoma growth in glioblastoma-vascular fusion organoids through CD19 targeting. To this end, anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells were administered via tail vein injection, and the growth of glioblastoma was tracked by quantifying bioluminescence. In addition, the distribution of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells that had infiltrated the cancer tissue was confirmed through dissection (Fig. 15). At this time, IL-15 and IL-2 were administered intraperitoneally at 1 μg / ml at weekly intervals to promote the differentiation and activity of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells in vivo.

[0232] To confirm the therapeutic efficacy of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells for glioblastoma through CD19 targeting, bioluminescence quantification was performed using IVIS Spectrum (PerkinElmer) equipment one day before NK cell administration in mice 3 weeks after transplantation, and the mice were divided into four experimental groups as follows.

[0233] Experimental group 1: glioblastoma-vascular fusion organoids and control NK cells;

[0234] Experimental group 2: glioblastoma-vascular fusion organoids and anti-CD19 CAR NK cells;

[0235] Experimental group 3: glioblastoma spheroids and control NK cells; and

[0236] Experimental group 4: Glioblastoma spheroids and anti-CD19 CAR NK cells.

[0237] NK cells labeled with 10 μM Vybrant™ CFDA SE (Intivrogen) reagent were injected at 3.5 X 10 per mouse. 6Each dog was administered via tail vein. When bioluminescence was measured on days 1, 5, 8, and 12 after administration (Fig. 16a), a significant difference in glioblastoma growth was observed between experimental groups 1 and 2 (Fig. 16b), but no difference was observed between experimental groups 3 and 4 (Fig. 16c).

[0238] Analysis of the transplanted glioblastoma tissues showed that anti-CD19 CAR-expressing iPS cell-derived NK cells infiltrated into the cancer tissues of the glioblastoma-vascularized fusion organoid transplantation group, whereas they were deposited outside the tissues of the glioblastoma spheroid transplantation group (Fig. 17a). Quantification of the infiltrating NK cells confirmed a significant difference between the anti-CD19 CAR-expressing iPS cell-derived NK cells in the glioblastoma-vascularized fusion organoid tissues and the control iPS cell-derived NK cells, and differences in the infiltration capacity of anti-CD19 CAR-expressing iPS cell-derived NK cells were observed between the glioblastoma-vascularized fusion organoid and glioblastoma spheroid transplantation models (Fig. 17b).

[0239] When the location of NK cells infiltrating the tissue was confirmed by cross-sectional immunostaining, anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells were present around PDGFRβ-expressing pericytes (Figs. 18a and 18b), and NKp44 expression of the infiltrating anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells was also confirmed (Fig. 18c).

[0240] [Example 6]

[0241] Validation of the therapeutic potential of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells in glioblastoma using glioblastoma-vascular fusion organoids.

[0242] This example was conducted to verify the therapeutic ability of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells for glioblastoma using in vivo modeling of the glioblastoma tumor microenvironment through glioblastoma-vascular fusion organoid xenografting, and to identify the effective administration dose and period as a cell therapy.

[0243] First, to determine the difference in efficacy depending on the administered dose of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells, bioluminescence quantification was performed using IVIS Spectrum (PerkinElmer) equipment one day before NK cell administration in mice 3 weeks after glioblastoma-vascular fusion organoid transplantation, and the mice were divided into three experimental groups as follows.

[0244] Experimental group 1: Control group NK cells;

[0245] Experimental group 2: single administration of anti-CD19 CAR NK cells; and

[0246] Experimental group 3: 2 doses of anti-CD19 CAR NK cells.

[0247] NK cells labeled with 10 μM Vybrant™ CFDA SE (Intivrogen) reagent were injected once per mouse at a dose of 3.5 X 10 6 Each group was administered tail vein injection. NK cell administration was performed three weeks after transplantation, and NK cells were additionally administered to the second administration group two days later. At this time, IL-15 and IL-2 were administered intraperitoneally at 1 μg / ml at one-week intervals to promote the differentiation and activity of NK cells derived from induced pluripotent stem cells expressing anti-CD19 CAR in vivo.

[0248] To confirm the inhibition of glioblastoma growth, bioluminescence was measured using an IVIS Spectrum (PerkinElmer) instrument on the day before, the day after, 7 days after, and 14 days after cell administration. As a result, the group administered two doses of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells effectively inhibited glioblastoma growth compared to the single dose and the control NK cell administration group (Fig. 19a). In addition, a significant reduction in tumor size was confirmed in the two-dose group (Fig. 19b).

[0249] Next, to confirm the duration of efficacy of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells, bioluminescence quantification was performed using IVIS Spectrum (PerkinElmer) equipment one day before NK cell administration to mice 3 weeks after glioblastoma-vascular fusion organoid transplantation, and the mice were divided into four experimental groups as follows.

[0250] Experimental group 1: PBS administration;

[0251] Experimental group 2: 3.5 x 10 NK cells 6 administration;

[0252] Experimental group 3: 3.5 X 10 anti-CD19 CAR NK cells 6 administration;

[0253] Experimental group 4: 7 x 10 anti-CD19 CAR NK cells 6 administration.

[0254] NK cells labeled with 10 μM Vybrant™ CFDA SE (Intivrogen) reagent were administered via tail vein. NK cell administration was performed at 3 weeks after transplantation, and IL-15 and IL-2 were administered intraperitoneally at 1 μg / ml at weekly intervals to promote the differentiation and activity of NK cells derived from anti-CD19 CAR-expressing induced pluripotent stem cells in vivo.

[0255] To assess the persistence of NK cells, bioluminescence was measured for 4 weeks, and tissue sections were analyzed 4 weeks later. As a result, glioblastoma growth was effectively inhibited in the anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cell administration group compared to the PBS administration group after 4 weeks of administration (Fig. 20a), and a significant reduction in tumor size was confirmed (Fig. 20b).

[0256] Cross-sectional immunohistochemistry confirmed the presence of NK cells that had infiltrated the tissue. It was confirmed that NK cells derived from anti-CD19 CAR-expressing induced pluripotent stem cells had infiltrated and remained inside the glioblastoma after 4 weeks, and that NKp44 expression persisted (Fig. 21).

[0257] The results of this example demonstrated the therapeutic potential of anti-CD19 CAR-expressing induced pluripotent stem cell-derived NK cells for glioblastoma through in vitro and xenograft modeling based on glioblastoma-vascular fusion organoids (Fig. 22).

[0258] Statistical analysis

[0259] All data are expressed as mean ± SEM. Statistical analyses were performed using GraphPad Prism version 9.0 (GraphPad Software, USA).

[0260] This patent application is the result of research conducted with the support of the National Research Foundation of Korea (Inter-ministerial Regenerative Medicine Technology Development Project Group) with funding from the government of the Republic of Korea (multi-ministerial; Ministry of Science and ICT, Ministry of Health and Welfare) (Project No.: 00215812, Research Project Name: Development of Advanced Artificial Skin Production Technology and Skin Regeneration Treatment Technology Based on Immune Control 3D Human Skin Organoid, Research Period: 2023.04.01 ~ 2025.12.31).

Claims

1. A pharmaceutical composition for the prevention or treatment of a solid tumor exhibiting a tumor microenvironment including pericytes, comprising natural killer cells expressing an anti-CD19 chimeric antigen receptor (CAR).

2. A pharmaceutical composition for the prevention or treatment of a solid cancer representing a tumor microenvironment including pericytes, wherein the anti-CD19 CAR in paragraph 1 is an anti-CD19 antibody or an antigen-binding fragment thereof that specifically binds to CD19.

3. In the second paragraph, the antigen-binding fragment of the anti-CD19 antibody is selected from the group consisting of Fab, Fab', F(ab')2, xFab, scFab, dsFv, Fv, scFv-Fc, scFab-Fc, diabody, minibody, scAb, dAb, half-IgG and combinations thereof, a pharmaceutical composition for preventing or treating a solid cancer representing a tumor microenvironment including pericytes.

4. A pharmaceutical composition for the prevention or treatment of a solid cancer that exhibits a tumor microenvironment including pericytes, wherein the natural killer cells expressing the anti-CD19 CAR in the first paragraph are differentiated from pluripotent stem cells expressing the anti-CD19 CAR.

5. In the fourth paragraph, a pharmaceutical composition for the prevention or treatment of a solid cancer exhibiting a tumor microenvironment including pericytes, wherein the pluripotent stem cell expressing the anti-CD19 CAR is differentiated into a natural killer cell expressing the anti-CD19 CAR through the following steps a) to c): a) A step of culturing pluripotent stem cells expressing anti-CD19 CAR in a medium containing mesoderm-inducing factors to obtain mesoderm; b) a step of culturing the mesoderm in a hematopoietic progenitor cell differentiation medium to obtain hematopoietic progenitor cells; and c) A step of culturing the above hematopoietic progenitor cells in a natural killer cell differentiation medium to induce differentiation into natural killer cells expressing anti-CD19 CAR.

6. In the fifth paragraph, a) step is a pharmaceutical composition for the prevention or treatment of a solid cancer exhibiting a tumor microenvironment including pericytes, wherein the first culture is performed for 1 to 4 days by treating with a GSK-3β inhibitor, BMP4 and VEGF, and then the medium is replaced and the second culture is performed for 1 to 4 days by treating with a TGF-β inhibitor, VEGF and stem cell factor.

7. In the fifth paragraph, step b) is a pharmaceutical composition for the prevention or treatment of a solid cancer exhibiting a tumor microenvironment including pericytes, wherein the composition is cultured in 5 mediums for 15 days by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, and FIT3 ligand.

8. In the fifth paragraph, the step c) is a pharmaceutical composition for the prevention or treatment of a solid cancer exhibiting a tumor microenvironment including pericytes, wherein the medium is replaced after primary culturing for 4 to 8 days by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, FIT3 ligand, IL7, IL15, and IL3, and then culturing for 20 to 40 days by treating with β-mercaptoethanol, sodium selenite, ethanolamine, ascorbic acid, stem cell factor, FIT3 ligand, IL7, IL15, and a p38 MAP kinase inhibitor.

9. In the first paragraph, the anti-CD19 CAR is a pharmaceutical composition for the prevention or treatment of a solid cancer that exhibits a tumor microenvironment including pericytes, which specifically targets pericytes in the microenvironment of a CD19-expressing solid cancer, thereby enhancing the ability to migrate and penetrate into tumor cells and enhance the ability to specifically destroy tumor cells.

10. A pharmaceutical composition for the prevention or treatment of a solid cancer that exhibits a tumor microenvironment including pericytes, wherein the CD19-expressing solid cancer in paragraph 1 is glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma or metastatic brain tumor.

11. Glioblastoma-vascular fusion organoids produced by co-culturing vascular organoids and glioblastoma spheroids.

12. In claim 11, the glioblastoma-vascular fusion organoid implements a tumor microenvironment including pericytes and can simulate the phenomenon of tumor translocation through the perivascular gap.

13. In the 11th paragraph, the glioblastoma-vascular fusion organoid is manufactured through the following steps a) and b): a) a step of culturing pluripotent stem cells and differentiating them into vascular organoids with a formed vascular network; and b) A step of producing a glioblastoma-vascular fusion organoid by co-culturing a vascular organoid in which the above vascular network has been formed and a glioblastoma spheroid.

14. In the 13th paragraph, the vascular organoid and the glioblastoma spheroid in which the vascular network of step b) is formed are co-cultured in a medium in which a medium for culturing vascular organoids and a medium for culturing glioblastoma spheroids are mixed, a glioblastoma-vascular fusion organoid.

15. In the 14th paragraph, the medium for culturing the vascular organoid is StemPro-34 SFM, EGM-2 (Endothelial Cell Growth Medium-2), and the medium for culturing the glioblastoma spheroid is at least one selected from the group consisting of DMEM (Dulbeco's Modified Eagle's Medium), IMDM (Iscove's Modified Dulbecco's Medium), a-MEM (Alpha Modification of Eagle's Medium), F12 (Nutrient Mixture F-12), RPMI 1640, Williams's medium E, McCoy's 5A, and DMEM / F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12).

16. A glioblastoma-vascular fusion organoid in the 13th paragraph, wherein step b) is performed for 4 days or more.

17. Microcirculation chip loaded with glioblastoma-vascular fusion organoid of Article 11.

18. Animal model in which the glioblastoma-vascular fusion organoid of Article 11 is xenografted.

19. In the 18th paragraph, an animal model in which the glioblastoma-vascular fusion organoid is xenografted, manufactured through the following steps a) and b): a) a step of manufacturing a glioblastoma-vascular fusion organoid with a vascular network formed by inserting vascular organoids and glioblastoma spheroids into an extracellular matrix and then treating with serum, VEGF-A, and FGF-2; and b) A step of transplanting the above glioblastoma-vascular fusion organoid into an immunodeficient animal model.

Images