CHST6 MINI gene - CHST6 expression construct with native promoter

Abstract

The invention provides polynucleotides selected to encode and express carbohydrate sulfotransferase 6 (CHST6) polypeptides. For example, we have designed a CHST6 mini gene with native coding and non-coding exons that can be used in vectors to express functional CHST6 polypeptides in corneal cells having deleterious mutations in endogenous CHST6 genes.

Description

[0001] CHST6 MINI GENE - CHST6 EXPRESSION CONSTRUCT WITH NATIVE

[0002] PROMOTER

[0003] CROSS REFERENCE TO RELATED APPLICATIONS

[0004] This application claims the benefit under 35 U.S.C. Section 119(e) of copending and commonly-assigned U.S. Provisional Patent Application No. 63 / 589,721, filed October 12, 2023, entitled “CHST6 MINI GENE - CHST6 EXPRESSION CONSTRUCT WITH NATIVE PROMOTER ", the contents of which is incorporated by reference herein.

[0005] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0006] This invention was made with government support under EY000331 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] TECHNICAL FIELD

[0008] Embodiments of the disclosure concern at least the fields of molecular biology and medicine.

[0009] BACKGROUND OF THE INVENTION

[0010] Blindness, which afflicts over 40 million people worldwide, can be caused by trauma, infection or genetic inheritance. While trauma and infection can be prevented or at times treated, relatively few options are available to prevent or treat blindness that results from genetic causes.

[0011] Comeal dystrophies are a group of inherited disorders that are usually bilateral, symmetric, slowly progressive and not related to environmental or systemic factors. Traditionally, comeal dystrophies were classified based on the anatomic level of the most affected comeal layer. Such classifications were refined in IC3D 2015 classification system based on the cellular layers involved, given improved understanding in genetic basis and pathogenesis. Comeal dystrophies are now divided into epithelia and subepithelial dystrophies, epithelial-stromal TGFBI dystrophies, stromal dystrophies, and endothelial dystrophies. An evidence-based category system for comeal dystrophies was also assigned to each distinct comeal dystrophy in IC3D 2015 classification system, based on the level of substantial evidence of its clinical, pathological, and genetic basis. Category 1 comeal dystrophy is a clinically well- defined comeal dystrophy in which the gene has been identified, and the specific mutations are known.

[0012] Macular comeal dystrophy (MCD) is classified as a category 1 stromal dystrophy in IC3D 2015 classification system due to the primary involvement of keratocytes in comeal stroma. MCD shares an autosomal recessive inheritance pattern and is associated with mutations in CHST6 gene, encoding comeal N- acetylglucosamine-6-O-sulfotransferase (CGn6ST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to position 6 of a non-reducing N- acetylglucosamine (GlcNAc) residue in KS. The activity of CGn6ST is essential for the sulfation of glycosaminoglycans (GAGs) in cornea. In MCD cornea, Alcian bluepositive un-sulfated / low-sulfated GAGs diffusely accumulate intracellularly and extracellularly of keratocytes throughout the comeal stroma. Additionally, based on histological findings, there is involvement of Descemet membrane and comeal endothelium, evidenced by Descemet thickening, guttata and comeal endothelial staining with Alcian blue. However, in MCD, cornea is thinner than normal with no evidence of comeal endothelial dysfunction.

[0013] There is a need in the art, as well as materials and methods that can be used, for treating specific inherited comeal dystrophies, other than comeal transplantation - the only available treatment option now. SUMMARY OF THE INVENTION

[0014] We have discovered molecular mechanisms associated with the mutation in carbohydrate sulfotransferase 6 (CH S 6) gene promoter in a comeal endothelial dystrophy that share some clinical and genetic features with MCD but is distinct from MCD in terms of clinical presentation, management, genetic mutations identified and functional impact of the associated mutations. We have undertaken a detailed characterization of the clinical, histopathologic, genetic, and functional phenotypes of CHST6 affected individuals in multiple families with corneal endothelial dystrophy. Following these analyses, we propose the name peripheral macular endothelial dystrophy (PMED) to describe this pathology. Building upon this discovery, we have designed and constructed a CHST6 mini gene with native coding and non-coding exons that can be used in vectors to express functional CHST6 polypeptides in cells having deleterious mutations in endogenous CHST6 gene sequences.

[0015] The invention disclosed herein has a number of embodiments. For example, embodiments of the invention include compositions of matter comprising a polynucleotide encoding a functional human carbohydrate sulfotransferase 6 (CHST6) enzyme; wherein the polynucleotide comprises less than 4,400 nucleotides (e.g., the polynucleotide sequence shown in SEQ ID NO: 1). Typically such polynucleotides comprise a DNA sequence of the CHST6 gene non-coding exon 1 and / or non-coding exon 2; and the polynucleotide comprises DNA sequences of a CHST6 gene coding exon 3. In certain embodiments of the invention, the polynucleotide comprises less than 3,750, 3,500, or 3,250 nucleotides. Polynucleotides encoding a functional human carbohydrate sulfotransferase 6 (CHST6) enzyme that are size limited in this way can, for example, then be introduced into an adeno-associated viral (AAV) vector. In particular, AAV has a packaging capacity of ~4.7Kb. Since the two ITRs of AAV are about 0.2-0.3Kb total, the foreign DNA that can be introduced between these 2 ITRs should be smaller than 4.4Kb.

[0016] In typical embodiments of the invention, the polynucleotide comprises a human keratocyte specific promoter. SEQ ID NO: 2 below provides an illustrative example of a CHST6 promoter and enhancer sequence (1439 bp) comprising a human keratocyte specific promoter. In certain embodiments of the invention, the polynucleotide comprises a human comeal endothelial cell specific promoter. SEQ ID NO: 3 below provides an illustrative example of a mutant CHST6 promoter and enhancer sequence (1439 bp) with CHST6 n.-97G>C, c.-690G>C mutation, which comprises a human comeal endothelial cell specific promoter. In embodiments of the invention, the polynucleotide can be disposed within a vector such as an adeno-associated viral vector. In certain embodiments of the invention, the vector is disposed within a mammalian cell, for example a comeal endothelial cell.

[0017] Embodiments of the invention also include methods of introducing an exogenous polynucleotide into a mammalian cell (e.g., a comeal endothelial cell, or a comeal keratocyte) comprising combining a vector comprising a CHST6 polynucleotide disposed therein with the cell such that the polynucleotide is transduced into the mammalian cell, thereby introducing the exogenous polynucleotide into the mammalian cell. Related embodiments of the invention include methods of treating a subject having a comeal dystrophy. Typically, the method includes the steps of administering to the subject an effective amount of a composition comprising vector designed to express a CHST6 polypeptide, so that the amount of functional CHST6 polypeptide in the cornea of the subject is elevated. Methods of the invention can be used to treat macular comeal dystrophy (MCD) and / or peripheral macular endothelial dystrophy (PMED). In one embodiment, the vector is an adeno associated vector comprising a nucleic acid molecule encoding a CHST6 protein (e.g., SEQ ID NO: 1 below) that is operably linked to a keratinocyte and / or corneal endothelial cell promotor (e.g., SEQ ID NO:2 and SEQ ID NO:3 below).

[0018] Other objects, features and advantages of the present invention will become apparent to those skilled in the art from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating some embodiments of the present invention, are given by way of illustration and not limitation. Many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof, and the invention includes all such modifications.

[0019] BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 provides a schematic of a vector map of an embodiment of the invention, pcDNA3-CGn6ST with CHST6 exon 2 and exon 3.

[0021] Figure 2 provides a schematic of a vector map of an embodiment of the invention, pcDNA3-CGn6STwPro containing CHST6 mini gene.

[0022] Figure 3 provides a schematic of a vector map as well as data from a functional analysis of CHST6 mini gene in pcDNA3 CGn6STwPro. (A) Schematic graphical representation of CHST6 gene structure and map of CHST6 promoter-containing expressing vector pcDNA3_CGn6STwPro, showing the relative positions of CHST6 exon 1 - 3 on the genome and in the vector. Color-coded lines depicted the relative positions of generated mutations in the vector. (B) Western Blot results of human comeal endothelial cell (HCEnC, lower panel) and human keratocyte (hKT, upper panel) cell lysates following CGn6STwPro transfections. (C) Bar graph summary of 5D4+ KS relative fold change in HCEnC (right panel) or hKT (left panel) transfected with mutant pcDNA3_CGn6STwPro expression vectors when compared to WT transfection. DETAILED DESCRIPTION OF THE INVENTION

[0023] In the description of embodiments, reference may be made to the accompanying figures which form a part hereof, and in which is shown by w ay of illustration a specific embodiment in which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural changes may be made without departing from the scope of the present invention.

[0024] In the National library or medicine Databases, Homo sapiens carbohydrate sulfotransferase 6 is given Gene ID: 4166. The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratin. Keratin sulfate helps maintain comeal transparency. Defects in this gene are a cause of macular comeal dystrophy (MCD). Genetic lesions can result in certain forms of blindness that are difficult to prevent or treat. The present invention is based upon the discovery that genetic lesions in the CHST6 gene promoter result in a comeal endothelial dystrophy that shares some clinical and genetic features with MCD but is distinct from MCD in terms of clinical presentation.

[0025] We have discovered a distinct comeal endothelial dystrophy that shares some clinical and genetic features with macular comeal dystrophy (MCD). Briefly, we examined affected individuals from seven families exhibiting peripheral posterior comeal macular opacities, endothelial guttae and comeal edema, along with twenty- two unaffected family members. Sanger sequencing of CHST6 were performed in all participants. Whole-exome sequencing (WES) was performed in three families. Histological examination of the Descemet membrane (DM) was performed on samples from three probands. Serum keratan sulfate (KS) levels w ere measured in six families. Functional analysis of identified mutations was carried out using CHST6 promoter containing CHST6 expression vector in human keratocytes (hKT) and in human comeal endothelial cells (HCEnC). CHST6 sequencing revealed a promoter mutation c.- 690G>C in homozygous state in five affected individuals from three families, and in compound heterozygous state with a coding mutation (R211Q; Y268C; or P280L) in seven affected individuals from the other four families. While P21 IQ and Y268C have been associated with MCD, P280L is a novel mutation.

[0026] The c.-690G>C mutation is rare (MAF = 0.000064) and has not been associated with MCD. WES failed to identify other candidate variants that segregated with affected status. In silico analysis predicted c.-690G>C to be a regulatory variant, located at the RNA polymerase II binding site. Functional analysis showed that c.-690G>C led to decreased KS sulfation in hKT but increased KS sulfation in HCEnC, while the novel P280L resulted in decreased KS sulfation in both hKT and HCEnC, similar to the previously reported Y268C mutation. DM Staining confirmed elevated levels of sulfated KS in DM and endothelium in affected probands. Minimum changes in serum sulfated KS levels were observed in affected individuals. These studies have determined that CHST6 c.-690G>C promoter mutation is associated with a novel comeal endothelial dystrophy characterized by peripheral posterior comeal macular opacities and endothelial dysfunction without stromal opacities. We suggest the name peripheral macular endothelial dystrophy (PMED) to describe this dystrophy.

[0027] Building upon this discovery, the invention provides polynucleotide encoding a CHST6 protein or active fragment thereof (e.g., SEQ ID NO: 1) which is designed to be disposed in selected vectors and transduced into cells in order to, for example, ameliorate an associated comeal dystrophy in affected individuals. Such vectors, which can be cloning vectors or expression vectors, provide a means to transfer an exogenous nucleic acid molecule into a prokaryotic or eukaryotic host cell.

[0028] In addition to containing a nucleic acid molecule encoding a CHST6 protein or active fragment thereof, a vector of the invention also can contain, if desired, one or more of the following elements: an polynucleotide encoding, for example, a promoter, an enhancer, a termination codon or another transcription or translation regulatory element; one or more selectable marker genes, such as an ampicillin, tetracycline, neomycin, hygromycin or zeomycin resistance gene, which is useful for selecting stable transfectants in mammalian cells; one or more enhancer or promoter sequences, which can be obtained, for example, from a viral, bacterial or mammalian gene; transcription termination and RNA processing signals, which are obtained from a gene or a virus such as SV40; an origin of replication such as an SV40, polyoma or E. coli origin of replication; versatile multiple cloning sites; and one or more RNA promoters such as a T7 or SP6 promoter, which allow for in vitro transcription of sense and antisense RNA.

[0029] In typical embodiments, a vector of the invention is an expression vector. Expression vectors are well known in the art and provide a means to transfer and express an exogenous nucleic acid molecule in a host cell. Contemplated expression vectors include vectors that provide for expression in a host cell such as a bacterial cell, yeast cell, mammalian cell or other animal cell. Such expression vectors include regulatory elements specifically required for expression of the DNA in a cell, the elements being located relative to the nucleic acid molecule encoding the CHST6 protein so as to permit expression thereof. The regulatory elements can be chosen to provide constitutive expression or, if desired, inducible or cell type-specific expression. Regulatory elements required for expression have been described above and include transcription and translation start sites and termination sites. Such sites permit binding, for example, of RNA polymerase and ribosome subunits. A bacterial expression vector can include, for example, an RNA transcription promoter such as the lac promoter, a Shine-Delgamo sequence and an initiator AUG codon in the proper frame to allow translation of an amino acid sequence.

[0030] Mammalian expression vectors can be particularly useful in embodiments of the invention and can include, for example, a heterologous or homologous RNA transcription promoter for RNA polymerase binding, a polyadenylation signal located downstream of the coding sequence, an AUG start codon in the appropriate frame and a termination codon to direct detachment of a ribosome following translation of the transcribed mRNA. Commercially available mammalian expression vectors include pSI, which contains the SV40 enhancer / promoter (Promega; Madison, Wis.); pTarget.TM. and pCI, which each contain the cytomegalovirus (CMV) enhancer / promoter (Promega); pcDNA3.1. a CMV expression vector (Invitrogen; Carlsbad, Calif.); and pRc / RSV, which contains Rous sarcoma virus (RSV) enhancer / promoter sequences (Invitrogen). In addition to these constitutive mammalian expression vectors, inducible expression systems are available, including, for example, an ecdysone-inducible mammalian expression system such as pIND and pVgRXR from Invitrogen. These and other mammalian expression vectors are commercially available or can be assembled by those skilled in the art using well known methods.

[0031] Viral vectors can be used in the administration of a nucleic acid molecule designed to expression or activity of a functional CHST6 protein into a subject or comeal cell. Such viral vectors include, for example, Herpes simplex virus vectors, vaccinia virus vectors, cytomegalovirus vectors, Moloney murine leukemia virus vectors, adenovirus vectors, lentivirus vectors, adeno-associated virus vectors, retrovirus vectors, and the like. Embodiments of the invention include vector compositions and associated gene therapy methods that utilize adeno-associated virus (AAV). AAV is a non-enveloped virus that can be engineered to deliver DNA to target cells, which has attracted a significant amount of attention in the field, especially in clinical-stage experimental therapeutic strategies. The ability to generate recombinant AAV particles lacking any viral genes and containing DNA sequences of interest for various therapeutic applications has thus far proven to be one of the safest strategies for gene therapies. The review in Naso et al., BioDrugs (2017) 31 :317-334 provides an overview of factors considered in the use of AAV as a vector for gene therapy. U.S. Patent Application Publication Numbers 20190017069 20180163227 20180104289 20170362670 20170348435 20170211095 20170304466 and 20170096682 disclose illustrative AAV methods and materials. The invention also provides a host cell containing a vector that includes a nucleic acid molecule encoding a CHST6 protein or an active fragment thereof (e.g. a sequence disclosed herein). Host cells expressing a CHST6 protein or an active fragment thereof can be used to screen for agents that increase the expression or activity of a CHST6 protein or to screen for selective inhibitors of a CHST6 protein of the invention. Examples of host cells useful in the invention include bacterial, yeast, and mammalian cells. Various mammalian cells useful as host cells include, for example, mouse NIH / 3T3 cells, CHO cells, COS cells and HeLa cells. In addition, mammalian cells obtained, for example, from a primary explant culture are useful as host cells. In one embodiment, the primary, explanted cells are comeal cells. Primary, explanted host cells such as comeal cells can be obtained from a subj ect for the purpose of introducing into these cells in vitro an expression vector as described above. Additional host cells include non-human mammalian embryonic stem cells, fertilized eggs and embryos, which can be routinely used to generate transgenic animals, such as mice, which express the novel CHST6 protein of the invention. Transgenic mice expressing CHST6 protein can be used, for example, to screen for compounds that enhance or inhibit the activity of this enzyme. Methods for introducing a vector into a host cell include electroporation, microinjection, calcium phosphate, DEAE-dextran and lipofection methods well known in the art.

[0032] Embodiments of the invention include methods of treating a patient / subject with a comeal dystrophy by administering to the subject an effective amount of an agent that increases the expression or activity of a CHST6 protein, whereby the amount of CHST6 protein activity in the cornea of the subject is elevated. Treatment of a subject with a comeal dystrophy by administration of a nucleic acid molecule can be carried out using conventional methods of administration, and can be accompanied by a compound that facilitates transfection into cells, including calcium phosphate, DEAE dextran, cationic lipids, liposomes, polylysine, or the like. Further, a nucleic acid molecule can be administered, if desired, in a viral vector, which can facilitate transfection into cells and can also improve tissue specificity, reduce death of transformed cells, and the like. These and additional methods of administering a nucleic acid molecule to a subject are known in the art as described, for example, in Chang (Ed.). Somatic Gene Therapy CRC Press, Inc. (1994).

[0033] EXAMPLES

[0034] Generation of CHST6 mini gene with native coding and non-coding exons

[0035] Non-coding Exon 1 of the Carbohydrate Sulfotransferase 6 (CHST6) gene (NM_0216I5) with surrounding sequences (1439 bp) flanking the predicted CHST6 promoter and two adjacent enhancers, based on ENCODE registry of candidate cis- regulatory elements (cCREs). were cloned into the previously described CHST6 expression vector pcDNA3-CGn6ST replacing the sequences of CMV enhancercontaining promoter and T7 promoter.

[0036] The 1430 bp sequence includes the following four cCREs:

[0037] • CRE E 1828288 (enhancer), Chrl 6: 75494700-75494885 Size: 186 bp

[0038] • CRE E1828289 (promoter), Chrl6:75495046-75495388 Size: 343 bp

[0039] • CRE E1828290 (promoter), Chrl6:75495391-75495551 Size: 161 bp

[0040] • CRE E1828291 (enhancer), Chrl6:75495716-75495971 Size: 256 bp

[0041] The cloning process is described in details below. PCR was performed to amplify the 1439 bp CHST6 promoter region (pCHST6) using primer pair (F: GCCCGAATTCTGACGC-AGGACTCCAATTCC (SEQ ID NO: 4), R: GGCACGCGTTGAAACGTATCATGTCTTTATCTGG (SEQ ID NO: 5)) from healthy subject with no variant within the region confirmed by Sanger sequence. Forward primer added an EcoRI restriction enzyme cutting site and reverse primer used added a Mlul site. Then the previously described vector pcDNA3-CGn6ST (Figure 1) containing nucleotide sequences of exon 2 and exon 3 of CHST6 gene was digested using Mlul and EcoRI to remove the sequences of CMV enhancer-containing promoter and T7 promoter. The purified 1439 bp CHST6 promoter sequence was then ligated into digested pcDNA3-CGn6ST to create pcDNA3-CGn6STwPro (Figure 2), a CHST6 expression vector that contains wild-type sequences of three exons of CHST6, including non-coding exons 1 and 2 as well as coding exon 3 - CHST6 mini gene. Significantly, the size of this CHST6 mini gene in pcDNA3-CGn6STwPro is 3011 bp, within the adeno-associated virus (AAV) packaging capacity of ~4.5 kb. The size of CHST6 native gene (NM_021615) is 23400 bp and the size of nucleotide sequences including CHST6 exon 1, 2 and 3 is 16801 bp, both larger than the packaging capacity of AAV.

[0042] As shown in Figure 3, functional assessment of pcDNA3-CGn6STwPro showed enzymatic activities mediated by expressed CFIST6 protein, as evidenced by the increased positive 5D4 antibody (MABN2483, Millipore Sigma) labeled highly sulfated keratan sulfate (KS) in immortalized human comeal stromal (keratocyte) cells transduced by pcDNA3-CGn6STwPro. The following mutations were introduced into pcDNA3-CGn6STwPro respectively to show the function of CHST6 promoter or CHST6 open reading frame (ORF) in pcDNA3-CGn6STwPro can be disrupted leading to changes in the levels of 5D4 labeled highly sulfated KS:

[0043] 1) CHST6 n.-

[0044] 97G>C, c.-690G>C (pcDNA3_CGn6STpro _c-690G>C)

[0045] 2) c.803A>G, p. Tyr268Cys (pcDNA3 CGn6STpro_Y268C)

[0046] 3) c.839C>T, p.Pro280Leu (pcDNA3_CGn6STpro_P280L)

[0047] Telomerase immortalized human comeal endothelial cells (HCEnC) and telomerase immortalized human comeal stromal cells - keratocytes (hKT) were transfected with pcDNA3_CGn6STwPro wild-type or mutant using Lipofectamine® LTX with PLUS reagent (A12621, Life Technologies) according to the manufacturer’s recommendations. To maximize the signal of sulfated KS, we co-transfected HCEnC or hKT (seeded in 24-well plate at 50% confluency 24 hours prior) with expression vectors of b3GnT7 (pcDNA3_b3GnT7, 250 ng / well) and of hKSG6ST (pcDNA3_KSG6ST, 250 ng / well), two enzymes involved in the extension of KS and C-6 sulfation of Gal residue in KS, together with pcDNA3_CGn6STwPro wild-type and / or mutant. Forty-eight hours post-transfection, cells were lysed with radioimmunoprecipitation assay (RIP A) buffer with proteinase and phosphatase inhibitors. Total protein was quantified by bicinchoninic acid (BCA) assay, separated and detected using the Simple Western assay Wes (ProteinSimple), a capillary -based Western Blot system. Highly sulfated KS, b3GnT7 protein and GAPDH were detected using 5D4, anti-B3GNT7 (NBP1-69637. Novus Biological) and anti-GAPDH (MAB374, Millipore Sigma) antibodies, respectively. Quantification and data analysis were performed in Compass for Simple Western software (ProteinSimple). The level of 5D4 positive sulfated KS was normalized to GAPDH as loading control and then to B3GNT7 as internal control for transfection efficiency in each sample. Four biological replicates of transfection and Western Blot were performed and the average 5D4+ KS level was calculated for each pcDNA3_CGn6STwPro mutant. In HCEnC, Western Blot showed the 5D4+ KS is low in cells transfected with wild-type pcDNA3_CGn6STwPro. There was increased levels of 5D4+ KS following transfection with promoter variant containing construct pcDNA3_CGn6STwPro_c.- 690G>C. indicating the disruption of CHST6 promoter maintained low CHST6 activity in HCEnC cells, a cell type not expressing CHST6 and not affected by CHST6 mutation-associated Macular Comeal Dystrophy. In addition, 5D4+ KS levels were unchanged in HCEnC following transfection of either coding variant containing constructs, pcDNA3_CGn6STwPro_P280L or pcDNA3_CGn6STwPro_Y268C. In hKT, on the contrary, there was significantly higher 5D4+ KS in cells transfected with wild-type pcDNA3_CGn6STwPro compared to HCEnC wild-type pcDNA3_CGn6STwPro transfection. There was no change in 5D4+ KS level following transfection with promoter variant containing construct pcDNA3_CGn6STwPro_c.- 690G>C compared to hKT wild-type pcDNA3_CGn6STwPro transfection. And transfection in hKT with either coding variant containing constructs, pcDNA3_CGn6STwPro_P280L or pcDNA3_CGn6STwPro_Y268C, led to decreased 5D4+ KS levels compared to hKT wild-type pcDNA3_CGn6STwPro transfection. The above data provide evidence that human keratocyte restricted sulfation of keratan sulfate in can be induced by transfection of wild-type pcDNA3_CGn6STwPro containing native CHST6 promoter and enhancers, and wild-type pcDNA3_CGn6STwPro does not cause aberrant over-production of 5D4+ KS in human comeal endothelial cells. The data further indicate the wild-type CHST6 promoter and enhancer sequence (1439 bp) descnbed here is a human keratocyte specific promoter, whereas the mutant promoter sequence (CHST6 n.-97G>C, c.-690G>C) is a human comeal endothelial specific promoter.

[0048] ILLUSTRATIVE POLYNUCLEOTIDE SEQUENCES: A 3011 bp nucleotide comprising a CHST6 mini gene

[0049] CGCGTTGAAACGTATCATGTCTTTATCTGGACCTGCTATGAACCTGCGCCT

[0050] CTGGGCCTAGGCTAGGGCAGGGAATGCGCAGGAGGAGGGGAAAAGCTGC

[0051] GGACCCAGCTCCTAAGGCCACCTGGTCTCTCCGCTCTTCCCAGTTGGGACA

[0052] CTGCACCGGGTCCATGTGTCATCCAGGTGCCGTGGCCTTGGGAAGGGTTT

[0053] GGATTCCAAGTCACCTCGCCGCAAGGATGCCCCCGAGAGTGAGGAGGGTC

[0054] AAGATTAAGATTCGACTTCCTTCACTAGGGCCTTTGTCCTCCCAGGAGCCC

[0055] CCCTTCTCTGGGGATTTGGGGTGGGGTGGGGTACAACGTTCCTCTGTAGTC

[0056] AGATGAGAGGTGACTCTGCCAGCGCCCTTTGACATTCTGGGCTAAAAGTT

[0057] GAGCCTCTCAGAGCCCCAGCCCACCTGGGCCCTCCTGCCCCGCCCTCGGCC

[0058] GGCGCCCCTCCCCCGAGGCGTGGCCCCTCGGTCGGGGGTGGGCCAACCGG

[0059] CTCCTTCCTTCCCCCACGGCGCTAGCTCCCGCTGGCCACCTCGGGACCGCA

[0060] GCCACGTCTGAAAGCGCCTCATTGTGTGCGCTCGGGCGGGCTGCACCGGG

[0061] CAGCGCCGAGGGTTGCCGGCCGGCGCGCGGGGAGTAGAGGGCGCGGGCC

[0062] GCAGTGCCGGGTTCCAGAGGGAGCTCTGCGCCGGGTCCTTCCCTGTGGTA

[0063] GCCCCAGGACACCCCCAGCCTCAACATCCCATTCTGGGACTCCTGCCCTGT

[0064] TCCCACATTCGTTCTACCTCGAGTCTCCAGGAGCTTCCAGTGGCTTGGTCA

[0065] CCGCCAACTCTCGTCCATGCCTCTTAGAGCCCCTTTCCCGGCCTCACCGGG

[0066] TGTCGCTTAATAGTCTTGGGACCTTAAGGAGCAAGTCAGCCCCTGCGGAC

[0067] CCTCCCAGTGAAGAGAAAGAGCTGGCTGTGCGGTGGAATTTGGAAGAGAC

[0068] GACGTTTGGGAGCCTTTGCTGAGTCCAGGGAGAGAGGCGTCCCCCACCGT

[0069] GCCGCTGCAGCTCGGGCAGAGCCGCCAAGCTTTGGGGTACGTTGGTTCTT

[0070] CATTCTCCGCGGGGGATGTCCCCACACTCGGGTCGGCTGGGGGCCGGGCT

[0071] GGTGGCACAGCTGGGGACGCTCCTCTGTCCTGCACCGGGGACCTGGGGTG

[0072] GCGGGAAGAGCTGGGAGTGGCTTTTCCATCAGCAACGTGGAAAGGGCATC

[0073] GCCGCTGTTGGCGCCGGTTTGGAAGTGTCTTGCTGGGGCTTCGGCTGCGCA

[0074] GGAGAATCCTCACTGCGAGGGGAGAACCCCTTTTGTCTCGATACTTGAGTT TCAAAGGACATGACTTTCAAAAGCTCTCCAAGGGCTTTTTCCATAGAATTA

[0075] TTGAGAGACGGTAGCTTGGCGGGTTGATTTGGAACCAGACCCAGGGGAAT

[0076] TGGAGTCCTGCGTCAGAATTCTGCAGATTAGCCCTGGACAGTGGCCCCCA

[0077] GCAGTCAGCATGTGGCTGCCGCGCGTCTCCAGCACAGCAGTGACCGCGCT

[0078] CCTCCTGGCGCAGACCTTCCTCCTCCTCTTTCTGGTTTCCCGGCCAGGGCC

[0079] CTCGTCCCCAGCAGGCGGCGAGGCGCGCGTGCATGTGCTGGTGCTGTCCT

[0080] CGTGGCGCTCGGGCTCGTCCTTCGTGGGCCAACTCTTCAACCAGCACCCCG

[0081] ACGTCTTCTACCTAATGGAGCCCGCGTGGCACGTGTGGACCACCCTGTCGC

[0082] AGGGCAGCGCCGCAACGCTGCACATGGCTGTGCGCGACCTGGTGCGCTCC

[0083] GTCTTCCTGTGCGACATGGACGTGTTTGATGCCTATCTGCCTTGGCGCCGC

[0084] AACCTGTCCGACCTCTTCCAGTGGGCCGTGAGCCGTGCACTGTGCTCGCCA

[0085] CCCGCCTGCAGTGCCTTTCCCCGAGGCGCCATCAGCAGCGAGGCCGTGTG

[0086] CAAGCCACTGTGCGCGCGGCAGTCCTTCACCCTGGCCCGGGAGGCCTGCC

[0087] GCTCCTACAGCCACGTGGTGCTCAAGGAGGTGCGCTTCTTCAACCTGCAG

[0088] GTGCTCTACCCGCTGCTCAGCGACCCCGCGCTCAACCTACGCATCGTGCAC

[0089] CTGGTGCGCGACCCGCGGGCCGTGCTGCGCTCCCGGGAGCAGACAGCCAA

[0090] GGCTCTGGCGCGTGACAACGGCATCGTGCTGGGCACCAACGGCACGTGGG

[0091] TGGAGGCCGACCCCGGCCTGCGCGTGGTGCGCGAGGTGTGCCGTAGCCAC

[0092] GTACGCATCGCCGAGGCCGCCACACTCAAGCCGCCACCCTTTCTGCGCGG

[0093] CCGCTACCGCCTGGTGCGCTTCGAGGACTTGGCGCGGGAGCCGCTGGCAG

[0094] AAATCCGTGCGCTCTACGCCTTCACTGGGCTCAGTCTCACGCCACAGCTCG

[0095] AGGCCTGGATCCATAACATCACCCACGGATCTGGACCTGGTGCGCGCCGC

[0096] GAAGCCTTCAAGACTTCGTCCAGGAATGCGCTCAACGTCTCCCAGGCCTG

[0097] GCGCCATGCGCTGCCCTTTGCCAAGATCCGCCGCGTGCAGGAACTGTGCG

[0098] CTGGTGCGCTGCAGCTGCTGGGCTACCGGCCTGTGTACTCTGAGGACGAG

[0099] CAGCGCAACCTCGCCCTTGATCTGGTGCTGCCACGAGGCCTGAACGGCTT

[0100] CACTTGGGCATCATCCACCGCCTCGCACCCCCGAAATTAGTGGAGGCCAC AGTTGTAGCAGGCGCTAGGCCCGGGAGAATCCATCACACTGGCGGCCGCT

[0101] CGAGCATGCATCTAGAGGGCCCTATTCTATAGTGTCACCTAAATGCTAGA

[0102] GCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTT

[0103] TGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTC

[0104] CTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCAT

[0105] TCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGG

[0106] AAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG (SEQ ID NO: 1)

[0107] A polynucleotide comprising a keratocyte promoter

[0108] CGCGTTGAAACGTATCATGTCTTTATCTGGACCTGCTATGAACCTGCGCCT

[0109] CTGGGCCTAGGCTAGGGCAGGGAATGCGCAGGAGGAGGGGAAAAGCTGC

[0110] GGACCCAGCTCCTAAGGCCACCTGGTCTCTCCGCTCTTCCCAGTTGGGACA

[0111] CTGCACCGGGTCCATGTGTCATCCAGGTGCCGTGGCCTTGGGAAGGGTTT

[0112] GGATTCCAAGTCACCTCGCCGCAAGGATGCCCCCGAGAGTGAGGAGGGTC

[0113] AAGATTAAGATTCGACTTCCTTCACTAGGGCCTTTGTCCTCCCAGGAGCCC

[0114] CCCTTCTCTGGGGATTTGGGGTGGGGTGGGGTACAACGTTCCTCTGTAGTC

[0115] AGATGAGAGGTGACTCTGCCAGCGCCCTTTGACATTCTGGGCTAAAAGTT

[0116] GAGCCTCTCAGAGCCCCAGCCCACCTGGGCCCTCCTGCCCCGCCCTCGGCC

[0117] GGCGCCCCTCCCCCGAGGCGTGGCCCCTCGGTCGGGGGTGGGCCAACCGG

[0118] CTCCTTCCTTCCCCCACGGCGCTAGCTCCCGCTGGCCACCTCGGGACCGCA

[0119] GCCACGTCTGAAAGCGCCTCATTGTGTGCGCTCGGGCGGGCTGCACCGGG

[0120] CAGCGCCGAGGGTTGCCGGCCGGCGCGCGGGGAGTAGAGGGCGCGGGCC

[0121] GCAGTGCCGGGTTCCAGAGGGAGCTCTGCGCCGGGTCCTTCCCTGTGGTA

[0122] GCCCCAGGACACCCCCAGCCTCAACATCCCATTCTGGGACTCCTGCCCTGT

[0123] TCCCACATTCGTTCTACCTCGAGTCTCCAGGAGCTTCCAGTGGCTTGGTCA

[0124] CCGCCAACTCTCGTCCATGCCTCTTAGAGCCCCTTTCCCGGCCTCACCGGG TGTCGCTTAATAGTCTTGGGACCTTAAGGAGCAAGTCAGCCCCTGCGGAC

[0125] CCTCCCAGTGAAGAGAAAGAGCTGGCTGTGCGGTGGAATTTGGAAGAGAC

[0126] GACGTTTGGGAGCCTTTGCTGAGTCCAGGGAGAGAGGCGTCCCCCACCGT

[0127] GCCGCTGCAGCTCGGGCAGAGCCGCCAAGCTTTGGGGTACGTTGGTTCTT

[0128] CATTCTCCGCGGGGGATGTCCCCACACTCGGGTCGGCTGGGGGCCGGGCT

[0129] GGTGGCACAGCTGGGGACGCTCCTCTGTCCTGCACCGGGGACCTGGGGTG

[0130] GCGGGAAGAGCTGGGAGTGGCTTTTCCATCAGCAACGTGGAAAGGGCATC

[0131] GCCGCTGTTGGCGCCGGTTTGGAAGTGTCTTGCTGGGGCTTCGGCTGCGCA

[0132] GGAGAATCCTCACTGCGAGGGGAGAACCCCTTTTGTCTCGATACTTGAGTT

[0133] TCAAAGGACATGACTTTCAAAAGCTCTCCAAGGGCTTTTTCCATAGAATTA

[0134] TTGAGAGACGGTAGCTTGGCGGGTTGATTTGGAACCAGACCCAGGGGAAT

[0135] TGGAGTCCTGCGTCAG (SEQ ID NO: 2)

[0136] A polynucleotide comprising a comeal endothelial cell promoter

[0137] CGCGTTGAAACGTATCATGTCTTTATCTGGACCTGCTATGAACCTGCGCCT

[0138] CTGGGCCTAGGCTAGGGCAGGGAATGCGCAGGAGGAGGGGAAAAGCTGC

[0139] GGACCCAGCTCCTAAGGCCACCTGGTCTCTCCGCTCTTCCCAGTTGGGACA

[0140] CTGCACCGGGTCCATGTGTCATCCAGGTGCCGTGGCCTTGGGAAGGGTTT

[0141] GGATTCCAAGTCACCTCGCCGCAAGGATGCCCCCGAGAGTGAGGAGGGTC

[0142] AAGATTAAGATTCGACTTCCTTCACTAGGGCCTTTGTCCTCCCAGGAGCCC

[0143] CCCTTCTCTGGGGATTTGGGGTGGGGTGGGGTACAACGTTCCTCTGTAGTC

[0144] AGATGAGAGGTGACTCTGCCAGCGCCCTTTGACATTCTGGGCTAAAAGTT

[0145] GAGCCTCTCAGAGCCCCAGCCCACCTGGGCCctcctgcccccccctcggccgGCGCCC

[0146] CTCCCCCGAGGCGTGGCCCCTCGGTCGGGGGTGGGCCAACCGGCTCCTTC

[0147] CTTCCCCCACGGCGCTAGCTCCCGCTGGCCACCTCGGGACCGCAGCCACG

[0148] TCTGAAAGCGCCTCATTGTGTGCGCTCGGGCGGGCTGCACCGGGCAGCGC

[0149] CGAGGGTTGCCGGCCGGCGCGCGGGGAGTAGAGGGCGCGGGCCGCAGTG CCGGGTTCCAGAGGGAGCTCTGCGCCGGGTCCTTCCCTGTGGTAGCCCCA GGACACCCCCAGCCTCAACATCCCATTCTGGGACTCCTGCCCTGTTCCCAC ATTCGTTCTACCTCGAGTCTCCAGGAGCTTCCAGTGGCTTGGTCACCGCCA ACTCTCGTCCATGCCTCTTAGAGCCCCTTTCCCGGCCTCACCGGGTGTCGC TTAATAGTCTTGGGACCTTAAGGAGCAAGTCAGCCCCTGCGGACCCTCCC AGTGAAGAGAAAGAGCTGGCTGTGCGGTGGAATTTGGAAGAGACGACGT

[0150] TTGGGAGCCTTTGCTGAGTCCAGGGAGAGAGGCGTCCCCCACCGTGCCGC TGCAGCTCGGGCAGAGCCGCCAAGCTTTGGGGTACGTTGGTTCTTCATTCT CCGCGGGGGATGTCCCCACACTCGGGTCGGCTGGGGGCCGGGCTGGTGGC ACAGCTGGGGACGCTCCTCTGTCCTGCACCGGGGACCTGGGGTGGCGGGA AGAGCTGGGAGTGGCTTTTCCATCAGCAACGTGGAAAGGGCATCGCCGCT GTTGGCGCCGGTTTGGAAGTGTCTTGCTGGGGCTTCGGCTGCGCAGGAGA

[0151] ATCCTCACTGCGAGGGGAGAACCCCTTTTGTCTCGATACTTGAGTTTCAAA GGACATGACTTTCAAAAGCTCTCCAAGGGCTTTTTCCATAGAATTATTGAG AGACGGTAGCTTGGCGGGTTGATTTGGAACCAGACCCAGGGGAATTGGAG TCCTGCGTCAG (SEQ ID NO: 3)

[0152] All publications mentioned herein (e.g., US20020061562A1 and those identified above) are incorporated by reference to disclose and describe aspects, methods and / or materials in connection with the cited publications.

[0153] Many of the techniques and procedures described or referenced herein are well understood and commonly employed by those skilled in the art. Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

Claims

CLAIMS:

1. A composition of matter comprising a polynucleotide encoding a functional human carbohydrate sulfotransferase 6 (CHST6) enzyme; wherein: the polynucleotide comprises DNA sequences of the CHST6 gene non-coding exon 1 and / or non-coding exon 2; the polynucleotide comprises DNA sequences of a CHST6 gene coding exon 3; and the polynucleotide comprises less than 4,400 nucleotides.

2. The composition of claim 1, wherein the polynucleotide comprises a human keratocyte specific promoter.

3. The composition of claim 1 , wherein the polynucleotide comprises a human corneal endothelial cell specific promoter.

4. The composition of claim 1, wherein the polynucleotide comprises less than 3,750, 3,500, or 3,250 nucleotides5. The composition of claim 4, wherein the polynucleotide comprises the polynucleotide sequence shown in SEQ ID NO: 1.

6. The composition of claim 5, wherein the polynucleotide is disposed within a vector.

7. The composition of claim 6, wherein the polynucleotide is disposed within a adeno-associated viral vector.

8. The composition of claim 6, wherein the vector is disposed within a mammalian cell.

9. The composition of claim 8, wherein the mammalian cell is a corneal endothelial cell.

10. A method of making a vector comprising a polynucleotide encoding a functional human carbohydrate sulfotransferase 6 (CHST6) enzyme; the method comprising disposing the polynucleotide in the vector, wherein: the polynucleotide comprises DNA sequences of the CHST6 gene non-coding exon 1 and / or non-coding exon 2; the polynucleotide comprises DNA sequences of a CHST6 gene coding exon 3; and the polynucleotide comprises less than 4,400 nucleotides, such that the vector is made.

11. The method of claim 10, wherein the polynucleotide comprises less than 3,750, 3,500, or 3,250 nucleotides12. The method of claim 11, wherein the polynucleotide comprises the polynucleotide sequence shown in SEQ ID NO: 1.

13. The method of claim 10, wherein vector is an adeno-associated viral vector.

14. The method of claim 10, wherein the polynucleotide comprises an endothelial or keratinocyte specific promoter.

15. A method of introducing an exogenous polynucleotide into a mammalian cell comprising combining a vector of claim 6 with the cell such that the polynucleotide is transduced into the mammalian cell, thereby introducing the exogenous polynucleotide into the mammalian cell.

16. The method of claim 10, wherein the mammalian cell is a corneal endothelial cell.

17. The method of claim 11, wherein the mammalian cell is a corneal stromal cell.

18. The method of claim 15, wherein the mammalian cell comprises a CHST6 c.-690G>C promoter mutation.

Images