Identification of genomic sequences for ataxias and epilepsies treatment

Abstract

The present invention is referred to a gRNA molecule capable of recognizing the target genomic sequence located between exon 37a and exon 38 in the CACNA 1B gene, ribonucleoprotein complexes comprising said gRNA molecule, nucleic acids encoding said gRNA molecule, as well as compositions comprising them for use as a medicament, in particular in the treatment of ataxias and epilepsies.

Description

[0001] “Identification of genomic sequences for ataxias and epilepsies treatment”

[0002] TECHNICAL FIELD

[0003] The present invention concerns in general the genic therapy field and the development of guide RNA (gRNA) molecules for use together with endonucleases or other CRISPR-associated proteins for the formation of ribonucleoprotein complexes capable of recognising and modifying a target genomic sequence. In particular, the present invention provides gRNA molecules capable of recognizing the target genomic sequence located between exon 37a and exon 38 in the CACNA1B gene, ribonucleoprotein complexes comprising one or more of said gRNA molecules, nucleic acids encoding said gRNA molecules, as well as compositions comprising them for use as a medicament, in particular in the treatment of ataxias and epilepsies.

[0004] STATE OF THE ART

[0005] It is known in the technical background that mutations of the CACNA1A gene may cause the occurrence of rare neurological diseases in humans. In particular, more than a hundred mutations of the CACNA1A gene, capable of causing various forms of ataxia and epilepsy, such as episodic ataxy of type 2 (OMIM # 108500), familiar hemiplegic migraine of type 1 (OMIM # 141500), spinocerebellar ataxia of type 6 (OMIM # 183086), developmental and epileptic encephalopathy 42 (OMIM # 617106), migraine with or without aura, susceptibility to, 5 (OMIM # 607508), have been identified.

[0006] The main function of the CACNA1A gene is regulating the communication between nerve cells. In many regions of human brain, the CACNA1A gene carries out this task in cooperation with a similar gene, the CACNA1B gene.

[0007] Both the CACNA1A and CACNA1B genes are subjected to alternative splicing process, which, as known, allows the generation of multiple variants of a messenger RNA (mRNA) starting from a single gene. In particular, alternative splicing in CACNA1A and CACNA1B generates two mutually exclusive principal variants in each gene: the splicing variant comprising exon 37a (EFa) and the one comprising exon 37b (EFb). It is known in literature that the EFa variant of the CACNA1A gene supports more effectively the communication between nerve cells with respect to the EFb variant of the gene thereof (Thalhammer et al. 2017). It is also found that the EFa variant of the CACNA1B gene is more effective than the EFb variant of the gene thereof in supporting the communication between nerve cells (Altier et al. 2007; Andrade et al. 2010). However, the CACNA 1A gene results more efficient than the CACNA 1B gene in supporting the communication between nerve cells (Cao et al. 2004; Mintz et al. 1995; Wu et al. 1999).

[0008] Functional deficits in the CACNA1A gene cause an increase in expression levels of the CACNA1B for compensatory purposes (Jun et al. 1999; Qian and Noebels 2000). Notwithstanding this, the communication between nerve cells remains severely compromised (Inchauspe et al. 2007; Ishikawa et al. 2005; Maejima et al. 2013; Mark et al. 2011). Therefore, diseases caused by mutations in the CACNA1A gene arise, at least to some extent, from the difficulty of the CACNA1B gene in fully compensating the functional deficits in the CACNA1A gene.

[0009] The current options for the treatment of the disorders related to the CACNA1A gene are limited to the management and / or treatment of the symptoms. At the present time indeed, there is no known cure for the genetic mutations concerning such gene.

[0010] Among the recently developed therapeutic approaches for the treatment of pathologies arising from mutations of the genes of interest, the therapeutic strategies based on “CRISPR” genome editing technology are emerging. These strategies aim at creating personalised medical approaches, i.e. at correcting the individual mutations underlying the occurrence of genetic diseases.

[0011] However, because of the considerable number of mutations identified as compromising the function of the CACNA1A gene, these therapeutic strategies are not easily applied to the editing of said gene. Therefore, there is a strong need in the scientific community for being able to rely on effective therapeutic strategies for the treatment of pathologies arising from mutations of the CACNA1A gene in humans, such as ataxias and epilepsies. SUMMARY OF INVENTION

[0012] The present invention is based on the finding that, favouring the expression of exon 37a of the CACNA1B gene through genomic editing, the functional deficits caused by the CACNA 1A mutations are beneficially compensated. Therefore, the employment of genomic editing represents an effective therapeutic approach for the treatment or the prevention of pathologies arising from the mutations of the gene thereof, such as ataxias and epilepsies.

[0013] In particular, after a thorough experimentation, the authors of the present invention developed a strategy of genomic editing of the CACNA 1B gene based on CRISPR technology, involving the formation of ribonucleoprotein complexes comprising CRISPR-associated proteins and one or more guide RNA molecules (gRNA), specifically designed for the recognition of target genomic sequences of 20-21 nucleotides, located between exon 37a and exon 38 in the CACNA1B gene. The gRNA molecules identified by the authors of the present invention are such as to direct the protein / gRNA ribonucleoprotein complex to induce a targeted mutation or modification, in particular a targeted break, in said target sequence of the CACNA 1B gene, in particular in proximity to the branch point site of exon 37b of the CACNA1B gene. The resulting effect is to destroy the branch point of exon 37b of the CACNA1B gene, such as to induce the splicing system to favour exon 37a (continuous curved arrow in Figure 2C) over exon 37b (dashed curved arrow in Figure 2C).

[0014] The authors of the present invention found that the mutation in the branch point site of exon 37b of the CACNA1B gene allows to favour the expression of the less common splicing variant of the CACNA1B gene (comprising exon 37a (EFa)) over the more common one (comprising exon 37b (EFb)), with no modifications in the total expression of the CACNA1B gene (Figure 3).

[0015] As clearly demonstrated from the results of in vivo experiments reported in the experimental section of the present application and carried out on mice with reduced expression of the CACNA1A gene, the increase in the expression of the variant EFa of the CACNA 1B obtained through the technology which is the object of the invention is capable of better compensating the functional deficits caused by the mutations of the CACNA 1A gene (Figure 4). Indeed, the treatment with CRISPR-Cas9 system and specific guide RNA molecules for the mutation of the branch point site of the CACNA1B gene and the consequent increase in the expression of the splicing variant containing exon 37a of the CACNA 1B gene allowed the authors to observe a significant correction of the behavioural abnormalities in treated mice.

[0016] The advantage provided from the genomic editing strategy which is the object of the present invention with respect to traditional approaches is two-fold:

[0017] - The strategy is suitable for counterbalancing the effects of the majority of the identified mutations of the CACNA1A gene, and it can therefore be employed for a gene therapy suitable for a wider range of patients.

[0018] CRISPR technologies that allow to mutate specific sites, such as a branch point site, show high efficiency in terminally differentiated cells that do not divide, such as nerve cells, and therefore they can be employed for gene therapy approaches in the brain.

[0019] Therefore, the object of the invention consists in a guide RNA molecule (gRNA) comprising a first portion complementary to a target genomic sequence located between exon 37a and exon 38 in the CACNA1B gene, for use in association with a CRISPR-associated protein, in particular a CRISPR-associated endonuclease.

[0020] Objects of the present invention are also: a ribonucleoprotein complex comprising a gRNA molecule according to any one of the embodiments herein described and a CRISPR-associated protein; a nucleic acid comprising: a sequence encoding a gRNA molecule according to any one of the embodiments herein described; a vector comprising a nucleic acid according to any one of the embodiments herein described; a composition comprising a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a vector according to any one of the embodiments herein described; a gRNA molecule, a ribonucleoprotein complex, a nucleic acid, a vector, or composition according to any one of the embodiments herein described, for use as medicament, in particular in the treatment and / or prevention of ataxia and / or epilepsy in a subject in need thereof; an ex vivo or in vitro method for modifying a target cell, which method comprises contacting said target cell with a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a vector and / or with a composition according to any one of the embodiments herein described; an ex vivo or in vitro method for regulating and / or increasing the expression levels of the messenger RNA (mRNA) splicing variant comprising exon 37a of the CACNA1B gene in a target cell, which method comprises contacting said target cell with a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a vector and / or a composition according to any one of the embodiments herein described; a modified isolated cell comprising a mutated CACNA1B gene, wherein said cell is obtainable by a method as defined in any one of the embodiments herein described; a modified isolated cell according to any one of the embodiments herein described, for use as medicament, in particular in the treatment and / or prevention of ataxia and / or epilepsy in a subject in need thereof; and a kit for modifying a target cell, comprising one or more gRNA molecules, a ribonucleoprotein complex, a nucleic acid, a vector, and / or a composition according to any one of the embodiments herein described.

[0021] Other advantages and characteristics of the present invention will be evident from the following detailed description.

[0022] BRIEF DESCRIPTION OF FIGURES

[0023] Figure 1. Alternative splicing at exon 37a and exon 37b of the CACNA1A and CACNA1B genes. (A) In the CACNA1A and CACNA 1B, either exon 37a or exon 37b is included in mature mRNA, resulting in two mutually exclusive variants (EFa or EFb) for each gene. (B) Quantification by RT-gPCR of variant 37a (EFa, light bars) and variant 37b (EFb, dark bars) of CACNA1A and CACNA1B from mouse brain at 40 days postnatal. (C) As in (B) but from human brain (Ambion #AM7962) and from human neurons derived from induced Pluripotent Stem Cell (iPSC) at 30-45 days of differentiation. The expression levels of variant EFa (light bars) are higher for CACNA 1A than for CACNA 1B.

[0024] Figure 2. CRISPR / Cas9-mediated regulation of alternative splicing of mutually exclusive exon 37a and exon 37b of CACNA1B. (A) Branch point adenosine (A) of exon 37a or exon 37b compete with each other for the same splicing site at 5’ (continuous and dashed curved arrow, respectively). In CACNA 1B, the endogenous splicing system favours exon 37b, which is included in mature mRNA more frequently than exon 37a. (B) Cas9 recognises its target site on the DNA through RNA-DNA interactions mediated by gRNA and induces a double-strand break (DSB). Following the DSB, the endogenous process of non-homologous end-joining (NHEJ) of the DNA, highly effective but prone to errors, repairs the break by inducing mutations in the form of small insertions or deletions of DNA (insertions / deletions (InDei) mutations), thus destroying the recognition sequence on the target site. (C) gRNAs specific for the branch point of exon 37b guide Cas9 to this site. The Cas9-induced mutations on the branch point of exon 37b (X) destroy this site and shift the balance of the competition between exon 37a (light continuous curved arrow) and exon 37 b (dark dashed curved arrow) in favour of the former.

[0025] Figure 3. Increase in the expression of the CACNA1B variant containing exon 37a (EFa) mediated by Cas9 and gRNAs CACNA1B #1-#6. (A) Position of gRNA CACNA1B #1 - #6 in CACNA1B. The predicted break site for each gRNA is indicated by a dashed vertical line. (B) Quantification by RT-gPCR of the total transcript of CACNA1B gene and the variants thereof containing exon 37a (EFa) or exon 37b (EFb) in human embryonic kidney (HEK) cells 48 hours after the expression by transfection in said cells of Staphylococcus aureus endonuclease Cas9 cells (SaCas9) together with a control gRNA (Ctrl) or gRNA CACNA1B #"\ or gRNA CACNA 1B #2 or gRNAs CACNA 1B #1 + CACNA 1B #3 or gRNAs CACNA1B #2 + CACNA1B #3. As in (B) but following transfection of HEK cells with Streptococcus pyogenes Cas9 (SpCas9) together with control gRNA (Ctrl) or gRNA CACNA1B #4 or gRNA CACNA1B #5 or gRNAs CACNA1B #4 + CACNA1B #Q (n = 6 experiments, *p<0.05, one sample t-test).

[0026] Figure 4A. Novel object recognition test. Exploratory behaviour of mice recorded in the presence of two identical objects, during the first phase of the test (top). Exploratory behaviour of mice recorded one hour after the first phase of the test (bottom), in the same arena where one of the objects was substituted with a novel one. Mice with reduced expression of CACNA1A (gRNA P / Q; grey bars) do not discriminate between known object and novel object. Mice with reduced expression of CACNA 1A and increased expression of variant 37a of CACNA1B (gRNAs P / Q + N; black bars) discriminate between known object and novel object in a manner similar to control mice (gRNA Ctrl; white bars; #p<0.05, ###p<0.001, paired t test; *p<0.05, **p<0.01 , one-way ANOVA followed by Tukey's post hoc test; n = 11 animals per group).

[0027] Figure 4B. Vertical pole test. Mice are placed at the top of a vertical pole (55 cm long, 1 cm diameter) with their heads facing upward and the latency to turn around and descend is quantified. The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N; black bars) recovers the deficits due to reduced expression of CACNA1A (gRNA P / Q; grey bars; *p<0.05, **p<0.01, one-way ANOVA followed by Tukey's post hoc test; n = 11 mice per group).

[0028] Figure 4C. Gait analysis. Left, representative tracings. The hind paw impressions are in white, the forepaws impressions are in black. Right, quantification of stride length, stride width and hind- forepaw deviation. The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N; black bars) recovers the deficits due to reduced expression of CACNA1A (gRNA P / Q; grey bars; *p<0.05, one-way ANOVA followed by Tukey's post hoc test; n = 11 animals per group).

[0029] Figure 4D. Rotarod. The motor coordination and balance skills are evaluated for three consecutive days employing the Rotarod device. Mice are placed on a rod that rotates at a speed of 5 revolutions per minute for 1 minute of acclimatisation. The rod is then accelerated at 0.1 revolutions per minute / second until 40 revolutions per minute speed is reached. For each mouse, the latency to fall and the revolutions per minute at the time of fall are recorded. The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N; black bars) recovers the deficits due to reduced expression of CACNA1A (gRNA P / Q; grey bars; *p<0.05, **p<0.01 , one-way ANOVA followed by Tukey's post hoc test; n = 11 animals per group).

[0030] Figure 4E. PTZ-induced epileptic seizure. Top, mice are subjected to 5 subsequent intraperitoneal injections of 8 mg / kg Pentylenetetrazol (PTZ), and their behaviour is recorded for 10 minutes after each injection. The severity of epileptic seizures is evaluated according to a modified Racine scale. Bottom left, average severity score of seizures after each PTZ injection (*p<0.05; **p<0.01 gRNA P / Q vs. gRNA Ctrl; #p<0.05; ##p<0.05 gRNA P / Q vs. gRNAs P / Q + N, repeated measures ANOVA followed by Tukey's post hoc test; n = 12 gRNA Ctrl, 13 gRNA P / Q e 13 gRNA P / Q + N). Bottom right, percentage of mice showing the indicated severity score after each PTZ injection (*p<0.05, **p<0.01, Chi-square test, n = 12 gRNA Ctrl, 13 gRNA P / Q e 13 gRNA P / Q + N). the increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N) recovers the deficits due to reduced expression of CACNA1A (gRNa P / Q).

[0031] Figure 5. Nucleotide (DNA) sequence of human CACNA1B gene, comprising the sequence from exon 36 to exon 38.

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] GLOSSARY

[0034] The terms employed in the present description are as generally understood by the skilled person, except where otherwise indicated.

[0035] The expression “CACNA1B gene” (from calcium voltage-gated channel subunit alphal B gene) employed in the context of the present invention refers to the human gene located in the gene locus on chromosome 9.q34.3, encoding the pore-forming subunit a1 B of N-type CaV2.2 calcium voltage-gated channels, which are essential for the release of neurotransmitter from brain neurons. Preferably, the CACNA1B gene referred to in the present description is the gene identifiable in the Ensembl database with identification code ENSG00000148408 (Ensembl release 110 - July 2023 © EMBL-EBI).

[0036] According to a preferred aspect, the nucleotide (DNA) sequence of human CACNA 1B gene, comprising the sequence from exon 36 to exon 38, is as displayed in SEQ ID No. 23 and shown in Figure 5.

[0037] The expression “CACNA1A gene” (from calcium voltage-gated channel subunit alphal A gene), employed in the context of the present invention, refers to the human gene located in the gene locus on chromosome 19p13.13, encoding the pore-forming transmembrane subunit alfa- 1A of calcium voltage-gated channels (CaV2.1) sensitive to P / Q voltage. Moreover, the CACNA1A gene is bound via an internal ribosomal entry site (IRES) to a second cistron encoding a a1 ACT transcription factor, which coordinates the expression of a program of genes involved in cerebellar development. As mentioned above, this gene mutations are associated with various neurological disorders, including familiar hemiplegic migraine (FHM), episodic ataxy of type 2 (EA2), spinocerebellar ataxia of type 6 (SCA6), and epilepsy. Preferably, the CACNA 1A gene referred to in the present description is the gene identifiable in the Ensembl database with identification code ENSG00000141837 (Ensembl release 110 - July 2023 © EMBL-EBI).

[0038] The expression “branch-point”, employed in the context of the present invention, refers to the site of an intron (a non-coding region) within a gene where the RNA splicing process occurs. This is the point where a nucleotide, usually adenosine, forms a branched structure, facilitating the removal of the intron and the joining of the adjacent exons (coding regions of the gene) to form the mature messenger RNA (mRNA). As a skilled person knows, the localisation of a branch point site in a DNA sequence of interest can be predicted by means of bioinformatics tools, known the said DNA sequence. With reference to the CACNA 1B gene, with the expression “branch point site” employed in the context of the present invention reference is made to, as also shown in Figure 5, a site located in the distal region of the intron between exon 37a and exon 37b of the CACNA1B gene; preferably, said branch point site comprises or consists of a sequence selected from SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21 e SEQ ID No. 22.

[0039] The term “CRISPR-associated protein”, employed in the context of the present invention, refers in particular to:

[0040] (i) a CRISPR-associated endonuclease, i.e. an enzyme capable of breaking chemical bonds in DNA or RNA, associated with the adaptive immune system CRISPR (from clustered regularly interspaced short palindromic repeats'), known in the technical background as a genetic editing tool, as well as any homolog, ortholog, or mutant thereof that retains endonuclease activity, such as for example a Cas9 or Cas13 endonuclease; or to:

[0041] (ii) Any variant or mutant of a CRISPR-associated endonuclease, or any variant or mutant of a homolog or ortholog of a CRISPR-associated endonuclease, modified in such a manner that it lacks endonuclease activity or is catalytically inactive. In particular, said endonuclease activity-lacking or catalytically inactive variant or mutant is associated or conjugated with at least one functionally active domain capable of producing a modification or a mutation in a DNA or RNA sequence, or, in particular, a functionally active domain capable of producing a break, for example a single- or double-strand one, in said DNA or RNA sequence. With the term “functionally active domain capable of producing a modification or a mutation in a DNA or RNA sequence”, as employed in the context of the present invention, reference is made in particular to any peptide, polypeptide, protein, enzyme, or fragment thereof known to a skilled person, which peptide, polypeptide, protein, enzyme, or fragment is capable of altering a DNA or RNA sequence, in particular capable of introducing a modification or a mutation in one or more nucleobases of said DNA or RNA sequence, for example by methylation, demethylation, acetylation, deacetylation, deamination or a combination thereof, more in particular a modification or a mutation such as to destroy or prevent the recognition of the branch point site of exon 37b of CACNA1B gene according to any one of the variations herein described.

[0042] With the term “functionally active domain capable of producing a double-strand break in a DNA sequence”, as employed in the context of the present invention, reference is made to any peptide, polypeptide, protein, or enzyme known to a skilled person as capable of producing a single- or a double-strand break in a DNA sequence, for example any restriction enzyme known in the field.

[0043] As mentioned above, in a preferred embodiment, the expression “CRISPR-associated protein”, employed in the context of the present invention, refers to a “CRISPR-associated endonuclease” or a homolog, ortholog, or mutant thereof that retains endonuclease activity, i.e. an enzyme capable of breaking specific DNA or RNA segments at the level of specific sequences within a genome. Its activity is guided by a guide RNA (gRNA) that identifies the exact point where the break occurs. One identified the target sequence, the endonuclease produces a single- or double-strand break in the DNA or RNA, that can be repaired by the cell by means of several mechanisms.

[0044] In particular, the term “Cas9 endonuclease”, employed in the context of the present invention, refers to the endonuclease-type enzyme that is part of the CRISPR-Cas9 system, widely employed for providing genome modifications, both for research and therapeutic purposes, as well as any homolog, ortholog or mutant thereof that retains endonuclease activity. Two Cas9 endonuclease types that are eligible for use in the present invention are, for example:

[0045] Streptococcus pyogenes Cas9 (SpCas9): this is the more commonly employed and studied variant of Cas9. It was discovered first and implemented into CRISPR-Cas9 technology. The recognition sequence must include the so-called NGG-type “protospacer adjacent motif (PAM) (where N is any nucleotide).

[0046] Staphylococcus aureus Cas9 (SaCas9): this is a Cas9 variant smaller than SpCas9 and it was identified in the Staphylococcus aureus bacterium. SaCas9 is useful for reducing the size of the CRISPR-Cas9 system, enabling its application in contexts where the space is limited. The PAM type recognised by SaCas9 is different from the one recognised by SpCas9 and it can allow the targeting of different target sequences.

[0047] The expression ’’capable of producing a modification of mutation in said target genomic sequence”, employed in the context of the present invention with reference to a ribonucleic complex according to any one of the variations herein described, refers to the capability of the said ribonucleoprotein complex of introducing a modification of mutation in one or more nucleobases of said target genomic sequence, for example by methylation, demethylation, acetylation, deacetylation, deamination of said one or more nucleobases or a combination thereof, or the capability of said ribonucleoprotein complex of producing a single- or double-strand break in said target genomic sequence.

[0048] In particular, with the expression “capable of producing a modification or mutation in said target genomic sequence” reference is made, in the context of the present invention, to the capability of a ribonucleoprotein complex according to any one of the embodiments herein described of introducing a modification of mutation in said target genomic sequence such as to destroy or prevent the recognition of the branch point site of exon 37b of CACNA1B gene according to any one of the variations herein described.

[0049] In the context of the present invention, the term “dead Cas9”, herein abbreviated as “dCas9” and also known to a skilled person as “inactive Cas9 endonuclease”, refers to a Cas9 endonuclease-type enzyme that lacks endonuclease activity or is catalytically inactive as a result of at least one mutation in one or more endonuclease domains. Said dCas9 can be a Cas9 protein according to any one of the variations herein described that comprises at least one mutation in one or more endonuclease domains such as to make the Cas9 protein catalytically inactive. In some embodiments, said dCas9 protein comprises at least 75% amino acid identity compared to a Cas9 protein of S. pyogenes. In other embodiments, said dCas9 protein comprises at least 75% amino acid identity compared to a Cas9 protein of S. aureus. In further embodiments, said dCas9 protein is a Cas9 protein of S. pyogenes or a Cas9 protein ortholog with at least one mutation in one or more endonuclease domains such as to make the Cas9 protein ortholog catalytically inactive.

[0050] In a preferred embodiment, said dCas9 protein is a Cas9 protein comprising D10A and H840A mutations in RuyCI and HNH endonuclease domains, such as to make said Cas9 protein catalytically inactive.

[0051] In the context of the present invention, the term “dead Cas13”, herein abbreviated as “dCas13” and also known to a skilled person as “inactive Cas13 endonuclease”, refers to a Cas13 endonuclease-type enzyme that lacks endonuclease activity or is catalytically inactive as a result of at least one mutation in one or more endonuclease domains. Said dCas13 can be a Cas13 protein according to any one of the variations known to a skilled person that comprises at least one mutation in one or more endonuclease domains such as to make the Cas13 protein catalytically inactive. In the context of the present invention, with the term “exon” reference is made to a region of a eukaryotic gene that contains the genetic information to encode proteins. Exons constitute the parts of the gene that are transcribed into messenger RNA (mRNA) during the process of DNA transcription. After transcription, introns (non-coding regions of the gene) are removed from the mRNA by a process called splicing, and the remaining exons are assembled to form the mature mRNA that is then translated into the corresponding proteins.

[0052] In the context of the present invention, the term “alternative splicing” refers to the molecular process that occurs during DNA transcription to produce different messenger RNA (mRNA) variants from the same gene. Instead of transcribing the entire gene into a single continuous sequence, the pre-messenger RNA undergoes selective breaks, called splicing, that remove certain parts called introns and join together the remaining parts called exons. The effect of this process is the generation of different mRNA variants, each containing different combinations of exons. This alternative splicing allows a single gene to encode for multiple proteins with different functions, contributing to the functional diversity of proteins produced by cells. Preferably a nucleic acid or nucleic acid molecule according to any one of the variants herein described is an isolated nucleic acid or an isolated nucleic acid molecule.

[0053] In the context of the present invention, the expression “non-homologous end-joining” (NHEJ) refers to DNA repair mechanism that occurs when double-strand breaks (DSBs) in DNA occur, for example due to damage or deliberately introduced breaks for genetic editing purposes. In this process, the broken ends of the DNA are simply rejoined, without resorting to a homologous DNA template. The damaged ends can undergo small insertions or deletions, which can lead to permanent mutations. NHEJ is a rapid and simple mechanism that occurs in all cells even in terminally differentiated ones that no longer divide such as nerve cells.

[0054] In the context of the present invention, the abbreviation “RT-qPCR” (from “Reverse Transcription Quantitative Polymerase Chain Reaction”) refers to a molecular biology technique used to amplify and quantify specific nucleic acid fragments, such as RNA. In particular, this methodology combines the retrotranscription of RNA into complementary DNA (cDNA) with quantitative polymerase chain reaction (qPCR), allowing precise and quantitative measurement of the amount of RNA present in the sample. RT-qPCR is widely used to analyse gene expression and transcript variation.

[0055] The “percent (%) sequence identity” as used herein with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are identical to nucleic acids in the reference polynucleotide sequence, after alignment of sequences and introduction of blanks, if necessary, to obtain the maximum percent identity of the sequence. The alignment for the purpose of determining the percent identity of the nucleic acid can be achieved in various ways that are within the capabilities of a skilled person, for example, using publicly accessible software such as BLAST, BLAST-2, or Megalign Software. The skilled persons will know how to determine the appropriate parameters for aligning sequences, including any algorithms needed to achieve maximum alignment over the entire length of the sequences to be compared. For example, percent sequence identity values can be generated using the BLAST sequence comparison computer program.

[0056] With the term “subject” in the present description reference is made to a human being or any other organism that may need to undergo treatment according to the present invention. Such subject may also be referred to herein as patient, individual, user, organism. Preferably, the subject is a human being.

[0057] Subjects particularly eligible for treatment with a composition according to any of the embodiments herein described are subjects suffering from or diagnosed with a pathology or disorder caused by one or more mutations in the CACNA1A gene such as the pathologies exemplified in the present description.

[0058] As employed in the present description with reference to a particular pathology, the wording “OMIM #”, followed by a six-digit number, refers to the registration number of the specific pathology according to the MIM or Mendelian Inheritance in Man database, 12thedition, which catalogues all the pathologies having a genetic component. For each disease the database provides, when possible, a link to the genes in the human genome that are relevant in the occurrence of the disease. Each disease with a genetic component is specifically assigned a sixdigit number, in which the first digit classifies the criterion of heredity. If the first digit is 1 the trait is considered autosomal dominant, if 2 autosomal recessives, if 3 linked to the X chromosome. The hash mark (#) before the registration number indicates that the phenotype may be caused by mutations in one or more genes; as an example, Pelizaeus-Merzbacher syndrome [MIM # 312,080] is an X-chromosome-linked recessive disease.

[0059] At any point in the present description and claims, the expression “comprising” may be replaced by “consisting of.”

[0060] At any point in the present description and claims, the symbol “T,” when given in the nucleotide sequence of an RNA molecule according to any of the embodiments herein described, is to be understood as corresponding to “U” (i.e. , uracil) and may therefore be replaced by the symbol “U” at each occurrence.

[0061] DETAILED DESCRIPTION

[0062] Guide RNA (a RNA) molecules and ribonucleoprotein complexes

[0063] A first aspect of the present invention concerns a gRNA molecule comprising a first portion complementary to a target genomic sequence located between exon 37a and exon 38 in the CACNA1B gene, such that, when in association with a CRISPR-associated protein, in particular a Cas9 protein, it is capable of forming with said protein a gRNA / protein ribonucleoprotein complex, said gRNA / protein ribonucleoprotein complex being capable of producing a mutation or modification, preferably a break, for example a single- or double-strand one, in said target genomic sequence.

[0064] In a preferred embodiment according to the present invention, the gRNA molecule according to any one of the embodiments herein described, when associated with a CRISPR- associated protein according to any one of the variants herein described, in particular a Cas9 endonuclease or any homolog or ortholog thereof, is capable of forming with said protein a gRNA / protein ribonucleoprotein complex, said gRNA / protein ribonucleoprotein complex being capable of producing a break in said target genomic sequence.

[0065] In other words, the gRNA molecule according to the present invention is specifically configured to include at least one sequence complementary to a specific target DNA sequence within the CACNA 1B gene, in particular a target DNA sequence located between exon 37a and exon 38 in the CACNA1B gene.

[0066] In one aspect according to the present invention, the gRNA molecule comprises a first portion complementary to a specific target DNA sequence located within, in proximity to, or comprising a sequence comprising the branch point site of exon 37b of the CACNA1B gene. Preferably, with the expression “in proximity to” reference is made to that the gRNA molecule comprises a first portion complementary to a target genomic sequence located at a distance from a sequence including the branch point site of exon 37b of the CACNA1 gene of no more than 10, 15, 18, 20, 21, 22, or 23 nucleotides.

[0067] Preferably, said gRNA molecule comprises a first portion complementary to a target genomic sequence located within or in proximity to a sequence comprising the branch point site of exon 37b of the CACNA1B gene.

[0068] According to a further aspect, said gRNA molecule comprises a first portion complementary to a target genomic sequence located within, in proximity to or comprising a sequence of exon 37b of the CACNA1B gene, or comprises a first portion complementary to a target genomic sequence located between exon 37b and exon 38 of the CACNA1B gene. In a preferred aspect, the invention provides a first gRNA molecule comprising a first portion complementary to a target genomic sequence located within or in proximity to a sequence comprising the branch point site of exon 37b of the CACNA 1B gene and a second gRNA molecule comprising a first portion complementary to a target genomic sequence located in proximity to or comprising a sequence of exon 37b or between exon 37b and exon 38 of the CACNA1B gene, which first and second gRNA molecules can be used simultaneously in association with a CRISPR-associated protein according to any of the embodiments herein described.

[0069] According to a preferred aspect of the invention, the first portion of a gRNA molecule according to any of the embodiments herein described comprises or consists of:

[0070] - a sequence selected from SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6.

[0071] It is understood that different mutations may be introduced into the sequence of the first portion of the gRNA molecule according to the invention provided that they do not impair the capability thereof, when associated with a CRISPR-associated protein to form a gRNA / protein ribonucleoprotein complex, of allowing the recognition of the target genomic sequence and producing a mutation or a modification, preferably a break, in the said sequence.

[0072] In one aspect of the invention, the first portion of a gRNA molecule according to any one of the embodiments herein described comprises or consists of: a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with a sequence selected from SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, such as said gRNA molecule retains its capability, when associated with a CRISPR-associated protein, of forming a gRNA / protein ribonucleoprotein complex capable of producing a mutation or a modification, preferably a break, in said target genomic sequence.

[0073] According to a particularly preferred aspect, the gRNA molecule comprising a first portion comprising or consisting of a sequence selected from SEQ ID NO. 1 , SEQ ID NO. 2, and SEQ ID NO. 3.

[0074] The gRNA molecule according to the present invention is capable of binding to a CRISPR- associated protein according to any one of the embodiments herein described, forming a ribonucleoprotein complex that can recognise and bind the target sequence in the DNA. This complex guides the protein to mutate or modify the DNA, in particular to introduce a break in the DNA, in the desired site, allowing targeted modifications to the genome.

[0075] To this aim, the gRNA molecule according to any one of the variations herein described may include a second portion capable of binding said CRISPR-associated protein so as to form said gRNA / protein ribonucleoprotein complex.

[0076] According to one aspect of the invention, a gRNA molecule comprising a first portion complementary to a target genomic sequence and a second portion capable of binding said CRISPR-associated protein according to any one of the embodiments herein described, is a chimeric gRNA molecule.

[0077] According to a preferred aspect of the invention, the gRNA molecule according to any one of the embodiments herein described comprises or consists of:

[0078] - a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 , and SEQ ID NO. 12, preferably comprising or consisting of a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8, and SEQ ID NO. 9.

[0079] According to a further aspect of the invention, the gRNA molecule according to any of the embodiments herein described comprises or consists of: a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 , and SEQ ID NO. 12, such as said gRNA molecule retains its capability, when used in association with a CRISPR-associated protein, of forming a gRNA / protein ribonucleoprotein complex capable of producing a mutation or a modification, preferably a break, in said target genomic sequence.

[0080] According to one aspect of the invention, the gRNA molecule according to any one of the embodiments herein described is a single-stranded RNA molecule (sgRNA) or a duplex RNA molecule (gRNA). Object of the invention is formed also by a ribonucleoprotein complex comprising a gRNA molecule according to any one of the embodiments herein described and a CRISPR-associated protein.

[0081] Preferably, said CRISPR-associated protein is an endonuclease capable of producing a break event in a sequence of single- or double stranded DNA. In an alternative embodiment, said CRISPR-associated protein is any variant or mutant of a CRISPR-associated endonuclease according to any one of the variations herein described, or is any variant or mutant of an ortholog or homolog of a CRISPR-associated endonuclease according to any one of the variations herein described, which variant or mutant lacks endonuclease activity or is catalytically inactive and is associated or conjugated to at least one functionally active domain capable of producing a mutation or a modification in a DNA or RNA sequence, i.e. having the capability of modifying one or more nucleobases of a DNA or RNA sequence, in particular by reaction or processes of methylation, demethylation, acetylation, deacetylation, deamination or a combination thereof, preferably by deamination. Preferably, said CRISPR-associated protein is Cas9 endonuclease or a variant thereof or fragment, homolog, ortholog, mutant, or chimeric protein retaining endonuclease activity, such as a Cas9 deriving from Streptococcus or Staphilococcus, in particular from Streptococcus pyogenes or from Staphylococcus aureus.

[0082] According to a further aspect, said CRISPR-associated protein is a chimeric protein comprising a variant or mutant of any one CRISPR-associated endonuclease known to a skilled person, which variant or mutant of said endonuclease lacks endonuclease activity or is catalytically inactive and is associated or conjugated to at least one functionally active domain capable of producing a mutation or a modification in a DNA or RNA sequence or, in particular, capable of producing a double-strand break in a DNA sequence according to any one of the variations herein described.

[0083] Preferably, said CRISPR-associated protein is any variant or mutant of the Cas9 endonuclease, such as a Cas9 deriving from Streptococcus or Staphilococcus, in particular from Streptococcus pyogenes or from Staphylococcus aureus, which lacks endonuclease activity or is catalytically inactive and is associated or conjugated to at least one functionally active domain capable of producing a mutation or a modification in a DNA or RNA sequence, or, in particular, capable of producing a single- or double-strand break in a DNA sequence according to any one of the variations herein described.

[0084] In a further aspect, said CRISPR-associated protein may be any variant or mutant of any homolog or ortholog of a Cas9 endonuclease known to a skilled person, such as for example a variant or mutant of a Cas13 endonuclease, which variant or mutant lacks endonuclease activity or is catalytically inactive and is associated or conjugated to at least one functionally active domain capable of producing a mutation or a modification in a DNA sequence, or, in particular, capable of producing a single- or double-strand break in a DNA sequence according to any one of the variations herein described.

[0085] In a particular aspect of the invention, said CRISPR-associated protein is a dCas9 or dCas13 protein associated or conjugated to at least one functionally active domain capable of producing a mutation or a modification in a DNA or RNA sequence or, in particular, capable of producing a single- or double-strand break in said DNA or RNA sequence according to any one of the variations herein described.

[0086] According to one aspect of the invention, said CRISPR-associated protein is a dCas9-X or dCas13-X-type chimeric protein, where X is a functionally active domain capable of producing a mutation or a modification in a DNA or RNA sequence or capable of producing a single- or double-strand break in a DNA or RNA sequence, according to any one of the variations herein described.

[0087] In an alternative aspect, said CRISPR-associated protein is a chimeric protein comprising any variant or mutant of any homolog or ortholog of a Cas9 or Cas13 endonuclease known to a skilled person, which variant or mutant lacks endonuclease activity or is catalytically inactive.

[0088] Preferably, said X functionally active domain is an enzyme capable of producing a modification in a nucleobase of the DNA or RNA, for example by methylation, demethylation, acetylation, deacetylation, deamination of said one or more nucleobases or a combination thereof, such as in particular a cytidine deaminase or adenine deaminase enzyme.

[0089] In a further aspect, said CRISPR-associated protein is a dCas9 protein conjugated with a restriction enzyme, for example with the Fokl enzyme (Fokl-dCas9 or fdCas9).

[0090] Nucleic acids and vectors

[0091] In one aspect, the invention provides also a nucleic acid comprising: (a) a sequence encoding one or more gRNA molecule according to any one of the embodiments herein described. According to one embodiment, the nucleic acid encodes for a gRNA molecule comprising a first portion complementary to a target genomic sequence located between exon 37a and exon 38 in the CACNA1B gene, capable of, when associated with a CRISPR-associated protein according to any one of the variations herein described, such as a Cas9 protein, producing a mutation or a modification, preferably a break, in said target genomic sequence.

[0092] According to one aspect, the nucleic acid according to any one of the embodiments herein described comprises (b) a sequence encoding a CRISPR-associated protein, preferably where said CRISPR-associated protein is a Cas9 endonuclease or a variant, homolog, ortholog, mutant, or fragment thereof retaining endonuclease activity.

[0093] According to a further aspect, the nucleic acid according to any one of the embodiments herein described comprises (b) a sequence encoding a variant or mutant of a Cas9 endonuclease which lacks endonuclease activity or is catalytically inactive and preferably comprises (c) at least a sequence encoding a functionally active domain capable of producing a mutation or a modification in a DNA sequence or capable of producing a single- or double-strand break in a DNA sequence according to any one of the variations herein described. The nucleic acid according to any one of the variations herein described may be a DNA molecule or a RNA molecule, such as a mRNA molecule.

[0094] Object of the invention is formed also by a vector comprising a nucleic acid according to any one of the embodiments herein described.

[0095] Said vector may be in any one of the forms known to a skilled person, such as in the form of a plasmid or viral vector.

[0096] In particular, the term “plasmid”, as herein employed, refers to a circular extrachromosomal double-stranded DNA molecule into which additional DNA segments can be bound. A plasmid is a type of vector, a nucleic acid molecule capable of carrying another nucleic acid to which it has been bound. Some plasmids are capable of independent replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and mammalian episomal plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell after introduction into the host cell, and then are replicated along with the host genome. Some plasmids are capable of directing the expression of the genes to which they are operatively linked. In one aspect of the invention, the vector is a viral vector, preferably a vector selected from the following list: adenovirus, adeno-associated virus (AAV), lentivirus, retrovirus, cytomegalovirus (CMV), hybrids or other vectors suitable for introducing a nucleic acid into a eukaryotic cell.

[0097] Compositions

[0098] A further aspect of the present invention refers to a composition comprising a gRNA molecule and / or a ribonucleoprotein complex, and / or a nucleic acid, and / or a vector according to any one of the embodiments herein described.

[0099] A composition according to the present invention may comprise also multiple different gRNA molecules selected from any one of the variations described in the present application.

[0100] In a particular embodiment, said composition comprises at least two different gRNA molecules selected from any one of the variations described in the present application.

[0101] In particular, the composition comprises at least a first gRNA molecule comprising a first portion complementary to a target genomic sequence located within or in proximity to a sequence comprising the branch point site of exon 37b of the CACNA 1B gene and a second gRNA molecule comprising a first portion complementary to a target genomic sequence located in proximity to or comprising a sequence of exon 37b or between exon 37b and exon 38 of the CACNA 1B gene.

[0102] Preferably, the composition comprises at least one or at least two gRNA molecules selected from: a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 1, a gRNA molecule comprising or consisting of the sequence displayed in SEQ ID NO. 2, a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 3, a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 4, a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 5, and a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 6. In one aspect, the composition comprises at least one gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 1 and a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 3.

[0103] In a further aspect, the composition comprises at least one gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 2 and a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 3.

[0104] In a further aspect, the composition comprises at least one gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 4 and a gRNA molecule comprising a first portion comprising or consisting of the sequence displayed in SEQ ID NO. 6.

[0105] The composition according to any one of the variations herein described may additionally comprise also a CRISPR-associated protein according to any one of the variations known to a skilled person such as those displayed in the present description, or a nucleic acid encoding for said CRISPR-associated protein.

[0106] According to one aspect of the invention, a composition according to any one of the embodiments herein described is a pharmaceutical composition.

[0107] In one aspect, the composition additionally comprises one or more pharmaceutically acceptable carriers, adjuvants, or excipients. Pharmaceutically acceptable carriers or excipients include for example solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption retardants as long as they are physiologically compatible, including pharmaceutically acceptable cell culture media. The choice of carrier, excipient, or diluent can be made in relation to the desired route of administration and standard pharmaceutical practice. They can be injected for example parenterally, for example intracavernously, intravenously, intraparenchymally into the CNS, in the cerebrospinal fluid (intracerebral ventricular or intrathecal), intramuscularly, or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution that may contain other substances, for example, an amount of salts or monosaccharides enough to make the solution isotonic with blood. Sterile injectable solutions can be prepared by incorporating the compounds of the invention in the required amount into the appropriate solvent with the various other ingredients listed above, as required.

[0108] The compositions according to the invention are preferably stable under manufacturing and storage conditions and preserved from the contaminating action of microorganisms, such as bacteria and fungi. The compositions can be packaged in sealed unit-dose or multidose containers, such as in vial form.

[0109] The compositions of the invention can also be administered in combination with other agents, such as other proteins, polypeptides, small molecules, or various pharmaceutically active agents. There is virtually no limit to the other components that may be included in the compositions, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended gene therapy.

[0110] Medical uses

[0111] One aspect of the present invention provides a gRNA molecule, a ribonucleoprotein complex, a nucleic acid, a vector, or a composition, in particular a pharmaceutical composition, according to any one of the embodiments herein described, for use as medicament, in particular in gene therapy, more in particular in in vivo or ex vivo gene therapy.

[0112] Preferably a gRNA molecule, a ribonucleoprotein complex, a nucleic acid, a vector, or a composition, in particular a pharmaceutical composition, according to any one of the embodiments herein described can be employed in the treatment or the prevention of pathologies of a pathology or functional deficit caused by one or more mutations in the CACNA 1A gene in a subject in need thereof.

[0113] Nonlimiting examples of pathologies or functional deficits caused by one or more mutations in the CACNA 1A gene include neurocerebral diseases, such as ataxias and epilepsies.

[0114] In one aspect of the invention, a gRNA molecule, a ribonucleoprotein complex, a nucleic acid, a vector, or a composition, in particular a pharmaceutical composition, according to any one of the embodiments herein described can be employed in the treatment and / or prevention of ataxia and / or epilepsy in a subject in need thereof and in particular in the treatment and / or prevention of a pathology selected from: episodic ataxy, in particular of type 2, familiar hemiplegic migraine, in particular of type 1 , spinocerebellar ataxia, in particular of type 6, developmental and epileptic encephalopathy, in particular of type 42, and migraine with or without aura.

[0115] According to a particularly preferred aspect, said pathology is selected from: episodic ataxy of type 2 (OMIM # 108500), familiar hemiplegic migraine of type 1 (OMIM # 141500), spinocerebellar ataxia of type 6 (OMIM # 183086), developmental and epileptic encephalopathy 42 (OMIM # 617106), migraine with or without aura, susceptibility to, 5 (OMIM # 607508).

[0116] The dosage and therapeutic regimen of the gRNA molecule, of the ribonucleoprotein complex, of the nucleic acid, of the vector, or of a composition according to the present invention may be established by a physician according to the weight, health status, sex, and age of the subject to be treated, as well as modified over time according to the subject's response to the therapeutic treatment. Thus, the dosage of individual active ingredients in a composition according to the invention may be adjusted, even over the period of taking the composition of the invention, depending on the results obtained over time. According to one aspect of the invention, the composition is administered to a subject in need thereof in one or more daily doses.

[0117] Object of the invention is formed also by an ex vivo or in vitro method for modifying a target cell, which method comprises a step of contacting said target cell with a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a vector and / or a composition according to any one of the embodiments herein described, such that said gRNA molecule and / or said ribonucleoprotein complex and / or said nucleic acid and / or said a vector and / or said composition is introduced into said target cell.

[0118] According to one aspect, the modification comprises or consists of the introduction and / or deletion of one or more nucleotides in the sequence comprising the branch point site of exon 37b of the CACNA1B gene. Preferably said introduction and / or deletion of one or more nucleotides is operated intracellularly by the endogenous process of non-homologous end-joining (NHEJ).

[0119] Therefore, according to a preferred aspect of the invention, the modification comprises or consists of at least one break at the branch point site of exon 37b of the CACNA1 B gene, followed by repair of the break by endogenous non-homologous end-joining process, with introduction and / or deletion of one or more nucleotides (insertions / deletions (InDei) mutations). According to a further aspect, the modification comprises or consists of the deamination of a cytidine nucleobase or adenine nucleobase of the DNA or RNA.

[0120] Object of the present invention is formed also by an ex vivo or in vitro method for regulating and / or increasing the expression levels of the messenger RNA (mRNA) splicing variant comprising exon 37a of the CACNA1B gene in a target cell, which method comprises contacting said target cell with a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a vector and / or a composition according to any one of the embodiments herein described.

[0121] With the expression “increasing the expression levels of the messenger RNA (mRNA) splicing variant comprising exon 37a of the CACNA1B gene in a target cell” reference is made, in particular, to increasing the abundance of the said variant in the treated cell with respect to the abundance thereof in the native, untreated cell.

[0122] According to one aspect, the target cell is a eukaryotic cell, preferably a mammalian cell. More preferably, the target cell is a brain cell.

[0123] According to one aspect of the invention, the method according to any one of the variations herein described comprises at least one step in which said target cell is transformed or transfected with a nucleic acid, with a vector, or with a composition comprising them according to any one of the embodiments herein described.

[0124] A method according to any one of the embodiments herein described may also comprise a step of determination or qualitative and / or quantitative analysis of the abundance or of the expression levels of the messenger RNA (mRNA) splicing variant comprising exon 37a of the CACNA1B gene. This determination can be made using any one of the methodologies known to a skilled person, and in particular, by performing quantitative reverse transcriptase polymerase chain reaction (RT-qPCT).

[0125] Object of the present invention is formed also by a modified isolated cell comprising a mutated CACNA1B gene, wherein said cell is obtained or prepared by a method as defined in any one of the embodiments herein described. Preferably, the modified isolated cell according to the present invention is a eukaryotic cell, preferably it is a mammalian cell and, in particular, it is a brain cell. Object of the present invention is formed also by a composition, in particular a pharmaceutical composition, comprising a plurality of cells modified according to any one of the embodiments herein described and, optionally, at least one pharmaceutically acceptable carrier or excipient.

[0126] Said composition is a composition suitable for cell administration, thus it is preferably a composition for parenteral administration in saline, but also, for example, an aqueous suspension or formulated according to any of the techniques described in the prior art. By way of example and not limitation, water or buffers, supplemented with preservatives, stabilizers, sugars and minerals, etc., may be used as pharmacologically acceptable excipients. The composition may also be in lyophilized form for storage and reconstituted in a suitable carrier before use.

[0127] The composition according to any one of the embodiments herein described preferably has a pH between 7 and 8 and is isotonic.

[0128] A modified isolated cell or a composition comprising it, in particular a pharmaceutical composition comprising it according to any one of the variations herein described may be used as a medicament, in particular in the treatment and / or prevention of a disease or functional deficit caused by one or more mutations in the CACNA1A gene in a subject in need thereof, in particular ataxia and / or epilepsy such as any of the diseases exemplified in the present description and claims.

[0129] A further object of the present invention is represented by a kit for the modification of a target cell, or for regulating and / or increasing the expression levels of the messenger RNA (mRNA) splicing variant comprising exon 37a of the CACNA1B gene in a target cell, comprising one or more gRNA molecules, a ribonucleoprotein complex, a nucleic acid, a vector, or a composition according to any one of the embodiments herein described.

[0130] Object of the present invention is also formed by the in vitro use of said kit for the modification of a target cell, or for regulating and / or increasing the expression levels of the messenger RNA (mRNA) splicing variant comprising exon 37a of the CACNA1B gene in a target cell according to any one of the variations previously herein outlined.

[0131] Object of the present invention is also formed by the use of a gRNA molecule, a ribonucleoprotein complex, a nucleic acid, a vector or an isolated cell modified according to any one of the embodiments herein described in the preparation of a medicament, particularly in the preparation of a medicament for the treatment and / or prevention of a pathology or functional deficit caused by one or more mutations in the CACNA1A gene in a subject in need, preferably ataxia and / or epilepsy.

[0132] Also herein described is a method for treating a subject suffering from a disease or functional deficit caused by one or more mutations in the CACNA1A gene, in particular a neurocerebral disease such as ataxia or epilepsy, in particular any one of the diseases exemplified in the present description and claims, which method comprises at least one step of administering to the subject one or more gRNA molecules, a ribonucleoprotein complex, a nucleic acid, a vector, or a composition, in particular a pharmaceutical composition, according to any one of the embodiments herein described in a therapeutically effective dosage form. A “therapeutically effective” dosage means a dosage that is effective in therapy, or an amount sufficient to provide a desired therapeutic effect.

[0133] Examples are given below that are intended to better illustrate the compositions and methodologies disclosed in the present description, these examples are in no way to be considered as a limitation of the preceding description and subsequent claims.

[0134] EXAMPLES

[0135] Example 1

[0136] As illustrated in Figure 2B, the Cas9 endonuclease recognises a specific site of genomic DNA thanks to a guide RNA (gRNA) that specifically pairs to the genomic DNA sequence of the target site. Once the recognition occurs, the Cas9 endonuclease creates a double-strand break (DSB) in the DNA target site. Following the DSB, the endogenous process of non-homologous end-joining (NHEJ) of the DNA, which is highly effective also in nerve cells but prone to errors, repairs the break by inducing mutations in the form of small insertions or deletions of DNA (insertions / deletions (InDei) mutations). Therefore, for the mutations to occur in a specific site of the genomic DNA, the sequences of genomic DNA specifically recognised by gRNAs must be identified. As illustrated in Figure 2C, six sequences of 20-21 nucleotides that direct the Cas9 endonuclease in proximity to the branch point of exon 37b of the CACNA1B gene, such as the Cas9 mutates it (dark cross), have been identified. The effect is the break of the branch point of exon 37b of the CACNA1B gene, such as the splicing system selects exon 37a (light continuous curved arrow) in spite of exon 37 b (dark dashed curved arrow).

[0137] As illustrated in Figure 3, this favours the expression of the less common variant of the CACNA1B gene (comprising exon 37a (EFa)) over the more common one (comprising exon 37b (EFb)), with no modification in the total expression of the CACNA1B gene.

[0138] The sequences of 20-21 nucleotides complementary to the target genomic sequences in the CACNA1B gene which have been identified are the following:

[0139] *Chr: chromosome

[0140] Example 2 - The increase in the expression of the CACNA1B variant comprising exon 37a (EFa) mediated by CRISPR / Cas9 corrects the behavioural abnormalities of mice with reduced expression of CACNA1A

[0141] In order to verify the impact of the increase in the expression of the CACNA1B variant comprising exon 37a (EFa) mediated by CRISPR / Cas9 in vivo, several tests described in the following were conducted on the following three experimental groups:

[0142] 1) Control gRNA (gRNA Ctrl; white bars): mice infected with SaCas9 + gRNA Ctrl, having normal expression of CACNA1A and CACNA1B 2) gRNA for knockdown of CACNA 1A (gRNA P / Q; gray bars): mice infected with SaCas9 + gRNA P / Q + gRNA Ctrl, having reduced expression of CACNA1A (in all its variants) and normal expression of CACNA1B,

[0143] 3) gRNA for knockdown of CACNA1A + gRNA for increasing the expression of exon 37a of CACNA1B (gRNAs P / Q + N; black bars): mice infected with SaCas9 + gRNA P / Q + gRNA N, having reduced expression of CACNA1A (in all its variants) and increased expression of variant 37a of CACNA1 B.

[0144] In the present set of experiments in mice, gRNA sequences comprising the following portions complementary to the target genomic sequences of the murine CACNA1A and CACNA1B genes were employed:

[0145] *Chr: chromosome

[0146] Reference genome: Mus musculus - UCSC Dec.2011 (mm10=C57BL / 6J)

[0147] In particular, in the present set of experiments carried out in mice, gRNA molecules having sequences displayed in SEQ ID No. 16, SEQ ID No. 17 e SEQ ID No. 18 were employed.

[0148] Novel object recognition test

[0149] A novel object recognition test was first carried out. During the first phase of the test, the exploratory behaviour of mice is recorded in the presence of two identical objects and no difference in the exploratory behaviour is detected among the three experimental groups (Figure 4A, top).

[0150] One hour after the first phase of the test, the mice are placed again in the same arena where one of the objects was substituted with a novel one (Figure 4A, bottom). Mice with reduced expression of CACNA 1A (gRNA P / Q; grey bars, Figure 4 A) do not discriminate between known object and novel object. Mice with reduced expression of CACNA1A and increased expression of variant 37a of CACNA1B (gRNAs P / Q + N; black bars in Figure 4 A) discriminate between known object and novel object in a manner similar to control mice (gRNA Ctrl; white bars; #p<0.05, ###p<0.001, paired t test; *p<0.05, **p<0.01 , one-way ANOVA followed by Tukey's post hoc test; n = 11 animals per group).

[0151] Vertical pole test

[0152] Mice are placed at the top of a vertical pole (55 cm long, 1 cm diameter) with their heads facing upward and the latency to turn around and descend is quantified. The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N; black bars in Figure 4B) recovers the deficits due to reduced expression of CACNA1A (gRNA P / Q; grey bars, Figure 4B; *p<0.05, **p<0.01, one-way ANOVA followed by Tukey's post hoc test; n = 11 mice per group).

[0153] Gait analysis

[0154] In Figure 4C, left, representative tracings. The hind paw impressions are in white, the forepaws impressions are in black. Right, quantification of stride length, stride width and hind- forepaw deviation. The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N; black bars in Figure 4C) recovers the deficits due to reduced expression of CACNA1A (gRNA P / Q; grey bars, Figure 4C; *p<0.05, one-way ANOVA followed by Tukey's post hoc test; n = 11 animals per group).

[0155] Rotarod

[0156] The motor coordination and balance skills are evaluated for three consecutive days employing the Rotarod device. Mice are placed on a rod that rotates at a speed of 5 revolutions per minute speed for 1 minute of acclimatisation. The rod is then accelerated at 0.1 revolutions per minute / second until 40 revolutions per minute speed is reached. For each mouse, the latency to fall and the revolutions per minute at the time of fall are recorded. The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N; black bars in Figure 4D) recovers the deficits due to reduced expression of CACNA1A (gRNA P / Q; grey bars, Figure 4D; *p<0.05, **p<0.01, oneway ANOVA followed by Tukey's post hoc test; n = 11 animals per group).

[0157] PTZ-induced epileptic seizure

[0158] Top in Figure 4E, mice are subjected to 5 successive intraperitoneal injections of 8 mg / kg Pentylenetetrazol (PTZ) every 10 minutes, and their behaviour is recorded after each injection. The severity of epileptic seizures is evaluated according to a modified Racine scale. Bottom left in Figure 4E, average severity score of seizures after each PTZ injection (*p<0.05; **p<0.01 gRNA P / Q vs. gRNA Ctrl; #p<0.05; ##p<0.05 gRNA P / Q vs. gRNAs P / Q + N, repeated measures ANOVA followed by Tukey's post hoc test; n = 12 gRNA Ctrl, 13 gRNA P / Q e 13 gRNA P / Q + N). Bottom right in Figure 4E, percentage of mice showing the indicated severity score after each PTZ injection (*p<0.05, **p<0.01 , Chi-square test, n = 12 gRNA Ctrl, 13 gRNA P / Q e 13 gRNA P / Q + N). The increased expression of the variant 37a of CACNA1B (gRNAs P / Q + N) recovers the deficits due to reduced expression of CACNA1A (gRNa P / Q).

[0159] List of the sequences in the description:

[0160] SEQ ID No. 1 - Nucleotide sequence of the portion complementary to the target sequence

[0161] CACNA 1B of the gRNA #1 molecule

[0162] CTGTGCCCTGGCCTCGCTGGG

[0163] SEQ ID No. 2 - Nucleotide sequence of the portion complementary to the target sequence

[0164] CACNA1B of the gRNA #2 molecule

[0165] GGAGGGGAGCGGGGAGGGGAG

[0166] SEQ ID No. 3 - Nucleotide sequence of the portion complementary to the target sequence

[0167] CACNA1B of the gRNA #3 molecule

[0168] AGCCTCCTGGGGGGCGGGTTG

[0169] SEQ ID No. 4 - Nucleotide sequence of the portion complementary to the target sequence

[0170] CACNA1B of the gRNA #4 molecule

[0171] GAGGCCAGGGCACAGTGGGG

[0172] SEQ ID No. 5 - Nucleotide sequence of the portion complementary to the target sequence

[0173] CACNA1B of the gRNA #5 molecule

[0174] GGCACAGTGGGGTGGTCCAC

[0175] SEQ ID No. 6 - Nucleotide sequence of the portion complementary to the target sequence

[0176] CACNA1B of the gRNA #6 molecule

[0177] ACCTTGTAAGCAACTCGAGC

[0178] SEQ ID No. 7 - Complete nucleotide sequence of the gRNA #1 molecule

[0179] CTGTGCCCTGGCCTCGCTGGGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtg t ttatctcgtcaacttgttggcgagatttt

[0180] SEQ ID No. 8 - Complete nucleotide sequence of the gRNA #2 molecule

[0181] GGAGGGGAGCGGGGAGGGGAGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccg tgt ttatctcgtcaacttgttggcgagatttt

[0182] SEQ ID No. 9 - Complete nucleotide sequence of the gRNA #3 molecule AGCCTCCTGGGGGGCGGGTTGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgt gt ttatctcgtcaacttgttggcgagatttt

[0183] SEQ ID No. 10 - Complete nucleotide sequence of the gRNA #4 molecule

[0184] GAGGCCAGGGCACAGTGGGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaa gt ggcaccgagtcggtgc

[0185] SEQ ID No. 11 - Complete nucleotide sequence of the gRNA #5 molecule

[0186] GGCACAGTGGGGTGGTCCACgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaag t ggcaccgagtcggtgc

[0187] SEQ ID No. 12 - Complete nucleotide sequence of the gRNA #6 molecule

[0188] ACCTTGTAAGCAACTCGAGCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagt ggcaccgagtcggtgc

[0189] SEQ ID No. 13 - Nucleotide sequence of the portion complementary to the target CACNA1A sequence of the gRNA P / Q (CACNA1A) molecule employed in Example 2

[0190] GGCAGTTCTGGCGGACAGGGA

[0191] SEQ ID No. 14 - Nucleotide sequence of the portion complementary to the target CACNA1B sequence of the gRNA N (CACNA1B) molecule employed in Example 2

[0192] ACAGAAGAGGCACACGGCAGG

[0193] SEQ ID No. 15 - Nucleotide sequence of the portion complementary to the target sequence of control gRNA molecule employed in Example 2

[0194] GTTCCGCGTTACATAACTTA

[0195] SEQ ID No. 16 - Complete nucleotide sequence of the gRNA P / Q (CACNA 1A) molecule employed in Example 2

[0196] GGCAGTTCTGGCGGACAGGGAgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtg t ttatctcgtcaacttgttggcgagatttt SEQ ID No. 17 - Complete nucleotide sequence of gRNA N (CACNA1B) molecule employed in Example 2 ACAGAAGAGGCACACGGCAGGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtg t ttatctcgtcaacttgttggcgagatttt

[0197] SEQ ID No. 18 - Complete nucleotide sequence of control gRNA molecule employed in Example 2

[0198] GTTCCGCGTTACATAACTTAgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgtt tatctcgtcaacttgttggcgagatttt

[0199] SEQ ID No. 19 - Nucleotide sequence of predicted branch point 1 of exon 37b of the CACNA 1B gene - This sequence is not included in the Sequence Listing as it comprises less than 10 nucleotides ggcctcGc

[0200] SEQ ID No. 20 - Nucleotide sequence of predicted branch point 2 of exon 37b of the CACNA 1B gene - This sequence is not included in the Sequence Listing as it comprises less than 10 nucleotides accccAc

[0201] SEQ ID No. 21 - Nucleotide sequence of predicted branch point 3 of exon 37b of the CACNA 1B gene - This sequence is not included in the Sequence Listing as it comprises less than 10 nucleotides cccctcCc

[0202] SEQ ID No. 22 - Nucleotide sequence of predicted branch point 4 of exon 37b of the CACNA 1B gene - This sequence is not included in the Sequence Listing as it comprises less than 10 nucleotides cccctAc

[0203] SEQ ID No. 23 - Nucleotide sequence (DNA) of the human CACNA1B gene from exon 36 included to exon 38 included

Claims

CLAIMS1. A guide RNA molecule (gRNA) comprising a first portion complementary to a target genomic sequence located between exon 37a and exon 38 in the CACNA 1B gene, for use in association with a CRISPR-associated protein, wherein said first portion comprises or consists of:- a sequence selected from SEQ 1 D NO. 1, SEQ ID NO. 2, SEQ 1 D NO. 3, SEQ ID NO. 4, SEQ 1 D NO. 5, and SEQ ID NO. 6.- a sequence having at least 95% or at least 99% identity with a sequence selected from SEQ 1D NO. 1 , SEQ ID NO. 2, SEQ 1 D NO. 3, SEQ ID NO. 4, SEQ 1 D NO. 5, and SEQ ID NO. 6.

2. The gRNA molecule according to claim 1 , wherein said target genomic sequence is located within or comprises a sequence comprising the branch point site of exon 37b of the CACNA 1B gene.

3. The gRNA molecule according to claims 1 or 2, wherein said branch point site comprises or consists of a sequence selected among ggcctcGc, accccAc, cccctcCc, and cccctAc.

4. The gRNA molecule according to any one of claims 1 to 3, wherein said target genomic sequence is located within or comprises a sequence of exon 37b of the CACNA 1B gene, or wherein said target genomic sequence is located between exon 37b and exon 38 of the CACNA1B gene.

5. The gRNA molecule according to claim 4, wherein said first portion comprises or consists of a sequence selected among SEQ 1 D NO. 1, SEQ ID NO. 2, and SEQ 1 D NO. 3.

6. The gRNA molecule according to any one of claims 1 to 5, comprising a second portion capable of binding said CRISPR-associated protein in such a way as to form a gRNA / protein ribonucleoprotein complex.

7. The gRNA molecule according to any one of claims 1 to 6, wherein said gRNA molecule comprises or consists of a sequence selected from SEQ 1 D NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ 1 D NO. 11 , and SEQ ID NO. 12, preferably comprises or consists of a sequence selected among SEQ 1D NO. 7, SEQ ID NO. 8, and SEQ ID NO. 9.

8. The gRNA molecule according to any one of claims 1 to 7, wherein said gRNA molecule is a single-stranded RNA molecule (sgRNA).

9. A ribonucleoprotein complex comprising a gRNA molecule according to any one of claims 1 to 8 and a CRISPR-associated protein, preferably a CRISPR-associated endonuclease.

10. The ribonucleoprotein complex according to claim 9, wherein said CRISPR-associated protein is a Cas9 endonuclease or a variant, ortholog, homolog, mutant, or fragment thereof that retains endonuclease activity.

11. The ribonucleoprotein complex according to claim 10, wherein said CRISPR-associated is a variant or a mutant of a CRISPR-associated endonuclease, preferably is a variant or a mutant of a Cas9 endonuclease or of a homolog or ortholog thereof, which variant or mutant lacks endonuclease activity and is associated or conjugated to at least one functionally active domain capable of producing a modification or a mutation, preferably capable of producing a deamination, in a DNA sequence.

12. The ribonucleoprotein complex according to claim 11 , wherein said variant or mutant of said CRISPR-associated endonuclease is a dCas9 or dCas13 protein.

13. The ribonucleoprotein complex according to any one of claims 11 to 12, wherein said Cas9 endonuclease derives from Streptococcus or Staphylococcus, in particular from Streptococcus pyogenes or from Staphylococcus aureus.

14. The ribonucleoprotein complex according to any one of claims 10 to 13, such that when said complex is introduced into a brain cell it is capable of increasing the expression levels of the splicing variant of messenger RNA (mRNA) including exon 37a of the CACNA1B gene.

15. A nucleic acid comprising: (a) a sequence encoding a gRNA molecule according to any one of claims 1 to 8; (b) a sequence encoding a CRISPR-associated protein, preferably wherein said CRISPR-associated protein is a Cas9 endonuclease or a variant, homolog, ortholog, mutant, or fragment thereof that retains endonuclease activity.

16. The nucleic acid according to claim 15, wherein said CRISPR-associated protein is a variant or mutant of a CRISPR-associated endonuclease, preferably of a Cas9 endonuclease or of a homolog or ortholog thereof, which variant or mutant lacks endonuclease activity, preferably wherein said CRISPR-associated protein is the dCas9 protein.

17. The nucleic acid according to claims 15 or 16, further comprising (c) a sequence encoding a functionally active domain capable of producing a modification or mutation, preferably capable of producing a deamination, in a DNA sequence.

18. The nucleic acid according to any one of claims 16 or 17, wherein said Cas9 endonuclease derives from Streptococcus or Staphylococcus, in particular from Streptococcus pyogenes or from Staphylococcus aureus.

19. A vector comprising a nucleic acid according to any one of claims 15 to 18.

20. The vector according to claim 19, wherein said vector is a viral vector, preferably is an adeno- associated viral vector (AAV).

21. A composition comprising a gRNA molecule according to any one of claims 1 to 8 and / or a ribonucleoprotein complex according to any one of claims from 9 to 14, and / or a nucleic acid according to any one of claims 15 to 18, and / or a vector according to claims 19 or 20, preferably wherein said composition is a pharmaceutical composition.

22. The composition according to claim 21 , further comprising a CRISPR-associated protein and / or a nucleic acid encoding said CRISPR-associated protein.

23. The composition according to claim 22, wherein said CRISPR-associated protein is a Cas9 endonuclease or a variant, homolog, ortholog, mutant, or fragment thereof that retains endonuclease activity.

24. The composition according to claim 23, wherein said CRISPR-associated protein is a variant or a mutant of a Cas9 endonuclease, or of a homolog or ortholog thereof, which lacks endonuclease activity, which variant or mutant is associated or conjugated to at least one functionally active domain capable of producing a modification or mutation, preferably capable of producing a deamination, in a DNA sequence.

25. The composition according to any one of claims 21 to 24, further comprising one or more pharmaceutically acceptable carriers or excipients.

26. The composition according to any one of claims 21 to 25, for use as a medicament.

27. The composition for use according to claim 26, in the treatment and / or prevention of a pathology or functional deficit caused by one or more mutations in the CACNA 1A in a subject in need thereof.

28. The composition for use according to any one of claims 26 or 27, in the treatment and / or prevention of ataxia or epilepsy in a subject in need thereof.

29. The composition for use according to any one of claims 26 to 28, in the treatment and / or prevention of a pathology selected from: episodic ataxia, in particular of type 2, familiar hemiplegic migraine, in particular of type 1, spinocerebellar ataxia, in particular of type 6, developmental and epileptic encephalopathy, in particular of type 42, and migraine with or without aura.

30. An ex vivo or in vitro method for modifying a target cell, which method comprises contacting said target cell with a gRNA molecule according to any one of claims 1 to 8, with a ribonucleoprotein complex according to any one of claims from 9 to 14, with a nucleic acid according to any one of claims from 15 to 18, with a vector according to claims 19 or 20, and / or with a composition according to any one of claims 21 to 29.

31. The method according to claim 30, wherein said modification comprises or consists of the introduction and / or deletion and / or mutation of one or more nucleotides in the sequence comprising the branch point site of exon 37b of the CACNA1B gene.

32. An ex vivo or in vitro method for regulating and / or increasing the expression levels of the messenger RNA (mRNA) splice variant comprising exon 37a of the CACNA1B gene in a target cell, which method comprises contacting said target cell with a gRNA molecule according to any one of claims 1 to 8, with a ribonucleoprotein complex according to any one of claims 9 to 14, with a nucleic acid according to any one of claims from 15 to 18, with a vector according to claims 19 or 20, and / or with a composition according to any one of claims 21 to 29.

33. The method according to any one of claims 31 to 32, wherein said target cell is a eukaryotic cell, preferably a mammal cell.

34. The method according to any one of claims 31 to 33, wherein said target cell is a brain cell.

35. The method according to any one of claims 31 to 34, further comprising at least one step of qualitative and / or quantitative determination of the expression levels of the messenger RNA (mRNA) splice variant comprising exon 37a of the CACNA1B gene.

36. The method according to claim 35, wherein said determination is carried out by performing reverse transcriptase quantitative polymerase chain reaction (RT-qPCT).

37. A modified isolated cell comprising a mutated CACNA 1B gene, wherein said cell is obtainable by a method as defined in any one of claims 30 to 36.

38. The modified isolated cell according to claim 37, wherein said cell is a eukaryotic cell, preferably a mammal cell.

39. The modified isolated cell according to claims 37 or 38, wherein said cell is a brain cell.

40. A pharmaceutical composition comprising a plurality of modified isolated cells according to any one of claims 37 to 39, for use as a medicament.

41. The pharmaceutical composition for use according to claim 40, in the treatment and / or prevention of a pathology or functional deficit caused by mutations in the CACNA1A gene in a subject in need thereof.

42. The composition for use according to any one of claims 40 or 41 , in the treatment and / or prevention of ataxia and / or epilepsy in a subject in need thereof.

43. The composition for use according to any one of claims 40 to 42, in the treatment and / or prevention of a pathology selected from: episodic ataxia, in particular of type 2, familiar hemiplegic migraine, in particular of type 1, spinocerebellar ataxia, in particular of type 6, developmental and epileptic encephalopathy, in particular of type 42, and migraine with or without aura.

44. A kit for modifying a target cell, comprising one or more gRNA molecules according to any one of claims 1 to 8, a ribonucleoprotein complex according to any one of claims 9 to 14, a nucleic acid according to any one of claims 15 to 18, a vector according to claims 19 or 20, and / or a composition according to any one of claims 21 to 29.

Images