Method for large-scale multiplex detection of lung cancer mutant genes using RNA and kit for large-scale multiplex detection of lung cancer mutant genes using same

Abstract

The present invention relates to a method for large-scale multiplex detection of lung cancer mutant genes using RNA and a kit for large-scale multiplex detection of lung cancer mutant genes using same and, more specifically, to a method for large-scale multiplex detection of lung cancer mutant genes using RNA, capable of simultaneously detecting 44 types of EGFR gene mutations, 1 type of BRAF gene mutation, 1 type of KRAS gene mutation, 10 types of EML4-ALK gene fusion mutations, and 12 types of ROS1 gene rearrangements, and a kit for detection of EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations using a primer set and a composition.

Description

A large-scale multiplex detection method for lung cancer mutant genes using RNA and a large-scale multiplex detection kit for lung cancer mutant genes using the same.

[0001] This application claims priority to Republic of Korea Patent Application No. 10-2023-0158257, filed November 15, 2023, the entire disclosure of which is incorporated herein by reference.

[0002] The present invention relates to a large-scale multiplex detection method for lung cancer mutant genes using RNA and a large-scale multiplex detection kit for lung cancer mutant genes using the same, and more specifically, to a gene mutation detection method capable of simultaneously and multiplexally detecting 44 types of EGFR gene mutations, 1 type of BRAF gene mutation, 1 type of KRAS gene mutation, 10 types of EML4-ALK gene fusion mutations and 12 types of ROS1 gene rearrangement mutations using RNA, and a kit for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations using a primer set and a composition.

[0003] Lung cancer is a common cancer worldwide and a leading cause of cancer-related death. According to cancer statistics from the National Cancer Center in Korea, lung cancer ranks fourth in terms of incidence, with over 25,000 new cases diagnosed annually. While the five-year survival rate has improved since the 2000s compared to the 1990s, it remains a mere 28.2%. In cases with distant metastasis, the five-year relative survival rate in Korea remains a very low 6.1%.

[0004] However, it is true that significant progress has been made in the treatment of metastatic non-small cell lung cancer (NSCLC) since the 2000s. This is the cancer for which the most diverse and effective targeted therapies have been developed and applied, and immunotherapy is also demonstrating promising therapeutic effects and expanding its scope of application. Cytotoxic chemotherapy continues to be an important cornerstone of treatment. Therefore, when deciding on chemotherapy for stage IV NSCLC patients, for whom curative treatment is difficult, it is crucial to first determine the patient's molecular pathology and select the appropriate treatment to ensure the most effective treatment for each individual.

[0005] In particular, in non-small cell lung cancer, it is very important to confirm the presence of the relevant genetic mutations because targeted therapies targeting certain genetic mutations show good effects in patients with those mutations. Among the genetic mutations, important tests include mutations in the EGFR, ALK, ROS1, and BRAF genes, and tests and treatments for these are covered by insurance. In addition, KRAS gene mutations are the second most frequently found mutation gene after EGFR in Asian lung cancer patients. With the recent development of Lumacras as a targeted treatment for KRAS G12C mutation-positive non-small cell lung cancer with a poor prognosis, the importance of diagnosing KRAS G12C mutations is also increasing.

[0006] Meanwhile, Patent Document 1 discloses a lung cancer diagnostic kit that simultaneously detects mutations in EGFR, KRAS, BRAF, and PIK3CA genes, but there is no known kit that can simultaneously and multiplely detect a total of 68 lung cancer-related gene mutations in EGFR (44 types), BRAF (1 type), KRAS (1 type), ROS1 (12 types), and EML4-ALK (10 types) genes using RNA.

[0007] Against this backdrop, the present inventors developed a kit capable of simultaneously detecting each of the 68 types of lung cancer gene mutations using mutation-specific primers after synthesizing and amplifying cDNA using a specific oligomer from mRNA, so that all 68 types of lung cancer gene mutations can be detected even from a small amount of sample, and completed the present invention.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] (Patent Document 1) Republic of Korea Publication No. 10-2015-0102468

[0011] Accordingly, the purpose of the present invention is to provide a primer set for synthesizing and amplifying cDNA containing EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, respectively, from RNA.

[0012] Another object of the present invention is to provide a primer set for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes and a composition for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes comprising the same.

[0013] Another object of the present invention is to provide a kit for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, which comprises a primer set and a probe that specifically bind to each of the EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, and a method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA using the kit.

[0014] Another object of the present invention is to provide a composition and kit for diagnosing lung cancer, which comprises a primer set that specifically binds to each of cDNAs containing 44 types of EGFR gene mutations, cDNAs containing 1 type of BRAF gene mutation, cDNAs containing 1 type of KRAS gene mutation, cDNAs containing 10 types of EML4-ALK gene mutations, and cDNAs containing 12 types of ROS1 gene mutations.

[0015] To solve the above-described problem, the present invention provides a primer set for synthesizing and amplifying cDNAs each containing EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, including primer sets of SEQ ID NOs: 1 to 34.

[0016] In addition, the present invention provides a primer set for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, including primer sets of SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132, and a composition for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, including the same.

[0017] In addition, the present invention provides a kit for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, which comprises a primer set for synthesizing and amplifying cDNAs each including the aforementioned EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations and a primer set for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations.

[0018] In the present invention, the composition or kit may additionally include at least one probe selected from the group consisting of SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130, and 133.

[0019] In the present invention, the composition or kit may additionally include a blocking primer of SEQ ID NO: 72.

[0020] Furthermore, the present invention provides a method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA using the kit for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations described above.

[0021] In the present invention, the method may include the following steps (a) to (d):

[0022] (a) a step of extracting RNA from a separated biological sample;

[0023] (b) a step of synthesizing and amplifying cDNAs each including EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations by treating the primer sets of sequence numbers 1 to 34 and reverse transcriptase;

[0024] (c) performing a polymerase chain reaction by processing a primer set of SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132 and a probe of SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130 and 133 Step; and

[0025] (d) A step of detecting mutations in EGFR, BRAF, KRAS, EML4-ALK, and ROS1 genes by confirming the amplification results by the polymerase chain reaction using fluorescence.

[0026] In the present invention, the EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations detected by the above method may include 44 types of EGFR gene mutations, 1 type of BRAF gene mutation, 1 type of KRAS gene mutation, 10 types of EML4-ALK gene mutations and 12 types of ROS1 gene mutations described in Tables 1 to 5 below.

[0027] Exon mutation EGFR nucleic acid sequence exon 18G719X2155G>A2155G>T2156G>C exon 19Ex19Del2240_2251del122239_2247del92238_2255del182235_2249del152236_2250del152239_2253del152239_2256d el182237_2254del182240_2254del152240_2257del182239_2248TTAAGAGAAG>C2239_2251>C2237_2255>T2235_2255>AAT 2237_2252>T2239_2258>CA2239_2256>CAA2237_2253>TTGCT2238_2252>GCA2238_2248>GC2237_2251del152236_2253del 182235_2248>AATTC2235_2252>AAT2235_2251>AATTC2253_2276del242237_2257>TCT2238_2252del152233_2247del15exon 20S768I2303G>TT790M2369C>TEx20Ins2307_2308ins9GCCAGCGTG2319_2320insCAC2310 _2311insGGT2311_2312ins9GCGTGGACA2309_2310AC>CCAGCGTGGATC797S2390>C2389>Aexon 21L858R2573T>G2573_2574TG>GTL861Q2582T>A

[0028] Codon mutation BRAF nucleic acid sequence 600V600E11799T>A

[0029] Codon mutation KRAS nucleic acid sequence G12G12C34G>T

[0030] EML4-ALKVariant 1Variant 2Variant 3aVariant 3bVariant 4Variant 5aVariant 5bVariant 6Variant 7Variant 8a

[0031] ROS1CD74 ex6-ROS1 ex34SDC4 ex2-ROS1 ex34EZR ex10-ROS1 ex34TPM3 ex8-ROS1 ex35LRIG3 ex16-ROS1 ex35CCDC6 ex5-ROS1 ex35CD74 ex6-ROS1 ex32SLC34A2 ex4-ROS1 ex32SLC34A2 ex13-ROS1 ex32SDC4 ex2-ROS1 ex32SDC4 ex4-ROS1 ex32GOPC ex4-ROS1 ex36

[0032] In the present invention, a blocking primer of sequence number 72 may be additionally processed in step (c).

[0033] In the present invention, the polymerase chain reaction of step (c) can be performed by an allele-specific polymerase chain reaction or a real-time polymerase chain reaction.

[0034] In the present invention, the method may further include a step of (e) confirming the amplification result by the polymerase chain reaction by measuring the Ct (cycle threshold) value.

[0035] In the present invention, the method can be applied to diagnosing lung cancer or predicting the drug response of lung cancer patients.

[0036] Additionally, the present invention provides a composition for diagnosing lung cancer, comprising a primer set that specifically binds to each of cDNAs including 44 types of EGFR gene mutations described in Table 1, cDNAs including 1 type of BRAF gene mutation described in Table 2, cDNAs including 1 type of KRAS gene mutation described in Table 3, cDNAs including 10 types of EML4-ALK gene mutations described in Table 4, and cDNAs including 12 types of ROS1 gene mutations described in Table 5.

[0037] In the present invention, the primer set included in the lung cancer diagnostic composition may be a primer set of SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131, and 132.

[0038] In the present invention, the lung cancer diagnostic composition may additionally include at least one probe selected from the group consisting of sequence numbers 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130, and 133.

[0039] In the present invention, the lung cancer diagnostic composition may additionally include a blocking primer of sequence number 72.

[0040] In the present invention, the lung cancer diagnostic composition may further include a primer set for synthesizing and amplifying cDNAs including 44 types of EGFR gene mutations, cDNAs including 1 type of BRAF gene mutation, cDNAs including 1 type of KRAS gene mutation, cDNAs including 10 types of EML4-ALK gene mutations, and cDNAs including 12 types of ROS1 gene mutations.

[0041] In the present invention, the primer set for synthesizing and amplifying the cDNA may be one or more primer sets selected from the group consisting of SEQ ID NOs: 1 to 34.

[0042] The present invention also provides a lung cancer diagnostic kit comprising the various types of lung cancer diagnostic compositions described above.

[0043] The kit according to the present invention synthesizes and amplifies cDNA using a specific oligomer from mRNA, and then uses a primer set specific for single sequence mutations in the EGFR, BRAF, and KRAS genes and EML4-ALK and ROS1 gene recombination mutations to simultaneously detect a total of 68 types of genetic mutations, making it possible to detect genetic mutations related to lung cancer at once from a small amount of sample.

[0044] Figure 1 is a schematic diagram showing an mRNA-based lung cancer-related gene mutation detection method of the present invention.

[0045] FIG. 2 is an exemplary diagram showing the arrangement of each MMX in a 96-well plate configuration when the primer sets and probes for detecting EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations according to the present invention are prepared as a qPCR Master Mix (MMX1 to MMX9) configured for each target.

[0046] Figure 3 illustrates a method for performing mmRT-qPCR when the mRNA-based lung cancer-related gene mutation detection method of the present invention is implemented as a massive multiplex real-time quantitative polymerase chain reaction (mmRT-qPCR).

[0047] Figures 4a to 4c illustrate the amplicon design of each gene target.

[0048] Figures 5a to 5l show the results of performing mmRT-qPCR using the kit for detecting EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations according to the present invention using the method shown in Figure 3.

[0049] Hereinafter, the present invention will be described in more detail.

[0050] All technical terms used in this invention, unless otherwise defined, have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of this invention.

[0051] As described above, a kit capable of simultaneously and multiple times detecting a total of 68 lung cancer-related gene mutations in the EGFR (44 types), BRAF (1 type), KRAS (1 type), ROS1 (12 types), and EML4-ALK (10 types) genes using RNA has not been developed. Therefore, the present inventors have sought a solution to the above-mentioned problem by developing a kit capable of simultaneously and multiple times detecting each of the 68 lung cancer gene mutations using mutation-specific primers after synthesizing and amplifying cDNA from mRNA using a specific oligomer, as shown in Fig. 1, so that all 68 types of various lung cancer gene mutations can be detected even from a small amount of sample.

[0052] Accordingly, the first aspect of the present invention relates to a primer set for synthesizing and amplifying cDNAs each including EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, and a primer set for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations.

[0053] The term "primer" refers to a polynucleotide that can act as an initiator of nucleic acid synthesis in the template direction when placed under conditions that initiate polynucleotide elongation. Primers can also be used in various other oligonucleotide-mediated synthetic processes, including de novo RNA synthesis and initiators of in vitro transcription-related processes. Primers are typically single-stranded oligonucleotides (e.g., oligodeoxyribonucleotides). The appropriate primer length varies depending on the intended use, typically ranging from 6 to 40 nucleotides, more typically from 15 to 35 nucleotides. Shorter primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with the template. The primer does not need to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize with the template for elongation. In certain embodiments, the term "primer pair" refers to a set of primers comprising a 5'-sense primer that hybridizes complementarily to the 5'-end of the nucleic acid sequence to be amplified, and a 3'-antisense primer that hybridizes to the 3'-end of the sequence to be amplified. The primers may be labeled, if desired, by incorporating a label that can be detected by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include: 32P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA assays), biotin, or haptens and proteins for which antiserum or monoclonal antibodies may be used.

[0054] In the present invention, the primer set for synthesizing and amplifying cDNAs each including the EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations may include a primer set of SEQ ID NOs: 1 to 34.

[0055] Specifically, sequence numbers 1 to 4 are primer sets for synthesizing and amplifying cDNA containing an EGFR gene mutation, wherein a first primer set including a forward primer of sequence number 1 and a reverse primer of sequence number 2, a second primer set including a forward primer of sequence number 1 and a reverse primer of sequence number 3, and a third primer set including a forward primer of sequence number 1 and a reverse primer of sequence number 4 reverse transcribe and pre-amplify the target region of EGFR mRNA, respectively, as shown in FIG. 4A, to generate three types of EGFR amplicons (556 bp, 587 bp, and 618 bp).

[0056] Sequence numbers 5 to 7 are primer sets for synthesizing and amplifying cDNA containing a BRAF gene mutation, and a fourth primer set including a forward primer of SEQ ID NO. 5 and a reverse primer of SEQ ID NO. 6, and a fifth primer set including a forward primer of SEQ ID NO. 5 and a reverse primer of SEQ ID NO. 7, respectively, reverse transcribe and pre-amplify the target region of BRAF mRNA to generate two types of BRAF amplicons (130 bp and 166 bp) as shown in FIG. 4A.

[0057] Sequence numbers 8 to 11 are primer sets for synthesizing and amplifying cDNA containing a KRAS gene mutation, wherein a sixth primer set including a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 9, a seventh primer set including a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 10, and an eighth primer set including a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 11 each reverse transcribe and pre-amplify the target region of KRAS mRNA to generate three types of EGFR amplicons (146 bp, 172 bp, and 194 bp) as shown in FIG. 4A.

[0058] SEQ ID NOS: 12 to 18 are primer sets for synthesizing and amplifying cDNA containing an EML4-ALK gene mutation, a ninth primer set containing a forward primer of SEQ ID NO: 12 and a reverse primer of SEQ ID NO: 18, a tenth primer set containing a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 18, an eleventh primer set containing a forward primer of SEQ ID NO: 14 and a reverse primer of SEQ ID NO: 18, a twelfth primer set containing a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 18, a thirteenth primer set containing a forward primer of SEQ ID NO: 16 and a reverse primer of SEQ ID NO: 18, and a fourteenth primer set containing a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 18, respectively, reverse transcribe and pre-amplify the target region of EML4-ALK mRNA to produce 10 kinds of EML4-ALK amplicons (168 bp, 237bp, 181bp, 149bp, 182bp, 137bp, 163bp, 154bp, 271bp and 181bp).

[0059] SEQ ID NOs. 19 to 34 are primer sets for synthesizing and amplifying cDNA including a ROS1 gene mutation, including a 15th primer set including a forward primer of SEQ ID NO. 19 and a reverse primer of SEQ ID NO. 22, a 16th primer set including a forward primer of SEQ ID NO. 20 and a reverse primer of SEQ ID NO. 22, a 17th primer set including a forward primer of SEQ ID NO. 21 and a reverse primer of SEQ ID NO. 22, an 18th primer set including a forward primer of SEQ ID NO. 23 and a reverse primer of SEQ ID NO. 26, a 19th primer set including a forward primer of SEQ ID NO. 24 and a reverse primer of SEQ ID NO. 26, a 20th primer set including a forward primer of SEQ ID NO. 25 and a reverse primer of SEQ ID NO. 26, a 21st primer set including a forward primer of SEQ ID NO. 27 and a reverse primer of SEQ ID NO. 32, and a 22nd primer set including a forward primer of SEQ ID NO. 28 and a reverse primer of SEQ ID NO. 32. A 23rd primer set comprising a forward primer of SEQ ID NO: 29 and a reverse primer of SEQ ID NO: 32, a 24th primer set comprising a forward primer of SEQ ID NO: 30 and a reverse primer of SEQ ID NO: 32, a 25th primer set comprising a forward primer of SEQ ID NO: 31 and a reverse primer of SEQ ID NO: 32, and a 26th primer set comprising a forward primer of SEQ ID NO: 33 and a reverse primer of SEQ ID NO: 34 each reverse transcribe and pre-amplify the target region of EML4-ALK mRNA to generate 12 types of ROS1 amplicons (118 bp, 191 bp, 126 bp, 215 bp, 204 bp, 205 bp, 158 bp, 125 bp, 141 bp, 112 bp, 139 bp, and 167 bp), as shown in FIG. 4c.

[0060] In the present invention, the primer set for detecting mutations in the EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes may include primer sets of SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132.

[0061] Specifically, a primer set for detecting a G719X mutation of the EGFR gene may include a primer set of SEQ ID NOs: 37 to 40. More specifically, a primer set for detecting a G719S mutation of the EGFR gene may include a reverse primer of SEQ ID NO: 37 and a forward primer of SEQ ID NO: 40, a primer set for detecting a G719C mutation of the EGFR gene may include a reverse primer of SEQ ID NO: 38 and a forward primer of SEQ ID NO: 40, and a primer set for detecting a G719A mutation of the EGFR gene may include a reverse primer of SEQ ID NO: 39 and a forward primer of SEQ ID NO: 40. In this case, the reverse primers may specifically bind to the G719S, G719C, and G719A mutations of the EGFR gene, respectively.

[0062] 29 Ex19Del mutations in the EGFR gene (2240_2251del12, 2239_2247del9, 2238_2255del18, 2235_2249del15, 2236_2250del15, 2239_2253del15, 2239_2256del18, 2237_2254del18, 2240_2254del15, 2240_2257del18, 2239_2248TTAAGAGAAG>C, 2239_2251>C, 2237_2255>T, 2235_2255>AAT, 2237_2252>T, 2239_2258>CA, A primer set for detecting 2239_2256>CAA, 2237_2253>TTGCT, 2238_2252>GCA, 2238_2248>GC, 2237_2251del15, 2236_2253del18, 2235_2248>AATTC, 2235_2252>AAT, 2235_2251>AATTC, 2253_2276del24, 2237_2257>TCT, 2238_2252del15 and 2233_2247del15) may include reverse primers of SEQ ID NOs: 43 to 71 and forward primers of SEQ ID NO: 73. More specifically, the primer set for detecting 29 types of Ex19Del mutations of the EGFR gene includes a primer set including a reverse primer of SEQ ID NO: 43 and a forward primer of SEQ ID NO: 73 capable of sequentially detecting the 29 types of mutations, a primer set including a reverse primer of SEQ ID NO: 44 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 45 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 46 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 47 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 48 and a forward primer of SEQ ID NO: 73,A primer set including a reverse primer of SEQ ID NO: 49 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 50 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 51 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 52 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 53 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 54 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 55 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 56 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 57 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 58 and a forward primer of SEQ ID NO: 73, SEQ ID NO: A primer set comprising a reverse primer of SEQ ID NO: 59 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 60 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 61 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 62 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 63 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 64 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 65 and a forward primer of SEQ ID NO: 73, a primer set comprising a reverse primer of SEQ ID NO: 66 and a forward primer of SEQ ID NO: 73,A primer set including a reverse primer of SEQ ID NO: 67 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 68 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 69 and a forward primer of SEQ ID NO: 73, a primer set including a reverse primer of SEQ ID NO: 70 and a forward primer of SEQ ID NO: 73, and a primer set including a reverse primer of SEQ ID NO: 71 and a forward primer of SEQ ID NO: 73. In this case, the reverse primers may each specifically bind to 29 types of Ex19Del mutations of the EGFR gene.

[0063] A primer set for detecting the S768I mutation of the EGFR gene may include a reverse primer of SEQ ID NO: 75 and a forward primer of SEQ ID NO: 76. In this case, the reverse primer may specifically bind to the S768I mutation of the EGFR gene.

[0064] A primer set for detecting five Ex20Ins mutations of the EGFR gene (2307_2308ins9GCCAGCGTG, 2319_2320insCAC, 2310_2311insGGT, 2311_2312ins9GCGTGGACA and 2309_2310AC>CCAGCGTGGAT) may include a primer set of SEQ ID NOs: 78 to 83. More specifically, the primer set for detecting five types of Ex20Ins mutations of the EGFR gene may be a primer set including a reverse primer of SEQ ID NO: 78 and a forward primer of SEQ ID NO: 83 capable of sequentially detecting the five types of mutations, a primer set including a reverse primer of SEQ ID NO: 79 and a forward primer of SEQ ID NO: 83, a primer set including a reverse primer of SEQ ID NO: 80 and a forward primer of SEQ ID NO: 83, a primer set including a reverse primer of SEQ ID NO: 81 and a forward primer of SEQ ID NO: 83, and a primer set including a reverse primer of SEQ ID NO: 82 and a forward primer of SEQ ID NO: 83. At this time, the reverse primers may specifically bind to five types of Ex20Ins mutations of the EGFR gene.

[0065] A primer set for detecting the T790M mutation of the EGFR gene may include a reverse primer of SEQ ID NO: 85 and a forward primer of SEQ ID NO: 86. In this case, the reverse primer may specifically bind to the T790M mutation of the EGFR gene.

[0066] A primer set for detecting two types of C797S mutations (2390>C and 2389>A) of the EGFR gene may include primer sets of SEQ ID NOs: 89 to 91. More specifically, a primer set for detecting two types of C797S mutations of the EGFR gene may be a primer set including a forward primer of SEQ ID NO: 89 and a reverse primer of SEQ ID NO: 91 capable of sequentially detecting the two types of mutations, and a primer set including a forward primer of SEQ ID NO: 90 and a reverse primer of SEQ ID NO: 91. In this case, the forward primer may specifically bind to two types of T790M mutations of the EGFR gene.

[0067] A primer set for detecting the L858R mutation of the EGFR gene may include a forward primer of SEQ ID NO: 93 and a reverse primer of SEQ ID NO: 94. In this case, the forward primer may specifically bind to the L858R mutation of the EGFR gene.

[0068] A primer set for detecting the L861Q mutation of the EGFR gene may include a reverse primer of SEQ ID NO: 96 and a forward primer of SEQ ID NO: 97. In this case, the reverse primer may specifically bind to the L861Q mutation of the EGFR gene.

[0069] A primer set for detecting the G12C mutation of the KRAS gene may include a forward primer of SEQ ID NO: 99 and a reverse primer of SEQ ID NO: 100. In this case, the forward primer may specifically bind to the G12C mutation of the KRAS gene.

[0070] A primer set for detecting the V600E1 mutation of the BRAF gene may include a forward primer of SEQ ID NO: 102 and a reverse primer of SEQ ID NO: 103. In this case, the forward primer may specifically bind to the V600E1 mutation of the BRAF gene.

[0071] A primer set for detecting 10 EML4-ALK gene mutations (Variant 1, 2, 3a, 3b, 4, 5a, 5b, 6, 7, and 8a) may include a primer set of SEQ ID NOs: 105 to 111. More specifically, a primer set for detecting EML4-ALK Variant 1 may include a forward primer of SEQ ID NO: 105 and a reverse primer of SEQ ID NO: 111, a primer set for detecting EML4-ALK Variant 2 may include a forward primer of SEQ ID NO: 106 and a reverse primer of SEQ ID NO: 111, a primer set for detecting EML4-ALK Variants 3a and 3b may include a forward primer of SEQ ID NO: 107 and a reverse primer of SEQ ID NO: 111, a primer set for detecting EML4-ALK Variants 5a and 5b may include a forward primer of SEQ ID NO: 108 and a reverse primer of SEQ ID NO: 111, a primer set for detecting EML4-ALK Variants 4 and 7 may include a forward primer of SEQ ID NO: 109 and a reverse primer of SEQ ID NO: 111, and a primer set for detecting EML4-ALK Variant 8a may include a forward primer of SEQ ID NO: 109 and a reverse primer of SEQ ID NO: 111. The primer set for detection may include a forward primer of SEQ ID NO: 110 and a reverse primer of SEQ ID NO: 111.

[0072] A primer set for detecting 12 ROS1 gene mutations (CD74 ex6-ROS1 ex34, SDC4 ex2-ROS1 ex34, EZR ex10-ROS1 ex34, TPM3 ex8-ROS1 ex35, LRIG3 ex16-ROS1 ex35, CCDC6 ex5-ROS1 ex35, CD74 ex6-ROS1 ex32, SLC34A2 ex4-ROS1 ex32, SLC34A2 ex13-ROS1 ex32, SDC4 ex2-ROS1 ex32, SDC4 ex4-ROS1 ex32, and GOPC ex4-ROS1 ex36) may include primer sets of SEQ ID NOs: 124 to 129, 131, and 132. More specifically, the primers for detecting 12 types of ROS1 gene mutations may be a forward primer of SEQ ID NO: 124 and a reverse primer of SEQ ID NO: 129, a forward primer of SEQ ID NO: 125 and a reverse primer of SEQ ID NO: 129, a forward primer of SEQ ID NO: 126 and a reverse primer of SEQ ID NO: 129, a forward primer of SEQ ID NO: 127 and a reverse primer of SEQ ID NO: 129, a forward primer of SEQ ID NO: 128 and a reverse primer of SEQ ID NO: 129, a forward primer of SEQ ID NO: 131 and a reverse primer of SEQ ID NO: 132, which can sequentially detect the 12 types of mutations.

[0073] In relation to the first aspect of the present invention, a composition for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes is provided, comprising primer sets of the above-mentioned SEQ ID NOs: 37 to 40, 43 to 71 and 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132.

[0074] In the present invention, the composition may additionally include at least one probe selected from the group consisting of SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130, and 133.

[0075] In the present invention, the term "probe" means a substance that specifically detects a specific substance, site, condition, etc., and in the present invention, it may be DNA, RNA, PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), or a mixture thereof that can complementarily bind to EGFR, BRAF, KRAS, EML4-ALK, and ROS1 genes. The probe of the present invention may be chemically synthesized using a phosphoramidite solid support method or other well-known methods. In addition, it may be modified by methylation, capping, etc. using known methods. In addition, the probe may have a length of 5 to 1000 bp, and may vary depending on the scale and location of the mutation, and its length is not limited.

[0076] In the present invention, the probes may be labeled with a fluorescent substance at the 5'-end and a quencher at the 3'-end. The fluorescent substance may be FAM, Quasar 670, or CY5, but is not limited thereto. The quencher may be BHQ-1 or BHQ-2, but is not limited thereto.

[0077] In the present invention, the composition may additionally include a blocking primer of SEQ ID NO: 72. In this case, the blocking primer of SEQ ID NO: 72 may be used together with a primer set and probe for detecting 29 types of Ex19Del mutations of the EGFR gene.

[0078] The above "blocking primer" contains nucleotides whose base sequence is complementary to the base sequence of the wild-type gene corresponding to the mutation site in the base sequence of the wild-type gene in the sample. Therefore, it binds to the wild-type gene, preventing the binding of a general primer, thereby inhibiting the amplification of the wild-type gene. However, a general primer can specifically bind to a gene with a mutation and amplify the gene, thereby increasing the sensitivity and specificity of the detection of the mutant gene.

[0079] In addition, one end of the blocking primer may include a nucleotide having the same base sequence as a terminal portion adjacent to the mutation site of a primer adjacent to the mutation site. If the primer adjacent to the mutation site is a forward primer, the one end is the 5' end, and if the primer adjacent to the mutation site is a reverse primer, the one end is the 3' end. The nucleotide having the same base sequence as a terminal portion adjacent to the mutation site of the primer adjacent to the mutation site refers to a nucleotide in a portion overlapping with the primer adjacent to the mutation site, and in the case of a gene having a mutation, nucleotides are continuously amplified at the terminal portion adjacent to the mutation site of this primer by binding of the primer adjacent to the mutation site, but in the case of a wild-type gene, one end of the blocking primer competitively binds instead of the terminal portion of the primer adjacent to the mutation, so the wild-type gene may not be amplified.

[0080] In addition, the terminal of the blocking primer may be modified to block amplification by PCR. If the primer adjacent to the mutation site is a forward primer, the other terminal is the 3' terminal, and if it is a reverse primer, the other terminal is the 5' terminal. The terminal modification is achieved by adding a C3-18 spacer [a structure in which 3-18 carbons are continuously linked] to the terminal of the blocking primer. For example, it may be performed by attaching one or more of a C3-spacer (a structure in which three carbons are connected in series), a C6-spacer (a structure in which six carbons are connected in series), a C12-spacer (a structure in which twelve carbons are connected in series), a C18-spacer (a structure in which eighteen carbons are connected in series), biotin, di-deoxynucleotide triphosphate (ddNTP), ethylene glycol, amine, or phosphate.

[0081] In connection with the first aspect of the present invention, a kit for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes using RNA is provided, comprising:

[0082] A primer set for synthesizing and amplifying cDNAs each containing EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, comprising primer sets of the above-mentioned sequence numbers 1 to 34, and

[0083] A primer set that specifically binds to mutations in the EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, respectively, comprising primer sets of the above-mentioned sequence numbers 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132.

[0084] In the present invention, the kit may additionally include one or more probes selected from the group consisting of sequence numbers 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130, and 133.

[0085] In the present invention, the kit may additionally include a blocking primer of sequence number 72.

[0086] In connection with the first aspect of the present invention, the use of a composition comprising (i) a primer set of SEQ ID NO: 1 to SEQ ID NO: 34 and / or (ii) a primer set of SEQ ID NO: 37 to 40, 43 to 71 and 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132 for the manufacture of a kit for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes is provided.

[0087] In the use of the composition for the manufacture of a kit according to the present invention, the composition may additionally comprise at least one probe selected from the group consisting of SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130 and 133.

[0088] In the use of the composition for the manufacture of a kit according to the present invention, the composition may additionally comprise a blocking primer of SEQ ID NO: 72.

[0089] In the present invention, the primer sets and probes for detecting the three G719X mutations of the EGFR gene can be provided as one Master Mix (MMX). In a specific embodiment of the present invention, the primer sets of SEQ ID NOs: 37 and 40 and the probe of SEQ ID NO: 41 for detecting the G719S mutation of the EGFR gene, the primer sets of SEQ ID NOs: 38 and 40 and the probe of SEQ ID NO: 41 for detecting the G719C mutation of the EGFR gene, and the primer sets of SEQ ID NOs: 39 and 40 and the probe of SEQ ID NO: 41 for detecting the G719A mutation of the EGFR gene are provided as MMX1.

[0090] In the present invention, the primer set and probe for detecting 29 types of Ex19Del mutations of the EGFR gene can be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 43 to 71 and 73, the blocking primer of SEQ ID NO: 72, and the probe of SEQ ID NO: 74 for detecting 29 types of Ex19Del mutations of the EGFR gene are provided as MMX2.

[0091] In the present invention, the primer set and probe for detecting the S768I mutation of the EGFR gene may be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 75 and 76 and the probe of SEQ ID NO: 77 for detecting the S768I mutation are provided as MMX3.

[0092] In the present invention, the primer set and probe for detecting the five Ex20Ins mutations of the EGFR gene can be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 78 to 83 and the probe of SEQ ID NO: 84 for detecting the five Ex20Ins mutations of the EGFR gene are provided as MMX4.

[0093] In the present invention, the primer set and probe for detecting the T790M mutation of the EGFR gene may be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 85 and 86 and the probe of SEQ ID NOs: 87 and 88 for detecting the T790M mutation of the EGFR gene are provided as MMX5.

[0094] In the present invention, the primer set and probe for detecting the C797S mutation of the EGFR gene may be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 89 to 91 and the probe of SEQ ID NO: 92 for detecting the C797S mutation of the EGFR gene are provided as MMX6.

[0095] In the present invention, the primer set and probe for detecting the two L858R mutations of the EGFR gene may be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 93 and 94 and the probe of SEQ ID NO: 95 for detecting the two L858R mutations of the EGFR gene are provided as MMX7.

[0096] In the present invention, the primer set and probe for detecting the L861Q mutation of the EGFR gene may be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 96 and 97 and the probe of SEQ ID NO: 98 for detecting the L861Q mutation of the EGFR gene are provided as MMX8.

[0097] In the present invention, the primer set and probe for detecting the G12C mutation of the KRAS gene and the primer set and probe for detecting the V600E1 mutation of the BRAF gene can be provided as a single MMX. In a specific embodiment of the present invention, the primer set of SEQ ID NOs: 99 and 100 and the probe of SEQ ID NO: 101 for detecting the G12C mutation of the KRAS gene and the primer set of SEQ ID NOs: 102 and 103 and the probe of SEQ ID NO: 104 for detecting the V600E1 mutation of the BRAF gene are provided as MMX9.

[0098] In the present invention, a primer set and probe for detecting EML4-ALK gene mutations may be provided as a single MMX. In a specific embodiment of the present invention, a primer set of SEQ ID NOs: 105 to 111 and probes of SEQ ID NOs: 112 and 113 for detecting EML4-ALK Variants 1, 2, 3a, 3b, 4, 5a, 5b, 6, 7, and 8a are provided as MMX10.

[0099] In the present invention, the primer set and probe for detecting 12 types of ROS1 gene mutations can be provided as one or more MMXs. In a specific embodiment of the present invention, a primer set of SEQ ID NO: 114 and SEQ ID NO: 117 and a probe of SEQ ID NO: 118 for detecting CD74 ex6-ROS1 ex34, a primer set of SEQ ID NO: 115 and SEQ ID NO: 117 and a probe of SEQ ID NO: 118 for detecting SDC4 ex2-ROS1 ex34, a primer set of SEQ ID NO: 116 and SEQ ID NO: 117 and a probe of SEQ ID NO: 118 for detecting EZR ex10-ROS1 ex34, a primer set of SEQ ID NO: 119 and SEQ ID NO: 122 and a probe of SEQ ID NO: 123 for detecting TPM3 ex8-ROS1 ex35, a primer set of SEQ ID NO: 120 and SEQ ID NO: 122 and a probe of SEQ ID NO: 123 for detecting LRIG3 ex16-ROS1 ex35, and a primer set of SEQ ID NO: 121 and SEQ ID NO: 122 and a probe of SEQ ID NO: 123 for detecting CDC6 ex5-ROS1 ex35. A primer set of sequence number 122 and a probe of sequence number 123 are provided as MMX11.In another specific embodiment of the present invention, a primer set of SEQ ID NO: 124 and SEQ ID NO: 129 and a probe of SEQ ID NO: 130 for detecting CD74 ex6-ROS1 ex32, a primer set of SEQ ID NO: 125 and SEQ ID NO: 129 and a probe of SEQ ID NO: 130 for detecting SLC34A2 ex4-ROS1 ex32, a primer set of SEQ ID NO: 126 and SEQ ID NO: 129 and a probe of SEQ ID NO: 130 for detecting SLC34A2 ex13-ROS1 ex32, a primer set of SEQ ID NO: 127 and SEQ ID NO: 129 and a probe of SEQ ID NO: 130 for detecting SDC4 ex2-ROS1 ex32, a primer set of SEQ ID NO: 128 and SEQ ID NO: 129 and a probe of SEQ ID NO: 130 for detecting SDC4 ex4-ROS1 ex32, and a probe of SEQ ID NO: 130 for detecting GOPC ex4-ROS1 ex36. The reverse primers of SEQ ID NO. 131 and 132 and the probe of SEQ ID NO. 133 are provided as MMX12.

[0100] According to a specific embodiment of the present invention, the MMX1 to MMX12 may be arranged according to the MMX configured for each target to be detected in a 96-well plate configuration through RT-qPCR. At this time, a positive control (PC) for setting a threshold for each target, an NTC for checking for contamination, and an internal control (IC) for checking the total amount of RNA used may be arranged in the 96-well plate. For example, the MMX1 to MMX9, the PC, and the NTC may be arranged as shown in FIG. 2, but are not limited thereto.

[0101] The kit of the present invention can be used for research use only (RUO) or in vitro diagnostic use (IVD).

[0102] The kit of the present invention may be a PCR kit, and may further include a primer set for synthesizing and amplifying cDNA including each of the aforementioned EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, and a primer set and probe for detecting each of the EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, a reagent for isolating RNA from a sample, a reagent for synthesizing cDNA from the isolated RNA, a hybridization reagent, and reagents necessary for a DNA amplification reaction.

[0103] Reagents required for the above amplification reaction include, for example, an appropriate amount of DNA polymerase (e.g., a thermostable DNA polymerase obtained from Thermusaquatiucs (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus litoralis or Phyrococcus furiosis (Pfu)), a DNA polymerase cofactor (Mg 2+ ), buffer solution, dNTPs (dATP, dCTP, dGTP and dTTP) and water (dH2O). In addition, the buffer solution may include, but is not limited to, an appropriate amount of Triton X-100, dimethylsufoxide (DMSO), Tween20, nonidet P40, PEG 6000, formamide and bovine serum albumin (BSA).

[0104] The kit of the present invention may be manufactured with a plurality of separate packagings or compartments containing the reagent components.

[0105] The kit of the present invention can be applied to various methods for amplifying genes.

[0106] According to one embodiment of the present invention, the PCR kit can be applied to general PCR (1st generation PCR), real-time PCR (2nd generation PCR), digital PCR (3rd generation PCR), or mass array (MassARRAY).

[0107] In the PCR kit of the present invention, the digital PCR may be a cast PCR (Competitive allele-specific TaqMan PCR) or a droplet digital PCR (Droplet digital PCR; ddPCR), and more specifically, may be an allele-specific cast PCR or an allele-specific droplet digital PCR, but is not limited thereto.

[0108] The above "cast PCR" is a method for detecting and quantifying rare mutations in samples containing large amounts of normal wild-type gDNA, using allele-specific TaqMan to suppress non-specific amplification from the wild-type allele. ® Combining qPCR with allele-specific MGB blockers can yield superior specificity over traditional allele-specific PCR.

[0109] The above "droplet digital PCR" is a system that divides a 20 ㎕ PCR reaction into 20,000 droplets, amplifies them, and then counts the target DNA. Depending on whether the target DNA is amplified in the droplet, it receives and counts it as a digital signal as a positive droplet (1) or a negative droplet (0), calculates the number of copies of the target DNA through the Poisson distribution, and finally confirms the result as the number of copies per ㎕ of sample. It can be used in cases such as detecting rare mutations, amplifying very small amounts of genes, and simultaneous confirmation of mutation types.

[0110] The above "mass array" is a multiplexing analysis method that can be applied to various genetic studies, such as genotyping, using a MALDI-TOF mass spectrometer. It can be used in cases where a large number of samples and targets are to be analyzed quickly at a low cost, or when a customized analysis is to be performed only on a specific target.

[0111] The kit of the present invention can employ AS-PCR (Allele-specific PCR) and real-time PCR technologies, and can include specific primers and fluorescent probes for detecting EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations in a sample containing cDNA (amplicons). During nucleic acid amplification, the target mutant DNA matches the base at the 3' end of the primer, and is selectively and efficiently amplified, after which the mutant amplicon can be detected by a fluorescent probe labeled with FAM. Wild-type DNA cannot match the specific primers, and no amplification occurs.

[0112] In connection with the first aspect of the present invention, a method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA using the kit for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations described above is provided.

[0113] Specifically, the method may include the following steps (a) to (d):

[0114] (a) a step of extracting RNA from a separated biological sample;

[0115] (b) a step of synthesizing and amplifying cDNAs each including EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations by treating the primer sets of sequence numbers 1 to 34 and reverse transcriptase;

[0116] (c) polymerase chain reaction was performed by processing primer sets of sequence numbers SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132 and probes of sequence numbers SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130 and 133. Steps to perform; and

[0117] (d) A step of detecting mutations in EGFR, BRAF, KRAS, EML4-ALK, and ROS1 genes by confirming the amplification results by the polymerase chain reaction using fluorescence.

[0118] In the present invention, the biological sample of step (a) refers to a genetic sample containing a genetic mutation site to be detected. For example, it may contain DNA, cDNA, or RNA, preferably mRNA. Specifically, it may be any biologically derived sample capable of genetic analysis, including nuclei and / or mitochondria, such as cells, tissues, organs, body fluids, etc., or endogenous genes or exogenous genes extracted therefrom. The cells, tissues, organs, body fluids, etc. may be collected from a mammalian patient (e.g., human, primate, rodent, etc.), and the cells may include cells of unicellular animals such as viruses or bacteria. In particular, in the case of lung cancer, the sample may be extracted from cells of a lung cancer patient, and in the case of residual tumor testing after lung cancer treatment, the genetic sample may be extracted from cancer cells of a patient who has received tumor treatment.

[0119] In the present invention, the cDNA synthesized in step (b) may have a size of about 100 to 600 bp. The synthesized cDNA may be about 2 19 The vessel may be amplified and may be diluted before performing step c).

[0120] In the present invention, a blocking primer of sequence number 72 may be additionally processed in step (c).

[0121] In the present invention, the step (c) can be performed by allele-specific PCR or real-time PCR.

[0122] The EGFR gene mutation detection method of the present invention may additionally include a step of (d) confirming the amplification result by PCR by measuring the Ct (cycle threshold) value.

[0123] The Ct (cycle threshold) value represents the cycle number at which the fluorescence generated in the reaction exceeds the threshold, and is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles at which a sufficient number of amplicons has accumulated in the reaction. The Ct value is the cycle at which an increase in ΔRn is first detected. Rn represents the magnitude of the fluorescence signal generated during PCR at each time point, and ΔRn represents the fluorescence emission intensity of the reporter dye divided by the fluorescence emission intensity of the reference dye (normalized reporter signal). The Ct value is also referred to as Cp (crossing point) in LightCycler. The Ct value represents the point at which the system begins to detect an increase in the fluorescence signal associated with the exponential growth of the PCR product in the log-linear phase. This point provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (http: / www.appliedbiosystems.co.kr / ).

[0124] Meanwhile, TaqMan probes are typically longer oligonucleotides (e.g., 20-30 nucleotides) than primers that contain a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ)) at the 3'-end. The excited fluorophore transfers energy to a nearby quencher rather than fluorescing (FRET = FRET or fluorescence resonance energy transfer; Chen, X., et al., Proc Natl Acad Sci USA, 94(20): 10756-61(1997)). Therefore, when the probe is normal, no fluorescence is emitted. TaqMan probes are designed to anneal to internal sites of PCR products.

[0125] TaqMan probes specifically hybridize to template DNA during the annealing step, but fluorescence is suppressed by a quencher present on the probe. During the extension reaction, the TaqMan probe hybridized to the template is degraded by the 5' to 3' nuclease activity of Taq DNA polymerase, releasing the fluorescent dye from the probe and releasing the suppression by the quencher, thereby displaying fluorescence. At this time, the 5'-end of the TaqMan probe must be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5' to 3' nuclease activity of the polymerase, resulting in the generation of a fluorescent signal from the reporter molecule.

[0126] The reporter molecule and quencher molecule conjugated to the TaqMan probe include fluorescent and non-fluorescent substances. Any fluorescent reporter molecule and quencher molecule known in the art that can be used in the present invention can be used, and examples thereof are as follows (the numbers in parentheses are the maximum emission wavelengths expressed in nanometers): Cy2 TM (506), YOPRO TM -1 (509), YOYO TM -1 (509), Calcein (517), FITC (518), FluorX TM (519), Alexa TM (520), Rhodamine 110 (520), 5-FAM (522), Oregon Green TM 500 (522), Oregon Green TM 488 (524), RiboGreen TM (525), Rhodamine Green TM (527), Rhodamine 123 (529), Magnesium Green TM (531), Calcium Green TM(533), TO-PRO TM -1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3 TM (570), Alexa TM 546 (570), TRITC (572), Magnesium Orange TM (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange TM (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red TM (590), Cy3.5 TM (596), ROX (608), Calcium Crimson TM (615), Alexa TM 594 (615), Texas Red(615), Nile Red (628), YO-PRO TM -3 (631), YOYO TM -3 (631), R-phycocyanin (642), CPhycocyanin(648), TO-PRO TM -3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5 TM(670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The numbers in parentheses are the maximum emission wavelengths in nanometers.

[0127] Suitable reporter-quencher pairs are described in many references: Pesce et al., editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2 ndEDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

[0128] Additionally, the non-fluorescent material used in the reporter molecule and quencher molecule coupled to the TaqMan probe may include a minor groove binding (MGB) moiety. The term "TaqMan MGB-conjugate probe" as used herein refers to a TaqMan probe conjugated with MGB at the 3'-end of the probe.

[0129] MGBs are substances that bind to the minor groove of DNA with high affinity, and include, but are not limited to, netropsin, distamycin, lexitropsin, mithramycin, chromomycin A3, olivomycin, anthramycin, sibiromycin, pentamidine, stilbamidine, berenil, CC-1065, Hoechst 33258, DAPI (4-6-diamidino-2-phenylindole), dimers, trimers, tetramers and pentamers of CDPI, N-methylpyrrole-4-carbox-2-amide (MPC) and dimers, trimers, tetramers and pentamers thereof.

[0130] Conjugation of the probe to the MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, the increased stability (i.e., increased degree of hybridization) results in an increased melting temperature (Tm) of the hybrid duplex formed by the MGB-conjugated probe compared to the standard probe. Thus, the MGB stabilizes van der Waals forces, thereby increasing the melting temperature (Tm) of the MGB-conjugated probe without increasing the probe length, thereby enabling the use of shorter probes (e.g., 21 nucleotides or less) in Taqman real-time PCR under more stringent conditions.

[0131] Additionally, the MGB-conjugate probe more efficiently removes background fluorescence. Therefore, the probe of the present invention may be in the form of a TaqMan MGB-conjugate, wherein the probe length includes, but is not limited to, 15-21 nucleotides.

[0132] In the present invention, the EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations may include 44 types of EGFR gene mutations, 1 type of BRAF gene mutation, 1 type of KRAS gene mutation, 10 types of EML4-ALK gene mutations and 12 types of ROS1 gene mutations described in Tables 1 to 5.

[0133] For example, the method for detecting EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations from RNA of the present invention can simultaneously and multiple times detect one or more of the 68 gene mutations listed in the above table.

[0134] Step (d) of the present invention may include melting temperature analysis using a double-strand specific dye.

[0135] Melting temperature curve analysis can be performed on a real-time PCR device, such as an ABI 5700 / 7000 (96-well format) or ABI 7900 (384-well format) device with onboard software (SDS 2.1). Alternatively, melting temperature curve analysis can be performed as an end-point analysis.

[0136] "Dyes that bind to double-stranded DNA" or "double-strand specific dyes" may be used if they have higher fluorescence when bound to double-stranded DNA than in the unbound state. Examples of such dyes include SOYTO-9, SOYTO-13, SOYTO-16, SOYTO-60, SOYTO-64, SYTO-82, ethidium bromide (EtBr), SYTOX Orange, TO-PRO-1, SYBR Green I, TO-PRO-3, or EvaGreen. These dyes, except EtBr and EvaGreen (Quiagen), have been tested in real-time applications.

[0137] The EGFR gene mutation detection method of the present invention can be performed by real-time PCR (RT-PCR) or quantitative PCR (qPCR), analysis on an agarose gel after standard PCR, gene mutation-specific amplification or allele-specific amplification through real-time PCR, tetra-primer amplification-refractory mutation system PCR, or isothermal amplification.

[0138] The above "standard PCR" is a technique known to those skilled in the art for amplifying single or multiple copies of DNA or cDNA. Most PCRs utilize thermostable DNA polymerases, such as Taq polymerase or Klein Taq. DNA polymerases use single-stranded DNA as a template and enzymatically assemble new DNA strands from nucleotides using oligonucleotides (primers). Amplicons generated by PCR can be analyzed, for example, on an agarose gel.

[0139] The aforementioned "real-time PCR" allows for real-time monitoring of the PCR process. Therefore, data is collected throughout the PCR process, not just at the end of the PCR. In real-time PCR, the reaction is characterized by the point in the cycle when amplification is first detected, rather than by the amount of target accumulated after a fixed number of cycles. Two methods are primarily used to perform quantitative PCR: dye-based detection and probe-based detection.

[0140] The above "Allele Specific Amplification (ASA)" is an amplification technique in which PCR primers are designed to distinguish templates that differ by a single nucleotide residue.

[0141] The above "gene variant-specific amplification or allele-specific amplification via real-time PCR" is a highly efficient method for detecting genetic variants or SNPs. Unlike most other methods for detecting genetic variants or SNPs, it does not require preliminary amplification of the target genetic material. ASA combines amplification and detection in a single reaction based on the discrimination of matched and mismatched primer / target sequence complexes. The increase in amplified DNA during the reaction can be monitored in real time by an increase in fluorescent signal caused by a dye such as SYBR Green I, which fluoresces upon binding to double-stranded DNA. Gene variant-specific amplification or allele-specific amplification via real-time PCR is indicated by a delay or absence of fluorescent signal for mismatched cases. In genetic variant or SNP detection, this provides information on the presence or absence of the genetic variant or SNP.

[0142] The above "Tetra-primer amplification-refractory mutagenesis system PCR" amplifies both wild-type and mutant alleles along with a control fragment in a single-tube PCR reaction. A non-allele-specific control amplicon is amplified by two common (outer) primers flanking the mutation region. The two allele-specific (inner) primers are designed in opposite directions to the common primers and, together with the common primers, can simultaneously amplify both wild-type and mutant amplicons. Consequently, the two allele-specific amplicons have different lengths because the mutations are positioned asymmetrically with respect to the common (outer) primers and can be easily separated by standard gel electrophoresis. The control amplicon provides an internal control for false negatives as well as amplification failures, and at least one of the two allele-specific amplicons is always present in the tetra-primer amplification-refractory mutagenesis system PCR.

[0143] The above "isothermal amplification" means that the amplification of nucleic acids is carried out at a lower temperature, without relying on a thermocycler, and preferably without the need for temperature changes during amplification. The temperature used in isothermal amplification can be between room temperature (22-24 ° C.) and about 65 ° C., or about 60-65 ° C., 45-50 ° C., 37-42 ° C., or ambient temperature of 22-24 ° C. The product resulting from isothermal amplification can be detected by gel electrophoresis, ELISA, ELOSA (Enzyme linked oligosorbent assay), real-time PCR, ECL (enhanced chemiluminescence), a bioanalyzer, which is a chip-based capillary electrophoresis device that analyzes RNA, DNA, and proteins, or turbidity.

[0144] In the present invention, the method for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes from the RNA can be used for diagnosing lung cancer or predicting the drug responsiveness of lung cancer patients.

[0145] Accordingly, the second aspect of the present invention relates to a composition for diagnosing lung cancer, comprising a primer set that specifically binds to each of DNAs including 44 types of EGFR gene mutations described in Table 1, DNAs including 1 type of BRAF gene mutation described in Table 2, DNAs including 1 type of KRAS gene mutation described in Table 3, DNAs including 10 types of EML4-ALK gene mutations described in Table 4, and DNAs including 12 types of ROS1 gene mutations described in Table 5, and a kit including the same.

[0146] In relation to the second aspect of the present invention, a method for diagnosing lung cancer or predicting the responsiveness of a lung cancer patient to a drug using the composition or kit is provided.

[0147] The method for diagnosing lung cancer or predicting the drug responsiveness of lung cancer patients according to the present invention is the same as the method for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK, and ROS1 genes from the aforementioned RNA, and therefore, description thereof is omitted.

[0148] In the present invention, the cancer may be non-small cell lung cancer.

[0149] The method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations of the present invention simultaneously and on a large scale detects known lung cancer-related gene mutations, thereby providing information for early diagnosis of lung cancer, prediction of prognosis and drug responsiveness of lung cancer patients, and establishment of a personalized treatment strategy for each patient, thereby contributing to more effective treatment of patients.

[0150] In the present invention, the term "prognosis" refers to the act of predicting the course and outcome of a disease in advance. More specifically, prognosis prediction can be interpreted as any act of predicting the course of a disease after treatment by comprehensively considering the patient's physiological and environmental conditions, as the course of the disease after treatment may vary depending on the patient's physiological and environmental conditions.

[0151] The above prognosis prediction can be interpreted as an act of predicting a patient's disease-free survival rate or survival rate after treatment of a specific disease by predicting the course and whether the disease will be cured. For example, predicting a "good prognosis" indicates a high disease-free survival rate or survival rate after treatment, meaning that the patient is likely to be cured. Predicting a "poor prognosis" indicates a low disease-free survival rate or survival rate after treatment, meaning that the patient is likely to relapse or die from the disease.

[0152] The term "disease-free survival rate" of the present invention means the possibility that a patient will survive without recurrence of a specific disease after treatment for the disease.

[0153] The term "survival rate" of the present invention means the possibility that a patient will survive after treatment for a specific disease, regardless of whether the disease relapses.

[0154] When the method for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes of the present invention is used for predicting the responsiveness of lung cancer patients to drugs, the drugs may include, but are not limited to, tyrosine kinase inhibitors.

[0155] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0156] [Example 1]

[0157] Preparation of primer sets and probes

[0158] 1-1. Preparation of primer sets for cDNA synthesis and amplification

[0159] Primer sets and probes for synthesizing and amplifying cDNAs containing EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations in Table 6 were designed using the OligoAnalyzer Tool (https: / sg.idtdna.com / calc / analyzer) program. For EGFR, KRAS, and BRAF, two to three reverse primers were designed to increase reverse transcription efficiency.

[0160] 프라이머 이름Mer서열 (5'-3')Tm(℃)서열번호EGFR_ex18_out_F118GTG GAG CCT CTT ACA CCC61.11EGFR_ex21_out_R118GCA CTT TGC CTC CTT CTG60.42EGFR_ex21_out_R213TCC AAT GCC ATC C49.83EGFR_ex21_out_R415CTG GTG GGT ATA GAT49.34BRAF_ex13~17_out_F121TTC TTC ATG AAG ACC TCA CAG59.75BRAF_ex13~17_out_R119CTG ATG ACT TCT GGT GCC 59.56BRAF_ex13~17_out_R415TCT GAC TGA AAG CTG51.67KRAS_ex1~2_out_F119GAG AGG CCT GCT GAA AAT G60.68KRAS_ex2~3_out_R120CTT GCT TCC TGT AGG AAT CC59.89KRAS_ex2~3_out_R315GAG ACA GGT TTC TCC51.510KRAS_ex2~3_out_R416CTG TGT CGA GAA TAT C49.911EML4-ALK_V1,6_out_F121GGA GTC ATG CTT ATA TGG AGC60.112EML4-ALK_V2_out_F119CAT CAC ACA CCT TGA CTG G60.113EML4-ALK_V3a,b_out_F118CCA AAA CTG CAG ACA AGC59.114EML4-ALK_V4,7_out_F118CTG GAG GAG GGA AAG ACA60.015EML4-ALK_V5a,b_out_F119CTC TGA AGA TCA TGT GGC C59.716EML4-ALK_V8a,b_out_F118CAT CCA AGT GGC ACA GTG60.417EML4-ALK_out_R120GTT GTA GTC GGT CAT GAT GG60.018CD74 ex6-ex34_out_F117GGA GCA AAA GCC CAC TG60.419SDC4 ex2-ex34_out_F121CTC CTA GAA GGC CGA TAC TTC61.020EZR ex10-ex34_out18GCT GCA GGA CTA TGA GGA60.421ROS1 ex34_out_R119CCA AAG GTC AGT GGG ATT G60.322TPM3 ex8-ex35_out_F119GTG CTG AGT TTG CTG AGA G60.423LRIG3 ex16-ex35_out_F119GTC ACA TCT TCA GGT GCT G60.224CCDC6 ex5-ex35_out_F119GAA TGA AGT GGA ACG GCT G60.825ROS1 ex35_out_R121GAT GGC CAA AGC TAC ATA CTG60.826CD74 ex6-ex32_out_F118GAG CAA AAG CCC ACT GAC60.727SLC34A2 ex4-ex32_out_F117CGT GTG CTC CCT GGA TA60.328SLC34A2 ex13-ex32_out_F118AGG ATG TCC CTG TCA AGG60.429SDC4 ex2-ex32_out_F120GAT GAC TTT GAG CTG TCT GG60.330SDC4 ex4-ex32_out_F119GTG TCA ATG TCC AGC ACT G60.731ROS1 ex32_R1_out19CTT CAG CTT TCT CCC ACT G59.932GOPC ex4-ex36_out_F119CGA GAC TAG CTG CCA AGT A60.633ROS1 ex36_out_R118GAT GTC CAC TGC TGT TCC59.834GusB_out_F119TCC CAC CTA GAA TCT GCT G60.535GusB_out_R121GCT GCA TAG TTA GAG TTG CTC60.736.

[0161] Using the primer sets in Table 6 above, amplicons for each gene target were designed as shown in Figures 4a to 4c.

[0162] 1-2. Preparation of allele-specific primer sets and probes

[0163] Primer sets and probes for detecting EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations in Table 7 were designed using the OligoAnalyzer Tool (https: / sg.idtdna.com / calc / analyzer) program.

[0164] EGFR_Oligo Mix_1서열 (5'-3')Tm(℃)서열번호G719S Rmt17CCG AAC GCA CCG GAG CT66.637G719C Rmt16CGA ACG CAC CGG AGC A64.538G719A Rmt18(-3T)TGC CGA ACG CAC CGT AGG66.639G719X SF4GCC TCT TAC ACC CAG TGG AGA A65.440G719X R_FAMAAA CTG AAT TCA AAA AGA TCA AAG TGC TG64.341EGFR_Oligo Mix_2서열 (5'-3')Tm(℃)서열번호Ex19-20_FAM_R28TCA CGT AGG CTT CAT CGA GGA TTT CCT T68.742Ex19del C1 Rmt20TGT TGG CTT TCG GAG ATG CC64.943Ex19del C2 Rmt21TTGG CTT TCG GAG ATG ATT CC62.544Ex19del C3 Rmt20GTT GGC TTT CGG AGA TTC CT62.245Ex19del C4 Rmt24GCTTTCG GAG ATG TTG CTT CCT TG65.846Ex19del C5 Rmt21CCT TGT TGG CTT TCT GTT CCT62.947Ex19del C6 Rmt21CCTTG TTG GCT TTC GGA TCC T64.648Ex19del C7 Rmt21TGGCT TTC GGA GAT GTT TTG A62.549Ex19del C8 Rmt20TGG CTT TCG GAG ATG TCT TG62.150Ex19del C9 Rmt21TCCTT GTT GGC TTT CGG TTC C65.051Ex19del C10 Rmt2(20)TGTTG GCT TTC GGA GCC TTG65.152Ex19del C11 Rmt20TTGTT GGC TTT CGG AGA TTC60.753Ex19del C12 Rmt21TTCCT TGT TGG CTT TCG ATT C61.354Ex19del C13 Rmt21GCT TTC GGA GAT GTT GGT TCC63.255Ex19del C14 Rmt20GTTGG CTT TCG GAG ATG GTT62.756Ex19del C15 Rmt20CTTG TTG GCT TTC GGA ACC T62.957Ex19del C16 Rmt23TTCCT TGT TGG CTT TCG GAA TTT63.858Ex19del C17 Rmt20GTT GGC TTT CGG AGA TAC CT61.659Ex19del C18 Rmt3(21)TTTC CTT GTT GGC TTT CGG TT63.360Ex19del C19 Rmt21TGTT GGC TTT CGG AGA AGC AA64.961Ex19del C20 Rmt21TGTTG GCT TTC GGA GAT TGC T64.762Ex19del C21 Rmt21TTGGC TTT CGG AGA TGT TGG C65.363Ex19del C22 Rmt20TGT TGG CTT TCG GAG ACT TG62.664Ex19del C23 Rmt22TGGC TTT CGG AGA TGT TGG AAT64.565Ex19del C24 Rmt22GTT GGC TTT CGG AGA TAT TTT G60.166Ex19del C25 Rmt22TGTTG GCT TTC GGA GAT GGA AT64.567Ex19del C26 Rmt2(19)TAG GCT TCA TCG AGG GTT G61.068Ex19del C27 Rmt20TCC TTG TTG GCT TTC GAG AC62.369Ex19del C28 Rmt2(20)TTGT TGG CTT TCG GAG ATT C60.770Ex19del C29 Rmt21GCTT TCG GAG ATG TTG CGA TA62.771Ex19del_BR2GCT TTC GGA GAT GTT GCT TCT CTT AAT TCC TTG A / 3phos / 69.572Ex19del SF1CGG CAC GGT GTA TAA GGG61.173Ex19Del R_FAMCTC TGG ATC CCA GAA GGT GAG AAA G65.674EGFR_Oligo Mix_3Sequence (5'-3')Tm(℃)SEQ ID NO. S768I Rmt14+CCGG GGT TGT CCA CGA60.475S768I,Ex20lns SF1CAA CAT CTC CGA AAG CCA59.776Ex19-20_FAM_R28TCA CGT AGG CTT CAT CGA GGA TTT CCT T68.777EGFR_Oligo Mix_4Sequence (5'-3')Tm(℃)SEQ ID NO. 20Ins C1 Rmt2(15)-4ACCA CGC TGG CAA CGC63.57820Ins C2 Rmt3(15)GGC ACA CGT GGT GGG73.37920Ins C3 Rmt2(16)CAC ACG TGG GGG TTA C62.58020Ins C4 Rmt2(16)-3TTGT CCA CGC TGT TCA C58.98120Ins C5 Rmt2(16)-3TATC CAC GCT GGC TAC G62.582S768I,Ex20lns SF1CAA CAT CTC CGA AAG CCA59.783Ex19-20_FAM_R28TCA CGT AGG CTT CAT CGA GGA TTT CCT T68.784EGFR_Oligo Mix_5 Sequence (5'-3')Tm(℃)SEQ ID NO.T790M Rmt(15)AGG GCA TGA GCT GCA60.485T790M SF5ACC CCC ACG TGT GCC G66.986[MX2] T790M IR4_FAMGTG ATG AGC TGC ACG G59.787[MX2] T790M IR2(-8T)_FAMGTG ATG AGT TGC ACG GTG G63.088EGFR_Oligo Mix_6 Sequence (5'-3')Tm(℃) SEQ ID NO: C797S C1 Fmt19AGC TCA TGC CCT TCG GCT C66.489C797S C2 Fmt18AGC TCA TGC CCT TCG GCA66.390C797S SR2CAG GTA CTG GGA GCC AAT ATT GTC64.491T790M_C797S FAM_FCTC CTG GAC TAT GTC CGG GAA CAC67.292EGFR_Oligo Mix_7Sequence (5'-3')Tm(℃)Sequence number L858R Fmt21-2ACAA GAT CAC AGA TTT TGG ACG 59.393L858R OR1TTG CCT CCT TCT GCA TGG TAT TC 65.194L858R_FAMCCA AAC TGC TGG GTG CGG AAG AG 69.095EGFR_Oligo Mix_8Sequence (5'-3')Tm(℃)Sequence number L861Q Rmt17CTC TTC CGC ACC CAG CT 63.696L861Q SF1CGT ACT GGT GAA AAC ACC G60.697L861Q FAM_RCAG CAT GTC AAG ATC ACA GAT TTT GGG CT 68.898KRAS,BRAF_Oligo Mix_1 sequence (5'-3')Tm(°C) sequence number G12C Fmt (17)TGT GGT AGT TGG AGC TT57.699G12_13 SR5GTT GGA TCA TAT TCG TCC ACA AA61.3100KRAS G12_13 FAMCAA GAG TGC CTT GAC GAT ACA GCT A65.8101V600E Fmt(17+A)ATT TGG TCT AGC TAC AGA54.7102BRAF SR1GAT CCA GAC AAC TGT TCA AAC TG61.7103BRAF_VICAAA TCT CGA TGG AGT GGG TCC CAT CA68.8104EML4-ALK_Oligo Mix_1 sequence (5'-3')Tm(℃) SEQ ID NO: V1_Fusion_F1GGA GCA AAA CTA CTG TAG AGC60.3105V2_Fusion_F6TGT CTA ACT CGG GAG ACT ATG60.2106V3a_Fusion_F4+1GCA GAC AAG CAT AAA GAT GTC A61.2107V5ab_Fusion_F2GTG GCC TCA GTG AAA AAA TCA G62.0108V4,7_Fusion_F1CTG TGG GAT CAT GAT CTG AA59.2109V8a_Fusion_F4GTG GCC ATA GGA ACG CA61.6110qPCR_R1_modifiedGAG CTT GCT CAG CTT GTA CT62.1111EML4-ALK_FAM_Probe_R1AGG GCT CTG CAG CTC CAT CTG CAT G71.5112V4_Fusion_ProbeTAG AGA TAT GCT GGA TGA GCC CTG65.0113ROS1_Oligo Mix_1서엄 (5'-3')Tm(℃)서엄번번CD74 ex6_F3ACTGACGCTCCACCGAA62.9114SDC4 ex2_F2ACCAGACGATGAGGATGT59.9115EZR ex10_F10TGAGGAGAAGACAAAGAAGGC61.8116ROS1 ex34_R1TGGGATTGTAACAACCAGAAAT60.6117ROS1 ex34_P6_FAMTTGGATACCAGAAACAAGTTTCATACTTA63.5118TPM3 ex8_F9TAGCCAAGCTGGAAAAGAC61.7119LRIG3 ex16_F12TTACCACAACATGACAGTAGT59.3120CCDC6 ex5_F1AGTGGAACGGCTGAAGAAGCA66.2121ROS1 ex35_R3TGCATAGCAGGCATTAGC59.9122ROS1 ex35_P3_VICTCGTTTATAAGCACTGTCACCC62.3123ROS1_Oligo Mix_2서엄 (5'-3')Tm(℃)서엄번다CD74 ex6_F3_17ACTGACGCTCCACCGAA62.9124SLC34A2 ex4_F11TGGATATTCTTAGTAGCGCCTT61.2125SLC34A2 ex13_F11ACCTTTGATAACATAACCATTAGC59.7126SDC4 ex2_F6TGTCTGGCTCTGGAGATCT61.8127SDC4 ex4_F11AGCAACATCTTTGAGAGAACG60.7128ROS1 ex32_R7TCTCCCACTGTATTGAATTTTTAC59.6129ROS1 exon32_P6_FAMAGGCATTCCCAAATTACTAGAAGGGA65.7130GOPC ex4_F12AGCTGCCAAGTACTTGGATAA61.6131ROS1 ex36_R3_17TCCACTTCCCAGCAAGA60.0132ROS1 exon36_P4_VICTCCCGAGGGAAGGCAGGAAG67.4133.

[0165] [Example 2]

[0166] Preparation of mutant RNA samples

[0167] By applying primer sets that can amplify the gDNA and mutant amplification regions of A549 lung-derived cell line with wild-type DNA / RNA of EGFR, BRAF, KRAS, EML4-ALK, and ROS1, wild-type clones of EGFR exons 18, 19, 20, and 21 regions, BRAF exon 15 region, KRAS exon 2 region, EML4 exons 1 to 20 region, ALK exon 20 region, ROS1 exons 32, 34, 35, and 36 region, CD74 exon 6 region, SDC4 exons 2, 4 region, EZR exon 10 region, TMP3 exon 8 region, LRIG3 exon 16 region, CCDC6 exon 5 region, SLC34A2 exons 4, 13 region, and GOPC exon 4 region were generated. was produced. Using the produced wild-type DNA, mutagenesis was performed on 44 EGFR target mutations, 1 BRAF target mutation, 1 KRAS target mutation, 10 EML4-ALK target recombination mutations, and 12 ROS1 target recombination mutations, and each mutant clone was obtained by transforming E.ColiDH5α cells. The wild-type clones and mutant clones were confirmed by direct base sequence analysis. The wild-type DNA and mutant DNA for each exon extracted through the clones were extracted after producing in vitro transcribed (IVT) RNA using RNA polymerase, and used as a standard material to evaluate the mutation detection performance of EGFR, BRAF, KRAS, EML4-ALK, and ROS1, respectively.

[0168] As shown in Table 8, samples were prepared by adding 3,000 copies, 300 copies, and 30 copies of each mutant RNA per 100 ng of A549 cell total RNA, and the group to which no mutant RNA was added was used as a control group.

[0169] Group sampleWTA549 cell total RNA 100 ngWT + mut 3,000A549 cell total RNA 100 ng + 3,000 copies of the corresponding mutant RNAWT + mut 300A549 cell total RNA 100 ng + 300 copies of the corresponding mutant RNAWT + mut 30A549 cell total RNA 100 ng + 30 copies of the corresponding mutant RNA

[0170] [Example 3]

[0171] Detection of EGFR, BRAF, KRAS, EML4-ALK, and ROS1 gene mutations using mRNA

[0172] Specific cDNA synthesis and amplification experimental conditions are as shown in Tables 9 and 10 below.

[0173] 2X Reverse Transcription & Preamplification Master Mix 10 μl 2X Reverse Transcription & Preamplification Oligo Mix (Oligos in Table 1) 2 μl Samples from each group in Table 3 2 μl Distilled water with unknown nuclease 6 μl Total 20 μl

[0174] Step Cycle Temperature Time 1125 ℃ 2 min 2150 ℃ 15 min 3195 ℃ 5 min 41595 ℃ 10 sec 560 ℃ 30 sec 672 ℃ 30 sec

[0175] Sufficient reaction mixtures containing each component listed in Table 4 were prepared in separate sterile centrifuge tubes, and the reaction master mix was thoroughly mixed by vortexing for 3 seconds and briefly centrifuged. PCR tubes were prepared for each sample as follows. 10 μl of the reverse transcription & preamplification master mix was aliquoted into each PCR tube, 2 μl of the reverse transcription & preamplification oligo mix was added, and 2 μl of each sample RNA was added. Then, 6 μl of nuclease-free distilled water was added and the PCR tubes were capped. The PCR tubes were briefly centrifuged to ensure that all liquid was collected at the bottom of each PCR tube. The PCR tubes were placed in a PCR machine, and the PCR machine was set up using the temperature conversion table in Table 5 and PCR was performed.

[0176] After completing the cDNA synthesis and preamplification steps, the PCR tubes were centrifuged, carefully opened on a biological safety bench, and the first dilution was performed with 180 μl of nuclease-free distilled water. 10 μl of the first dilution solution was transferred to a tube containing 990 μl of nuclease-free distilled water for a second dilution, thereby diluting the preamplified DNA by a final 1000-fold.

[0177] Next, the specific genetic mutation detection experimental conditions are as shown in Tables 11 and 12 below.

[0178] 2X Qualitative Analysis PCR Master Mix (Oligos in Table 2) 10 μl 1000-fold diluted preamplified sample 9.5 μl ADPS Smart DNA polymerase (1 U / μl) 0.5 μl Total 20 μl

[0179] Step Cycle Temperature Time Data Collection 1195 ℃ 5 min - 24595 ℃ 10 sec - 360 ℃ 30 sec FAM / CY5472 ℃ 10 sec -

[0180] A sufficient reaction mixture containing the 1000-fold diluted preamplified DNA sample and each component listed in Table 6 was prepared in separate sterile centrifuge tubes, and the reaction master mix was thoroughly mixed by vortexing for 3 seconds and briefly centrifuged. PCR tubes were prepared for each sample as follows. 10 μl of the qualitative analysis PCR master mix was aliquoted into each PCR tube, and 9.5 μl of the 1000-fold diluted preamplified sample was added. 0.5 μl of ADPS Smart DNA polymerase was added and the PCR tubes were capped. The PCR tubes were briefly centrifuged to ensure that all the liquid collected at the bottom of each PCR tube. The PCR tubes were placed in a real-time PCR (real-time PCR) instrument, and the PCR instrument was set up using the temperature conversion table in Table 7, and PCR was performed. After PCR completion, the FAM / CY5 signal of each sample was analyzed for data analysis, the Ct value was recorded, and the ΔCt value for each well was calculated as follows.

[0181] ΔCt value = Sample Ct value (FAM of each master mix) - Positive control Ct value (FAM of each master mix)

[0182] ΔCt value = sample Ct value (CY5 of each master mix) - positive control Ct value (CY5 of each master mix)

[0183] The calculated ΔCt value for each well is used to determine whether the mutation to be detected exists in that tube.

[0184] As a result, the minimum detection limit (LOD) for each target is as shown in Figures 5a to 5l. The copy number that appears first without overlapping the 0 copy amplification curve is set as the minimum detection limit, and it was confirmed that a sample can be determined to contain the target mutation if a Ct value that is about 2 to 3 lower than the 0 copy Ct value is obtained.

[0185] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Primer sets for synthesizing and amplifying cDNAs containing EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, respectively, including: A forward primer of sequence number 1 and a reverse primer of sequence numbers 2 to 4; A forward primer of sequence number 5 and a reverse primer of sequence numbers 6 to 7; A forward primer of sequence number 8 and a reverse primer of sequence numbers 9 to 11; Forward primers of SEQ ID NOs: 12 to 17 and reverse primers of SEQ ID NO: 18; A forward primer of SEQ ID NO: 19 to 21 and a reverse primer of SEQ ID NO: 22; A forward primer of SEQ ID NO: 23 to 25 and a reverse primer of SEQ ID NO: 26; A forward primer of SEQ ID NO: 27 to 31 and a reverse primer of SEQ ID NO: 32; and A forward primer of sequence number 33 and a reverse primer of sequence number 34.

2. A primer set for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, comprising primer sets of sequence numbers 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132.

3. A composition for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, comprising the primer set of clause 2.

4. A composition for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, further comprising at least one probe selected from the group consisting of sequence numbers 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130 and 133 in the third paragraph.

5. Kit for detection of EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations using RNA, including: A primer set for synthesizing and amplifying cDNAs each containing EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations, comprising a primer set of sequence number 1 to sequence number 34, and A primer set specifically binding to mutations in the EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes, each comprising a primer set of SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132.

6. Method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA using the kit of Article 5.

7. A method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA, comprising the following steps: (a) a step of extracting RNA from a separated biological sample; (b) a step of synthesizing and amplifying cDNAs each including EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations by treating the primer sets of sequence numbers 1 to 34 and reverse transcriptase; (c) a step of performing a polymerase chain reaction by treating primer sets of SEQ ID NOs: 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132 and probes of SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130 and 133; and (d) A step of detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations by confirming the amplification results by the polymerase chain reaction using fluorescence.

8. A method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA in claim 6, wherein the EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations include 44 EGFR gene mutations described in Table 1 below, 1 BRAF gene mutation described in Table 2 below, 1 KRAS gene mutation described in Table 3 below, 10 EML4-ALK gene mutations described in Table 4 below and 12 ROS1 gene mutations described in Table 5 below. [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] 9. A method for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes from RNA, wherein in step (c), a blocking primer having sequence number 72 is additionally processed.

10. A method for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes from RNA, wherein the polymerase chain reaction of step (c) is performed by allele-specific polymerase chain reaction or real-time polymerase chain reaction.

11. A method for detecting mutations in EGFR, BRAF, KRAS, EML4-ALK and ROS1 genes from RNA, further comprising the step of (e) confirming the amplification result by the polymerase chain reaction by measuring the Ct (cycle threshold) value.

12. A method for detecting EGFR, BRAF, KRAS, EML4-ALK and ROS1 gene mutations from RNA according to any one of claims 6 to 11, which is applicable to diagnosing lung cancer or predicting the responsiveness of lung cancer patients to drugs.

13. A composition for diagnosing lung cancer, comprising a primer set that specifically binds to each of cDNAs including 44 EGFR gene mutations described in Table 1 below, cDNAs including 1 BRAF gene mutation described in Table 2 below, cDNAs including 1 KRAS gene mutation described in Table 3 below, cDNAs including 10 EML4-ALK gene mutations described in Table 4 below, and cDNAs including 12 ROS1 gene mutations described in Table 5 below. [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] 14. A composition for diagnosing lung cancer, wherein the primer set in claim 13 comprises primer sets of sequence numbers 37 to 40, 43 to 71, 73, 75, 76, 78 to 83, 85, 86, 89 to 91, 93, 94, 96, 97, 99, 100, 102, 103, 105 to 111, 114 to 117, 119 to 122, 124 to 129, 131 and 132.

15. A composition for diagnosing lung cancer, further comprising at least one probe selected from the group consisting of sequence numbers SEQ ID NOs: 41, 42, 74, 77, 84, 87, 88, 92, 95, 98, 101, 104, 112, 113, 118, 123, 130, and 133 and a blocking primer of sequence number 72, in claim 13.

16. A composition for diagnosing lung cancer, further comprising a primer set for synthesizing and amplifying cDNA comprising the 44 types of EGFR gene mutations in claim 13, cDNA comprising the 1 type of BRAF gene mutation, cDNA comprising the 1 type of KRAS gene mutation, cDNA comprising the 10 types of EML4-ALK gene fusion mutations, and cDNA comprising the 12 types of ROS1 gene rearrangement mutations.

17. A composition for diagnosing lung cancer, wherein the primer set in paragraph 16 is at least one primer set selected from the group consisting of the following sequence numbers 1 to 34.

18. A kit for diagnosing lung cancer, comprising a composition according to any one of claims 13 to 17.

Images