Double stranded therapeutic oligonucleotde endosomal escape conjugates, coated particles, and therapeutic uses thereof

Double-stranded therapeutic oligonucleotide endosomal escape peptide conjugates address the challenges of ASO delivery by using pH-sensitive strands and EEPs to facilitate endosomal escape, enhancing therapeutic efficacy and stability.

WO2025111273A1PCT designated stage expired Publication Date: 2025-05-30EMORY UNIVERSITY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/056534
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-20
Filing Date
2024-11-19
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Antisense oligonucleotides (ASOs) face challenges in pharmacodynamic distribution, failure to cross cell membranes, and instability, particularly due to degradation in acidic endosomal environments, which hinders their clinical effectiveness.

Method used

Development of double-stranded therapeutic oligonucleotide endosomal escape peptide conjugates, which include a pH-sensitive polynucleotide strand and a therapeutic polynucleotide strand conjugated to an endosomal escape peptide (EEP). These conjugates are designed to facilitate the release of therapeutic oligonucleotides from endosomes through acid-induced unfolding of the pH-sensitive strand and activation of the EEP for membrane disruption.

Benefits of technology

The conjugate system enhances the delivery of therapeutic oligonucleotides into the cytosol by effectively escaping endosomal degradation, thereby improving the therapeutic efficacy and reducing off-target effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024056534_30052025_PF_FP_ABST
    Figure US2024056534_30052025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are double stranded therapeutic oligonucleotide endosomal escape peptide conjugates and uses in therapeutic methods. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate comprises a pH sensitive polynucleotide strand and a therapeutic polynucleotide strand. In certain embodiments, the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide (EEP). In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate is attached to a particle. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or coated particle is used in an antisense or other oligonucleotide therapy.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]DOUBLE STRANDED THERAPEUTIC OLIGONUCLEOTDE ENDOSOMAL ESCAPE CONJUGATES, COATED PARTICLES, AND THERAPEUTIC USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 601,057 filed November 20, 2023. The entirety of this application is hereby incorporated by reference for all purposes. STATEMENT REGARDING FEDERALLY FUNDED RESEARCH This invention was made with government support under HL142866 awarded by the National Institutes of Health. The government has certain rights in the invention. INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED AS AN XML FILE VIA THE OFFICE ELECTRONIC FILING SYSTEM The Sequence Listing associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is 23182PCT.xml. The XML file is 42,240 bytes, was created on November 19, 2024, and is being submitted electronically via the USPTO Patent Center. BACKGROUND Antisense oligonucleotides (ASOs) are short oligonucleotides (typically 16−30 bases long) usually designed to bind complementary mRNA and or other nucleic acids which translates into disease treatment. ASOs are being developed as drugs; however, problems of pharmacodynamic distribution, failure to spontaneously cross cell membranes to reach target mRNAs, and oligonucleotide instability are sometimes obstacles to clinical effectiveness. ASOs are susceptible to being absorbed and broken down in the acidic environment within endosomes. Thus, there is a need to identify improved methods of delivering ASOs and other nucleic acid based drugs. Chen et al. report a pH-driven DNA nanoswitch for responsive controlled release. Chemical Communications.2011, 47 (10), 2850. Wu et al report intracellular fate of spherical nucleic acid nanoparticle conjugates. J. Am. Chem. Soc.2014, 136 (21), 7726−7733. Jayakumar et al. report a near-infrared-light-based nano-platform boosts endosomal escape and controls gene knockdown. Nano, 2014, 8 (5), 4848−4858. Lannes et al. report tuning the pH response of i-Motif DNA oligonucleotides. Chembiochem, 2015, 16 (11), 1647−1656. Shi et al. report light-induced self-escape of spherical nucleic acid from endo / lysosome for efficient non-cationic gene delivery. Angew Chem, Int Ed Engl, 2020, 59 (43), 19168−19174. Mitchell et al. report engineering precision nanoparticles for drug delivery. Nat Rev Drug Discovery, 2021, 20 (2), 101−124. Bost et al. report the delivery of oligonucleotide therapeutics using chemical modifications, lipid nanoparticles, and extracellular vesicles. ACS Nano 2021, 15 (9), 13993−14021. Roise et al. report acid-sensitive surfactants enhance the delivery of nucleic acids. Molecular Pharmaceutics, 2022, 19 (1), 67−79. Mendes et al. report nanodelivery of nucleic acids. Nature Reviews, 2022, 2(1). Sharma et al. report gene regulation using nanodiscs modified with HIF-1‑α antisense oligonucleotides. Bioconjugate Chem, 2022, 33, 279−293 and WO2023 / 141562. References cited herein are not an admission of prior art. SUMMARY Disclosed herein are double stranded therapeutic oligonucleotide endosomal escape peptide conjugates and uses in therapeutic methods. In certain embodiments, a double stranded therapeutic oligonucleotide endosomal escape peptide conjugate comprises a pH sensitive polynucleotide strand and a therapeutic polynucleotide strand; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds a segment of the pH sensitive polynucleotide stand; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds an in vivo target. In certain embodiments, the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide (EEP). In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate is attached to a particle. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or coated particle is used in an antisense or other oligonucleotide therapy. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate containing a therapeutic entity is conjugated to peptides that facilitate triggering endosomal release of the therapeutic entity under acidic conditions. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugates are coated on small particles, nanoparticles, or nanodiscs. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugates optionally coated on small particles, nanoparticles, or nanodiscs are used in therapeutic treatments. In certain embodiments, the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate comprises: a pH sensitive polynucleotide strand and a therapeutic polynucleotide strand; wherein the pH sensitive polynucleotide strand comprises a polynucleotide motif sequence that folds providing a folded state when exposed to an aqueous pH below 6 and unfolds when exposed to an aqueous pH above 6 providing an unfolded state; wherein the pH sensitive polynucleotide strand comprises a sequence that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds the segment of the pH sensitive polynucleotide stand; wherein the therapeutic polynucleotide strand comprises therapeutic entity, e.g., a nucleotide sequence that binds an in vivo target; and wherein the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide. In certain embodiments, the sequence in the pH sensitive polynucleotide strand that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state comprises the polynucleotide sequence that binds an i-motif, e.g., GTGTGATTGGGGGACGT (SEQ ID NO: 1). In certain embodiments, the endosomal escape peptide (EEP) comprises an amino acid sequence of GLFDIIKKIAESF (SEQ ID NO: 2), poly arginine, RGD, DGR, variants or combinations thereof. In certain embodiments, the endosomal escape peptide (EEP) having GLFDIIKKIAESF (SEQ ID NO: 2) is conjugated through the N-terminal G to the 3’ end (directly or indirectly, i.e., through other nucleotides and / or linking groups) of the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1). In certain embodiments, the therapeutic entity, e.g., nucleotide sequence that binds an in vivo target nucleic acid, is conjugated to the 5’ end (directly or indirectly, i.e., through other nucleotides and / or linking groups) of the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1). In certain embodiments, the pH sensitive polynucleotide strand comprises and i-motif, i.e., multiple sequences comprising a polyC sequence, e.g., CC, CCC, CCCC, or CCCCC separated by 1 to 4 or more A or T nucleotides, e.g. the polynucleotide sequence AACGTCCCCCAATCCCCC (SEQ ID NO: 3). In certain embodiments, the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCCAATCCCCC (SEQ ID NO: 4). In certain embodiments, the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCCAATCCCCCAATCCCCC (SEQ ID NO: 5). In certain embodiments, the nucleotide sequence that binds an in vivo target is TGGCAAGCATCCTGTA (SEQ ID NO: 6, HIF-1-a ASO), GCCUCAGTCTGCTTCGCACC (SEQ ID NO: 7, mipomersen), TCTTGGTTAACATGAAATCCC (SEQ ID NO: 8, inotersen), CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 9, eteplirsen is a morpholino phosphorodiamidate antisense oligomer). GTTGCCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 10, golodirsen) TCACTTTCATAATGCTGG (SEQ ID NO: 11, nusinersen) CGGAATCAGTGAATGCTTATACATTCG (SEQ ID NO: 12, pegaptanib) GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO: 13, fomivirsen), CCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 14, viltolarsen), CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 15, casimersen), ATGGAATACTCTTGGTTACTT (SEQ ID NO: 16, patisiran) TAAGATGAGACACTCTTTCTGGT (SEQ ID NO: 25, milasen) TATATTTCCAGGATGAAAGTCCA (SEQ ID NO: 24, lumasiran) ACAAAGCAAAACAGGTTCTAGAA (SEQ ID NO: 23, inclisiran) GGTTGGATTGGTTGG (SEQ ID NO: 17, defibrotide aptamer), and / or GGTTGGATCGGTTGG (SEQ ID NO: 18, defibrotide aptamer). In certain embodiments, this disclosure relates to particles coated with or comprising the double stranded polynucleotide complex as reported herein. In certain embodiments, the double stranded polynucleotide complex is conjugated to the particle through the pH sensitive polynucleotide strand. In certain embodiments, the double stranded polynucleotide complex is conjugated through the 5’ end of the pH sensitive polynucleotide strand. In certain embodiments, particle is a gold nanoparticle. In certain embodiments, the particle is a nanodisc. In certain embodiments, the therapeutic polynucleotide strand, particle, disc, or nucleic acid complex comprising the therapeutic polynucleotide strand comprises an antisense sequence, gapmer sequence, splice switching oligonucleotide, or aptamer sequence. In certain embodiments, in the therapeutic polynucleotide strand, particle, disc, or nucleic acid complex, the therapeutic polynucleotide strand is conjugated to an oligonucleotide based therapeutic agent or a small molecule or peptide based therapeutic agent. In certain embodiments, this disclosure relates to methods of treating or preventing a disease or conditions comprising administering an effective amount of a double stranded therapeutic polynucleotide complex as disclosed herein or a particle as disclosed herein, to a subject in need thereof. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS Figure 1A illustrates DNA EndosomaL Escape Vehicle Response (DELVR). A pH- triggered spherical nucleic acid that provides an antisense oligonucleotide (ASO) release upon endosomal acidification resulting in selective membrane disruption. A nanoparticle core (AuNP) bound directly to an i-Motif strand (pH sensitive) and is hybridized to a therapeutic complement strand containing an antisense oligonucleotide (ASO) and endosomal escape peptide (EEP). The double stranded therapeutic polynucleotide complex is attached to a particle comprising a pH sensitive polynucleotide strand and a therapeutic polynucleotide strand; wherein the pH sensitive polynucleotide strand comprises a polynucleotide motif sequence; wherein the pH sensitive polynucleotide strand comprises a sequence that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds the segment of the pH sensitive polynucleotide stand; wherein the therapeutic polynucleotide strand comprises therapeutic entity, e.g., a nucleotide sequence that binds an in vivo target (antisense oligonucleotide, ASO); and wherein the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide (EEP). Figure 1B illustrates DELVR wherein the coated particle is taken up into cells within endosomes via endocytosis. Although it is not intended that embodiments of this disclosure be limited by any particular mechanism, it is contemplated that as the endosome matures, the i-Motif strand responds to acidification (pH lowering), causing release of the complement therapeutic ASO strand and exposing the membrane-active endosomal escape peptide (EEP). The EEP selectively disrupts the endosomal membrane, leading to endosomal escape of the therapeutic ASO strand and allowing for the antisense therapeutic to reach a target. Figure 2A illustrates i-Motif pH sensitive folding. RA and IA refer to random coiling and i- Motif structures. Also illustrated is the hemi-protonated cytosine facilitating cytosine hydrogen bonding. Figure 2B provides specific sequences (SEQ ID NO: 19-23) for each DNA strand with names corresponding to the size of repeated cytosine arrays or the distribution of cytosines (cytosines 5C array is highlighted). It is desirable that the transition from single-stranded DNA (ssDNA) to i-Motif is spontaneous under acidic conditions and not favorable at neutral pH. Figure 2C shows absorbance spectra for i-Motif DNA with arrays of various numbers of cytosines as a function of pH. The right plot shows the percentage of DNA folded into an i-Motif versus pH for i-Motif 5C, scrambled i-Motif 5C, and non-i-Motif DNA. The left plot shows the i- Motif folded percentage vs pH for i-Motif 3C, 4C, and 5C. Figure 3A shows a structure-switching i-Motif duplex that is triggered at a pH of about 5.5. i.e., transitions from double-stranded DNA (dsDNA) to folded i-Motif and random coil DNA. Highlighted is the 5C-base i-Motif and the two C-tract overhang complement. Cy3B is a pH- insensitive fluorescence reporter that is quenched with a black hole quencher (BHQ). Intentional mismatches minimize the formation of G quadruplexes and maintain equal melting temperatures. Figure 3B shows data quantifying duplex denaturation as a function of pH. Nine i-Motif duplexes were investigated as a function of the number (#) of C-bases per array and the # C-array overhangs. Each i-Motif contains four arrays, and the number of bound arrays varied with increasing overhang. Each individual trial is normalized to a thermally melted positive control (“+”) to determine % release as a function of pH. Experiments were conducted at 52.5 nM quencher and 50 nM Cy3B strand for 3 h at 37 °C. Figure 4A illustrates a conjugation strategy between the oligonucleotide (5CD2) GTGTGATTGGGGGACGTTTTCTA (SEQ ID NO: 22) containing DNA SEQ ID NO: 1, and endosomal escape peptide (EEP) containing SEQ ID NO: 2. The EEP contains an alkyne-modified glycine (propargylglycine: G*) at a terminus that reacts with a 3′ azide group on the DNA through a copper-catalyzed azide−alkyne cycloaddition reaction. The oligonucleotide contains an internal Cy3 modification to enable fluorescence reporting. Figure 4B shows data indicating endosomal escape peptides increase uptake for oligonucleotide conjugates. Uptake fold change with EEP containing peptide SP1, SP2, SP3, N- modified Aurein1.2, and C-modified Aurein1.2) were evaluated. Flow cytometry histograms were used to evaluate distribution of Cy3 fluorescence uptake in HeLa cells among N-modified Aurein1.2, SP1, SP2, SP3, and a no EEP negative control. HeLa cells were incubated with 50 nM DNA-EEP for 4 h in serum-free media. Each group was measured and background subtracted against untreated cells. Figure 5A shows scheme of i-Motif duplex quenching mechanism with EEP. The internal Cy3 allows for FRET reporting of duplex dissociation upon acidification. Evaluations of the pH response for structure-switching i-Motif duplex with EEP and on AuNP were performed. Figure 5B shows data quantifying duplex release between i-Motif 5C and its complement (5CD2) with or without EEP at varying pH - 52.5 nM quencher strand (i-Motif 5C) and 50 nM Cy3-EEP strand (5CD2) were annealed and subsequently incubated together for 3 h at 37 °C in varying pH buffer (1× UB4). Samples were then fluorescently measured via a plate reader. Figure 5C provides a scheme showing the i-Motif AuNP release mechanism using the AuNP as a quencher. Figure 5D shows data quantifying duplex release on AuNP between i-Motif 5C and its complement (5CD2) with or w / o EEP at varying pH. Constructs were incubated for 3 h at 37 °C in varying pH buffer (1× UB4) and then fluorescently measured via plate reader. The % release is normalized to a thermally melted positive control, which indicates complete release. Figure 6A provides a scheme using RNase H degradation in antisense therapy. The antisense oligonucleotide (ASO) binds mRNA, recruiting RNase H1 to degrade the target mRNA. The staple DNA does not hinder activity. Figure 6B illustrates potential release mechanisms of DELVR, invoking pH or nuclease- driven cues. Nucleases can bind and degrade dsDNA in lysosomes. Figure 6C shows data on the relative HIF1a knockdown across each release group observed at 100 nM ASO (EZN2968). Data are normalized against untreated and scrambled ASO (EZN3088) negative controls. DELVR dose dependence (synergistic group) to knockdown HIF1a at 0, 10, 50, and 100 nM ASO (+T*+G*+G*C*A*A*G*C*A*T*C*C*+T*+G*+ T*AGTGTGATTGGGGGACGTTTTCTA, SEQ ID NO: 21, where “+” refers to locked nucleic acid, “*” refers to phosphorothioate) was compared to that of scrambled ASO DELVR with 100.3%, 76.1%, 57.2%, and 34.6% HIF1a expression, respectively. Figure 7 shows data quantifying DELVR triggering in cells using fluorescence lifetime imaging microscopy (FLIM). FLIM involves using a pulsed laser (MHz) to collect an accumulation of emitted photon arrival times from a sample. Intact DELVR yields short lifetimes, and released DELVR yields long lifetimes. The data are derived from intensity-weighted FLIM images of DELVR incubated within HeLa cells for various timeframes. DELVR constructs (2 nM) were administered to cells for 30 min before washing and then were imaged at the end of the incubation period. Provided are quantification of the average lifetimes for 0.5 nM intact synergistic DELVR, 100 nM ATTO532-DNA, and 100 nM unconjugated ATTO532 dye in 1× PBS. Figure 8A illustrates DELVR-NNA (nanodiscoidal nucleic acids) nanoparticles. ND scaffold is prepared with 1% Cy5-PE lipids that quench the internal Cy3 dye on the 5CD2 complement strand. When DELVR is triggered by acidification, the complement strand is unquenched leading to bright cy3 emission. Figure 8B shows data indicating DELVR-NNA maintains pH-responsivity. Plot showing the % release of Cy3 reporter with or without EEP as a function of pH to determine pKa. DETAILED DESCRIPTIONS Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to embodiments described, and as such may, of course, vary. An "embodiment" refers to an example and is not necessarily limited to such example. It is also to be understood that the terminology used herein is for describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed. As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible. Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of medicine, organic chemistry, biochemistry, molecular biology, pharmacology, and the like, which are within the skill of the art. Such techniques are explained fully in the literature. It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings unless a contrary intention is apparent. As used in this disclosure and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") have the meaning ascribed to them in U.S. Patent law in that they are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The term “comprising” in reference to an oligonucleotide having a nucleic acid sequence refers to an oligonucleotide or peptide that may contain additional 5’ (5’ terminal end) or 3’ (3’ terminal end) nucleotides or N- or C-terminal amino acids, i.e., the term is intended to include the oligonucleotide sequence or peptide sequence within a larger nucleic acid or peptide. "Consisting essentially of" or "consists of" or the like, have the meaning ascribed to them in U.S. Patent law in that when applied to methods and compositions encompassed by the present disclosure refers to compositions like those disclosed herein that exclude certain prior art elements to provide an inventive feature of a claim, but which may contain additional composition components or method steps, etc., that do not materially affect the basic and novel characteristic(s) of the compositions or methods. The term “consisting of” in reference to an oligonucleotide or peptide having a nucleotide or peptide sequence refers an oligonucleotide or peptide having the exact number of nucleotides or amino acids in the sequence and not more or having not more than a range of nucleotide expressly specified in the claim. For example, “5’ sequence consisting of” is limited only to the 5’ end, i.e., the 3’ end may contain additional nucleotides. Similarly, a “3’ sequence consisting of” is limited only to the 3’ end, and the 5’ end may contain additional nucleotides. The term “conjugated” refers to linking molecular entities through covalent bonds, or by other specific binding interactions, such as due to hydrogen bonding or other van der Walls forces. The force to break a covalent bond is high, e.g., about 1500 pN for a carbon-to-carbon bond. The force to break a combination of strong protein interactions is typically a magnitude less, e.g., biotin to streptavidin is about 150 pN. Thus, a skilled artisan would understand that conjugation must be strong enough to restrict the breaking of bonds in order to implement the intended results. In certain embodiments, the term conjugated is intended to include linking molecular entities that do not break unless exposed to a force of about greater than about 5, 10, 25, 50, 75, 100, 125, or 150 pN depending on the context. A "linking group" refers to any variety of molecular arrangements that can be used to bridge or conjugate molecular moieties together. An example formula may be -Rn- wherein R is selected individually and independently at each occurrence as: -CRnRn-, -CHRn-, -CH-, -C-, -CH2-, -C(OH)Rn, -C(OH)(OH)-, -C(OH)H, -C(Hal)Rn-, -C(Hal)(Hal)-, -C(Hal)H-, -C(N3)Rn-, -C(CN)Rn-, -C(CN)(CN)-, -C(CN)H-, -C(N3)(N3)-, -C(N3)H-, -O-, -S-, -N-, -NH-, -NRn-, -(C=O)-, -(C=NH)-, -(C=S)-, -(C=CH2)-, which may contain single, double, or triple bonds individually and independently between the R groups. If an R is branched with an Rnit may be terminated with a group such as -CH3, -H, -CH=CH2, -CCH, -OH, -SH, -NH2, -N3, -CN, or -Hal, or two branched Rs may form an aromatic or non-aromatic cyclic structure. It is contemplated that in certain instances, the total Rs or “n” may be less than 100 or 50 or 25 or 10. Examples of linking groups include bridging alkyl groups, alkoxyalkyl, polyethylene glycols, amides, esters, and aromatic groups. The terms, "nucleic acid," or "oligonucleotide," is meant to include nucleic acids, ribonucleic or deoxyribonucleic acid, mixtures, nucleobase polymers, or analogs thereof. An oligonucleotide can include native or non-native bases. In this regard, a native deoxyribonucleic acid can have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine and a ribonucleic acid can have one or more bases selected from the group consisting of uracil, adenine, cytosine, or guanine. The term "nucleobase polymer" refers to nucleic acids and chemically modified forms with nucleobase monomers. In certain embodiments, methods and compositions disclosed herein may be implemented with nucleobase polymers comprising units of a ribose, 2’deoxyribose, locked nucleic acids (1-(hydroxymethyl)-2,5-dioxabicyclo[2.2.1]heptan-7-ol), 2′-O-methyl groups, a 3′- 3′-inverted thymidine, phosphorothioate linkages, or combinations thereof. In certain embodiments, the nucleobase polymer may be less than 100, 50, or 35 nucleotides or nucleobases. Nucleobase monomers are nitrogen containing aromatic or heterocyclic bases that bind to naturally occurring nucleic acids through hydrogen bonding otherwise known as base pairing. A typical nucleobase polymer is a nucleic acid, RNA, DNA, or chemically modified form thereof. A nucleobase polymer may be single or double stranded or both, e.g., they may contain overhangs. Nucleobase polymers may contain naturally occurring or synthetically modified bases and backbones. In certain embodiments, a nucleobase polymer need not be entirely complementary, e.g., may contain one or more insertions, deletions, or be in a hairpin structure provided that there is sufficient selective binding. With regard to the nucleobases, it is contemplated that the term encompasses isobases, otherwise known as modified bases, e.g., are isoelectronic or have other substitutes configured to mimic naturally occurring hydrogen bonding base-pairs, e.g., within any of the sequences herein U may be substituted for T, or T may be substituted for U. Examples of nucleotides with modified adenosine or guanosine include, but are not limited to, hypoxanthine, xanthine, 7-methylguanine. Examples of nucleotides with modified cytidine, thymidine, or uridine include 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine. Contemplated isobases include 2'-deoxy-5- methylisocytidine (iC) and 2'-deoxy-isoguanosine (iG) (see U.S. Pat. No. 6,001,983; No. 6,037,120; No.6,617,106; and No.6,977,161). Nucleobase polymers may be chemically modified, e.g., within the sugar backbone or on the 5’ or 3’ ends. As such, in certain embodiments, nucleobase polymers disclosed herein may contain monomers of phosphodiester, phosphorothioate, methylphosphonate, phosphorodiamidate, piperazine phosphorodiamidate, ribose, 2′-O-methy ribose, 2′-O- methoxyethyl ribose, 2'-fluororibose, deoxyribose, 1-(hydroxymethyl)-2,5- dioxabicyclo[2.2.1]heptan-7-ol, P-(2-(hydroxymethyl)morpholino)-N,N-dimethylphosphon amidate, morpholin-2-ylmethanol, (2-(hydroxymethyl)morpholino) (piperazin-1-yl)phosphinate, or peptide nucleic acids or combinations thereof. In certain embodiments, the nucleotide base polymer is single or double stranded and / or is 5’ end polyphosphorylated, e.g., di-phosphate, tri-phosphate and / or 3’ end capped with one, two, or more thymidine nucleotides. In certain embodiments, the nucleobase polymer can be modified to contain a phosphodiester bond, methylphosphonate bond or phosphorothioate bond. The nucleobase polymers can be modified, for example, 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-H of the ribose ring. Constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography and re-suspended in water. In certain embodiments, nucleobase polymers include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA "locked nucleic acid" nucleotides such as a 2',4'-C methylene bicyclo nucleotide (see for example U.S. Patent No. 6,639,059, U.S. Patent No.6,670,461, U.S. Patent No. 7,053,207). In certain embodiments, the disclosure features modified nucleobase polymers, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and / or alkylsilyl, substitutions. The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p- acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art. As used herein, the term “small molecule” refers to any variety of covalently bound molecules with a molecular weight of less than 900 or 1000. Typically, the majority of atoms include carbon, hydrogen, oxygen, nitrogen, and to a lesser extent sulfur and / or a halogen. Examples include steroids, short peptides, mono or polycyclic aromatic or non-aromatic, heterocyclic compounds. As used herein, "subject" refers to any animal, preferably a human patient, livestock, or domestic pet. As used herein, the terms "treat" and "treating" are not limited to the case where the subject (e.g., patient) is cured and the disease is eradicated. Rather, embodiments, of the present disclosure also contemplate treatment that merely reduces symptoms, and / or delays disease progression. As used herein, the term "combination with" when used to describe administration with an additional treatment means that the agent may be administered prior to, together with, or after the additional treatment, or a combination thereof. The term "effective amount" refers to that amount of a compound or pharmaceutical composition described herein that is sufficient to effect the intended application including, but not limited to, disease treatment, as illustrated below. The therapeutically effective amount can vary depending upon the intended application (in vitro or in vivo), or the subject and disease condition being treated, e.g., the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The specific dose will vary depending on, for example, the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other agents, timing of administration, the tissue to which it is administered, and the physical delivery system in which it is carried. Double stranded therapeutic oligonucleotides conjugated to endosomal escape peptides Disclosed herein are nucleic acid complexes containing a therapeutic entity conjugated to peptides that facilitate triggering endosomal release of the therapeutic entity under acidic conditions. In certain embodiments, the nucleic acid and peptide conjugate are coated on small particles, nanoparticles, or nanodiscs. In certain embodiments, the nucleic acid and peptide conjugate optionally coated on small particles, nanoparticles, or nanodiscs are used in therapeutic treatments. In certain embodiments, the nucleic acid and peptide conjugate is a double stranded therapeutic polynucleotide complex comprising: a pH sensitive polynucleotide anchor strand and a therapeutic polynucleotide strand; wherein the pH sensitive polynucleotide strand comprises a polynucleotide motif sequence that folds providing a folded state when exposed to an aqueous pH below 6 and unfolds when exposed to an aqueous pH above 6 providing an unfolded state; wherein the pH sensitive polynucleotide strand comprises a sequence that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds the segment of the pH sensitive polynucleotide stand; wherein the therapeutic polynucleotide strand comprises therapeutic entity, e.g., a nucleotide sequence that binds an in vivo target; and wherein the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide. In certain embodiments, the sequence in the pH sensitive polynucleotide strand that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state comprises the polynucleotide sequence that binds an i-motif, e.g., GTGTGATTGGGGGACGT (SEQ ID NO: 1). In certain embodiments, the endosomal escape peptide (EEP) comprises an amino acid sequence of GLFDIIKKIAESF (SEQ ID NO: 2), poly arginine, RGD, DGR, variants or combinations thereof. In certain embodiments, the endosomal escape peptide (EEP) having GLFDIIKKIAESF (SEQ ID NO: 2) is conjugated through the N-terminal G to the 3’ end (directly or indirectly, i.e., through other nucleotides and / or linking groups) of the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1). In certain embodiments, the therapeutic entity, e.g., nucleotide sequence that binds an in vivo target nucleic acid, is conjugated to the 5’ end (directly or indirectly, i.e., through other nucleotides and / or linking groups)of the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1). In certain embodiments, the pH sensitive polynucleotide strand comprises and i-motif, i.e., multiple sequences comprising a polyC sequence, e.g., CC, CCC, CCCC, or CCCCC separated by 1 to 4 A or T nucleotides, e.g. the polynucleotide sequence AACGTCCCCCAATCCCCC (SEQ ID NO: 3). In certain embodiments, the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCCAATCCCCC (SEQ ID NO: 4). In certain embodiments, the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCCAATCCCCCAATCCCCC (SEQ ID NO: 5, i-Motif 5C). In certain embodiments, the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCAATCCCCAATCCCCAATCCCC (SEQ ID NO: 20, i- Motif 4C). In certain embodiments, the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCAATCCCAATCCCAATCCC (SEQ ID NO: 19, i-Motif 3C). In certain embodiments, the nucleotide sequence that binds an in vivo target is TGGCAAGCATCCTGTA (SEQ ID NO: 6, HIF-1-a ASO), GCCUCAGTCTGCTTCGCACC (SEQ ID NO: 7, mipomersen), TCTTGGTTAACATGAAATCCC (SEQ ID NO: 8, inotersen), CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 9, eteplirsen). GTTGCCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 10, golodirsen) TCACTTTCATAATGCTGG (SEQ ID NO: 11, nusinersen) CGGAATCAGTGAATGCTTATACATTCG (SEQ ID NO: 12, pegaptanib) GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO: 13, fomivirsen), CCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 14, viltolarsen), CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 15, casimersen), ATGGAATACTCTTGGTTACTT (SEQ ID NO: 16, patisiran) TAAGATGAGACACTCTTTCTGGT (SEQ ID NO: 25, milasen) TATATTTCCAGGATGAAAGTCCA (SEQ ID NO: 24, lumasiran) ACAAAGCAAAACAGGUUCUAGAA (SEQ ID NO: 23, inclisiran) GGTTGGATTGGTTGG (SEQ ID NO: 17 defibrotide aptamer), and / or GGTTGGATCGGTTGG (SEQ ID NO: 18, defibrotide aptamer). In certain embodiments, this disclosure relates to small particles or discs coated with or comprising the double stranded oligonucleotide complex as reported herein. In certain embodiments, the double stranded oligonucleotide complex is conjugated to the particle through the pH sensitive polynucleotide strand. In certain embodiments, the double stranded oligonucleotide complex is conjugated through the 5’ end of the pH sensitive polynucleotide strand. In certain embodiments, particle is a gold or other metal or polymer nanoparticle. In certain embodiments, the particle is a nanodisc. In certain embodiments, the therapeutic polynucleotide strand, particle, disc, or nucleic acid complex comprising the therapeutic polynucleotide strand comprises an antisense sequence, gapmer sequence, splice switching oligonucleotide, or aptamer sequence. In certain embodiments, in the therapeutic polynucleotide strand, particle, disc, or nucleic acid complex the therapeutic polynucleotide strand is conjugated to a small molecule or peptide based therapeutic agent. In certain embodiments, the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide. In certain embodiments, the endosomal escape peptide (EEP) comprises a polyarginine (e.g., RR or RRR), polyleucine (e.g., KK or KKK), multiple arginine(R) and / or leucine (K) amino acids (statistically more prevalent than a random or typical peptide, more than 20% or 30% of the amino acids in a segment of less than 10 or 15 amino acids), RGD, DGR, or combinations thereof. In certain embodiments, the endosomal escape peptide (EEP) having the amino acids sequence of GLFDIIKKIAESF (SEQ ID NO: 2) is conjugated through the N-terminal G to the 3’ end (directly or indirectly, i.e., through other amino acids, nucleotides, and / or linking groups) of the polynucleotide sequence. In certain embodiments, the endosomal escape peptide (EEP) comprises GLFDIIKKIAESF (SEQ ID NO: 2, Aurein 1.2), RQIKIWFQNRRMKWKKGG (SEQ ID NO: 26, Penetratin), GRKKRRQRRRPPQ (SEQ ID NO: 27, HIV TAT 1), RKKRRQRRR (SEQ ID NO: 28, HIV TAT2), LLILRRRIRKQAHAHSK (SEQ ID NO: 29, pVEC), GLRKRLRKFRNK (SEQ ID NO: 30, sC18), GWLTNSAGYLLGKINLKALAALAKKIL (SEQ ID NO: 31, Transportan), CSIPPEVKFNKPKVLI (SEQ ID NO: 32, C105Y), SDLWEMMMVSLACQY (SEQ ID NO: 33, Pep-7), KLWMRWYSPTTRRYG (SEQ ID NO: 34, IVV-14), GFWFG (SEQ ID NO: 35, SP1), GWWG (SEQ ID NO: 36, SP2), GWWWG (SEQ ID NO: 37, SP3), HHHHHHHH (SEQ ID NO: 38, H-8), or combinations thereof. Double stranded therapeutic endosomal escape conjugates, particles, and phosphate membrane nanodiscs In certain embodiments, this disclosure relates to particles coated with or comprising the double stranded oligonucleotide complex as reported herein. In certain embodiments, the particles are lipids, liposomes, spherical nucleic acids (SNAs), polymeric nanoparticles or nanodiscs. In certain embodiments, the particles or nanodiscs are of any size / diameter, e.g.3 nm to 200 or 500 nm, or from 0.001 mm to 10 mm. In certain embodiments, the particles are comprised of a metal and / or polymer and / or polymer coating. In certain embodiments, the polymer is a hydrophilic polymer such as a polyethylene glycol. In certain embodiments, the hydrophobic polymer is a lipid, fatty acid lipid, or lipid phosphate. In certain embodiments, a hydrophobic polymer and / or hydrophilic polymer surrounds the polymer core. In certain embodiments, the polymer contains a lipid monolayer or lipid bilayer. In certain embodiments, gold or other metal particles are attached to the complexes by a linking group with one or more heteroatoms for ligation to the metal, e.g., sulfur, basic nitrogen, carboxylate, or combinations thereof. In certain embodiments, protein bases particles are attached to the complexes by a linking group with one or more heteroatoms for ligation to the metal, e.g., sulfur, basic nitrogen, carboxylate, or combinations thereof. Nanodiscs containing phospholipid membranes can be generated using stabilizing scaffold proteins or synthetic polymers. Typically, the stabilizing protein, or functional variant, is a form of a natural Apolipoprotein A-I, e.g., ApoA1, (truncated or operable variants) which forms a complex with the phospholipid components. See WO2023 / 141562. Hydrophobic and hydrophilic interactions between the stabilizing protein and phospholipids creates disc like shapes that are typically water soluble and mimic a cell-membrane environment. Often the diameter of the phosphate membrane nanodisc ranges from about 5 nm to 20 nm which can vary depending on the apolipoprotein length and sequence. In certain embodiments, phosphate membrane nanodisc (ND) scaffolds have thiol- containing phospholipids in the phosphate membrane nanodiscs; thus, so one can use these lipids to attach maleimide-modified double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein forming covalent linkages. ND scaffolds reported herein are provided to maximize loading density on the ND scaffold, also referred to as "phosphate membrane nanodiscs." In certain embodiments, this disclosure relates to phosphate membrane nanodiscs covalently modified with double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein containing antisense oligonucleotides or other nucleobase polymers and medical uses related thereto. In certain embodiments, the phosphate membrane nanodiscs comprise a phospholipid having a thiol group used for conjugation to agents such as double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein having a thiol reactive group, e.g., maleimide. In certain embodiment, the phosphate membrane nanodiscs comprise a stabilizing peptide having a thiol group used for conjugation to therapeutic agents such as double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein. In certain embodiments, this disclosure relates to phosphate membrane nanodisc covalently conjugated to a double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein wherein the phosphate membrane nanodisc comprises a zwitterionic phospholipid, a nanodisc stabilizing peptide, such as an ApoA1, variant, or fragment thereof, and wherein the double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein is conjugated to a phospholipid providing a thiol-linked adduct. In certain embodiments, this disclosure relates to phosphate membrane nanodiscs covalently conjugated to a double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein, wherein the phosphate membrane nanodisc comprises a zwitterionic phospholipid, a nanodisc stabilizing peptide, such as an ApoA1, variant, or fragment thereof, comprising a C-terminal thiol group, C-terminal cysteine amino acid, a GC sequence, or GGC sequence, wherein the double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein is conjugated to a phospholipid providing a thiol-linked adduct; and wherein the double stranded therapeutic oligonucleotides endosomal escape peptides disclosed herein is conjugated to the stabilizing peptide providing a thiol-linked adduct to the C-terminal thiol group, C-terminal cysteine amino acid, a GC sequence, or GGC sequence. In certain embodiments, the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein is a nucleobase polymer and the thiol-linked adduct is a thiol-maleimide adduct. In certain embodiments, this disclosure relates to phosphate membrane nanodiscs wherein the nanodisc stabilizing peptide comprises the amino acid sequence of PVLDLFRELLNELLEALKQKLKGGC (SEQ ID NO: 39) and the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate comprises a maleimide or thiol group to form a maleimide conjugate or dithiol linkage. In certain embodiments, a phosphate membrane nanodisc is conjugated to 4, 5, 6, or greater double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein on each phosphate membrane nanodisc. In certain embodiments, the phosphate membrane nanodisc is made by the process of contacting the zwitterionic phospholipid, a phospholipid having a thiol group, and a nanodisc stabilizing peptide, at a temperature between 40 and 45 degrees Celsius or between 35 and 55 degrees Celsius. In certain embodiments, the phosphate membrane nanodisc is made by the process of contacting the zwitterionic phospholipid, a phospholipid having a thiol group, and a nanodisc stabilizing peptide, in an aqueous solution at a pH between 7.5 and 8.5 or between 7.0 and 9.0. In certain embodiments, the zwitterionic phospholipid is 1,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC). In certain embodiments, the phospholipid having a thiol group is 1,2- dipalmitoyl-sn-glycero-3-phosphothioethanol. In certain embodiments, the molar ratio or weight ratio of the zwitterionic phospholipid to the phospholipid having a thiol group is between 8:1 and 10:1 or between 8:1 and 20:1. In certain embodiments, the phosphate membrane nanodiscs comprise a cationic and / or zwitterionic phospholipid, a phospholipid having a thiol group, a stabilizing peptide having a thiol group, and a double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein. In certain embodiments, the cationic and / or or zwitterionic phospholipid is 1,2- dimyristoyl-sn-glycero-3-phosphocholine (DMPC). In certain embodiments, the phospholipid having a thiol group is 1,2-dipalmitoyl-sn-glycero-3-phosphothioethanol on an outer surface which provide a thiol reactive phospholipid. In certain embodiments, the 1,2-dimyristoyl-sn- glycero-3-phosphocholine (DMPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphothioethanol are in the ratio of 9:1 or between 8:1 and 10:1. In certain embodiments, the stabilizing peptide having a thiol group comprises the amino acid sequence of PVLDLFRELLNELLEALKQKLKGGC (SEQ ID NO: 39), CGGPVLDLFRELLNELLEALKQKLK (SEQ ID NO: 40) or CPVLDLFRELLNELLEALKQKLKC (SEQ ID NO: 41). In certain embodiments, double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein is covalently conjugated to the nanodisc through the phospholipid having a thiol group on the outer surface of the phosphate membrane nanodisc. In certain embodiments, the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein is linked to the phosphate membrane nanodisc through the phospholipid having a thiol group providing a maleimide-thiol adduct. In certain embodiments, the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein which is covalently conjugated to the phosphate membrane nanodisc through the stabilizing peptide having a thiol group on the outer surface of the nanodiscs. In certain embodiments, the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein is linked to the phosphate membrane nanodisc through the stabilizing peptide having a thiol group providing a maleimide-thiol adduct. In certain embodiments, the maleimide-thiol adduct can be conjugated to the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein using any type of linking group. In certain embodiments, as an alternative to using a maleimide thiol reactive agent, one can use any construct that is reactive with thiol groups (thiol reactive entities) conjugated to the double stranded therapeutic oligonucleotides endosomal escape peptide conjugate disclosed herein by a linking group. In certain embodiments, thiol reactive entities include haloacetyl, bromoacetyl, or iodoacetyl chemical groups which form thiol ether adducts, and pyridyl disulfides to form disulfide adducts. Methods of treatment In certain embodiments, this disclosure relates to methods of treating or preventing a disease or conditions comprising administering an effective amount of a double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein, to a subject in need thereof. In certain embodiments, this disclosure relates to methods of treating diseases or conditions comprising administering to a subject in need thereof an effective amount of a double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein that can treat the disease or conditions, e.g., a therapeutic agent can specifically bind a disease or condition associated biomolecule. In certain embodiments, this disclosure relates to methods of treating cancer comprising administering an effective amount of a double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that specifically binds to HIF-1a mRNA as reported herein to a subject in need thereof. In certain embodiments, this disclosure relates to methods of treating cancer comprising administering to a subject in need thereof an effective amount of a double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that specifically binds to HIF- 1a mRNA as reported herein e.g., comprises TGGCAAGCATCCTGTA (SEQ ID NO: 5). In certain embodiments, the cancer is pancreatic cancer, liver cancer, kidney cancer, lung cancer, non-small cell lung cancer, or small cell lung cancer. In certain embodiments, this disclosure relates to methods of treating diseases or conditions associated with HIF-1a targeting due to abnormal levels of HIF-1a such as atherosclerosis, psoriasis, diabetic retinopathy, macular degeneration, rheumatoid arthritis, asthma, inflammatory bowel disease, warts, allergic dermatitis, inflammation, and skin inflammation. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of fomivirsen, GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO: 13). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating cytomegalovirus retinitis (CMV) in immunocompromised patients, including those with AIDS. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of pegaptanib, CGGAATCGTGAATGCTTATACATCG (SEQ ID NO: 12). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating neovascular (wet) age-related macular degeneration (AMD). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of mipomersen, GCCUCAGTCTGCTTCGCACC (SEQ ID NO: 7). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating of homozygous familial hypercholesterolemia. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of defibrotide aptamers, GGTTGGATTGGTTGG (SEQ ID NO: 17) and / or GGTTGGATCGGTTGG (SEQ ID NO: 18). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating or preventing the formation of blood clots. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of eteplirsen, CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 9). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating Duchenne muscular dystrophy (DMD). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of nusinersen, TCACTTTCATAATGCTGG (SEQ ID NO: 11). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating spinal muscular atrophy (SMA). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of inotersen TCTTGGTTAACATGAAATCCC (SEQ ID NO: 8). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating polyneuropathy (nerve disease) of hereditary transthyretin-mediated amyloidosis. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of golodirsen, GTTGCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: X). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating Duchenne muscular dystrophy (DMD). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of viltolarsen, CCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 14). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating Duchenne muscular dystrophy (DMD). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of casimersen, CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 15). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating Duchenne muscular dystrophy (DMD). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of patisiran, ATGGAATACTCTTGGTTACTT (SEQ ID NO: 16). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating polyneuropathy associated with hereditary transthyretin-mediated amyloidosis (hATTR). In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of milasen, TAAGATGAGACACTCTTTCTGGT (SEQ ID NO: 25). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating a neurological disorder. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of lumasiran, TATATTTCCAGGATGAAAGTCCA (SEQ ID NO: 24). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating primary hyperoxaluria type 1. In certain embodiments, the therapeutic polynucleotide strand of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein comprises a nucleotide sequence of inclisiran, ACAAAGCAAAACAGGTTCTAGAA (SEQ ID NO: 23). In certain embodiments, this disclosure contemplates use of the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate or particle as disclosed herein for treating hypercholesterolemia. Pharmaceutical compositions and kits In certain embodiments, this disclosure relates to pharmaceutical compositions and kits comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or particles or nanodiscs containing the same as reported herein. In certain embodiments, this disclosure relates to the production of a medicament comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or particles or nanodiscs containing the same as reported herein for therapeutic uses reported herein. In certain embodiments, this disclosure relates to pharmaceutical compositions comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or particles or nanodiscs containing the same as reported herein. In certain embodiments, the pharmaceutical composition optionally comprises a pharmaceutical carrier, and that the pharmaceutical composition optionally comprises further therapeutic agents, anticancer agents, anti-inflammatory agents, etc. In certain embodiments, a pharmaceutical composition is in the form of a liquid comprising pH buffering agents and optionally salts and / or a saccharide or polysaccharide. In certain embodiments, this disclosure contemplates an intravenous formulation with pH buffering agents and tonicity in a range representing physiological values (pH 7 to 8) or for bolus administration, e.g., containing normal saline or dextrose optionally containing pH buffering agents. In certain embodiments, the pharmaceutical composition is in the form of a sterilized pH buffered aqueous salt solution or a saline phosphate buffer between a pH of 6 to 8, optionally comprising a saccharide or polysaccharide. In certain embodiments, this disclosure relates to pharmaceutical compositions comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or nanoparticles or nanodiscs containing the same as reported herein and a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutically acceptable excipient is selected from lactose, sucrose, mannitol, triethyl citrate, dextrose, cellulose, methyl cellulose, ethyl cellulose, hydroxyl propyl cellulose, hydroxypropyl methylcellulose, carboxymethylcellulose, croscarmellose sodium, polyvinyl N-pyrrolidone, crospovidone, ethyl cellulose, povidone, methyl and ethyl acrylate copolymer, polyethylene glycol, fatty acid esters of sorbitol, lauryl sulfate, gelatin, glycerin, glyceryl monooleate, silicon dioxide, titanium dioxide, talc, corn starch, carnauba wax, stearic acid, sorbic acid, magnesium stearate, calcium stearate, castor oil, mineral oil, calcium phosphate, starch, carboxymethyl ether of starch, iron oxide, triacetin, acacia gum, esters, or salts thereof. Compositions suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents solvents or vehicles include water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like), suitable mixtures thereof, vegetable (such as olive oil, sesame oil) and injectable organic esters such as ethyl oleate. These compositions may also contain preserving, emulsifying, and dispensing agents. Prevention of the action of microorganisms may be controlled by addition of any of various antibacterial and antifungal agents, example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form may be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, capsules, gel capsules, and pills. In addition to the phosphate membrane nanodiscs conjugated to therapeutic agents as reported herein, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan or mixtures of these substances, and the like. In certain embodiments, pharmaceutical compositions comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or nanoparticles or nanodiscs containing the same as reported herein can be administered to subjects either orally, parenterally (intravenously, intramuscularly, or subcutaneously), intracisternally, intraperitoneally, intravesically, locally (powders, ointments, or drops), intravaginally, as a buccal or nasal spray, topically to the skin, or rectally. In certain embodiments, the pharmaceutical compositions are in a form for inhalation. In certain embodiments, the pharmaceutical composition comprises double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or nanoparticles or nanodiscs containing the same as reported herein and a propellant. In certain embodiments, an aerosolizing propellant is compressed air, ethanol, nitrogen, carbon dioxide, nitrous oxide, hydrofluoroalkanes (HFAs), or combinations thereof. In certain embodiments, the disclosure contemplates a pressurized or unpressurized container comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or nanoparticles or nanodiscs containing the same as reported herein. In certain embodiments, the container is a manual pump spray, inhaler, meter-dosed inhaler, dry powder inhaler, nebulizer, vibrating mesh nebulizer, jet nebulizer, or ultrasonic wave nebulizer. In certain embodiments, this disclosure contemplates kits comprising pharmaceutical compositions comprising double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or nanoparticles or nanodiscs containing the same as reported herein and optionally another therapeutic agent / anticancer agent in same or separate pharmaceutical composition or container. The kits may contain a transfer device such a needle, syringe, cannula, capillary tube, pipette, or pipette tip. In certain embodiments, the agents may be contained in a storage container, sealed, or unsealed, such a vial, bottle, ampule, blister pack, or box. In certain embodiments, the kit further comprises written instructions for using the agents for treating and / or preventing cancer or other disease or condition in a subject. In certain embodiments, this disclosure relates to uses of double stranded therapeutic oligonucleotides endosomal escape peptide conjugates disclosed herein, or nanoparticles or nanodiscs containing the same as reported herein in the production of a medicament for treating diseases of conditions disclosed herein. Dosing is dependent on severity and responsiveness of the disease state to be treated, and the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Optimum dosages may vary depending on the relative potency of individual oligonucleotides. Generally, it can be estimated based on amounts found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 1 g per kg of body weight, and may be given once or more daily, weekly, monthly, or yearly, or even once every 2 to 10 years or by continuous infusion for hours up to several months. The repetition rates for dosing can be estimated based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state. An endosomal escape trojan horse platform to improve cytosolic delivery of nucleic acids or other therapeutics Disclosed herein is an antisense oligonucleotide (ASO) delivery system termed DNA EndosomaL Escape Vehicle Response (DELVR) that senses and responds to the nuclease-rich and acidic environment of the endosome to release its drug cargo. DELVR comprises two main components: the first is an ASO conjugated to an EEP, and the second is a nanoparticle coated with a pH-responsive complementary oligonucleotide anchor. In DELVR, copies of the ASO-EEP are hybridized to nanoparticles modified with anchor oligos. The EEP is designed to face the interior of the nanoparticle, thus concealing the EEP. The anchor-ASO duplex is sensitive to acidic pH and nucleases that release the ASO-EEP drug. The oligo sequences and EEP composition were optimized to achieve a maximal pH response and identify conditions for enhanced ASO activity. By benchmarking DELVR against that of conventional nanoparticle ASOs and conventional ASO- EEP conjugates, this platform offers enhanced efficacy and potential for boosting the activity of validated ASOs in clinical development. In certain embodiments, this disclosure relates to ASO membrane disruption agents that are selectively released upon acidification, thus minimizing off-target effects. Endocytosis is an obstacle to cytosolic delivery of nucleic acids. Nucleic acid drugs become trapped within endosomes. Active delivery agents such as cell-penetrating peptides are contemplated to improve cytosolic delivery. Membrane-active agents are often not selectivity for endosomal membranes. Endosomes produce an acidic environment, which aids in degradation of foreign materials, that impacts the delivery of therapeutic agents. Disclosed herein is a pH-triggered spherical nucleic acid that provides smart ASO release upon endosomal acidification and selective membrane disruption, termed DNA EndosomaL Escape Vehicle Response (DELVR). A DNA strand with an i-Motif is anchored a nanoparticle (AuNP), where the complement therapeutic strand contains both a drug, e.g., ASO sequence, and a functionalized endosomal escape peptide (EEP). By orienting the EEP toward the AuNP core, the EEP is inactive until it is released through acidification-induced i-Motif folding (Figure 1A and 1B). Disclosed herein is platform for improving the endosomal escape of nucleic acid therapeutics that is modular and can be used to boost drug efficacy of virtually any ASO. By first demonstrating the tunability of single-stranded i-Motif DNA, it is shown that i-Motif pKa increases with structured cytosine repeats and increasing cytosine density, which led us to believe that i-Motif DNA may have further applications as a duplex release trigger. Screening i-Motif duplexes demonstrated the capability for i-Motif sequences to drive the denaturation of the duplex in response to acidification. The duplex pair between the i-Motif with 5C repeats and its complement with an overhang of two C-arrays has an effective duplex release at pH 5.5, a release value well within the pH range present during endosomal maturation. These results demonstrate the capability of i-Motif duplexes to respond to an endosomal environment while maintaining physiological stability, which has previously limited i-Motif translation in drug delivery. A specific application of this i-Motif duplex sequence for an antisense therapy is exemplified; however, this design can be applied more broadly for RNA interference therapies, nanoflares, and other cellular delivery applications for nucleic acids. EEPs are hidden by the dense DNA shell and can be selectively exposed to a single molecule with duplex denaturation. It is contemplated that the EEPs boost antisense efficacy without detrimental effects on the i-Motif trigger, which enables its application for spherical nucleic acid (SNA) delivery. As SNAs are reported to remain trapped within endosomes and are degraded by lysosomes, DELVR solves a major limitation for SNAs. HIF1a was used as an antisense target as it is a prevalent target for cancer therapies that is upregulated alongside the hypoxic conditions often associated with tumors. The ability of the DELVR platform to enhance the efficacy of established antisense drugs by using EZN2968 to target HIF1a was demonstrated. An added benefit of this platform is the enhanced tumor localization resulting from the use of an SNA delivery agent. The modular design allows for the antisense drug, EEP, and even the nanoparticle vehicle to be exchanged, depending on application. By testing various DELVR components individually, it is shown that the highest level of antisense activity is found when all of the components are combined. The endosomal escape efficiency is diminished when the i-Motif duplex anchor is exchanged with a non-pH-responsive duplex, which highlights that the activity is primarily due to the pH-triggering mechanism rather than nonspecific or nuclease dissociation. The synergistic DELVR construct had the fastest release within HeLa cells across all four DELVR variants. This suggests that rapid cytosolic entry enhances the antisense therapeutic and may reduce nonspecific lysosomal degradation as indicated by knockdown results. For many nucleic acid therapeutic strategies, delivery efficiency remains a major bottleneck toward success in the clinic, and it is contemplated that DELVR allows for increased clinical translation for nucleic acid therapies. A library of i-Motif duplexes was characterized to identify structure-switching nucleic acid sequences triggered by endosomal acidification. Antisense efficacy using HIF1a, a hypoxic indicator upregulated in many cancers, was evaluated and demonstrated dose-dependent activity through RT-qPCR. DELVR significantly improves ASO efficacy in vitro. Fluorescence lifetime imaging and activity measurement was used to show that DELVR benefits synergistically from nuclease- and pH-driven release strategies with increased ASO endosomal escape efficiency. The constructs improve cytosolic delivery of nucleic acid therapeutics and offers a method for overcoming intracellular barriers to drug delivery. Antisense oligonucleotides (ASOs) are emerging as useful drugs to treat a broad range of diseases. ASOs oligonucleotides are typically synthetically modified and designed to bind complementary mRNA and often with the intent of block translation of a target that can benefit a disease state. Although it is not intended that embodiments of this disclosure be limited by any particular mechanism, it is also contemplated that ASOs can inhibit protein expression by recruiting RNase H to degrade the mRNA and / or steric blocking translation, e.g. by the ribosome. ASOs stability of oligonucleotides in vivo hindered their application; thus, the oligonucleotides typically contain nuclease-resistant chemical modifications. Distribution of ASO drugs is hindered due to the negatively charged backbone of the polymer and its large molecular weight which often restrict spontaneous crossing the cell membrane to reach targets, e.g., mRNA. Estimates suggest few nucleic acids make it into the cytoplasm of cells, and it is contemplated that the vast majority of oligonucleotide drugs are trapped in endosomes. It is contemplated that the environment of endosomes is acidic and that endosomes often merge with lysosomes that contain degradative enzymes, destroying the cargo. Thus, ASOs are typically dosed at high concentrations that can potentially cause off-target effects such as cytotoxicity and increased immune response. Thrombocytopenia is the most common adverse event that has led to halting multiple ASO trials. Thus, there is a need to enhancing the efficacy of oligonucleotide based drugs. By using nanoparticle based nucleic acid delivery it is contemplated that nucleic acids become less susceptible to enzymatic degradation, e.g., because of steric blocking of nucleases. RNA-based therapeutics are generally less stable than its DNA counterpart. In is contemplated that nanoparticles coated conjugates reported herein enhance the rate of cell uptake and reduce clearance. This disclosure relates to a general strategy to efficiently deliver nucleic acid drugs into the cytosol by enhancing leakage or escape from endosomes. In certain embodiments, this disclosure relates to the use of proteins that can induce endosomal escape such as cell-penetrating peptides (CPPs) or endosomal escape peptides (EEPs). Thus, constructs disclosed herein may include or be conjugated to membrane active agents such as cationic amphiphilic drugs e.g. chloroquine, siramesine, and / or bafilomycin to disrupt the endosomal maturation pathway, e.g., by increasing nonspecific escape. Other constructs include Triton X-100TMmonomer (t- octylphenoxypolyethoxyethanol, polyethylene glycol tert-octylphenyl ether) and / or amphotericin B which are contemplated to function through direct membrane disruption and induce increased endosomal leakage. Other constructs include attenuated diphtheria toxin to increase cytosolic delivery. One objective of DELVR is to circumvent the endosomal entrapment of nucleic acid drugs. Although it is not intended that embodiments of this disclosure be limited by any particular mechanism, in one example a blocked (double-stranded) ASO that is tethered to a nanoparticle is delivered to cells, where the conjugates are internalized by endocytosis. Upon endosomal maturation, the pH of the endosome drops and acts as the primary trigger for the release of the ASO from the AuNP by dissociation from the i-Motif oligonucleotide anchored to the AuNP. Nucleases also act as a secondary release mechanism for the ASO-EEP cargo. The release activates the ASO and exposes the EEP to disrupt the endosomal membrane, thus allowing for active delivery into the cell cytoplasm. To develop the pH-triggered release mechanism, i-Motif DNA was tested. When acidified, cytosine nucleobases become hemi-protonated and can form hydrogen bonds to another cytosine nucleobase (Figure 2A). This is a noncanonical Watson−Crick base pairing interaction and leads to the development of a four-stranded antiparallel structure, called an i-Motif. To explore this folding process, three i-Motif sequences with increasing C-tract length, a scrambled i-Motif sequence, and a non-C-rich sequence were screened. Folding into the i-Motif structure is thermodynamically favored at increasing H cation concentrations. Sequences that displayed a repeating pattern of 3, 4, or 5 C-bases separated by AAT spacers were designed. Folding of an i-Motif sequence containing tracts of 5 C-base was quantified (40% C-bases) by UV−vis spectroscopy, which showed a bathochromic and hypochromic shift upon acidification. When this sequence was scrambled, the response was highly dampened, thus confirming that the repeating C-base pattern was central for i-Motif folding. The C-bases enable the pH response. A control sequence with 12% C-base composition showed no observable chromic shift. Using absorbance at λ = 295 nm, a unique i-Motif absorbance signature, the percentage of DNA folded into the i-Motif structure were calculated as a function of pH. Data were normalized using pH 5.0 and pH 8.0 as the 100% and 0% folded values, respectively. By fitting the data to a Boltzmann sigmoidal function, it was calculated that the transition pH (pKa) for 5 C-tract i-Motif and scrambled i-Motif were 6.79 (±0.020) and 5.73 (±0.011), respectively. The non-i-Motif DNA failed to show a detectable transition within the pH range tested. The pH transition was dependent on the number of C-bases in a row as the 3, 4, and 5 C-tracts displayed transition pH values of 6.12 (±0.023), 6.67 (±0.016), and 6.79 (±0.020), respectively. This validates the role of C-bases in stabilizing folding of the i-Motif structure. To further characterize i-Motif folding, the first derivative for each i-Motif pH transition was calculated and the full width at half-maximum (FWHM) of the transition was used to determine the sharpness of the transition. It was found that i-Motif 5C has a FWHM of 0.414 pH units, whereas the scrambled i-Motif FWHM was 0.585 pH units. Additionally, the structured i- Motif 3C, 4C, and 5C were found to have FWHM values of 0.640, 0.436, and 0.414 pH units, respectively, confirming that increasing the number of C-bases in a row leads to a narrowing of the pH transition profile. Finally, given that these oligos are being designed with in vivo applications in mind, the pH transition for the nuclease-resistant phosphorothioate (PS)-linked nucleic acids were evaluated. PS modified 5C−i-Motif sequences showed a pH transition of 6.83 (±0.023) and FWHM of 0.919 pH units. A shift in i-Motif pKa for the PS modification was not substantial. It was desirable to designing an i-Motif that can switch from a duplexed state at neutral pH into a folded single stranded state at acidic conditions. To create such a structure-switching i-Motif, the initial duplex should be stable at neutral pH and at 37 °C. Upon acidification, the duplex then denatures. It is desirable for the i-Motifs to fold into their tertiary structure and display stability at the acidic pH. The process is spontaneous under acidic conditions and highly unfavorable at neutral pH. Multiple i-Motif duplex sequences were screened. A fluorescence quencher in proximity to the Cy3B fluorophore allowed for fluorescence reporting of duplex denaturation. Additionally, intentional base pair mismatches were implemented to prevent the formation of the G quadruplex, which can hinder duplex formation or downstream application. Duplexes were designed with similar melting temperature (TM) so that thermal stability did not mask pH responsivity, while maintaining stability at 37 °C. the fluorescence increase as a function of pH was measured for the i-Motif library, exploring the C-tract density as well as the number of C-arrays that remained unbound by the duplex as an overhang (Figure 3B). Screen conditions and kinetics were optimized to reduce nonspecific release due to temperature or incubation duration. As the overhang length increased, the pKa slightly increased, as indicated by a shift in % release toward more neutral pH values, although this was not significant. Further, a significant increase in pKa was observed with increasing C-tract length from three to five. A two-way ANOVA was conducted to quantify trends from overhang length as well as C-tract length for this screen. With these two trends, it was found that the optimal candidate for the i-Motif duplex trigger was the combination of the five C tract length i-Motif and two array overhangs, which is termed the i-Motif 5C-5CD2 duplex. A representative structure of an oligonucleotide conjugated to Aurein1.2, which is an antimicrobial peptide is shown in Figure 4A. One challenge with using EEPs is that positively charged amino acids can nonspecifically interact with the negatively charged DNA backbone. To address this potential problem, a small screen of short amphipathic EEP-DNA conjugates was conducted to explore the activity of other EEPs in comparison to that of Aurein1.2. Overall, it was found that the conjugation of EEPs to DNA significantly increased cellular uptake in HeLa cells, as measured by flow cytometry, where the Cy3 signal associated with the conjugate was quantified (Fig. 4B). Additionally, to confirm that the conjugates were entering cells, confocal microscopy visualized the uptake process and revealed that in addition to increased Cy3 fluorescence signal from each cell, the EEP-DNA fluorescence was more evenly distributed across the cell, suggesting endosomal escape rather than general membrane association. Furthermore, EEP orientation also influences cellular uptake as N-modified Aurein1.2 significantly improved uptake in HeLa cells, whereas C-modified Aurein1.2 did not significantly improve uptake compared to the nonmodified oligonucleotides. To further understand how EEP orientation affects cellular uptake, AlphaFold2 was utilized to predict the terminally modified Aurein1.2 structures and found that the C-modified Aurein1.2 has more hydrophobic residues exposed at the non-DNA-conjugated end, while the N- modified Aurein1.2 exposure is more hydrophilic. As the N-modified Aurein1.2-DNA conjugate showed the highest level of HeLa cell uptake as indicated by flow cytometry and confocal microscopy, EEP will refer to N-modified Aurein1.2 from here on unless otherwise noted. The ability of the i-Motif DNA-EEP conjugate to function on a SNA was explored. First, the effect of EEP conjugation to DNA in the i-Motif pH response was tested. The i-Motif 5CD2 with terminal Iowa Black quencher was hybridized to the EEP conjugated to its counterpart with an internal Cy3 (Figure 5A). Through FRET, Cy3 fluorescence is quenched when i-Motif 5CD2 is hybridized. Upon acidification, i-Motif 5CD2 folded and then released the N-terminal Aurein1.2 conjugated complement, dequenching the Cy3 fluorescence signal. The double-stranded duplex maintains its response to acidification in the presence of the EEP. This shows that the electrostatic interaction between the EEP and DNA does not significantly alter the pH response. Similarly, the i-Motif function was tested on a spherical nucleic acid. The i- Motif was anchored to a gold nanoparticle core through a thiol−gold interaction (Figure 5C). This i-Motif anchor was hybridized to the 5CD2 oligo modified with an internal Cy3 as well as a N-modified Aurein1.2 EEP oriented toward the AuNP core. Each AuNP contained 164.9 (±5.6) i-Motif anchor strands and 91.7 (±9.4) complement strands as measured by OliGreenTMand Cy3 reporter assays. Note that less than 100% hybridization efficiency is expected with dsDNA-SNAs and that the highest hybridization efficiency is achieved using the freeze method to synthesize SNAs, which was utilized. Through nanometal surface energy transfer (NSET), the Cy3 was quenched when DELVR was fully intact at neutral pH; however, once acidification occurs, the complement is released, allowing Cy3 to recover fluorescence. When testing the release on the gold core, pH responsivity was maintained, but the total amount of oligo released was reduced by 36% when compared to that of the soluble duplex. This suggests that the EEP may interact with the gold core, hindering full release. Another potential complication pertains to the molecularly crowded cellular environment that could hinder the i-Motif duplex release. To emulate this environment, experiments were designed to determine how PEG-8K at densities ranging from 5% to 20% mass / mass impacted the pKa and % release of oligonucleotides from the AuNP. The 20% PEG-8k concentration led to a small, less than 10% shift in pKa of the i-Motif duplex and % release. This suggests that the cell environment will slightly alter the DELVR pH response. DELVR pH response using HIF1a-targeting ASO Hypoxia inducible factor 1a (HIF1a) is upregulated in hypoxic tissues, often associated with solid tumor-forming cancers. The activity of this HIF1a-targeting ASO in HeLa cells was confirmed by measuring HIF1a mRNA expression using RT-qPCR with 18S as a housekeeping gene. The ASO is potent when delivered using OligofectamineTMtransfection agent (EC50 about 10 nM) providing a concentration-dependent response, indicating that the drug can target HIF1a. As DELVR includes direct hybridization to the i-Motif anchor, experiments were performed to determine whether the binding region effects the ASO efficacy. HeLa cells were incubated with 5 nM DELVR containing EEPs or 5 nM DELVR without EEPs for 4, 8, or 16 h. These cells were fixed, permeabilized, and antibody stained to label early endosomes (EEA1), late endosomes / lysosomes (LAMP1), and nuclei (DAPI). Images (Z stack confocal) were collected for multiple fluorescent channels to reduce imaging bias and enable quantification of colocalization. It was hypothesized that both groups would have similar colocalization with EEA1, while a difference in LAMP1 colocalization would indicate effective endosomal escape, as DELVR is pH-responsive to values found in late endosomes or lysosomes. Qualitatively, the DELVR-EEP Cy3 signal appears more confluent in both the 4 h and 8 h incubation compared to DELVR without EEP. Further, Cy3 signal from DELVR without EEP appears punctate in both the 4 h incubation and 8 h incubation with additional localization around the nuclear edge. The two DELVR groups shared similar LAMP1 M2 values at 4 h; however, after 8 h incubation, colocalization of DELVR-EEP with LAMP1 decreased, while DELVR without EEP slightly increased. This shows that EEP enables DELVR to escape from endosomal vesicles, rescuing the construct from lysosomal degradation. After 16 h, LAMP1 colocalization decreases for both groups, indicating nonspecific leakage and / or degradation of DNA, with DELVR-EEP having the lowest colocalization value. Studying EEA1 colocalization, indicated that both DELVR-EEP and DELVR without EEP share similar M2 values at 4, 8, and 16 h of incubation, suggesting that DELVR is not responsive to early endosomal conditions. Having confirmed that ASO was active, experiments were performed to determine whether DELVR could enhance efficacy. Given the highly acidic and nucleolytic environment of endosomes, two nonexclusive mechanisms for ASO activation were contemplated: pH-driven and nuclease-driven. Accordingly, DELVR constructs were designed to explore these mechanisms of action. Note that the pH sensitive anchor strand complement was fully PS modified and contained LNA modifications to reduce nuclease activity. The pH DELVR construct used a PS modification to diminish nuclease- driven release of the ASO, while maintaining pH activity. In contrast, the nuclease DELVR contained a PO backbone but lacked the i-Motif sequence and hence primarily released due to nuclease action. The nonspecific DELVR had a PS backbone and lacked the i-Motif and thus served as a control. Finally, the synergistic DELVR contained both PO backbone and i-Motif PS modifications addressing both DNase and pH inputs, i.e., +T*+G*+G*C*A*A*G*C*A*T*C*C*+T*+G*+T*AGTGTGATTGGGGGACGTTTTCTA (SEQ ID NO: 21) wherein “+” refers to locked nucleic acid,“*” refers to phosphorothioate. When we incubated 100 nM of the four DELVR constructs with HeLa cells for 24 h, the synergistic DELVR showed a significant improvement in HIF1a knockdown compared to the three other groups. This confirms the optimal design for DELVR and indicates that the mechanism of action functions through a combination of both nuclease and pH activity. Moreover, to confirm that DELVR is an effective endosomal escape platform, HeLa cell uptake was quantified through flow cytometry, measured using ATTO647N fluorescence. To ensure that DELVR constructs remain intact and mean fluorescence intensity (MFI) was proportional to HeLa cell uptake, HeLa cells were briefly incubated with the four DELVR constructs for 1 h. The pH and synergistic DELVR constructs had the lowest cellular uptake, while the nuclease and nonspecific DELVR constructs were highest. By normalizing cellular uptake to antisense knockdown activity, it was identified that the pH-sensitive DELVR constructs (pH and synergistic constructs) were the most efficient antisense and endosomal escape therapeutics, validating DELVR as a delivery platform. The dose dependent response of DELVR was measured and show that DELVR using spherical nucleic acids (SNAs) is efficacious with an EC50 of 54.2 nM (Figure 6C). DELVR significantly outperforms the clinically tested drug, which is bare ASO in solution, and is comparable to the activity of ASO delivered by transfection agents (OligofectamineTM, OFA), which cannot be used in vivo due to toxicity. The superior activity of DELVR (ASO-SNA EEP) is demonstrated when measuring HIF1a knockdown efficacy compared to that of ASO-EEP (no AuNP) as well as ASO- SNA (no EEP) conditions, which are not as effective. Fluorescence lifetime imaging microscopy (FLIM) was conducted to visualize and quantify the DELVR in vitro. FLIM, compared to other fluorescence imaging techniques, provides a unique advantage for nucleic acids and nanomedicine, as fluorescence lifetime is a concentration independent property of fluorophores that is dependent on its local environment. A pulsed laser was employed to collect an accumulation of lifetime events from the sample based on emitted photons. Utilizing NSET quenching interactions between ATTO532 and the AuNP, ATTO532 exhibits a short lifetime when bound within DELVR and a longer lifetime when released off the AuNP (Figure 7). To quantify this interaction, intact synergistic DELVR constructs, ATTO532- conjugated 5CD2 DNA, and free ATTO532 dye were measured in 1× PBS buffer and found to have average lifetimes of 1.73 (±0.52), 3.26 (±0.22), and 3.80 (±0.05) ns. This agrees with standard ATTO532 dye measurements provided by the manufacturer. The decay profile further corroborates this finding, as a longer shift in lifetime decay was also observed. To confirm the sensitivity of the FLIM measurement, unbound ATTO532-DNA was also titrated into a solution containing 0.5 nM DELVR to show that the lifetime increased as the ratio of unbound DNA to bound DELVR DNA increased. As ATTO532 lifetime significantly increases once released off each DELVR, each DELVR construct was incubated in HeLa cells for various lengths from 30 min to 24 h to visualize cellular release profiles. Indeed, the shortest incubation times also exhibited the shortest lifetimes, quantified using a biexponential reconvolution decay model. This indicates that each of the DELVR constructs is intact when entering cells and degrades over time as represented by the shift toward longer lifetimes. After an 8 h incubation within HeLa cells, the synergistic DELVR had a significantly longer lifetime (τAVG = 2.97 ± 0.16 ns) compared to the nuclease DELVR (τAVG = 2.43 ± 0.10 ns), pH DELVR (τAVG = 1.92 ± 0.46 ns), and nonspecific DELVR (τAVG = 2.06 ± 0.31 ns) constructs, indicating a more rapid release of the SNA. Interestingly, the pH and nonspecific DELVRs have the slowest release rates, likely stemming from the PS modified backbone enhancing nuclease resistance. It is contemplated that one explanation for rapid release of synergistic DELVR may be that it follows a sequential two-part release with an initial nuclease- driven release followed by acid-responsive i-Motif release to enhance delivery. Additionally, a nuclear stain showed that the fluorescent signal was generated outside of the nuclear region, suggesting cytoplasmic delivery. This is further supported as longer incubation times display more confluent fluorescence rather than sparse and punctate distribution as found within endosomes. Furthermore, the synergistic DELVR construct had the fastest release within cells with a half-life of 10.01 h−1, compared to pH (t1 / 2 = 22.83 h−1), nuclease (t1 / 2 = 15.26 h−1), and nonspecific release (t1 / 2 = 15.65 h−1) DELVRs, suggesting a potential explanation for the enhancement in knockdown efficacy compared to other constructs. Synthesis of 15 nm Gold Nanoparticles A 250 mL two-neck round-bottom boiling flask with a stir bar was prepared by adding aqua regia (3:1 HCl to HNO3) and mixing within the flask for 1 min. Aqua regia was discarded, and the flask was rinsed at least 15 times with water. The flask was inverted and left to dry until use. A 4 mL volume of 25 mM HAuCl4 stock was diluted in 96 mL of H2O and was added to the two-neck round-bottom flask. A condenser was attached to one neck, and the other neck was covered with foil. The flask was placed over a water bath, stirred vigorously at 400 rpm, and boiled using a hot plate. Once boiling, 10 mL of 38.8 mM sodium citrate tribasic was swiftly injected into the flask and refluxed for 15 min. The flask was removed and quickly placed onto ice until cooled. The solution was concentrated by removing the supernatant via centrifugation at 13,000g for 30 min and stored at 4 °C until further use. The extinction coefficient is dependent on the AuNP size, as determined by TEM. DNA Functionalization of Gold Nanoparticles Gold nanoparticles were functionalized with DNA following the freeze method. Thiolated DNA and its complement were added in 300- fold excess to 15 nm gold nanoparticles and frozen at −30 °C for at least 1 h. Immediately after freezer removal, 10× PBS was added to create a final concentration of 1× PBS and was thawed for 30 min. Following the thaw, the solution was brought up to 500 μL using 1× PBS before being centrifuged at 13,000g for 20 min at RT. Unbound DNA was removed via aspiration, and the gold nanoparticle solution was washed and centrifuged a total of three times. DNA-functionalized gold nanoparticles (spherical nucleic acids) were stored at 4 °C for up to 1 week until use. Before experimentation, the concentration was determined through UV−vis spectroscopy by measuring the peak absorbance (527 nm) and using Beer−Lambert’s law. Synthesis of Dye-Functionalized DNA Amine-modified DNA was functionalized to NHS ester modified dye (Cy3B, ATTO532, ATTO647N) via NHS ester amine chemistry. A 50 μg aliquot of NHS ester dye was suspended in 1 μL of fresh DMSO. A 1 μL volume of 10× PBS, 1 μL of 1 M NaHCO3, and 7 μL of 1 mM DNA were combined. Then, dye was added to the DNA solution and left to react for 1 h. The reaction was quenched with the addition of 1× TBS and run through a P-2 gel to remove excess unreacted dye. Product was purified through reverse-phase HPLC with an Agilent AdvanceBioTMOligonucleotide C18 column and eluted in solvents A (0.1 M TEAA in H2O) and B (acetonitrile (ACN)). Product was eluted with a linear gradient of 10−27.5% solvent B over 35 min at 60°C. Product was concentrated and confirmed using electron spray ionization mass spectrometry. Synthesis of Azide-Functionalized DNA Amine-modified DNA was functionalized with an azide group via NHS ester amine chemistry. This procedure was conducted for both phosphodiester and phosphorothioate DNA. A 2 μL volume of 1 M NaHCO3 was added to 2 μL of 10× PBS. A 10 μL portion of 1 mM amine- modified DNA was added to the solution. An excess of azidoacetic acid NHS ester (1 mg) was prepared in 25 μL of DMSO and was added to begin the reaction. The reaction was left for 1 h at room temperature and quenched with addition of 1× TBS. The product was purified using reverse- phase HPLC and eluted in solvents A (0.1 M TEAA in H2O) and B (ACN). Product was eluted with a linear gradient of 10−27.5% solvent B over 35 min at 60 °C. Recovered product was concentrated and confirmed via electron spray ionization mass spectrometry. Copper Click Cycloaddition of Endosomal Escape Peptides to DNA Azide-modified DNA was functionalized to endosomal escape peptides through copper click cycloaddition. A 10 μL amount of 20 mM CuSO4, 30 μL of 50 mM THPTA, and 10 μL of TEA were combined and left at room temperature for 5 min. In a separate tube, 100 μg of EEP was dissolved in 38.5 μL of DMSO and was added to 10 μL of 1 mM DNA. After a brief incubation, 2.5 μL of 100 mM sodium ascorbate was added to the CuSO4−THPTA solution. Both tubes were combined and incubated at 50 °C for 1 h. To quench the reaction, 50 μL of EDTA was added and the product was purified using reverse-phase HPLC C18 column and eluted in solvents A (0.1 M TEAA in H2O), B (ACN), and C (50 mM EDTA, 10% MeOH). For phosphodiester backbone DNA, the product was eluted using a linear gradient of 10− 40% solvent B over 30 min at RT. For phosphorothioate-modified DNA, the column was equilibrated with 100% solvent C, and the product was eluted in 100% solvent C for 12.5 min before transitioning to a linear gradient of 90% solvent A with 10−35% solvent B over 30 min at RT. Recovered product was concentrated and confirmed via electron spray ionization mass spectrometry.

Claims

CLAIMS What is claimed is:

1. A double stranded therapeutic oligonucleotide endosomal escape peptide conjugate comprising a pH sensitive polynucleotide strand and a therapeutic polynucleotide strand; wherein the pH sensitive polynucleotide strand comprises a polynucleotide motif sequence that folds providing a folded state when exposed to an aqueous pH below 6 and unfolds when exposed to an aqueous pH above 6 providing an unfolded state; wherein the pH sensitive polynucleotide strand comprises a sequence that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds the segment of the pH sensitive polynucleotide stand; wherein the therapeutic polynucleotide strand comprises a nucleotide sequence that binds an in vivo target; and wherein the therapeutic polynucleotide strand is conjugated to an endosomal escape peptide (EEP).

2. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 1 wherein the sequence in the pH sensitive polynucleotide strand that base pairs and binds to a segment of the therapeutic polynucleotide strand when the pH sensitive polynucleotide is in an unfolded state comprises the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1).

3. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 1 wherein the endosomal escape peptide (EEP) comprises a GLFDIIKKIAESF (SEQ ID NO: 2).

4. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 3 wherein the endosomal escape peptide (EEP) having GLFDIIKKIAESF (SEQ ID NO: 2)is conjugated through the N-terminal G to the 3’ end of the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1).

5. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate claim 3 wherein the nucleotide sequence that binds an in vivo target nucleic acid is conjugated to the 5’ end of the polynucleotide sequence GTGTGATTGGGGGACGT (SEQ ID NO: 1).

6. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 3 wherein the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCC (SEQ ID NO: 3).

7. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 6 wherein the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCCAATCCCCC (SEQ ID NO: 4).

8. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 7 wherein the pH sensitive polynucleotide strand comprises the polynucleotide sequence AACGTCCCCCAATCCCCCAATCCCCCAATCCCCC (SEQ ID NO: 5).

9. The double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of claim 7 wherein the nucleotide sequence that binds an in vivo target is TGGCAAGCATCCTGTA (SEQ ID NO: 6, HIF-1-a ASO), GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 7, mipomersen), TCTTGGTTAACATGAAATCCC (SEQ ID NO: 8, inotersen), CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 9, eteplirsen). GTTGCCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 10, golodirsen) TCACTTTCATAATGCTGG (SEQ ID NO: 11, nusinersen) CGGAATCAGTGAATGCTTATACATTCG (SEQ ID NO: 12, pegaptanib) GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO: 13, fomivirsen), CCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 14, viltolarsen), CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 16, casimersen),GGTTGGATTGGTTGG (SEQ ID NO: 17 defibrotide aptamer), and / or GGTTGGATCGGTTGG (SEQ ID NO: 18, defibrotide aptamer).

10. A particle coated with or comprising the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of any of claims 1-9.

11. The particle of claim 10 wherein the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate is conjugated to the particle through the pH sensitive polynucleotide strand.

12. The particle of claim 10 wherein the double stranded therapeutic oligonucleotide endosomal escape peptide conjugate is conjugated through the 5’ end of the pH sensitive polynucleotide strand.

13. The particle of any of claims 10-12, wherein the particle is a gold nanoparticle.

14. The particle of any of claims 10-12, wherein the particle is a nanodisc.

15. The particle of any of claims 10-12, wherein the therapeutic polynucleotide strand comprises an antisense sequence, gapmer sequence, splice switching oligonucleotide, or aptamer sequence.

16. The particle of any of claims 10-12, wherein the therapeutic polynucleotide strand is conjugated to a small molecule or peptide based therapeutic agent.

17. A method of treating or preventing a disease or conditions comprising administering an effective amount of a double stranded therapeutic oligonucleotide endosomal escape peptide conjugate of any of claims 1-9 or a particle of claims 10-16, to a subject in need thereof.

Citation Information

Patent Citations

  • Methods and compositions for determining ph

    US20180245137A1

  • Endosomal escape peptides

    US20180312542A1

  • Transferrin receptor targeting peptide oligonucleotide complexes and methods of use thereof

    WO2023023031A2