Novel promoter and use thereof

The introduction of the cj7.7, cj7.8, and cj7.9 promoters addresses the need for universal high-expression efficiency in microorganisms, enhancing gene expression and product formation across different species.

WO2025116387A1PCT designated stage expired Publication Date: 2025-06-05CJ CHEILJEDANG CORP
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/018165
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-27
Filing Date
2024-11-18
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

There is a need for a high-expression efficiency system that can be used across various microorganisms, such as Escherichia, Corynebacterium, and Bacillus, as existing promoters are specific and do not offer universal applicability.

Method used

The development of a novel polynucleotide sequence with promoter activity, designated as the cj7.7, cj7.8, and cj7.9 promoters, which can be used to increase the expression and activity of genes in microorganisms, thereby serving as a universal promoter for efficient production of target products.

Benefits of technology

The novel promoters significantly enhance gene expression and product formation in various microorganisms, demonstrating their effectiveness as universal promoters for the production of amino acids and other valuable substances.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024018165_05062025_PF_FP_ABST
    Figure KR2024018165_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present application relates to a novel promoter and a method for producing a target product using same. A polynucleotide of the present application has promoter activity, can efficiently regulate the expression and activity of a target gene in a microorganism, and can be useful for efficiently producing a target product.
Need to check novelty before this filing date? Find Prior Art

Description

Novel promoters and their uses

[0001] The present application relates to a novel promoter and a method for producing a target product using the same.

[0002]

[0003] Efforts to utilize microorganisms to produce high-titer target substances, such as amino acids or other useful substances for various applications such as feed, pharmaceuticals, and food, through genetic manipulation and / or the introduction of exogenous genes into biosynthetic pathways have been ongoing (US 9109242 B2). One such method involves inducing overexpression of target genes in microorganisms, which requires a highly efficient gene expression system. Since the promoter is one of the most crucial elements in gene expression systems, the development of a useful promoter is essential.

[0004] The tac promoter derived from Escherichia coli is widely known as a strong promoter, and in the case of coryneform microorganisms, strong promoters have been developed by modifying the promoters of their own genes (Gene, 102, 93-98, 1991; Microbiology, 142, 1297-1309, 1996). On the other hand, the general structure of the promoter sequence for gene expression in coryneform microorganisms is unknown, unlike that of other industrial microorganisms such as E. coli or Bacillus subtilis. Therefore, promoters have been developed by removing the promoter portion of an antibiotic resistance gene such as chloramphenicol, introducing chromosomal DNA isolated from coryneform microorganisms after digestion with an appropriate restriction enzyme, and then transforming coryneform microorganisms with this promoter and measuring the antibiotic resistance of the resulting strain. In addition, various promoters have been explored to overexpress foreign genes in Bacillus microorganisms, and these promoters are being used to produce enzymes for food, pharmaceutical, and other industrial purposes. Many vector systems using promoters for the expression of alpha-amylase, protease, and lipase genes from various Bacillus genus microorganisms are still being developed to this day (Schumann 2007. Adv. Appl. Microbiol. 153:813-821).

[0005] However, there is still a need for a system that exhibits high expression efficiency in various microorganisms, such as microorganisms of the genus Escherichia, microorganisms of the genus Corynebacterium, or microorganisms of the genus Bacillus, and thus the need for the development of a universal promoter is still emerging.

[0006]

[0007] The present inventors have completed the present application by confirming that a novel promoter can be introduced into a microorganism and increase the expression and activity of a gene operably linked thereto, and that it can be used as a universal promoter rather than a promoter limited to a specific gene, thereby being useful in efficiently producing a target product influenced by the promoter and gene.

[0008]

[0009] One object of the present application is to provide a polynucleotide having promoter activity, comprising any one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 3.

[0010] Another object of the present application is to provide an expression cassette comprising the polynucleotide and a target gene.

[0011] Another object of the present application is to provide a microorganism comprising the polynucleotide or expression cassette.

[0012] Another object of the present application is to provide a method for producing a target product, comprising a step of culturing the microorganism in a medium.

[0013]

[0014] The novel promoter of the present application can increase the expression and activity of a gene introduced into a microorganism and operably linked thereto, and can be used as a general promoter rather than a promoter limited to a specific gene, so that it can be usefully utilized to efficiently produce a target product influenced by the promoter and gene.

[0015]

[0016] FIG. 1 is a graph showing green fluorescence intensity in a mutant strain comprising a cj7 promoter variant operably linked to a green fluorescent protein gene according to one embodiment.

[0017]

[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0019] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments of the present application described herein. Furthermore, such equivalents are intended to be encompassed by this application.

[0020]

[0021] One aspect of the present application provides a polynucleotide having promoter activity, comprising any one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 3.

[0022]

[0023] In this application, the term "polynucleotide" is a polymer of nucleotides in which nucleotide units (monomers) are linked in a long chain shape by covalent bonds, and is a DNA strand of a certain length or longer.

[0024] As used herein, the term "promoter" refers to a DNA region upstream of a coding region that contains a binding site for polymerase and has transcription initiation activity into mRNA of a target gene of the promoter, i.e., a DNA region to which a polymerase binds to initiate transcription of the gene. The promoter may be located 5' to the mRNA transcription initiation site.

[0025] In the present application, the term "polynucleotide having promoter activity" means a DNA region present near a transcription site of a target gene, which includes a site where RNA polymerase or an enhancer binds for expression of a gene operably linked thereto, i.e., a target gene. For the purpose of the present application, the polynucleotide may be used as a universal promoter, and the polynucleotide may regulate (e.g., increase or decrease) the expression of a target gene operably linked thereto, the production and / or activity of a protein encoded by the target gene, compared to an existing promoter or a cell-endogenous promoter in a cell, and may regulate (e.g., increase or decrease) the production and / or activity of a target product (e.g., one or more selected from the group consisting of a biologically active substance, for example, an amino acid, a nucleic acid, a vitamin, a protein, a fatty acid, an organic acid, etc.) involved in the production of the target gene, but is not limited thereto. The above amino acids, nucleic acids, vitamins, proteins, fatty acids or organic acids also include, but are not limited to, their metabolites, their precursors or their derivatives.

[0026]

[0027] The polynucleotide of the present application may include, without limitation, any polynucleotide sequence having promoter activity.

[0028] In the present application, a polynucleotide having promoter activity comprising a polynucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3 may be referred to as a “polynucleotide” or as “cj7.7 promoter (SEQ ID NO: 1)”, “cj7.8 promoter (SEQ ID NO: 2)”, or “cj7.9 promoter (SEQ ID NO: 3)”, respectively, and all of the above-described terms may be used in the present application.

[0029]

[0030] The polynucleotide may have any one polynucleotide sequence selected from SEQ ID NOs: 1 to 3, may include any one polynucleotide sequence selected from SEQ ID NOs: 1 to 3, may be essentially composed of any one polynucleotide sequence selected from SEQ ID NOs: 1 to 3, or may be composed of any one polynucleotide sequence selected from SEQ ID NOs: 1 to 3.

[0031] Even if the present application describes a "polynucleotide having a nucleotide sequence described by a specific sequence number" or a "polynucleotide comprising a nucleotide sequence described by a specific sequence number", it is obvious that a polynucleotide having a nucleotide sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application if it has the same or corresponding activity as a polynucleotide composed of the nucleotide sequence of the corresponding sequence number. For example, if it has the same or corresponding activity as the above polynucleotide, it does not exclude meaningless sequence additions before and after the nucleotide sequence of the corresponding sequence number, mutations that may occur naturally, or silent mutations thereof, and it is obvious that even if it has such sequence additions or mutations, it falls within the scope of the present application.

[0032] The polynucleotide provided in the present application may include a polynucleotide sequence of SEQ ID NO: 1, 2, or 3, which may mean (a) a polynucleotide comprising or essentially comprising a polynucleotide sequence of SEQ ID NO: 1, 2, or 3, or a polynucleotide sequence complementary thereto, and / or (b) a polynucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the polynucleotide sequence of SEQ ID NO: 1, 2, or 3, or a polynucleotide sequence complementary thereto, and which maintains the original function and / or the desired function of the polynucleotide.

[0033] For example, the original function and / or the intended function of the polynucleotide may be a function as a promoter. The polynucleotide 'functions as a promoter and includes a polynucleotide sequence of SEQ ID NO: 1, 2, or 3' may mean that when the polynucleotide is operably linked to a target gene as a promoter and used, mutations such as additions, deletions, and / or substitutions of nucleotides that may occur during the process of linking to the target gene, such as using a restriction enzyme, may be induced (introduced) to the polynucleotide sequence of SEQ ID NO: 1, 2, or 3, without limitation. In addition, the polynucleotide comprising the polynucleotide sequence of SEQ ID NO: 1, 2, or 3 and having a promoter function may include, without limitation, all polynucleotides that hybridize under stringent conditions with all or part of the polynucleotide sequence of SEQ ID NO: 1, 2, or 3 or a complementary sequence thereof and have promoter activity. Sequence numbers 1 to 3 having the above promoter activity may be mutant promoters of the Pcj7 promoter with enhanced promoter activity compared to the known promoter, the Pcj7 promoter of sequence number 4 (US 7662943 B2).

[0034] Additionally, the polynucleotides provided in the present application may be natural or non-natural, and may be, for example, non-naturally synthesized chemically or recombinantly.

[0035] In this application, homology and identity refer to the degree of relatedness between two given base sequences and can be expressed as a percentage.

[0036] The terms homology and identity are often used interchangeably.

[0037] Sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or the entire length of the sequence. Polynucleotides containing degenerate codons in place of codons in the hybridizing polynucleotides are also contemplated.

[0038] Whether any two polynucleotide sequences are homologous, similar, or identical can be determined using known computer algorithms such as the "FASTA" program with default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be used. (including the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, BLAST from the National Center for Biotechnology Information database, or ClustalW can be used to determine homology, similarity, or identity.

[0039] Homology, similarity, or identity of polynucleotides can be determined by comparing sequence information, for example, using the GAP computer program, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or, for example, Needleman et al. (1970), J Mol Biol. 48: 443. In brief, the GAP program defines the GAP as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a unary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a univariate comparison matrix, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), as disclosed in Gribskov et al. (1986) Nucl. Acids Res. 48: 443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps. Accordingly, as used herein, the term "homology" or "identity" refers to the relevance between sequences.

[0040]

[0041] Additionally, probes that can be prepared from known genetic sequences, for example, polynucleotide sequences that hybridize under stringent conditions and have the same activity as all or part of the aforementioned polynucleotide sequences, can be included without limitation. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., supra). For example, the conditions for hybridizing genes with high homology or identity, genes with 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, even more specifically 97% or more, and particularly specifically 99% or more, and not hybridizing genes with lower homology or identity than that, or washing conditions for once, specifically two to three times, at a salt concentration and temperature equivalent to 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, and more specifically 68°C, 0.1XSSC, 0.1% SDS, which are washing conditions for typical southern hybridization, can be listed.

[0042] Hybridization requires that two polynucleotides have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the present application may also encompass isolated polynucleotide fragments that are complementary in their entirety, as well as substantially similar polynucleotide sequences.

[0043] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0044] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0045]

[0046] The polynucleotide having the promoter activity of the present application can be used as a promoter.

[0047] The above promoter may be located at the 5' end of the transcription start site into mRNA.

[0048] The above promoter may have increased or decreased promoter activity compared to conventional promoters. That is, it may increase or decrease not only the expression of the target gene in the host cell, but also the expression and / or activity of the protein encoded by the target gene. For the purposes of the present application, the target gene for enhanced or weakened expression may be modified depending on the product to be produced, and the above promoter may be used as a general-purpose promoter for enhanced or weakened expression of the target gene.

[0049]

[0050] The above "target gene" refers to a gene whose expression is to be controlled by the promoter sequence of the present application for the purposes of the present application. The protein encoded by the target gene may be referred to as the "target protein," and the gene encoding the "target protein" may be referred to as the "target gene."

[0051] The above target gene can be used without limitation as long as it is a gene whose expression is controlled by the promoter sequence of the present application, and may be a foreign gene.

[0052] The above "foreign gene" refers to a gene that is non-native (non-natural) and included in a microorganism. For example, it may be (a) a gene that cannot be found naturally in a microorganism (foreign or artificial), (b) a gene that can be found naturally in a microorganism (endogenous), but the transcription or translation of the gene in the microorganism results in an unnatural amount of the gene (more or less than the amount naturally present), (c) a case where the protein sequence endogenously present in the microorganism or the sequence of the gene encoding the protein is different, and / or (d) a case where two or more of the above-mentioned items are combined in the microorganism.

[0053] Additionally, a polynucleotide encoding a target protein may undergo various modifications in the coding region without altering the polypeptide sequence, either due to codon degeneracy or in consideration of codons preferred by the organism to which the polynucleotide is to be expressed. The description of the polynucleotide sequence is as described above.

[0054]

[0055] Another aspect of the present application provides the polynucleotide; an expression cassette comprising the polynucleotide and a target gene, and / or a vector comprising the polynucleotide or the expression cassette.

[0056] The term "expression cassette" as used herein refers to a unit cassette that includes a promoter and a target gene, and is capable of expressing the target gene operably linked to the promoter. Various factors that can facilitate efficient expression of the target gene may be included internally or externally in such a gene expression cassette. The gene expression cassette may typically include a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.

[0057] The term "operably linked" in this application means that a polynucleotide having promoter activity of the present application is functionally linked to the gene sequence to initiate and mediate transcription of the target gene. Operable linkages can be produced using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be produced using, but is not limited to, cleavage and ligation enzymes known in the art.

[0058] The term "vector" as used herein refers to an artificial DNA molecule that carries genetic material capable of expressing a gene of interest in a suitable host, such as a polynucleotide having promoter activity or a DNA preparation comprising additional suitable gene expression regulatory sequences. The vector may be, but is not limited to, a vector capable of integrating a polynucleotide having promoter activity into a host cell. Alternatively, the vector may be a vector comprising the gene of interest. The regulatory sequences may include an additional promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome, and may be integrated into the genome itself.

[0059] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0060] For example, a polynucleotide and / or a target gene (polynucleotide) having promoter activity can be inserted into a chromosome through a vector for intracellular chromosomal insertion. The insertion of the polynucleotide and / or the target gene (polynucleotide) into the chromosome can be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the polynucleotide and / or target gene (polynucleotide) molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, resistance to cytotoxic agents, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic characteristics, so that transformed cells can be selected.

[0061] For example, in the recombinant vector, if the target protein coding gene is a fusion gene including genes each encoding two or more proteins, all genes included in the fusion gene may be designed to be under the control of one polynucleotide (promoter), or one or more of them may be under the control of a separate polynucleotide. For example, the recombinant vector may comprise a polynucleotide having the promoter activity and one gene or two or more (e.g., two, three, four, five, six, seven, eight, nine, or ten) genes operably linked to the polynucleotide, and when it comprises two or more genes, it may comprise one polynucleotide having the promoter activity (i.e., the two or more genes are under the control of one promoter), or two or more (in this case, the polynucleotide may comprise less than or equal to the number of genes so that at least one of the two or more genes is under the control of a separate promoter), but is not limited thereto.

[0062] The term "transformation" in this application refers to introducing a vector containing a target polynucleotide (gene) into a host cell so that the polynucleotide can be expressed within the host cell. As long as the polynucleotide can be expressed within the host cell, the transformed vector can include both, whether it is integrated into the chromosome of the host cell or located extrachromosomally. Furthermore, the polynucleotide includes DNA or RNA. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0063]

[0064] In another aspect, the present application provides a microorganism comprising a polynucleotide having the promoter activity of the present application, and an expression cassette comprising the polynucleotide and a target gene.

[0065] The polynucleotide having the above promoter activity and the expression cassette are as described above.

[0066] The above expression cassette and the vector containing it can be introduced into a microorganism by transformation.

[0067] The term "microorganism" in this application encompasses both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and encompasses all microorganisms whose specific mechanisms have been weakened or strengthened due to factors such as the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene. The term "microorganism" in this application may be included without limitation as long as it is a microorganism into which a polynucleotide having the promoter activity of the present application has been introduced.

[0068]

[0069] The microorganism comprising the polynucleotide of the present application may be a microorganism that expresses a target gene using one of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3 as a promoter or has the ability to produce a target product in which the target gene is involved in production, but is not limited thereto. The microorganism may be a microorganism that naturally expresses the target gene or has the ability to produce the target product, or a microorganism that has been granted the ability to express the target gene or produce the target product to a parent strain that does not express the target gene or has the ability to produce the target product, but is not limited thereto.

[0070] The above microorganism is, for example, a cell or microorganism that expresses the target gene by being transformed with a vector containing a polynucleotide having the promoter activity of the present application and a target gene. For the purpose of the present application, the host cell or microorganism may be any microorganism that can produce the target product by including the target gene.

[0071]

[0072] In this application, the term "microorganism producing a target protein or target product" includes both wild-type microorganisms and microorganisms that have undergone genetic modification, either naturally or artificially, and may be microorganisms that have had a specific mechanism weakened or strengthened due to causes such as the insertion of an external gene or the enhancement or inactivation of the activity of an endogenous gene, and may be microorganisms that include genetic modification for the production of a target protein or product. For the purpose of this application, the microorganism producing the target protein or target product may be a microorganism characterized by having an increased ability to produce the target protein or target product by including a polynucleotide having the promoter activity of the present application. Specifically, in this application, the microorganism producing the target protein or target product, or the microorganism having the ability to produce the target protein or target product, may be a microorganism in which some of the genes in the biosynthetic pathway of the target protein or target product are strengthened or weakened, or some of the genes in the degradation pathway of the target protein or target product are strengthened or weakened.

[0073] Specifically, the microorganism of the present application may be a microorganism of the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, the genus Bacillus or the genus Brevibacterium, and specifically, may be a microorganism of the genus Corynebacterium, the genus Escherichia or the genus Bacillus, and for example, may be Corynebacterium glutamicum, Bacillus subtilis or Escherichia coli, but any microorganism in which the polynucleotide having the promoter activity of the present application can operate as a promoter is included without limitation.

[0074]

[0075] In this application, the term "target product" refers to a biologically active substance to be produced or the production of which is to be controlled (increased or decreased) using a polynucleotide provided in this application, an expression cassette comprising the polynucleotide and a target gene, a vector comprising the polynucleotide or the expression cassette, and / or a microorganism, and is a concept that includes not only the biologically active substance to be ultimately produced but also the target protein that the microorganism can produce. For example, it may refer to the target protein itself encoded by the target gene, and / or all biologically active substances produced with the participation of the target protein. The above biologically active substance means all substances produced or derived from an organism (e.g., a cell) or having a certain function in a living body or in a cell, for example, amino acids (glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, O-acetyl homoserine, etc.), nucleic acids, vitamins (vitamins A, B (B1, B2, B3, B5, B6, B7, B9, B12, etc.), C, D, E, K, etc.), proteins (the above target proteins and other proteins, for example, hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments having a target function), fusion proteins in which two or more are fused, etc.). It may be, but is not limited to, sugars (e.g., monosaccharides, disaccharides, polysaccharides, sugar alcohols, etc.), fatty acids (myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linolelaidic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.).In addition, if the substance is produced by the involvement of the target protein, it may include, in addition to the above substances, their metabolites (such as polyhydroxyalkanoates (PHAs)), their precursors, and derivatives that maintain their biological activity.

[0076] In the present application, the term "target protein" means a protein involved in the production of a biologically active substance to be produced or the production of which is to be controlled (increased or decreased) using a polynucleotide provided in the present application, an expression cassette comprising the polynucleotide and the target gene, a vector comprising the polynucleotide or the expression cassette, and / or a microorganism, and may mean, for example, the target protein itself encoded by the target gene.

[0077] For example, if the target protein is involved in the production of the target product, (1) the target protein may be at least one selected from the group consisting of proteins involved in at least one process or step of the intracellular production pathway (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular excretion pathway of the target product (e.g., amino acids, nucleic acids, vitamins, proteins other than the target protein, etc.), for example, enzymes (various synthetase, decomposition enzyme, phosphorylation enzyme, carboxylase (e.g., pyruvate carboxylase, etc.), reductase, oxidase, decarboxylase, dehydrogenase, dehydratase, transferase, epimerase, etc.), intermediate, transport protein, membrane protein (channel, etc.), but is not limited thereto, (2) a protein whose target or expression (production) is to be increased, Or, it may be a protein involved in the production of a biological substance whose production or production is to be increased. The target gene may be a gene encoding the target protein described in (1) or (2) above. For example, the target gene may be a gene encoding a protein involved in the production of a predetermined biological substance, such as an amino acid, nucleic acid, or vitamin, but is not limited thereto.

[0078] In one example, among the amino acids, the gene involved in the production of lysine may be one or more genes selected from among genes encoding proteins (e.g., enzymes) involved in lysine biosynthesis. For example, proteins involved in lysine biosynthesis include dihydrodipicolinate synthase (dapA), aspartokinase III (lysC), dihydrodipicolinate reductase (dapB), diaminopimelate decarboxylase (lysA), diaminopimelate dehydrogenase (ddh), phosphoenolpyruvate carboxylase (ppc), aspartate semialdehyde dehydrogenase (asd), aspartate transaminase (aspC), diaminopimelate epimerase (dapF), It may be at least one selected from the group consisting of tetrahydrodipicolinate succinylase (dapD), succinyl-diaminopimelate deacylase (dapE), and aspartase (aspA), but is not limited thereto.

[0079] Among the above amino acids, the gene involved in the production of threonine may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in threonine biosynthesis. For example, the protein involved in threonine biosynthesis may be one or more selected from the group consisting of aspartokinase III (lysC), aspartate semialdehyde dehydrogenase (asd), aspartokinase I (thrA), homoserine kinase (thrB), threonine synthase (thrC), and aspartate aminotransferase (AspAT / ASAT / AAT), but is not limited thereto.

[0080] Among the above amino acids, the gene involved in the production of arginine may be one or more genes selected from among genes encoding proteins (e.g., enzymes) involved in arginine biosynthesis. For example, the protein involved in arginine biosynthesis may be at least one selected from the group consisting of, but is not limited to, N-acetylglutamic acid synthetase (argA), N-acetylglutamic acid kinase (argB), N-acetylglutamyl phosphate reductase (argC), acetylornithine transaminase (argD), acetylornithine deacetylase (argE), ornithine carbamoyltransferase (argF, argI), argininosuccinate synthetase (argG), argininosuccinate lyase (argH), ornithine acetyltransferase (argJ), and carbamoyl phosphate synthetase (carAB).

[0081] Among the above amino acids, the gene involved in the production of valine may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in valine biosynthesis. For example, the protein involved in valine biosynthesis may be one or more selected from the group consisting of acetohydroxy acid isomeroreductase (IlvC), dihydroxy-acid dehydratase (IlvD), and branched-chain amino acid aminotransferase (IlvE), but is not limited thereto.

[0082] Among the above amino acids, the gene involved in the production of histidine may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in histidine biosynthesis. For example, the protein involved in histidine biosynthesis may be one or more selected from the group consisting of ATP phosphoribosyltransferase (hisG), phosphoribosyl-AMP cyclohydrolase (hisI), phosphoribosyl-ATP pyrohydrolase (hisI), phosphoribosylformimino-5-aminoimidazocarboxamidribotideisomerase (hisA), amide transferase (hisH), histidine phosphate aminotransferase (hisC), histidine phosphatase (hisB), and histidine dehydrogenase (hisD), but is not limited thereto.

[0083] Among the above amino acids, the gene involved in the production of cysteine ​​may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in cysteine ​​biosynthesis. For example, the protein involved in cysteine ​​biosynthesis may be one or more selected from the group consisting of serine acetyltransferase (cysE) and Na-3-phosphoglycerate dehydrogenase (serA), but is not limited thereto.

[0084] Among the above amino acids, the gene involved in the production of serine may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in serine biosynthesis. For example, the protein involved in serine biosynthesis may be one or more selected from the group consisting of, but not limited to, 3-phosphoglycerate dehydrogenase (serA), phosphoserine transaminase (serC), and phosphoserine phosphatase (serB).

[0085] Among the above amino acids, the gene involved in the production of glutamic acid may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in glutamic acid biosynthesis. For example, glutamate biosynthetic proteins include glutamate dehydrogenase (gdhA), glutamine synthetase (glnA), glutamate synthetase (gltBD), isocitrate dehydrogenase (icdA), aconitate hydratase (acnA, acnB), citrate synthase (gltA), methylcitrate synthase (prpC), phosphoenolpyruvate carboxylase (ppc), pyruvate carboxylase (pyc), pyruvate dehydrogenase (aceEF, lpdA), pyruvate kinase (pykA, pykF), phosphoenolpyruvate synthase (ppsA), enolase (eno), phosphoglycero mutase (pgmA, pgmI), phosphoglycerate kinase (pgk), and glyceraldehyde 3-phosphate dehydrogenase. It may be at least one selected from the group consisting of enzyme (gapA), triosephosphate isomerase (tpiA), fructose bisphosphate aldolase (fbp), phosphofructokinase (pfkA, pfkB), glucose phosphate isomerase (pgi), 6-phosphogluconic acid dehydratase (edd), 2-keto-3-deoxy-6-phosphogluconic acid aldolase (eda), and transhydrogenase, but is not limited thereto.

[0086] Among the above amino acids, the gene involved in the production of glutamine may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in glutamine biosynthesis. For example, the protein involved in glutamine biosynthesis may be one or more selected from the group consisting of glutamic acid dehydrogenase (gdhA) and glutamine synthetase (glnA), but is not limited thereto.

[0087] Among the above amino acids, the gene involved in the production of proline may be one or more genes selected from genes encoding proteins (e.g., enzymes) involved in proline biosynthesis. For example, the protein involved in proline biosynthesis may be one or more selected from the group consisting of glutamate-5-kinase (proB), γ-glutamyl-phosphate reductase, pyrroline-5-carboxylate reductase (putA), etc., but is not limited thereto.

[0088] The gene involved in the production of the above nucleic acid may be one or more genes selected from among genes encoding proteins (e.g., enzymes) involved in nucleic acid biosynthesis. For example, nucleic acid biosynthesis-related proteins include amidophosphoribosyltransferase (purF), PRA-glycine ligase (purD), phosphoribosylaminoimidazolesuccinocarboxamide synthase (purC), bifunctional AICAR formyltransferase / IMP cyclohydrolase (purH), adenylosuccinate synthase (purA), adenylosuccinate lyase (purB), phosphoribosylaminoimidazole mutase (purE), and It may be at least one selected from the group consisting of phosphoribosylaminoimidazole carboxylase (purK), but is not limited thereto.

[0089]

[0090] Another aspect of the present application provides a method for producing a target product, comprising a step of culturing the microorganism in a medium. Furthermore, the method may further comprise a step of recovering the target product from the microorganism or the medium in which it was cultured.

[0091] The above microorganisms and target products are as described above.

[0092] The term "cultivation" in this application refers to growing microorganisms under appropriately artificially controlled environmental conditions. The method for producing the desired product using the microorganism containing the polynucleotide in this application can be performed using methods widely known in the art.

[0093] In the above method, the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. At this time, the culture conditions are not particularly limited, but an appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, most specifically pH 6.8) may be adjusted using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), and an aerobic condition may be maintained by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture may be performed for about 10 to 160 hours, but is not limited thereto. The target product produced by the culture may be secreted into the medium or may remain within the cells.

[0094] In addition, the culture medium used may be used as a carbon source, including sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), fats and oils (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid), either individually or in combination, but is not limited thereto. The nitrogen source may be used as a nitrogen-containing organic compound (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea), or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), either individually or in combination, but is not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and their corresponding sodium-containing salts may be used individually or in combination as phosphorus sources, but are not limited thereto. In addition, the medium may include essential growth-promoting substances such as other metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, and vitamins.

[0095] The method for recovering the target product produced in the above-described cultivation step of the present application can be performed by collecting the target product from the culture solution using a suitable method known in the art, depending on the cultivation method. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC can be used, and the target product can be recovered from the medium or microorganism using a suitable method known in the art.

[0096] Additionally, the recovery step may include a purification process and may be performed using any suitable method known in the art. Accordingly, the recovered target product may be in purified form or a microbial fermentation broth containing the target product (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).

[0097] Additionally, for the purposes of the present application, a microorganism comprising a polynucleotide having the promoter activity of the present application is characterized by an increased production of the target product. This is because, compared to wild-type microorganisms that can produce the target product in very small amounts or not at all, the polynucleotide having the promoter activity of the present application can increase the production of the target product.

[0098]

[0099] Another aspect of the present application provides a use as a promoter of a polynucleotide comprising any one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 3.

[0100]

[0101] The present application will be described in more detail below through examples. However, these examples are intended to exemplify the present application and the scope of the present application is not limited to these examples.

[0102]

[0103] Example 1: Construction of a mutant library of a recombinant vector containing the cj7 promoter sequence.

[0104]

[0105] To discover promoters that can strongly induce gene expression in microbial strains, a mutant library was constructed based on the existing cj7 promoter (SEQ ID NO: 4: US 7662943 B2), which is known to exhibit strong activity.

[0106] First, to amplify the cj7 promoter, an expression vector pCES208-Pcj7-GFP was constructed, in which a nucleic acid molecule in which the cj7 promoter (SEQ ID NO: 4) and green fluorescent protein (GFP) are operably linked was inserted into pCES208 (J. Microbiol. Biotechnol. 18:639-647, 2008), an E. coli-Corynebacterium shuttle vector. Specifically, PCR was performed using primers of SEQ ID NOs: 5 and 6 using p117-cj7-gfp (US 7662943 B2) as a template. The cj7-GFP fragment obtained from the PCR was fusion cloned into the pCES208 vector using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pCES208-Pcj7-GFP. A mutant library was constructed using pCES208-Pcj7-GFP as a template.

[0107] The library was constructed using an error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit). PCR was performed using primers of SEQ ID NOs: 7 and 8 under conditions where mutations could occur. The conditions for generating one mutation per 1000 bp were as follows: preheating at 94°C for 30 s with 40 μM (final rxn) dGTP and no MnSO4 (8 mM), followed by 25 cycles of 94°C for 30 s and 68°C for 1 min. The PCR product obtained at this time was subjected to 25 cycles of denaturation at 95°C for 50 seconds, annealing at 60°C for 50 seconds, and extension at 68°C for 12 minutes using a mega primer (500-125 ng), followed by DpnI treatment, and transformed into Corynebacterium glutamicum ATCC13032 strain to produce a recombinant vector mutant library (pCES208_Pcj7(library)-gfp).

[0108]

[0109] Example 2: Evaluation of the green fluorescent protein (GFP) expression induction activity of a recombinant vector in Corynebacterium glutamicum

[0110]

[0111] To evaluate the activity of the recombinant vector mutant library produced in Example 1 above, GFP expression in the recombinant strain into which the vector was introduced was compared.

[0112] In the above Example 1, the transformed strain was first selected by exposing it to ultraviolet light to obtain a strain that fluoresces. Next, promoter activity was quantitatively measured for the second selection. Specifically, Corynebacterium glutamicum ATCC13032, into which the recombinant vector pCES208_Pcj7(library)-gfp had been introduced, was cultured, and cells were obtained by centrifugation. Next, the harvested cells were suspended in a protein extraction buffer (1 mM EDTA, 3% glycerol, 1% Triton-X-100 solution in PBS, pH-7.5) and sonicated to disrupt the cells. The cell lysate was centrifuged, and the supernatant containing the cell extract was collected. The protein amount of the obtained cell extract was measured by the Bradford assay. Next, the same amount of cell extract was irradiated with excitation light at 488 nm using the method of Laure Gory et al. (FEMS Microbiology Letters 194, 127-133, 2001), and the fluorescence sensitivity was measured using an LS-50B spectrophotometer (Perkin-Elmer) for the emission light at 511 nm, thereby evaluating the expression level of the GFP gene.

[0113] Ten mutants whose GFP expression was about 5 to 9 times or about 7 to 9 times higher than that of the cj7 promoter were selected, and the expression level of the GFP gene in these mutants was measured by fluorescence sensitivity. The results are shown in Fig. 1. Among these, the top three mutants with high GFP expression, M2, M7, and M9, were selected, and their green fluorescence intensities are shown in Table 1. These mutant promoters were named cj7.7, cj7.8, and cj7.9, respectively, and their sequences were analyzed and shown in Table 2.

[0114] Strain name Promoter Fluorescence sensitivity Relative fluorescence sensitivity ATCC13032 / pCES208 Intrinsic promoter 0-ATCC13032 / pCES208_Pcj7_gfpcj74269100% ATCC13032 / pCES208_Pcj7.7_gfpcj7.731504738% ATCC13032 / pCES208_Pcj7.8_gfpcj7.834839816% ATCC13032 / pCES208_Pcj7.9_gfpcj7.939868934%

[0115] 프로모터핵산 서열 (5'→3')서열번호cj7.7AGAAACATCCCAGCGCTACTAATAGGGAGCGTTGACCTTCCTTCCACGGACCGGTAATCGGAGTGCCTAAAACCGCATGCGGCTTAGGCTCCAAGATAGGTTCTGCGCGGCCGGGTAATGCATCTTCTTTAGCAACAAGTTGAGGGGTAGGTGCAAATAAGAACGACATAGAAATCGTCTCCTTTCTGTTTTTAATCAACATACACCACCACCTAAAAATTCCCCGACCAGCAAGTTCACAGTATTCGGGCACAATATCGTTGACAAAATATTGTTTCGGAATATAATGGGATACGTACCCAACGAAAGGAAACACTC1cj7.8AGAAACATCCCAGCGCTACTAATAGGGAGCGTTGACCTTCCTTCCACGGACCGGTAATCGGAGTGCCTAAAACCGCATGCGGCTTAGGCTCCAAGATAGGTTCTGCGCGGCCGGGTAATGCATCTTCTTTAGCAACAAGTTGAGGGGTAGGTGCAAATAAGAACGACATAGAAATCGTCTCCTTTCTGTTTTTAATCAACATACACCACCACCTAAAAATTCCCCGACCAGCAAGTTCACAGTATTCGGGCACAATATCGTTGACAAAATATTGTTTTGTGGTATAATGGGATACGTACCCAACGAAAGGAAACACTC2cj7.9AGAAACATCCCAGCGCTACTAATAGGGAGCGTTGACCTTCCTTCCACGGACCGGTAATCGGAGTGCCTAAAACCGCATGCGGCTTAGGCTCCAAGATAGGTTCTGCGCGGCCGGGTAATGCATCTTCTTTAGCAACAAGTTGAGGGGTAGGTGCAAATAAGAACGACATAGAAATCGTCTCCTTTCTGTTTTTAATCAACATACACCACCACCTAAAAATTCCCCGACCAGCAAGTTCACAGTATTCGGGCACAATATCGTTGCCAAAATATTGTTTTGTGGTATCATGGGATACGTACCCAACGAAAGGAAACACTC3

[0116]

[0117] Example 3: Evaluation of the green fluorescent protein (GFP) expression induction activity of a recombinant vector in E. coli

[0118]

[0119] 3-1. Production of transformed strains

[0120] The recombinant vectors pCES208_Pcj7.7_gfp, pCES208_Pcj7.8_gfp, pCES208_Pcj7.9_gfp and pCES208_Pcj7_gfp selected in the above Example 2 were each transformed into Escherichia coli DH5α by the heat shock method, and the transformed strains were obtained on Luria-Bertani (LB) agar medium containing 25 mg / L of kanamycin, and these were named 'DH5α / pCES208_Pcj7.7_gfp', 'DH5α / pCES208_Pcj7.8_gfp', 'DH5α / pCES208_Pcj7.9_gfp' and 'DH5α / pCES208_Pcj7_gfp', respectively.

[0121]

[0122] 3-2. Confirmation of expression induction activity of transformed strains

[0123] To confirm the activity of the cj7.7, cj7.8, and cj7.9 promoters in E. coli, the transformed strains DH5α / pCES208_Pcj7.7_gfp, DH5α / pCES208_Pcj7.8_gfp, DH5α / pCES208_Pcj7.9_gfp, and DH5α / pCES208_Pcj7_gfp obtained in Example 3-1 were cultured using the following method, and the activity of GFP was measured.

[0124] Specifically, the transformed E. coli strains were inoculated at a ratio of 1:20 by volume into a 250 ml corner-baffle flask containing 25 ml of LB medium containing kanamycin, and cultured with shaking (200 rpm) at 37°C until the mid-culture phase (OD600=3.0). The cells were collected from the culture solution by centrifugation (5,000 rpm, 15 min), washed twice with 0.1% (w / v) Tris.HCl (pH8.0) buffer, suspended in the same buffer, disrupted by ultrasonic disruption, and the supernatant was collected by centrifugation (15,000 rpm, 20 min), and the protein concentration was quantified by the Bradford method. The same amount of fungal extract was irradiated with excitation light at 488 nm using the method of Laure Gory et al., and the 511 nm emission light was measured using an LS-50B spectrophotometer (Perkin-Elmer), thereby measuring the expression level of the GFP gene, and the results are shown in Table 3 below.

[0125] Strain Promoter Fluorescence Sensitivity Relative Fluorescence Sensitivity DH5α / pCES208_Pcj7_gfpcj7473100% DH5α / pCES208_Pcj7.7_gfpcj7.71062225% DH5α / pCES208_Pcj7.8_gfpcj7.81358287% DH5α / pCES208_Pcj7.9_gfpcj7.92787489%

[0126] As shown in Table 3 below, in E. coli, the cj7.7, cj7.8, and cj7.9 promoters all exhibited promoter activity, and were confirmed to have promoter activity that was at least twice as high as that of the cj7 promoter, which is known to be a strong promoter.

[0127]

[0128] Example 4: Evaluation of the green fluorescent protein (GFP) expression induction activity of a recombinant vector in Bacillus subtilis

[0129]

[0130] 4-1. Construction of recombinant vectors containing cj7.7, cj7.8, and cj7.9 promoters

[0131] To construct recombinant vectors containing Pcj7.7, Pcj7.8, and Pcj7.9, PCR was performed using primers of SEQ ID NOs: 9 and 10, with promoter cj7.7, promoter cj7.8, and promoter cj7.9 as templates, respectively. PCR was performed by denaturing at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, and then polymerization at 72°C for 5 minutes, thereby obtaining Pcj7.7, Pcj7.8, and Pcj7.9, respectively.

[0132] In addition, the ORF (Open Reading Frame) of the GFP gene was obtained by performing PCR using the pGFPuv vector (clontech, USA) as a template and primers of SEQ ID NO: 11 and 12. The PCR was performed by denaturing at 94°C for 5 minutes, then repeating 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, and then performing a polymerization reaction at 72°C for 7 minutes, thereby obtaining a gene fragment containing the ORF of GFP.

[0133] In addition, to introduce Pcj7.7, Pcj7.8, Pcj7.9, and GFP into the Bacillus expression vector pHT43 (Mobitec GmbH), the vector was prepared by performing PCR using the pHT43 vector as a template and primers of SEQ ID NO: 13 and 14. The PCR was performed by denaturing at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 5 minutes, followed by polymerization at 72°C for 5 minutes.

[0134] Thereafter, the ORFs of Pcj7.7, Pcj7.8 or Pcj7.9 and GFP genes were operably linked to the pHT43 vector obtained by the above method using an infusion enzyme, thereby producing a recombinant vector in which Pcj7.7, Pcj7.8 or Pcj7.9 was linked to GFP, and these were named 'pHT_Pcj7.7_gfp', 'pHT_Pcj7.8_gfp', and 'pHT_Pcj7.9_gfp', respectively.

[0135] As a control group to confirm the activity of the new promoter, PCR was performed using the previously known strong promoter P43 (Wang and Doi, J Biol Chem. 1984 Jul 10; 259(13): 8619-25) as a template and the primers of SEQ ID NOs: 15 and 16 to obtain P43. In addition, the ORF (Open Reading Frame) of the GFP gene was obtained by PCR using the pGFPuv vector (clontech, USA) as a template and the primers of SEQ ID NOs: 17 and 12 to obtain a gene fragment containing the ORF of the GFP gene. Thereafter, using the same method as above, the ORFs of the P43 and GFP genes were operably linked to the pHT43 vector using the BD In-Fusion kit to construct a recombinant vector in which P43 is linked to GFP, and this was named 'pHT_P43_gfp'.

[0136]

[0137] 4-2. Production of transformed strains

[0138] The recombinant vectors pHT_Pcj7.7_gfp, pHT_Pcj7.8_gfp, pHT_Pcj7.9_gfp constructed in the above Example 4-1 and pHT_P43_gfp containing the previously known strong promoter P43 were each transformed into Bacillus subtilis ATCC23857 by the electric pulse method (Eppendorf Protocol No. 4308 915 504), and then the transformed strains were obtained on a selection medium containing 50 mg / L of kanamycin, and these were designated as 'ATCC23857 / pHT_Pcj7.7_gfp', 'ATCC23857 / pHT_Pcj7.8_gfp', 'ATCC23857 / pHT_Pcj7.9_gfp' and It was named 'ATCC23857 / pHT_P43_gfp'.

[0139]

[0140] 4-3. Confirmation of expression-inducing activity of Pcj7.7, Pcj7.8, and Pcj7.9

[0141] To confirm the activity of the cj7.7, cj7.8, and cj7.9 promoters in Bacillus subtilis, the transformed strains Bacillus subtilis ATCC23857 / pHT_Pcj7.7_gfp, ATCC23857 / pHT_Pcj7.8_gfp, ATCC23857 / pHT_Pcj7.9_gfp, and ATCC23857 / pHT_P43_gfp obtained in Example 4-2 were cultured using the following method, and the activity of GFP was measured.

[0142] Specifically, the transformed Bacillus subtilis strains were inoculated at a ratio of 1:20 based on volume into a 250 ml corner-bubble flask containing 25 ml of the seed medium, and cultured with shaking (200 rpm) at 30°C until the mid-culture phase (OD600=10.0). The components of the seed medium are listed in Table 4 below. The cells were collected from the culture solution by centrifugation (5,000 rpm, 15 min), washed twice with 0.1% Tris.HCl (pH8.0) buffer solution, and then suspended in the same buffer solution until the turbidity at 610 nm was approximately 160. After adding 1.25 g of glass beads per 1.5 ml of suspension, the cells were disrupted for 6 minutes using a bead beater, and the supernatant was collected through centrifugation (15,000 rpm, 20 minutes). The protein concentration was quantified by the Bradford method (Bradford, MM 1976. Anal. Biochem. 72:248-254). The same amount of cell extract was irradiated with excitation light at 488 nm using the method of Laure Gory et al., and the fluorescence sensitivity was measured at 511 nm using an LS-50B spectrophotometer (Perkin-Elmer). The expression level of the GFP gene was evaluated, and the results are shown in Table 5 below.

[0143] Medium type ingredients: Glucose 10g, ammonium sulfate 2.68g, yeast extract 20g, corn steep liquor 30g / L, NaH2PO4 2H2O 4.5g, K2HPO4 14.6g, MgSO4 7H2O 2g, Na2SO4 2g / L (based on 1 liter of distilled water)

[0144] Strain Promoter Fluorescence Sensitivity Relative Fluorescence Sensitivity ATCC23857 / pHT_P43_gfpP43307100% ATCC23857 / pHT_Pcj7.7_gfpcj7.7355116% ATCC23857 / pHT_Pcj7.8_gfpcj7.8389127% ATCC23857 / pHT_Pcj7.9_gfpcj7.9448146%

[0145] As shown in Table 5 above, in Bacillus subtilis, the cj7.7, cj7.8, and cj7.9 promoters all exhibited promoter activity, and were confirmed to have higher promoter activity compared to P43, which is known to be a strong promoter.

[0146]

[0147] The above results suggest that the mutant promoters of the present application, cj7.7, cj7.8, and cj7.9, can function as universal promoters in various host cells, including not only Corynebacterium genus but also Escherichia genus and Bacillus genus.

[0148]

[0149] Example 5: Evaluation of target product production capacity

[0150]

[0151] 5-1. Evaluation of acetyl homoserine production capacity

[0152]

[0153] 5-1-1. Construction of gapN expression vector containing sequences of cj7, cj7.7, cj7.8, and cj7.9 promoters

[0154] To determine the effect of the cj7 mutant promoter on acetylhomoserine production, a vector was constructed in which the gapN gene (NADP-dependent glyceraldehyde-3-phosphate dehydrogenase from Lactobacillus delbrueckii subsp. Bulgaricus) is regulated by the cj7 mutant promoter. The amino acid sequence (SEQ ID NO: 18) and nucleotide sequence (SEQ ID NO: 19) of the Ldb1179 gene encoding gapN from Lactobacillus delbrueckii subsp. Bulgaricus ATCC 11842 were obtained from the National Institutes of Health GenBank (NIH GenBank).

[0155] Specifically, PCR was performed using the DNA of the pCES208_Pcj7.7_gfp, pCES208_Pcj7.8_gfp, pCES208_Pcj7.9_gfp or pCES208_Pcj7_gfp vectors constructed in Examples 1 and 2 as templates and primers of SEQ ID NOs: 20 and 21, respectively. The PCR was performed by denaturing at 94°C for 5 minutes, then repeating 30 cycles of denaturing at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerizing at 72°C for 1 minute, and then performing a polymerization reaction at 72°C for 5 minutes to obtain a DNA fragment including the Pcj7.7, Pcj7.8, Pcj7.9 or Pcj7 promoter sequence.

[0156] Additionally, a gene fragment of approximately 1.43 kb was prepared by amplifying the chromosome of Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 strain as a template and using primers of SEQ ID NOs. 22 and 23 to change the initiation codon TTG to ATG. The PCR reaction was performed 30 times with denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute and 30 seconds. The PCR product was electrophoresed on a 0.8% agarose gel, and the approximately 1.4 kb band was eluted and purified.

[0157] The above amplified products, cj7 promoter mutant PCR products (Pcj7.7, Pcj7.8, Pcj7.9) or Pcj7 gene fragment and gapN gene ORF were cut with BamH° restriction enzyme and mixed with pCES208 (J. Microbiol. Biotechnol. 18:639-647, 2008), an E. coli-Corynebacterium shuttle vector, and recombinant vectors in which Pcj7.7, Pcj7.8, Pcj7.9 or Pcj7 is linked to gapN were constructed using In-Fusion® HD cloning kit (clontech), and these were designated as 'pCES_Pcj7.7_gapN', 'pCES_Pcj7.8_gapN', 'pCES_Pcj7.9_gapN' and It was named 'pCES_Pcj7_gapN'.

[0158]

[0159] Example 5-1-2. Production of transformed strains

[0160] The recombinant vectors 'pCES_Pcj7.7_gapN', 'pCES_Pcj7.8_gapN', 'pCES_Pcj7.9_gapN' and 'pCES_Pcj7_gapN' produced in the above Example 5-1-1 were transformed into Corynebacterium glutamicum KCCM12634P (US 2023-0340549 A1), an acetylhomoserine producing strain, by electric pulse method, and then the transformed strains were obtained in a selection medium containing 25 mg / L of kanamycin, and these were respectively 'KCCM12634P::Pcj7.7_gapN', 'KCCM12634P::Pcj7.8_gapN', 'KCCM12634P::Pcj7.9_gapN' and It was named 'KCCM12634P::Pcj7_gapN'.

[0161]

[0162] Example 5-1-3. Evaluation of O-acetyl homoserine production ability of transformed strains

[0163] The transformed strain produced in Example 5-1-2 was cultured using the following method, and then the production ability of O-acetyl homoserine was measured. The 'KCCM12634P::Pcj7_gapN' strain was used as a control.

[0164] Specifically, the strain was inoculated using an inoculation loop into a 250 ml corner-baffle flask containing 25 ml of production medium, and cultured at 37°C for 20 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0165]

[0166] <Production medium (pH 7.2)>

[0167] Glucose 30 g, KH2PO4 2 g, urea 3 g, (NH4)2SO4 40 g, peptone 2.5 g, CSL (Sigma) 5 g (10 ml), MgSO4.7H2O 0.5 g, methionine 400 mg, leucine 400 mg, CaCO3 20 g (based on 1 liter of distilled water)

[0168] After completion of cultivation, the production of O-acetyl homoserine was measured by HPLC. Based on the strain containing the cj7 promoter, the increase rate of O-acetyl homoserine concentration in the culture medium for each strain tested is shown in Table 6 below.

[0169]

[0170] Strain name O-acetyl homoserine concentration increase rate (%) KCCM12634P::pCES208_Pcj7_gapN 100% KCCM12634P::pCES208_Pcj7.7_gapN 109.67% KCCM12634P::pCES208_Pcj7.8_gapN 116.12% KCCM12634P::pCES208_Pcj7.9_gapN 119.35%

[0171] As shown in the table above, when the mutant promoter of cj7 was introduced, it was confirmed that gapN activity increased, resulting in an increase in the production of acetyl homoserine. This indicates that the mutant promoter of cj7 of the present application is effective in increasing the production of O-acetyl homoserine.

[0172]

[0173] 5-2. Evaluation of isoleucine production capacity

[0174]

[0175] 5-2-1. Production of a Corynebacterium glutamicum Transformant Strain Capable of Producing Isoleucine

[0176] In order to confirm the effect of the mutant promoter of cj7 on isoleucine production, among the four vectors produced in Example 5-1-1, pCES_Pcj7_gapN and pCES_Pcj7.9_gapN, which showed excellent results in the evaluation of GFP expression intensity and acetylhomoserine production, were transformed into Corynebacterium glutamicum KCCM12739P (CA10-3101, US 2023-0098971 A1), an isoleucine-producing strain, by electroporation to produce isoleucine-producing strains into which the cj7 promoter and the mutant promoter of cj7 were introduced. The strains produced in this way were named KCCM12739P::pCES208_Pcj7_gapN and KCCM12739P::pCES208_Pcj7.9_gapN.

[0177]

[0178] 5-2-2. Evaluation of isoleucine production capacity of transformed strains

[0179] The strains prepared above were cultured using the following method and their isoleucine production ability was compared.

[0180] After inoculating a 250 ml corner-bottom flask containing 25 ml of production medium, the culture was shaken at 200 rpm for 60 hours at 32°C. The composition of the production medium is as follows.

[0181] <Production medium (pH 7.2)>

[0182] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / L, manganese sulfate monohydrate 10 mg / L, biotin 200 ㎍ / L (based on 1 liter of distilled water)

[0183]

[0184] After completion of cultivation, isoleucine productivity was measured by HPLC. Based on the strain containing the cj7 promoter, the increase rate of L-isoleucine concentration in the culture medium for the tested strains is shown in Table 7 below.

[0185]

[0186] Strain name L-isoleucine concentration increase rate (%) KCCM12739P::pCES208_Pcj7_gapN100% KCCM12739P::pCES208_Pcj7.9_gapN111%

[0187] As shown in the table above, when the mutant promoter of cj7 was introduced, it was confirmed that gapN activity increased, leading to an increase in isoleucine production. This indicates that the mutant promoter of cj7 of the present application is effective in increasing L-isoleucine production.

[0188]

[0189] 5-3. Valine productivity evaluation

[0190]

[0191] 5-3-1. Construction of an ilvE expression vector containing the sequences of the cj7 and cj7.9 promoters.

[0192] To determine the effect of the mutant promoter of cj7 on valine production, a vector was constructed in which ilvE (Ncgl2123, SEQ ID NO: 24), which encodes branched-chain amino acid aminotransferase, a key gene for valine biosynthesis, is expressed by Pcj7.9 and Pcj7.

[0193] Specifically, PCR was performed using the DNA of the pCES208_Pcj7.9_gfp or pCES208_Pcj7_gfp vectors constructed in Examples 1 and 2 as templates and primers of SEQ ID NOs: 25 and 26, respectively. The PCR was performed by denaturing at 94°C for 5 minutes, then repeating 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, and then performing a polymerization reaction at 72°C for 5 minutes, thereby obtaining a DNA fragment including the Pcj7.9 or Pcj7 promoter sequence.

[0194] Additionally, a fragment of the ilvE gene of approximately 1.1 kb was prepared by amplification using the primers of SEQ ID NOs: 27 and 28 using the Corynebacterium glutamicum ATCC14067 chromosome as a template through PCR. The PCR reaction consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute and 30 seconds. The PCR product was electrophoresed on a 0.8% agarose gel, and the approximately 1.1 kb band was eluted and purified.

[0195] The above amplification product, Pcj7.9 or Pcj7 gene fragment and ORF of ilvE gene were prepared by cutting with EcoRV / SalI restriction enzymes and mixing with pCES208 (J. Microbiol. Biotechnol. 18:639-647, 2008), an E. coli-Corynebacterium shuttle vector, and using In-Fusion® HD cloning kit (clontech), recombinant vectors in which Pcj7.9 or Pcj7 is linked to ilvE were constructed, and these were named 'pCES_Pcj7.9_ilvE' and 'pCES_Pcj7_ilvE'.

[0196]

[0197] 5-3-2. Production of a Corynebacterium glutamicum Transformant Strain Capable of Producing Valine

[0198] The two recombinant vectors 'pCES_Pcj7.9_ilvE' and 'pCES208_Pcj7_ilvE' produced in the above Example 5-3-1 were transformed into Corynebacterium glutamicum KCCM11201P (US 8465962 B2), a valine-producing strain, by electroporation, and the transformed strains were obtained in a selection medium containing 25 mg / L of kanamycin, and were named KCCM11201P::pCES208_Pcj7.9_ilvE and KCCM11201P::pCES208_Pcj7_ilvE, respectively.

[0199]

[0200] 5-3-3. Evaluation of valine production capacity of transformed strains

[0201] The strains prepared above were cultured using the following method and their valine production ability was compared.

[0202] Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0203]

[0204] <Production medium (pH 7.2)>

[0205] Glucose 100 g, ammonium sulfate 40 g, soy protein 2.5 g, corn steep solids 5 g, urea 3 g, potassium phosphate dibasic 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 μg, thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0206]

[0207] After completion of cultivation, valine production was measured by HPLC. Based on the strain containing the cj7 promoter, the increase rate of L-valine concentration in the culture medium for the tested strains is shown in Table 8 below.

[0208]

[0209] Strain name L-valine concentration increase rate (%) KCCM11201P:: pCES208_Pcj7_ilvE100% KCCM11201P:: pCES208_Pcj7.9_ilvE115%

[0210] As shown in the table above, it was confirmed that when the mutant promoter of cj7 was introduced, the activity of ilvE increased, resulting in an increase in valine production. This indicates that the mutant promoter of cj7 of the present application is effective in increasing L-valine production.

[0211]

[0212] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the claims described below, and their equivalent concepts, rather than the detailed description above.

[0213]

[0214]

Claims

1. A polynucleotide having promoter activity, comprising any one polynucleotide sequence selected from the group consisting of sequence numbers 1 to 3.

2. An expression cassette comprising the polynucleotide of paragraph 1 and the target gene.

3. A microorganism comprising the polynucleotide of claim 1 or the expression cassette of claim 2.

4. In the third paragraph, the microorganism is a microorganism of the genus Corynebacterium, the genus Escherichia or the genus Bacillus.

5. A method for producing a target product, comprising a step of culturing the microorganism of clause 3 in a medium.

6. A method according to claim 5, wherein the method further comprises a step of recovering a target product from the microorganism or a medium in which the microorganism is cultured.

7. A method in paragraph 5, wherein the target product is at least one selected from the group consisting of amino acids, nucleic acids, vitamins, proteins, fatty acids, and organic acids.

8. A method in paragraph 5, wherein the microorganism is a microorganism of the genus Corynebacterium, the genus Escherichia or the genus Bacillus.

9. Use as a promoter of a polynucleotide comprising any one polynucleotide sequence selected from the group consisting of sequence numbers 1 to 3.

Citation Information

Patent Citations

  • Novel of l-threonine dehydratase variant and method of producing l-isoleucine using the same

    US20230098971A1

  • Variant of inner membrane protein and method for producing target product by using same

    US20230340549A1

  • Promoter sequences from Corynebacterium ammoniagenes

    US7662943B2

  • Microorganism having enhanced L-valine productivity and method for producing L-valine using the same

    US8465962B2

  • Corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same

    US9109242B2