Method for screening for drugs for treatment of type 2 diabetes mellitus by using islet organoid
The use of pancreatic islet organoids derived from human pluripotent stem cells offers a more accurate and efficient method for screening drugs for type 2 diabetes, overcoming limitations of traditional screening methods.
Patent Information
- Application Number
- PCT/KR2024/018927
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-30
- Filing Date
- 2024-11-27
- Publication Date
- 2025-06-05
AI Technical Summary
Current methods for screening drugs for type 2 diabetes are limited by cross-species specificity and two-dimensional cell culture, which do not accurately replicate human disease conditions.
A method using pancreatic islet organoids derived from human pluripotent stem cells, which are induced to differentiate into three-dimensional structures resembling human pancreatic islets, allowing for the induction of type 2 diabetes and screening of drug candidates.
This method provides a high-speed, accurate platform for evaluating the therapeutic effects of drug candidates on type 2 diabetes, mimicking human disease conditions more closely than traditional methods.
Smart Images

Figure KR2024018927_05062025_PF_FP_ABST
Abstract
Description
A method for screening drugs for the treatment of type 2 diabetes using pancreatic islet organoids
[0001] The present invention relates to a method for screening drugs for treating type 2 diabetes using pancreatic islet organoids, and more particularly, to a method for screening drugs effective in treating type 2 diabetes from candidate substances using pancreatic islet organoids, and a platform therefor.
[0002] Diabetes is a metabolic disease characterized by hyperglycemia caused by impaired insulin secretion or function, which is essential for blood sugar regulation in the body. Diabetes can lead to microvascular complications in the retina, kidneys, and nerves, as well as macrovascular complications such as arteriosclerosis, cardiovascular disease, and cerebrovascular disease, which increase mortality. Current diabetes treatments include diet, oral hypoglycemic agents such as metformin, sulfonylureas, alpha-glucosidase inhibitors, and thiazolidinediones, insulin therapy, and exercise therapy. However, the complexity of diet therapy makes it difficult for patients to incorporate it into their daily lives. Furthermore, ketoacidosis is known to occur when diabetic patients exercise with low insulin levels, while hypoglycemia can occur when exercise is performed with high insulin levels. Furthermore, oral hypoglycemic agents and insulin therapy are only minimally effective in lowering blood sugar levels in diabetic patients with beta-cell dysfunction.
[0003] While some treatments for diabetes are known, conducting clinical trials on all patients is challenging, and various side effects are common. Consequently, drug evaluations are often conducted using animal models of the disease or non-human cell lines to assess the efficacy of candidate compounds, including diabetes treatments. However, species specificity between humans and non-human animals, as well as differences in the two-dimensional culture environment and cell composition of cell lines, limit these drugs from demonstrating efficacy comparable to that observed in humans.
[0004] Accordingly, the present inventors have developed a three-dimensional pancreatic islet organoid disease model using human-derived pluripotent stem cells to overcome the limitations of the above-mentioned interspecies specificity and two-dimensional cell culture, which has a cell composition and morphology more similar to that of the human body and has the disease characteristics of type 2 diabetes, and have made great efforts to provide a method for accurately and rapidly identifying candidate substances that exhibit a treatment or improvement effect on type 2 diabetes and a platform therefor, and have developed a screening method and an efficacy evaluation method for a diabetes treatment agent that can overcome the limitations of the above-mentioned interspecies specificity and two-dimensional cell culture, thereby completing the present invention.
[0005] The present invention aims to provide a screening platform capable of evaluating the therapeutic effects of various candidate substances for type 2 diabetes using pancreatic islet organoids, and a screening method using the same.
[0006] One aspect of the present invention relates to a method for screening a drug candidate for treating type 2 diabetes, comprising the steps of (S1) inducing differentiation of a pancreatic islet organoid from a human-derived pluripotent stem cell; (S2) treating the pancreatic islet organoid of (S1) with collagen to induce three-dimensional differentiation; (S3) inducing type 2 diabetes in the pancreatic islet organoid of (S2); and (S4) treating the pancreatic islet organoid of (S3) with a drug candidate to determine the type 2 diabetes treatment effect.
[0007] In one specific example of the present invention, the human-derived pluripotent stem cell may be human embryonic stem cell line H1.
[0008] In one specific example of the present invention, the initial cell number of the human embryonic stem cell line H1 is 0.55 x 10 6 0.65 x 10 6 cells / cm 2 It could be.
[0009] In one specific example of the present invention, the three-dimensional differentiation induction may be performed on a 96 to 384 well plate.
[0010] In one specific example of the present invention, the collagen may be human-derived collagen type IV.
[0011] In one specific example of the present invention, the concentration of the human-derived collagen type IV may be 10 to 20 μg / mL.
[0012] In one specific example of the present invention, the type 2 diabetes disease may be induced by adding free fatty acids, glucose, and inflammatory cytokines.
[0013] In one specific example of the present invention, the free fatty acid may be palmitate.
[0014] In one specific embodiment of the present invention, the glucose may be at a concentration of 20 to 50 mM.
[0015] In one specific example of the present invention, the inflammatory cytokine may be interleukin-1β (IL-1β), tumor necrosis factor α (TNFα), or a combination thereof.
[0016] In one specific example of the present invention, the type 2 diabetes treatment effect may be determined by measuring the increase or decrease in insulin secretion or inflammatory cytokines.
[0017] Another aspect of the present invention relates to a method for providing information for selecting a drug for treating type 2 diabetes, comprising a step of determining that a drug candidate substance screened through the above screening method is effective in treating type 2 diabetes.
[0018] Another aspect of the present invention relates to a pharmaceutical composition for treating type 2 diabetes, comprising a drug candidate substance screened through the above screening method as an active ingredient.
[0019] Another aspect of the present invention relates to a food composition for improving type 2 diabetes, which contains a drug candidate substance screened through the above screening method as an active ingredient.
[0020] The method for screening a drug for treating type 2 diabetes using a pancreatic islet organoid according to the present invention provides a platform and method for high-speed screening of new drug candidates effective in treating type 2 diabetes using multi-wells of 96 or more wells by using pancreatic islet organoids having a cell composition and physical structure similar to those of an actual human body.
[0021] The screening method according to the present invention can simultaneously derive the results of 1) a hormone stimulation test, 2) an inflammatory stress test, and 3) a cytotoxicity test with only one experiment for a candidate substance for the treatment of type 2 diabetes.
[0022] Figure 1 shows the results showing the morphological differences between pancreatic organoids generated in 6-well and 96-well ultra-low attachment plates.
[0023] Figure 2 shows the results of evaluating the cell death rate according to collagen concentration by adding human placental collagen IV (Collagen type IV) to a 96-well plate for up to 14 days to promote the stability and maturation of pancreatic islet organoids. The results of repeated experiments (n=5) compared to the control group are expressed as the mean ± standard deviation (SD) *P<0.05, **P<0.01.
[0024] Figure 3 shows the results of evaluating insulin secretion in response to glucose by adding human placental collagen IV (Collagen type IV) to a 96-well plate for up to 14 days to promote the stability and maturation of pancreatic islet organoids. The results of repeated experiments (n=5) compared to the control group are expressed as the mean ± standard deviation (SD) *P<0.05, **P<0.01.
[0025] Figure 4 shows the results of evaluating the effects of laminin on the maturation and function of pancreatic islet organoids during 3D culture by measuring insulin secretion following glucose stimulation. Laminin was administered alone or simultaneously with collagen at 5 and 10 μg / mL. The values for high glucose (HG) were compared with those for low glucose (LG), and the insulin secretion values (n=2) were expressed as the mean ± error.
[0026] Figure 5 shows the results of analyzing the expression of specific gene markers after treating 3D-cultured pancreatic islet organoids with type 2 diabetes-inducing substances, either singly or in combination. Gene expression levels were compared with those of normal pancreatic islet organoids, and the replicate results (n=3) were expressed as *P<0.05, **P<0.01, ***P<0.001, mean±standard deviation (SD).
[0027] Figure 6 shows the results of analyzing the expression of type 2 diabetes-related genes after treatment with a combination of type 2 diabetes-inducing substances selected from the results of Figure 5: 1.5 mM palmitate, 30 mM glucose, 10 ng / mL IL-1β, and 100 ng / mL TNFα.
[0028] Figure 7 shows the results of quantitative PCR array analysis of the expression of inflammatory cytokines following the induction of type 2 diabetes. Compared to normal pancreatic islet organoids, increases or decreases in gene expression are expressed in red (increase) or green (decrease), respectively (n=3).
[0029] Figure 8 shows the results of an ELISA test analyzing the secretion of inflammatory cytokines IL-8 (CXCL8) (A) and CXCL1 (B) selected from the results of Figure 7. The expression levels of inflammatory cytokines are shown in comparison with the control group, normal pancreatic islet organoids.
[0030] Figure 9 shows the results of glucose-stimulated insulin secretion (GSIS) evaluation according to the induction period of type 2 diabetes. Insulin secretion was compared with that of normal islet organoids as a control group, and the results of repeated experiments (n=4~5) were expressed as **P<0.01, mean±standard deviation (SD).
[0031] Figure 10 shows the results of confirming insulin secretion according to treatment with the existing diabetes treatment drug, resveratrol, in normal and type 2 diabetes-induced pancreatic islet organoids. The results of repeat results (n=4~5) were compared with the results of normal or type 2 diabetes-induced pancreatic islet organoids that were not treated with diabetes treatment, and are expressed as the mean ± standard deviation (SD) *P<0.05, **P<0.01, ***P<0.001.
[0032] Figure 11 shows the results of confirming insulin secretion according to treatment with the existing diabetes treatment drug, sitagliptin, in pancreatic islet organoids induced with type 2 diabetes. The results of repeat results (n=4~5) were compared with the results of normal or type 2 diabetes-induced pancreatic islet organoids not treated with diabetes treatment, and *P<0.05, **P<0.01, ***P<0.001, and are expressed as the mean±standard deviation (SD).
[0033] Figure 12 shows the results of confirming insulin secretion in pancreatic islet organoids induced with type 2 diabetes following treatment with the existing diabetes treatment drug, Exendin-4. Compared to the results of normal or type 2 diabetes-induced pancreatic islet organoids not treated with diabetes treatment, *P<0.05, **P<0.01, ***P<0.001, expressed as the mean ± standard deviation (SD).
[0034] Figure 13 shows the results of confirming insulin secretion using cells cryopreserved at the final stage of beta cell differentiation. Normal pancreatic islet organoids were designated as Ctrl (Control), and organoids induced with type 2 diabetes were designated as T2D (Type 2 Diabetes). The results of repetitions (n=3) were expressed as *P<0.05, **P<0.01, ***P<0.001, mean±standard deviation (SD).
[0035] Figure 14 is a schematic diagram of a drug screening method according to the present invention. Endocrine cells, including beta cells, differentiated from H1 human embryonic stem cells (hESCs) can be used for drug screening by inducing type 2 diabetes immediately after stage 6, or can be cryopreserved for long-term preservation.
[0036] The present invention will be described in detail with reference to the attached tables and drawings below.
[0037] If drawings are included, they are provided as examples to ensure that the spirit of the present invention is fully conveyed to those skilled in the art. Therefore, the present invention is not limited to the drawings presented and may be embodied in other forms, and the drawings may be exaggerated to clarify the spirit of the present invention.
[0038] In this case, if there is no other definition in the technical and scientific terms used, they have the meaning commonly understood by a person of ordinary skill in the technical field to which this invention belongs, and the description of known functions and configurations that may unnecessarily obscure the gist of the present invention in the following description and attached drawings are omitted.
[0039] Additionally, the singular forms used in the specification of the present invention may be intended to include the plural forms as well, unless the context specifically indicates otherwise.
[0040] In addition, units used in the specification of the present invention without special mention are based on weight, and for example, units of % or ratio mean weight% or weight ratio.
[0041] Furthermore, in the specification of the present invention, the expression “comprises” is an open description equivalent to expressions such as “includes,” “contains,” “has,” or “is characterized by,” and does not exclude additional unrecited elements, materials, or processes. Furthermore, the expression “consists substantially of…” means that other unrecited elements, materials, or processes may be present together with the specified elements, materials, or processes in an amount that does not significantly affect at least one basic and novel technical idea of the invention to an unacceptable degree. Furthermore, the expression “consists of” means that only the recited elements, materials, or processes are present.
[0042] As used herein, the terms "component", "composition", "composition of compounds", "compound", "drug", "pharmaceutically active agent", "active agent", "cure", "treatment", "treatment" or "medicine" are used interchangeably to mean a compound or composition of compounds or substances that, when administered to a subject (human or animal), induces a desired pharmacological and / or physiological effect by local and / or systemic action.
[0043] The terms "treatment" or "treatment" (as well as their different forms) as used herein encompass preventive (e.g., prophylactic treatment), curative, or palliative treatment. The term "treating," as used herein, encompasses alleviating or reducing at least one adverse or negative effect or symptom of a condition, disease, or disorder. The terms "prevention," "improvement," and "treatment" as used herein should be interpreted in the broadest sense, where "prevention" means preventing the development of one or more of the clinical symptoms of a disease in a patient who may be exposed to or susceptible to the disease but who has not yet experienced or manifested symptoms of the disease. "Treatment" means any action that arrests or reduces the development of a disease or one or more of its clinical symptoms.
[0044] In the present invention, “sample” or “specimen” refers to an object for analysis and is used with the same meaning throughout the specification.
[0045] Hereinafter, a method for screening a drug showing a therapeutic effect on type 2 diabetes using the pancreatic islet organoid of the present invention is described in detail.
[0046] One aspect of the present invention relates to a method for screening a drug candidate for treating type 2 diabetes, comprising the steps of (S1) inducing differentiation of a pancreatic islet organoid from a human-derived pluripotent stem cell; (S2) treating the pancreatic islet organoid of (S1) with collagen to induce three-dimensional differentiation; (S3) inducing type 2 diabetes in the pancreatic islet organoid of (S2); and (S4) treating the pancreatic islet organoid of (S3) with a drug candidate to determine the type 2 diabetes treatment effect.
[0047] The pancreatic islet organoids induced with type 2 diabetes according to the present invention are preferable because they provide functional and structural similarity when compared to the pancreatic islets of a patient suffering from type 2 diabetes in an actual human body, thereby increasing accuracy when screening for drugs for treating or improving type 2 diabetes.
[0048] The type of the human-derived pluripotent stem cell is not particularly limited, but may be, for example, a human embryonic stem cell line or an induced pluripotent stem cell line, and more specifically, may be H1 (human embryonic stem cellline H1), H6, etc. When the embryonic stem cell is used, it is preferable to produce a pancreatic islet organoid having a shape similar to an actual one.
[0049] The culture method used for differentiation using H1 can be applied to a conventional human embryonic stem cell culture method, but is not limited thereto. As a specific example, H1 cells can be differentiated into pancreatic islet organoids including beta cells through a total of 6 stages according to the method disclosed in the protocol (Hogrebe, NJ, Maxwell, KG, Augsornworawat, P. et al. Generation of insulin-producing pancreatic β cells from multiple human stem cell lines. Nat Protoc 16, 4109-4143 (2021). https: / doi.org / 10.1038 / s41596-021-00560-y). Although not limited, even if cells at stage 6 are cryopreserved, they can exhibit the same level of differentiation effect as before, and since the cell differentiation period is eliminated in the screening process, drug screening can be completed within 2 weeks, which is preferable.
[0050] First, a method for differentiating endocrine cells, mainly including beta cells constituting pancreatic islet organoids, at a two-dimensional level using human-derived pluripotent stem cells H1, which may follow the conventional protocol disclosed in the above literature, but is not limited thereto, and in the present invention, the initial cell number of H1 is 0.5 x 10 6 0.65 x 10 6 cells / cm 2 , preferably 0.55 x 10 6 0.65 x 10 6 cells / cm 2 , or even better, 0.60 x 10 6 0.65 xx 10 6 cells / cm 2 It can be performed to satisfy the range of .
[0051] The above three-dimensional differentiation induction is a step of stabilizing the culture by configuring endocrine cells differentiated at a two-dimensional level into pancreatic islet organoids and inducing maturation of beta cells. The differentiation induction may be performed, for example, on a well plate having a size of 96 to 384, but the size of the well is not limited to the above range, and by using a 96-well ultra-low contact plate, the number of cells constituting each organoid can be constantly controlled, thereby showing consistency in size, shape, and maturity, and can be applied directly to drug screening without separate organoid movement after differentiation completion, thereby reducing variation in the sample, which is preferable. In a specific embodiment of the present invention, 2.5×10 per well of a 96-well plate 4 5×10 4 The multi-well plate for drug screening may include, but is not limited to, Corning®96-well Spheroid Microplates (Cat. no. 4515) from Corning, but is not limited thereto, and plates from other manufacturers that can play an equivalent role may be introduced and used. In the case of the 3D organoid according to the present invention, it is preferable because even if the number of wells increases, changes in the amount of insulin secretion according to the treatment of candidate drugs can be measured accurately and at high speed.
[0052] The type of the above collagen component is not particularly limited as long as it is collagen that can be used for pancreatic islet organoid culture, but for example, an extracellular matrix can be used, and specifically, human-derived collagen type IV can be used, which can differentiate two-dimensionally manufactured endocrine cells into a stable and highly mature pancreatic islet organoid form, and the human placenta-derived type IV collagen is preferably contained in a content of 5 to 20 μg / mL, preferably 7 to 20 μg / mL, and even more preferably 7 to 15 μg / mL. If the collagen content is insufficient, cell maturation of the pancreatic islet organoid may decrease, making it impossible to perform a glucose-stimulated insulin secretion (GSIS) test for drug screening. In consideration of the stability and cost-effectiveness of the pancreatic islet organoid as in the examples of the present invention, a content of 10 μg / mL is preferred.
[0053] The method for inducing type 2 diabetes in the above pancreatic islet organoid is not particularly limited, but in the present invention, it may be induced by adding free fatty acids, glucose, and inflammatory cytokines.
[0054] The type of the above free fatty acid is not particularly limited, and as a specific example, palmitate can be used, and it is preferable to include it at a concentration of 0.5 to 2.5 mM, preferably 1.0 to 2.0 mM, and more preferably 1.2 to 1.7 mM.
[0055] The concentration of glucose for inducing high glucose stress is not particularly limited, but is preferably comprised of, for example, 20 to 50 mM, preferably 20 to 40 mM, and even more preferably 25 to 35 mM.
[0056] The type of inflammatory cytokine for inducing inflammatory stress in pancreatic islet organoids is not particularly limited, but as a specific example of the present invention, IL-1β and TNFα can be used, and the range of the concentration to be treated is not particularly limited in the case of IL-1β, 10 to 30 ng / mL, preferably 10 to 25 ng / mL, and more preferably 10 to 20 ng / mL, and in the case of TNFα, 100 to 200 ng / mL, 100 to 175 ng / mL, and more preferably 100 to 150 ng / mL, but is not limited thereto, and as in a specific embodiment of the present invention, it can be 10 ng / mL IL-1β and 100 ng / mL TNFα. If the concentration is lower than the above, type 2 diabetes is not sufficiently induced, which is not good. For type 2 diabetes-inducing substances, the treatment time is not particularly limited. For example, it can be 2 to 5 days, preferably 2.5 to 4 days, and even more preferably 2.5 to 3.5 days. Specifically, a treatment period of approximately 3 days is most preferred. If the treatment period is too short, diabetic characteristics may not be induced, and if treatment is performed, severe cell damage to pancreatic islet organoids may occur, making it difficult to confirm the diabetes treatment effect of the drug candidate.
[0057] Methods for measuring the progression of type 2 diabetes are not particularly limited, and any measurement method capable of quantitatively measuring relevant indicator substances may be introduced and used without limitation. Examples of methods for analysis include, but are not limited to, the GSIS test used in one embodiment of the present invention, a method for confirming related gene expression through qRT-PCR, or a method for measuring the increase or decrease in insulin secretion or inflammatory cytokines.
[0058] In order to screen drug candidates for the treatment of type 2 diabetes, the drug candidates can be treated on type 2 diabetes-induced pancreatic islet organoids for 1 to 5 days, preferably 2 to 4 days, and more preferably 2 to 3 days, to determine the effect of improving insulin secretion, but is not limited thereto. A specific embodiment of the present invention includes the results of determining insulin secretion by treating normal and disease-induced pancreatic islet organoids with three commercially available therapeutic agents for 2 days. The effect on reference substances can include, but is not limited to, the GSIS test to determine insulin secretion.
[0059] The efficacy of drug candidates can primarily, but not limited to, assessing their effects on hormone stimulation, including insulin, and the secretion of inflammatory cytokines. It can also include efficacy assessments related to oxidative stress, endoplasmic reticulum (ER) and mitochondrial stress. Drug efficacy can be confirmed using, but is not limited to, the GSIS assay, ELISA, qRT-PCR, Western blot, or immunostaining. For the initial selection of drug candidates, it is recommended to perform the GSIS assay and inflammatory cytokine measurement, and then confirm the level of insulin and inflammatory cytokine secretion using ELISA. Protein secretion, including insulin, can be assessed using, but is not limited to, ELISA or HTRF testing. Measurement of insulin secretion and inflammatory stress enables rapid screening of drug candidates for the treatment of type 2 diabetes using pancreatic islet organoids. The organoids used in the above tests can be used to measure the number of cells or the total amount of DNA contained within the organoids, and the measured values can be used for normalization against the insulin secretion value.
[0060] The type 2 diabetes disease simulating and drug screening platform or system of the present invention relates to a method for producing pancreatic islet organoids differentiated from human-derived stem cells at the drug screening level. The screening platform according to the present invention is preferable because it contains alpha and delta cells in addition to beta cells within a three-dimensional structure, and thus has remarkably high functional and physical similarity to the human body. In particular, the pancreatic islet organoids previously published have the disadvantage that they cannot uniformly produce organoids with a consistent size and shape, and it is difficult to apply them to the drug screening level after differentiation is completed.
[0061] In the type 2 diabetes disease simulating and drug screening platform according to the present invention, human-derived collagen is treated together during pancreatic islet organoid culture at the high-speed screening level so that the organoids can be uniformly and stably differentiated at the level for drug screening, and in addition, it is a scaffold-free type culture method that does not require a physical structure in the form of a scaffold such as Matrigel, which is mainly used in 3D culture, so that not only does it allow the drug to directly contact the cells constituting the organoid, but it also has the surprising advantage of having almost no restrictions on the types of drug efficacy evaluation experiments that can be applied.
[0062] Another aspect of the present invention relates to a method for providing information for selecting a drug for treating type 2 diabetes, comprising a step of determining that a drug candidate substance screened through the above screening method is effective in treating type 2 diabetes.
[0063] Another aspect of the present invention relates to a pharmaceutical composition for treating type 2 diabetes, comprising a drug candidate substance screened through the above screening method as an active ingredient.
[0064] The pharmaceutical composition according to the present invention can be administered in a pharmaceutically effective amount.
[0065] In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined according to the type and severity of the patient's disease, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the excretion rate, the duration of treatment, the concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by those skilled in the art.
[0066] The composition of the present invention may be used in combination with various treatments that can be recognized by those skilled in the art as being effective in treating type 2 diabetes, as well as other pharmaceutical compositions for treating type 2 diabetes.
[0067] The present invention provides a pharmaceutical preparation comprising the pharmaceutical composition for treating type 2 diabetes.
[0068] The screening method of the present invention may further include a food-based acceptable food additive, along with one or more of the compounds screened. The food additive may be used in combination with other foods or food ingredients, and may be appropriately used according to conventional methods. The amount of active ingredients mixed may be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment).
[0069]
[0070] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.
[0071] [Materials, Reagents, and Method Information]
[0072] [reagent]
[0073] - Other reagents were purchased from Sigma-Aldrich (St. Louis, MO) and used.
[0074] [Statistical Analysis]
[0075] The measurement results obtained through repeated experiments were expressed as mean ± standard deviation (SD), and statistical significance was analyzed using GraphPad Prism software (GraphPad Software Inc., La Jolla, CA, USA).
[0076] Statistical significance was analyzed using Student's t test or one-way analysis of variance (ANOVA) followed by Tukey's multiple-comparison test.
[0077]
[0078] [Example 1] Production of pancreatic islet organoids and induction of type 2 diabetes
[0079] 1-1. Differentiation induction of pancreatic islet organoids derived from human pluripotent stem cells
[0080] Differentiation into islet organoids was induced using human pluripotent stem cells H1 (WiCell) using the following method.
[0081] Specifically, pancreatic islet organoid differentiation was induced according to the overall contents disclosed in the previous protocol (Hogrebe et al. Nat Portoc 16, 4109-4143, 2021), but the cell concentration at the time of initial inoculation was 0.63 x 10 6 cells / cm 2 It was done as follows.
[0082] At differentiation stage 6 of the above protocol, after differentiation in a two-dimensional state was induced for 7 days, cell detachment was induced using Accutase (Stemcell, Cat. No. 07920). Cells were seeded at 2.5 x 10 in ESFM medium (prepared according to Hogrebe et al. Nat Portoc 16, 4109-4143, 2021). 4 After manufacturing cells / well, they were seeded into 96-well Spheroid Microplates (Corning, USA; Cat. No. 4515), which are 96-well ultra-low attachment plates, and cultured in an incubator at 37°C and 5% CO2.
[0083] The results are presented in Figure 1.
[0084] As described above, pancreatic islet organoids produced in 6-well plates are not uniform in size and shape and show differences in the degree of differentiation of the organoids, making them unsuitable for drug screening. On the other hand, 3D pancreatic islet organoids cultured in 96-well plates have uniform shape and size, making them suitable for drug screening immediately after differentiation and reducing variability between samples.
[0085] 1-2. Addition of collagen type 4 for high-speed screening
[0086] In order to induce maturation and stability of beta cells in the 96-well cultured pancreatic islet organoids in the above example, 48 hours after the production of the 3D pancreatic islet organoids, collagen type 4 (Advanced Biomatrix, Cat. No. 5022) extracted from human placenta was added to the culture medium and then cultured.
[0087] Specifically, pancreatic islet organoids were cultured for 14 days in culture medium containing 5, 10, and 20 μg / mL collagen type 4, respectively. The effects of collagen on beta cells and pancreatic islet organoids were evaluated through apoptosis and glucose-stimulated insulin secretion (GSIS) assays in pancreatic islet organoids.
[0088] At this time, cell death was confirmed through an LDH release test, and the amount of LDH present in the medium supernatant was analyzed using CytoTox 96®Non-Radioactive Cytotoxicity Assay (Promega, Cat. no. 1781) every 7, 10, and 14 days during culture, and the analysis method was performed according to the protocol provided by the manufacturer.
[0089] As a specific example of the above protocol, 50 μL of the medium supernatant was transferred to a new 96-well plate, 50 μL of CytoTox 96® Reagent was added, and the reaction was allowed to proceed for 30 minutes at room temperature, protected from light. After 1 hour, 50 μL of stop solution was added to terminate the reaction, and the absorbance was measured at 490 nm within 1 hour. Glucose-stimulated insulin secretion (GSIS) test was performed in Krebs buffer (KrB; 128 mM NaCl, 5 mM KCl, 2.7 mM CaCl 2· The GSIS test was performed using 2 mM 2H2O, 1.2 mM MgSO4, 1 mM Na2HPO4, 1.2 mM KH2PO4, 5 mM NaHCO3, 10 mM HEPES, and 0.1% (wt / vol) BSA, pH 7.4. When performing the GSIS test, the low concentration glucose was used at a concentration of 2 mM, and the high concentration glucose was used at a concentration of 20 mM, respectively.
[0090] On days 7, 10, and 14 of 96-well culture, each islet organoid was washed three times with 180 μL KrB and then once with KrB containing 2 mM glucose (MilliporeSigma, Cat. no. G7528). 100 μL of KrB containing 2 mM or 20 mM glucose was dispensed into each well and cultured for 1 hour. 40 μL of the supernatant was then transferred to a new 96-well plate, and the concentration of secreted insulin from the islet organoids was measured.
[0091] The KrB supernatant was harvested and stored at -80°C, and an insulin ELISA test was performed within several weeks. The amount of secreted insulin present in the supernatant was measured using a Human insulin ELISA Kit (ALPCO, Cat. no. 80-INSHU-E01.1). The KrB supernatant was diluted 3-5 times with fresh KrB, and the ELISA test was performed according to the manufacturer's protocol.
[0092] Organoids that completed the glucose-stimulated insulin secretion (GSIS) test were then used for normalization by measuring cell viability using the CellTiter-Glo®3D Cell Viability Assay Kit.
[0093] For specific normalization, an equal amount of CellTiter-Glo®3D Reagent was added to a plate containing KrB and islet organoids, and the plate was incubated at room temperature for 5 minutes in a shaking incubator at 700–800 rpm, followed by incubation for 25 minutes. A portion of the supernatant was then transferred to an opaque 96-well plate, and the luminescence wavelength was measured. The values obtained from the insulin ELISA test were divided by the relative luciferase unit (RLU) value, and the control group was set to 1 and displayed.
[0094] The above test results are shown in Figures 2 and 3.
[0095] As a result, the LDH efflux test results confirmed that cell death was significantly reduced after 14 days of culture in a culture medium containing 10 μg / mL or more of collagen type 4, and the morphology of the pancreatic islet organoids confirmed under a microscope that the morphology cultured in a culture medium containing collagen type 4 was stable (see Fig. 2).
[0096] In addition, as a result of performing the glucose-stimulated insulin secretion assay (GSIS assay) of pancreatic islet organoids, it was confirmed that the experimental group treated with collagen at 10 μg / mL or more from 7 days after differentiation showed a significant difference in insulin secretion according to glucose concentration (see Fig. 3).
[0097] From the above, it was confirmed that the addition of collagen type 4 during pancreatic organoid culture reduced cell death and increased the response of beta cells to glucose-stimulated ingulin secretion, and this was applied to the following examples.
[0098] 1-3. Insulin secretion according to the type of extracellular matrix (ECM)
[0099] To determine whether there is a difference in insulin secretion of pancreatic islet organoids depending on the type of extracellular matrix, 5 and 10 μg / mL of laminin (Sigma-Aldrich, Cat. no. L2020), the most commonly used ECM protein, was administered simultaneously with or alone the collagen type 4 for 5 days, and insulin secretion was evaluated using the glucose-stimulated insulin secretion assay (GSIS assay).
[0100] The results are shown in Figure 4.
[0101] From this, it was confirmed that insulin secretion according to glucose stimulation was confirmed only in pancreatic islet organoids containing 10 μg / mL of collagen type 4, and that the addition of laminin did not respond properly to glucose stimulation, and in the experimental group that was simultaneously administered laminin and collagen type 4, the amount of insulin secretion did not increase in response to high concentration glucose stimulation, confirming that the addition of laminin, an ECM protein, did not affect the stability and maturity of pancreatic islet organoids. Therefore, in the following examples, only collagen type 4 was added and utilized to improve the stability and maturity of pancreatic islet organoids.
[0102] 1-4. Induction of Type 2 Diabetes Using Human Pluripotent Stem Cell-Derived Pancreatic Islet Organoids
[0103] Type 2 diabetes was induced in the pancreatic islet organoids produced through the above example using the following method.
[0104] Type 2 diabetes was induced by administering a combination of specific inducers, including 1.5 mM palmitate (Sigma-Aldrich), an unsaturated fatty acid, 30 mM high glucose (Sigma-Aldrich; High Glucose, HG), and 10 ng / mL of human IL-1β Systems (10 ng / mL) and 100 ng / mL of human TNFα (Peprotech), to pancreatic islet organoids.
[0105] The above-mentioned inducers were added to pancreatic islet organoids along with the medium for 3, 5, and 7 days, and the expression of genes associated with type 2 diabetes was confirmed by qRT-PCR analysis. Eight to ten pancreatic islet organoids were collected from each experimental group, and RNA was extracted. RNA was extracted using the Rneasy Mini Kit (Qiagen, Cat. No. 74004), and cDNA was synthesized from 500 μg of RNA.
[0106] The PCR primer combinations used in the above qRT-PCR are listed in Table 1 below.
[0107] qRT-PCR 프라이머유전자정방향역방향Tm (℃)산물 (bp)IAPPCAGCTGCAATGTTGGACAGAACGCAGCATGATGGCAGTTTAT60133InsulinCTACCTAGTGTGCGGGGAACATTGTCCACAATGCCACGC60167PDX1GGGAAAACCCGCTCTCTCAGCCAAGGTGGAGTGCTGTAGG6018GAACGACAGGAGGGAGGGAGA GCAAATGCCCGGAACTTTTTCTTT60(1)Ngn3CGGTAGAAAGGATGACGCCTGGTCACTTCGTCTTCCGAG60241TXNIPGGCCTTAAAGGATGCGGACTCTTACGCCAGGAGGCCATTT60179sXBP1gctgagtccgcagcaggtctc 30(2)CHOPAATGAACGGCTCAAGCAGGAAGCCACTTCTGGGAAAGGTG60159Atf3ACCGTTAGGATTCAGGCAGCTCACTCCACATCCCCTACGA60102TRIB3CCAACCCGATCCCATCTCTGGCTGAGCGTGTAGTAGGGTG60131AGCAGCAGCAGCAGGTCAGGT1 ATTGGGTTTGCTTGTCCAGGT60120IL-1βTCTTCCTGGGAGGGACCAAAAGCCCTAGGGATTGAGTCCA60122TNFaCACAGTGAAGTGCTGGCAACAGGAAGGCCTAAGGTCCACT60185iNOSCGCATGACCTTGGTGTTTGGCATAGACCATGCCTT201818GGCTT rRNAGTAACCCGTTGAACCCCATTCCATCCAATCGGTAGTAGCG60100(1) Nathaniel J. Hogrebe et al., 2021, Nature Protocols, https: / doi.org / 10.1038 / s41596-021-00560-y(2) Yoon SB, ONE et al., 2019, PL. https: / / doi.org / 10.1371 / journal.pone.0219978
[0108] The CT values obtained from the above qRT-PCR were quantified using the delta delta Ct method and normalized using the 18S rRNA quantitative value. At this time, the value of the untreated pancreatic islet organoid (control group) was set to 1, and the expression of each gene was expressed as a fold-increase value. The results are shown in Figs. 5 and 6. First, Fig. 5 shows the results of analyzing the expression of type 2 diabetes-related genetic factors according to a combination of one or more selected type 2 diabetes inducers. As the inducers, free fatty acids, inflammatory cytokines, and high-concentration glucose, which were obtained through prior research, were combined, and one or more combinations were treated at a fixed constant concentration to pancreatic islet organoids for 3 to 7 days, and then the expression of type 2 diabetes-related gene markers was analyzed.
[0109] As a result, 1.5 mM palmitate increased the expression of sXBP1 and IAPP, which are genes related to beta cell death, but there was no significant difference in the expression of TXNIP, which is involved in glucose toxicity and beta cell death in beta cells of type 2 diabetes, and genes related to inflammatory stress (MCP1, IL-1βTNFα).
[0110] When treated alone with a cytokine mix (CM) of 10 ng / mL IL-1β and 100 ng / mL TNFα, the expression of genes related to inflammatory stress (MCP1, IL-1βTNFα) and beta cell dedifferentiation (Ngn3) increased, but no significant difference was observed in the expression of genes related to beta cell death (IAPP and TXNIP, etc.). In addition, when treated alone with 30 mM glucose, the expression of genes related to beta cell death increased, but the effect was so minimal as to be insignificant.
[0111] As a result of treatment with a combination of the above cytokine mix and two glucose inducers, the expression of beta cell apoptosis, inflammatory stress, and beta cell dedifferentiation genes associated with type 2 diabetes increased in various ways, but the effects were so minimal as to be insignificant.
[0112] From the results of the above comparative experiments, it was confirmed that it is absolutely necessary to administer all three inducers in combination.
[0113] Next, Fig. 6 shows the results of analyzing the expression of 14 genes related to six representative beta cell characteristics in type 2 diabetes, namely beta cell function, dedifferentiation, beta cell death, endoplasmic reticulum stress, inflammatory response, and oxidative stress, which were further selected after inducing type 2 diabetes by treating pancreatic islet organoids with a combination of three inducing substances based on the results obtained in Fig. 5 above.
[0114] The expression of IAPP (Islet amyloid polypeptide), known to induce amyloid due to overexpression in pancreatic islets in type 2 diabetes, increased from 3 days after inducing type 2 diabetes, whereas the expression of insulin (Ins), PDX1, and MafB, which indicate mature beta cell function, decreased as the disease induction time increased. In addition, Ngn3, known to confirm the dedifferentiation of beta cells into pancreatic progenitor cells, was confirmed to increase from 3 days after inducing type 2 diabetes. Dedifferentiation is a phenomenon commonly observed in beta cells of type 2 diabetes patients and plays an important role in the decrease in the number of beta cells. It was confirmed that the method for inducing type 2 diabetes according to the present invention induces dedifferentiation in beta cells in pancreatic islet organoids, thereby exhibiting the characteristics of type 2 diabetes.
[0115] The expression of five genes (TXNIP, spliced XBP1, CHOP, Atf3, Trb3) involved in endoplasmic reticulum (ER) stress and β-cell apoptosis was also confirmed to increase from 3 days after induction of type 2 diabetes, supporting the above characteristics. In addition, the expression of MCP1 and TNFα, genes involved in the inflammatory response, and iNOS, a gene related to oxidative stress (ROS stress), was confirmed to increase according to the disease induction period.
[0116] In type 2 diabetes, inflammatory stress, unlike type 1 diabetes, has a less direct effect on beta cell death, but it acts on beta cells continuously and chronically. As shown in Figure 6, the expression of genes related to inflammatory stress was confirmed, but the difference in expression was small, so the difference in expression of inflammatory cytokines was analyzed using the qPCR array technique (Qiagen, RT² Profiler™PCR Array Human Inflammatory Cytokines & Receptors, GeneGlobe ID PAHS-011Z) (see Figure 7 and Table 2). As a result of the analysis using the above method, it was confirmed that the gene expression of most chemokines, interleukins, and other cytokines increased in the model induced with type 2 diabetes (T2D) (see Figure 7). Among them, chemokines with a significantly high degree of increase were selected, and the regulation fold and p-value are shown in Table 2.
[0117] Inflammatory cytokine NO overexpressed in type 2 diabetes disease model. Gene symbol regulation (fold) p value 1 CCL 2 0.0000 19 2 CSF 12.190.00010 4 3 CX 3 CL 12.290.000025 4 CX CL 151.840.00010 7 5 CX CL 241.430.0000026 CX CL 39.660.000011 7 CX CL 6 29.360.000022 8 IL 7 2.950.0000059 CX CL 8 10.260.00000010 LTB 6.330.0000071 1 NAMPT 2.210.00010 71 2 TNFRSF 11B 2.040.000004
[0118] Based on the above qPCR array results, CXCL8 (hereinafter referred to as IL-8) and CXCL1 were selected as ELISA targets, and the secretion of IL-8 according to the induction of type 2 diabetes was confirmed, and the results are shown in Fig. 8. From this, it was confirmed that the secretion of IL-8 significantly increased when type 2 diabetes was induced, and it is expected that this can be applied to the evaluation of the efficacy of drugs targeting inflammatory stress in the future. From the above results, it was confirmed that the characteristics of type 2 diabetes were expressed in the pancreatic islet organoid model of the present invention, and it was used for high-speed screening of candidate substances that can be used for the treatment or prevention of type 2 diabetes.
[0119]
[0120] [Example 2] Screening of drug candidates for the treatment or prevention of type 2 diabetes.
[0121] 2-1. High-speed screening analysis of type 2 diabetes disease models
[0122] The evaluation of candidate substances for the treatment of type 2 diabetes was conducted by measuring the effect on insulin secretion of pancreatic islet organoids produced according to the above example, and the evaluation was performed by performing a glucose-stimulated insulin secretion assay (GSIS assay).
[0123] According to the above examples, the insulin secretion ability according to the induction of type 2 diabetes was measured by treating pancreatic islet organoids with type 2 diabetes-inducing substances for 1 to 5 days and evaluating glucose-stimulated insulin secretion. At this time, the insulin secretion value was normalized to RLU (Relative Luciferase Units) measured by CellTiter-Glo® Luminescent Cell Viability Assay (Promega, Cat. no. G7570), and the decrease or increase fold was expressed relatively by setting the low-concentration glucose stimulation for normal pancreatic islet organoids as 1.
[0124] The results are shown in Figure 9.
[0125] From this, it was confirmed that the pancreatic islet organoids in which type 2 diabetes was induced throughout the entire period did not significantly increase insulin secretion even under glucose stimulation, and in particular, it was confirmed that the total amount of insulin secreted also decreased as the treatment period of the type 2 diabetes inducing substance increased. Based on the results of Fig. 6, it can be assumed that this is due to decreased beta cell function and apoptosis.
[0126] In a type 2 diabetes model, it was confirmed that the amount of insulin secretion in response to glucose stimulation was significantly reduced compared to normal pancreatic islet organoids from day 3 after treatment with an inducer.
[0127] Additionally, as the treatment time of the type 2 diabetes-inducing substance increased, the amount of insulin secreted from the type 2 diabetes pancreatic islet organoid model also continuously decreased.
[0128] It was confirmed that treatment with inducers for more than 4 days could induce excessive death of beta cells and was therefore not suitable for evaluating candidate substances. Based on the above results, the treatment time of inducers for type 2 diabetes was set to a maximum of 3 days and applied to the evaluation of insulin secretion efficacy using reference drugs (commercially available substances).
[0129] 2-2. Evaluation of drug efficacy in type 2 diabetes models
[0130] To evaluate whether the type 2 diabetes disease model is suitable for application to screening of candidate substances for the treatment of type 2 diabetes, three drugs conventionally used for the treatment of diabetes, resveratrol (Cas Number 501-36-0; Sigma-Aldrich, Cat. no. R5010), sitagliptin (Cas Number 486460-32-6; Sigma-Aldrich, Cat. no. SML 3205), and exendin-4 (Cas Number 141758-74-9; Tocris Bioscience, Cat. no. 1933), were selected (see Figs. 10 to 12) and applied to the type 2 diabetes disease model of the above example, thereby evaluating their effects on insulin secretion, respectively.
[0131] First, the three drugs were each treated for 2 days in 96-well plate-sized normal or type 2 diabetic pancreatic islet organoids, and then glucose-stimulated insulin secretion (GSIS) assay was performed. After the evaluation, the pancreatic islet organoids were evaluated for drug toxicity and cell viability using CellTiter-Glo® Luminescent Cell Viability Assay (Promega, Cat. no. G7570), and the RLU (Relative Luciferase Units) values obtained therefrom were used for normalization of secreted insulin.
[0132] From this, it was confirmed that all three drugs enhanced insulin secretion that was reduced due to the induction of type 2 diabetes, and the efficacy of the three drugs in organoids induced with type 2 diabetes was significantly more effective than in normal organoids (see Figs. 10 to 12).
[0133] From the above results, it was confirmed that the type 2 diabetes disease pancreatic islet organoid model according to the present invention is suitable for high-speed screening of candidate substances for the treatment of type 2 diabetes disease.
[0134] Additionally, cells can be cryopreserved at stage 6, the final stage of beta cell differentiation, and applied to drug efficacy evaluation. The results of forming pancreatic islet organoids using cryopreserved and non-cryopreserved cells at stage 6 and confirming insulin secretion in response to glucose stimulation are shown in Figure 13.
[0135] Compared to the normal islet organoid (Control; Ctrl) group that did not induce type 2 diabetes, it was confirmed that the amount of insulin secreted in response to glucose stimulation did not decrease in the islet organoids formed from cryopreserved cells, and it was confirmed that when treated with a type 2 diabetes inducing substance, a decrease in insulin secretion in response to glucose stimulation was induced, similar to the previous non-cryopreserved cells.
[0136] In Fig. 14, the contents related to one embodiment of the present invention are summarized and illustrated in the form of a schematic diagram.
[0137] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. (S1) A step of inducing differentiation of pancreatic organoids from human-derived pluripotent stem cells; (S2) A step of treating the pancreatic organoid of (S1) with collagen to induce three-dimensional differentiation at the 96-well plate level; (S3) a step of inducing type 2 diabetes in the pancreatic organoid of (S2); and (S4) A step of treating the pancreatic organoid of (S3) with a drug candidate to determine the treatment effect of type 2 diabetes; A method for screening a drug candidate substance for treating type 2 diabetes, comprising:
2. In paragraph 1, A method for screening a drug candidate for treating type 2 diabetes, wherein the human-derived pluripotent stem cell is a human embryonic stem cell line H1.
3. In paragraph 2, The initial cell number of the above human embryonic stem cell line H1 was 0.55 x 10 6 Inside 0.65 x 10 6 cells / cm 2 A method for screening drug candidates for the treatment of type 2 diabetes.
4. In paragraph 1, A method for screening a drug candidate for treating type 2 diabetes, wherein the above three-dimensional differentiation induction is performed on a 96 to 384 well plate.
5. In paragraph 1, A method for screening a drug candidate for treating type 2 diabetes, wherein the collagen is human-derived collagen type IV.
6. In paragraph 5, A method for screening a drug candidate for treating type 2 diabetes, wherein the concentration of the human-derived collagen type IV is 10 to 20 μg / mL.
7. In paragraph 1, A method for screening a drug candidate for treating type 2 diabetes, wherein the type 2 diabetes is induced by adding free fatty acids, glucose, and inflammatory cytokines.
8. In paragraph 7, A method for screening a drug candidate for treating type 2 diabetes, wherein the free fatty acid is palmitate.
9. In paragraph 7, A method for screening a drug candidate for treating type 2 diabetes, wherein the glucose concentration is 20 to 50 mM.
10. In paragraph 7, A method for screening a drug candidate for treating type 2 diabetes, wherein the inflammatory cytokine is interleukin-1β (IL-1β), tumor necrosis factor α (TNFα), or a combination thereof.
11. In paragraph 1, A method for screening a drug candidate for treating type 2 diabetes, wherein the type 2 diabetes treatment effect is determined by measuring the increase or decrease in insulin secretion or inflammatory cytokines.
12. A method for providing information for selecting a drug for treating type 2 diabetes, comprising a step of determining that a drug candidate substance screened through any one of the screening methods selected from the group consisting of clauses 1 to 11 is effective in treating type 2 diabetes.
13. A pharmaceutical composition for treating type 2 diabetes, comprising as an active ingredient a drug candidate substance screened through any one of the screening methods selected from the group consisting of clauses 1 to 11.
14. A food composition for improving type 2 diabetes, containing as an active ingredient a drug candidate substance screened through any one of the screening methods selected from the group consisting of clauses 1 to 11.
Citation Information
Patent Citations
RFID tag for tire burial with improved transmission and reception sensitivity
KR102636494B1
Pancreatic extracellular matrix-derived support for pancreatic organoid culture and transplantation, and method for preparing same
WO2022108314A1