Pharmaceutical composition for cancer treatment, comprising recombinant newcastle disease virus vectors

Abstract

The present invention relates to a pharmaceutical composition for cancer treatment, comprising recombinant Newcastle disease virus vectors. The recombinant Newcastle disease virus vectors OncoK148 and OncoK14-318, which are the products of the present invention, are oncolytic viruses which are types of cancer immunotherapy agents, and may be used as cancer therapeutic agents in various animal species such as dogs, cats, humans, etc.

Description

Pharmaceutical composition for treating cancer comprising a recombinant Newcastle disease virus vector

[0001] This patent application claims priority to Republic of Korea Patent Application No. 10-2023-0170070, filed with the Korean Intellectual Property Office on November 29, 2023, the disclosure of which is incorporated herein by reference.

[0002] The present invention relates to a pharmaceutical composition for treating cancer comprising a recombinant Newcastle disease virus vector. More specifically, the present invention relates to a recombinant Newcastle disease virus vector prepared by inserting genes for Granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-12alpha into a pK148 / 08 vector prepared from the Newcastle disease virus K148 / 08 strain, a recombinant Newcastle disease virus vector in which the pathogenicity of the virus strain is reduced by inserting an additional nucleotide between the HN gene and the L gene, and a pharmaceutical composition for treating cancer comprising the same.

[0003]

[0004] In modern society, with increasing life expectancy, the mortality rate from cancer is increasing significantly, surpassing that of diseases previously considered major causes of death. Cancer occurs when normal cells undergo a shortened division cycle due to specific genetic changes, preventing them from performing their normal functions and allowing them to metastasize to other organs. For cases where surgery is difficult to treat or to improve prognosis, chemotherapy is often used in conjunction with anticancer drugs. Consequently, research on targeted anticancer drugs is actively underway. Chemotherapy drugs are broadly categorized into three generations: first-generation chemotherapy, second-generation targeted therapy, and third-generation immunotherapy. While highly effective, chemotherapy has the disadvantage of killing both normal and cancer cells. Targeted therapy, while able to distinguish between normal and cancer cells, can develop resistance. Immunotherapy drugs stimulate the immune system by injecting artificial immune proteins into the body, inducing immune cells to recognize and selectively attack cancer cells.

[0005] Third-generation cancer immunotherapies, which have recently gained attention, mainly include immune checkpoint inhibitors, immunotherapy, and immunoviral therapies. Even after discontinuation of treatment, the body's immune system remembers the cancer cells, maintaining a defense mechanism against them. This allows for longer-lasting therapeutic effects compared to existing anticancer drugs. Among these, oncolytic viruses recognize specific cancer cell characteristics and specifically target and eliminate them. While oncolytic viruses can directly kill cancer cells, they also have the advantage of activating the body's immune system by presenting tumor-associated antigens released from dead cancer cells. Furthermore, even if they fail to directly kill cancer cells, they can transform cold cancer, a major challenge in solid tumor treatment, into hot cancer, maximizing the efficacy of existing anticancer drugs.

[0006] Newcastle disease virus (NDV) is a type of oncolytic virus that exhibits cancer-killing properties. Unlike the commonly used HSV-1 and adenovirus, it is known to attack only specific cancer cells and does not cause direct disease in humans. NDV has excellent proliferation in embryonated eggs, allowing for high-titer virus production without concentration. Because it propagates in embryonated eggs, it is easy to propagate the virus without special facilities. NDV is an RNA virus, so its genetic material does not insert into the cell nucleus, making it safe. Unlike DNA viruses, RNA viruses have small genomes, making genetic manipulation easier, making it easy to insert foreign genes.

[0007]

[0008] The present inventors have conducted extensive research efforts to develop a pharmaceutical composition for cancer treatment using the Newcastle disease virus (NDV). As a result, using reverse genetics technology, we inserted two cytokines (GM-CSF and IL-12a) into the genes of the low-pathogenic Newcastle disease virus strain K148 / 08, creating an oncolytic virus, a type of immunotherapy, and confirmed its superior cancer cell killing efficacy. Furthermore, we confirmed that inserting 318 nucleotides before the L gene reduced pathogenicity, leading to the completion of the present invention.

[0009] Accordingly, it is an object of the present invention to provide a recombinant Newcastle disease virus vector comprising a nucleic acid molecule encoding hGM-CSF and a nucleic acid molecule encoding hIL-12alpha.

[0010] Another object of the present invention is to provide a recombinant Newcastle disease virus vector comprising a nucleic acid molecule encoding hGM-CSF and a nucleic acid molecule encoding hIL-12alpha, and having reduced pathogenicity by inserting a nucleotide before the L gene.

[0011] Another object of the present invention is to provide a pharmaceutical composition for treating cancer comprising the recombinant Newcastle disease virus vector as an active ingredient.

[0012]

[0013] According to one aspect of the present invention, the present invention provides a recombinant Newcastle disease virus vector comprising a nucleic acid molecule encoding hGM-CSF and a nucleic acid molecule encoding hIL-12alpha.

[0014] In one embodiment of the present invention, the hGM-CSF comprises an amino acid sequence encoded by the nucleotides of SEQ ID NO: 9.

[0015] In one embodiment of the present invention, the hIL-12alpha is composed of an amino acid sequence encoded by the nucleotide sequence number 10.

[0016] In one embodiment of the present invention, the nucleotide sequence encoding hGM-CSF and hIL-12alpha includes a Kozak sequence upstream of these genes.

[0017] In the present invention, the term "Kozak sequence" refers to an amino acid sequence of a specific DNA or mRNA that plays a crucial role in gene expression. This sequence is primarily found in eukaryotic mRNA and plays a crucial role in determining where the ribosome recognizes the mRNA and initiates translation (protein synthesis). The Kozak sequence is typically located around the AUG start codon and significantly influences mRNA translation efficiency, thereby regulating how effectively a specific gene is translated into protein. Therefore, it is a crucial regulatory element in gene expression.

[0018] In a specific embodiment of the present invention, the Kozak sequence is CC or CGCCACC, but is not limited thereto.

[0019] In one embodiment of the present invention, the Newcastle disease virus genome comprises genes of NP, P, M, F, HN, and L sequentially in the 5' to 3' direction.

[0020] In addition, in one embodiment of the present invention, it may further include a T7 promoter, leader sequence and 3' UTR sequence linked to the 5'-terminus of the NP protein encoding gene, and a 5'UTR, trailer sequence and T7 terminator sequence at the 3'-terminus of the L protein encoding gene.

[0021] According to a specific embodiment of the present invention, the Newcastle disease virus vector usable in the present invention may be a lentogenic vector, more specifically, a linear plasmid vector, and most specifically, a Newcastle disease virus vector derived from NDV K148 / 08 deposited under the deposit number KCTC 11570BP.

[0022] In one embodiment of the present invention, the nucleic acid molecule encoding the hGM-CSF may be inserted between the P gene and the M gene, but is not limited thereto.

[0023] In another embodiment of the present invention, the nucleic acid molecule encoding hIL-12alpha may be inserted between the M gene and the F gene, but is not limited thereto.

[0024] In one embodiment of the present invention, the recombinant Newcastle disease virus vector may have a multibasic cleavage site (MBCS) peptide 111-GGKQGR / L-117 substituted with 111-GRRQKR / F-117 at amino acid positions 111 to 117 of the F gene. The substitution of the MBCS enhances the cancer-killing ability of the recombinant Newcastle disease virus vector of the present invention.

[0025] In a specific embodiment of the present invention, the recombinant Newcastle disease virus vector may comprise the nucleotide of SEQ ID NO: 18.

[0026] In one embodiment of the present invention, the Newcastle disease virus genome may sequentially include genes of NP, P, M, F, HN, and L, and a nucleotide of sequence number 19 may be inserted between the HN and L genes.

[0027] The nucleotide of the above sequence number 19 is a sequence derived from K148 / 08 NP CDS and HN-L NCR. Among the nucleotides of the above sequence number 19, the base sequence derived from K148 / 08 NP CDS is represented by sequence number 21, and the base sequence derived from HN-L NCR is represented by sequence number 22.

[0028] The insertion of the nucleotide of SEQ ID NO: 19 reduces the replication ability of the recombinant Newcastle disease virus vector of the present invention and reduces the ICPI, which is an index of pathogenicity of the Newcastle disease virus, to 0.7 or less. If the ICPI, which is an index of pathogenicity of the Newcastle disease virus, is 0.7 or less, it is classified as lentogenic and can be handled in a BL2 facility, not a BL3 facility. Therefore, the recombinant Newcastle disease virus vector of the present invention, in which the nucleotide of SEQ ID NO: 19 is inserted between the HN and L genes, can be used in a BL2 facility. However, the insertion of the nucleotide of SEQ ID NO: 19 does not adversely affect the killing ability of the recombinant Newcastle disease virus vector of the present invention.

[0029] In a specific embodiment of the present invention, the recombinant Newcastle disease virus vector may comprise the nucleotide sequence of SEQ ID NO: 20. The recombinant Newcastle disease virus of the present invention comprising the nucleotide sequence of SEQ ID NO: 20 is named "OncoK148-318".

[0030] In another aspect of the present invention, the present invention provides a Newcastle disease virus vector, which sequentially comprises the genes of NP, P, M, F, HN, and L described above, and wherein a nucleotide of SEQ ID NO: 19 is inserted between the HN and L genes.

[0031] The above Newcastle disease virus vector may be in a form that does not include the nucleic acid molecule encoding the above-described hGM-CSF and the nucleic acid molecule encoding hIL-12alpha.

[0032]

[0033] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for treating cancer, comprising the recombinant Newcastle disease virus vector described above as an active ingredient.

[0034] The pharmaceutical composition of the present invention can be administered to animals including mammals and birds, wherein the mammals include, but are not limited to, dogs, cats, mice, rats, rabbits, humans, apes, etc. The birds can include, but are not limited to, chickens, ducks, geese, turkeys, etc.

[0035] The pharmaceutical composition of the present invention may be administered via routes such as intranasal, oral, intradermal, intramuscular, intraperitoneal, intraperitoneal, intravenous, conjunctival, and subcutaneous, but is not limited thereto.

[0036] The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with another therapeutic agent, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple times.

[0037] The pharmaceutical composition of the present invention is an immuno-oncology agent and can be administered together with an immunostimulant that enhances immune activity.

[0038] In one embodiment of the present invention, the pharmaceutical composition reduces cancer metastasis.

[0039] In one embodiment of the present invention, the cancer may be a solid cancer such as breast cancer, lung cancer (small cell lung cancer, non-small cell lung cancer), stomach cancer, colorectal cancer (rectal cancer, colon cancer), liver cancer, pancreatic cancer, kidney cancer, bladder cancer, testicular cancer, prostate cancer, skin cancer, melanoma, nasopharyngeal cancer, head and neck cancer, brain cancer, ovarian cancer, uterine cancer, cervical cancer, bone cancer, sarcoma, fibrosarcoma, but is not limited thereto.

[0040] In another embodiment of the present invention, the cancer may be a blood cancer such as, but not limited to, acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, lymphoma, multiple myeloma, etc.

[0041]

[0042] The present invention provides a recombinant Newcastle disease virus vector comprising a nucleic acid molecule encoding hGM-CSF and a nucleic acid molecule encoding hIL-12alpha, and a pharmaceutical composition comprising the same for treating cancer. The recombinant Newcastle disease virus vectors OncoK148 and OncoK148-318, which are products of the present invention, are oncolytic viruses, a type of immunotherapy, and can be used as cancer therapeutics in various animal species, including dogs, cats, and humans.

[0043]

[0044] Figure 1 is a schematic diagram showing a method for producing OncoK148, a recombinant NDV produced using the NDV 148 virus strain of the present invention.

[0045] Figure 2 is a diagram showing the tumor size after administration of conventional K148 and rK148-GRRQKR in BALB / c nude tumor-induced by HT1080 to confirm the cancer-killing ability of the recombinant NDV of the present invention according to the difference in MBCS (K148 vs. rK148-GRRQKR).

[0046] Figure 3 is a PCR band photograph confirming that NCR+hGM-CSF is inserted between the P and M genes of OncoK148, a recombinant NDV of the present invention, and NCR+hIL-12a is inserted between the M and F genes.

[0047] Figure 4 is a diagram showing the results of ELISA performed to confirm the expression of hGM-CSF (A) and hIL-12alpha (B) of OncoK148, a recombinant NDV of the present invention.

[0048] Figure 5 is a diagram comparing the growth curves of OncoK148 and rK148-GRRQKR, which are recombinant NDVs of the present invention.

[0049] Figure 6 is a diagram showing the tumor size (A) and survival rate (B) after OncoK148 was injected into C57BL / 6 mice induced with tumors from the melanoma cell line B16-F10.

[0050] Figure 7 is a diagram showing the tumor size after OncoK148 was injected into BALB / c mice in which tumors were induced by the breast cancer cell line 4T1.

[0051] Figure 8 is a schematic diagram showing a method for producing OncoK148-318, a recombinant NDV produced using the NDV 148 virus strain of the present invention.

[0052] Figures 9a and 9b are diagrams showing the results of ELISA performed to confirm the expression of hGM-CSF and hIL-12alpha of the OncoK148-3218 virus of the present invention.

[0053] Figure 10 is a diagram showing the tumor size after a single injection of OncoK148 and OncoK148-318 into nude BALB / c mice induced with tumors from the fibrosarcoma cell line HT1080.

[0054] Figure 11 is a diagram showing the tumor size after multiple injections of OncoK148 and OncoK148-318 into nude BALB / c mice induced with tumors from the fibrosarcoma cell line HT1080.

[0055] Figures 12a and 12b are diagrams showing tumor size and lung weight after OncoK148 and OncoK148-318 were injected into BALB / c mice induced with tumors from the breast cancer cell line 4T1.

[0056]

[0057] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0058]

[0059] Example

[0060]

[0061] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0062]

[0063] <Example 1: Construction of OncoK148 Viral Vector>

[0064]

[0065] Experimental materials and methods

[0066]

[0067] 1. Cells and viruses used

[0068] Chicken embryo fibroblast (CEF), Hep-2, and B16-F10 cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 8% fetal bovine serum and antibiotics. 4T1 and HT1080 cell lines were also cultured in RPMI 1640 (Roswell Park Memorial Institute) supplemented with 8% fetal bovine serum and antibiotics.

[0069] The method for constructing K148 NDV (KCTC 11570BP) as a plasmid has been described in a previous experiment [Korean Patent Publication No. 10-2022-0109351]. A modified Vaccinia Ankara T7 recombinant virus (MVA-T7) for supplying T7 transcriptase was provided by Bernard Moss (National Institutes of Health, USA). The MVA-T7 virus was cultured in CEF cells for future use.

[0070]

[0071] 2. Construction of pOncoK148 clone containing the genes for hGM-CSF and hIL-12a

[0072] Muta-direct cleavage site of the F gene of K148 virus strain TM The site-directed mutagenesis kit was used to modify the gene as shown in Table 1 (pK148-GRRQKR).

[0073]

[0074] Multibasic cleavage site motif change classification K148 F MBCS (origin) Changed F MBCS (OncoK148) Amino acid sequence GGKQGR / LGRRQKR / F

[0075]

[0076] pK148-GRRQKR was linearized to allow insertion of the untranslated region (UTR) between the P and M genes of the K148 full-length gene cDNA clone and the cDNA fragment of the hGM-CSF gene. The hGM-CSF gene and NCR were amplified by PCR and cloned into the RBC TA cloning vector (RBC Bioscience, Taipei, Taiwan). Muta-direct TM A Kozak sequence (CC) was inserted upstream of the ATG of the hGM-CSF gene using a site-directed mutagenesis kit (iNtRON Biotechnology, Korea). The cDNAs of the NCR and hGM-CSF gene were inserted between the P and M genes of pK148-GRRQKR using an In-Fusion® PCR cloning kit (Clontech, Mountain View, CA). pK148-GRRQKR was linearized to allow insertion of the cDNA fragment of the untranslated region (UTR) between the M and F genes of the hIL-12a gene cDNA clone. The hIL-12a gene and NCR were amplified by PCR and cloned into the RBC TA cloning vector (RBC Bioscience, Taipei, Taiwan). Muta-direct TM A Kozak sequence (CGCCACC) was inserted upstream of the ATG of the hIL-12a gene using a site-directed mutagenesis kit (iNtRON Biotechnology, Korea). The cDNA of the NCR and hIL-12a gene was generated by In-Fusion ®A PCR cloning kit (Clontech, Mountain View, CA) was used to insert a fragment between the M and F genes of pK148-GRRQKR. This resulted in the construction of the pOncoK148 clone (Fig. 1). Primers for linearizing pK148 and for infusing hGM-CSF and hIL-12a with the linearized pK148 are described in Table 2.

[0077]

[0078] Primer sequence numbers used to construct pOncoK148 clone. Primer name. 15'- TTAGCCATTCAGTGCAAGGCGC - 3'PM Insertion-up. 25'- TCACCACTGCAGCTCGCAGC - 3'PM Insertion-down. 35'- gcactgaatggctaaCCGACAACACCCAGCTCGC - 3'Infusion UTR-hGM-CSF_F. 45'- gagctgcagtggtgaTCACTCCTGGACTGGCTCCC - 3'Infusion UTR-hGM-CSF__R. 55'- GCTGCATCTCTGAGATTACACTC - 3'MF Insertion-up. 65'- CTATTTCTTGAAAGGATTGTATTTGGC - 3'MF Insertion-down. 75'- cctttcaagaaatagTCACCACTGCAGCTCGCAGCC - 3'Infusion UTR-hIL-12a_F. 85' - tctcagagatgcagcTTAGGAGCATTCAGATAGCTCATC - 3'Infusion UTR-hIL-12a_R

[0079] pOncoK148 clone was amplified in HIT-DH5α competent cells at 37°C for 18 h and purified using PureLink TM -Purified using the HiPure plasmid midiprep kit.

[0080]

[0081] 3. Virus rescue and proliferation

[0082] Two plasmids encoding full genome cDNA (pOnco148 and pK148-GRRQKR) and three supporting plasmids (N, P, and L) were transfected into Hep-2 cells. To supply T7 transcriptase, Hep-2 cells cultured in 6-well plates were infected with the MVA-T7 virus. pK148 / 22-HA 8.8 ug, pSupport_NP 1 ug, pSupport_P 0.1 ug, and pSupport_L 0.1 ug were mixed and transfected into Hep-2 cells using Lipofectamine 3000 (Thermo Fisher Scientific, California, USA). After culturing for 1 hour in a 37℃ incubator, the cells were washed once with PBS, the medium was replaced with Opti-MEM media, and cultured for 72 hours under 37℃, 5% CO2 conditions. Afterwards, the cells were frozen and thawed once to harvest the OncoK148 virus. The harvested virus was inoculated into 10-day-old SPF fertilized eggs and cultured at 37℃ for 3 days. After 3 days of culture, the inoculated eggs were refrigerated at 4℃ for 1 hour, and Allantoic Fluid was used for Hemagglutination Assay (HA) to detect the rescued virus. HA-positive samples were filtered through a 0.45 μm syringe filter (Ministart RC 15, Sartorius Stedim Biotech, Germany) and subcultured into 10-day-old SPF fertilized eggs. Allantoic fluid from the eggs was harvested, aliquoted, and stored at -80°C for further experiments.

[0083]

[0084] 4. Virus gene insertion and growth curve analysis

[0085] To confirm whether two cytokines were inserted into the genes of rescued oncoK148, RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using the SuperScript IV first-Strand system (Thermo Fisher Scientific, California). Gene insertion was confirmed through gene amplification by PCR. In addition, the stability and amplification characteristics of the OncoK148 virus were confirmed by diluting 10-fold K148-GRRQKR and OncoK148 virus (100 EID 50 ) was inoculated into 10-day-old SPF fertilized eggs. The allantoic fluid of the inoculated eggs was collected at 12, 24, 36, 48, 60, and 72 hours, and RNA from the virus culture at each time point was extracted and the amount of virus was quantified through qPCR. The CT value was calculated as EID through a standard curve. 50 / Converted to mL.

[0086]

[0087] 5. Confirmation of cytokine expression

[0088] To confirm the expression of cytokines inserted into the rescued OncoK148 virus, cells were infected with CEFs. Supernatants were collected every 12 hours for up to 72 hours after infection. The collected supernatants were used to detect hGM-CSF and hIL-12 alpha, respectively, using ELISA.

[0089]

[0090] 6. Animal testing (mice)

[0091] 6-1. MBCS difference confirmation test of K148 F protein

[0092] Fifteen 6-week-old BALB / c nude mice were purchased from Orient Bio. They were raised according to the groups shown in Table 3 below.

[0093] Test to confirm MBCS differences of K148 F protein using mice Group Virus name (live virus) Injection dose Age Livestock Number of livestock Injection cancer cell line G1 K148 10 8.0 EID 50 6wBLAB / c nude5HT1080G2K148-GRRQKR10 8.0 EID 50 6wBLAB / c nude5HT1080G3PBS-6wBLAB / c nude5HT1080

[0094] Specifically, 5X10 7 100 μL of B16-F10 cells (cell / ml) were inoculated subcutaneously into the right flank of BALB / c nude mice. After inoculation, the tumor size was 100 mm 3 ~150 mm 3 When the mice in group 1 were injected with K148 and K148-GRRQKR, PBS 10 into the tail vein 9.0 EID 50 / mL 100 ul was injected. Tumor size was measured using a digital caliper from the first day after injection. The tumor size measurement method is expressed by the following formula.

[0095] ceremony

[0096] Tumor size (mm) 3 ) = [(long axis of tumor) X (short axis of tumor) 2 ] / 2

[0097]

[0098] 6-2. OncoK148 efficacy test using mice

[0099] Ten 6-week-old C57BL / 6 mice and 14 6-week-old BALB / c mice were purchased from Orient Bio. They were raised separately as shown in Table 4 below.

[0100] OncoK148 efficacy test using mice Group Virus name (live virus) Injection dose Age Livestock Number of livestock Injection cancer cell line G1 OncoK148 10 8.0 EID 50 6wC57BL / 65B16-F10G2PBS-6wC57BL / 65B16-F10G3OncoK14810 8.0 EID 50 6wBALB / c74T1G4PBS-6wBLAB / c74T1

[0101] Specifically, 5X10 7 100 μL of B16-F10 cells (cell / ml) were inoculated subcutaneously into the right flank of C57BL / 6 mice. After inoculation, the tumor size was 50 mm. 3 ~100 mm 3 When the mice in group 1 were injected with OncoK148 10 into the tail vein 9.0 EID 50 / mL 100 ul was injected. Tumor size was measured daily using a digital caliper from the first day after injection until the 14th day, and survival rate was observed. In addition, 5X10 7 100 μL of 4T1 cells (cell / ml) was inoculated subcutaneously into the right flank of BALB / c mice. After inoculation, the tumor size was 50 mm. 3 ~100 mm 3 When the mice in group 3 were injected with OncoK148 10 in the tail vein 9.0 EID 50 / mL 100ul was injected. Tumor size was measured daily using a digital caliper from day 1 after injection until day 14, and survival rate was observed.

[0102]

[0103] 7. Confirmation of lung metastasis for 4T1 cells

[0104] Mice were raised until day 20 after inoculation, after measuring tumor size by day 14. On day 20, the mice were necropsied, and their lungs were removed. The removed lungs were observed to determine whether the tumor had metastasized.

[0105]

[0106]

[0107] Experimental results

[0108]

[0109] 1. Confirmation of cancer-killing activity according to MBCS of NDV F protein

[0110] BALB / c nude mice induced with tumors by HT1080 were injected with K148, MBCS-modified K148-GRRQKR, and PBS via tail vein. A significant difference in tumor size was observed from the third day, and on the 15th day, tumor growth in K148-GRRQKR was confirmed to be more than half that of the other groups (Fig. 2).

[0111]

[0112] 2. Production of OncoK148 virus and confirmation of cytokine expression

[0113] The hGM-CSF and hIL-12alpha genes were successfully inserted into a plasmid encoding the K148 full-length gene (Fig. 3). Successful rescue of oncoK148 after transfection was confirmed by hemagglutination. The oncoK148 gene was further confirmed by three passages in 10-day-old SPF cells, and no mutations were found in the hGM-CSF and hIL-12alpha gene sequences. Successful expression of hGM-CSF and hIL-12alpha was confirmed through ELISA (Fig. 4). Specifically, hGM-CSF was expressed only in OncoK148, and hIL-12alpha was expressed at a higher level in OncoK148-treated cells than in cells treated with rK148-GRRQKR.

[0114]

[0115] 3. OncoK148 virus growth curve analysis

[0116] Analysis of the growth curves of OncoK148 and K148-GRRQKR viruses confirmed that the highest titer of the two viruses was 10 K148. 9.5 EID 50 / mL, OncoK148 is 10 9.5 EID 50 No significant difference was confirmed in / mL (Fig. 5).

[0117]

[0118] 4. Confirmation of the potent cytotoxicity of OncoK148 using C57BL / 6 mice vaccinated with B16-F10.

[0119] A significant difference was observed from the 6th day after OncoK148 vaccination, and finally, on the 14th day after vaccination, Group 1 had 1756.26 mm 3 ± 487.83, Group 2 is 4069 mm 3was observed, a 57% decrease. In terms of survival rate, 3 animals in group 1 survived until the 14th day, but only 1 animal in group 2 survived (Fig. 6).

[0120]

[0121] 5. Confirmation of the cancer-killing activity of OncoK148 using BALB / c mice inoculated with 4T1.

[0122] A significant difference was observed from the 8th day after OncoK148 vaccination, and finally, on the 14th day after vaccination, group 3 had 554.08 mm 3 ± 126.20, Group 4 is 990.85 mm 3 ± 170.69, a 45% decrease (Fig. 7). On the 20th day after vaccination, metastasis to the lungs was observed in only 1 out of 7 animals in Group 3, but in all 7 animals in Group 4 (Table 4).

[0123] 4T1 metastasis to lungs in BALB / c mice. Pulmonary metastasis. G3OncoK14814.3% (1 / 7)G4PBS100% (7 / 7).

[0124]

[0125] <Example 2: Construction of OncoK148-318 Viral Vector>

[0126]

[0127] Experimental materials and methods

[0128]

[0129] 1. Cells and viruses used

[0130] The cells and viruses used were identical to those used in Example 1.

[0131]

[0132] 2. Construction of pOncoK148-318 clone containing the genes for hGM-CSF and hIL-12a

[0133] First, a pOncoK148 clone was prepared using the same method as that used in Example 1. The prepared pOncoK148 clone was linearized between the HN gene and the L gene, and 318 nucleotides were inserted between them (Fig. 8).

[0134] pOncoK148 clone was amplified in HIT-DH5α competent cells at 37°C for 18 h and purified using PureLink e It was purified using the HiPure plasmid midiprep kit.

[0135]

[0136] 3. Virus rescue and proliferation

[0137] OncoK148-318 virus was obtained in the same manner as in Example 1, except that a plasmid encoding full genome cDNA (pOnco148-318) was used instead of the plasmid encoding full genome cDNA (pOnco148) in Example 1.

[0138]

[0139] 4. Analysis of cytokine expression and final titer following viral gene insertion

[0140] To confirm the expression of cytokines inserted into the rescued OncoK148-318 virus, cells were infected with DF-1. Supernatants were collected every 24 hours for up to 72 hours after infection. The collected supernatants were detected using hGM-CSF and hIL-12a ELISA, respectively. In addition, to confirm the stability and amplification characteristics of the OncoK148 virus, 10-fold diluted K148 / 08 and OncoK148-318 virus (100 EID 50 ) was inoculated into 10-day-old SPF fertilized eggs. The allantoic fluid of the inoculated eggs was collected at 72 hours, and the EID of the virus culture 50 was measured.

[0141]

[0142] 5. ICPI (Intracerebral pathogenicity index) measurement

[0143] Ten 1-day-old chicks were injected intracerebral with 100 μl of OncoK148-318 or OncoK148. Lesions in the chicks were checked daily until day 8 and recorded as normal (0), sick (1), or dead (2). All scores were summed and divided by 80 (ranging from 0 to 2) to calculate the ICPI value. NDV is classified as lentogenic if ICPI is 0.7 or less, mesogenic if 0.7 to 1.4, and velogenic if 1.4 to 2.0.

[0144]

[0145] 6. Animal testing (mice)

[0146] 1) Single-dose experiment using nude BALB / c mice

[0147] Thirty 6-week-old nude BALB / c mice were purchased from Orient Bio and housed according to the following Table 6. 5X10 7 100 μL of HT1080 cells (cell / ml) were inoculated subcutaneously into nude BALB / c right flanks. After inoculation, the tumor size was 50 mm 3 ~100 mm 3 When the mice were injected with OncoK148 and OncoK148-318 10 in the tail vein as shown in Table 6 below 9.0 EID 50 / mL 100 ul each was injected. Tumor size was measured using a digital caliper at 2-day intervals from day 1 after injection until day 14, and survival rate was observed.

[0148] OncoK148-318 efficacy test using nude mice Group Virus name (live virus) Injection dose Age Livestock Number of livestock Injection cancer cell line G1 OncoK148-318 10 8.0 EID 50 6wNude BLAB / c10HT1080G2OncoK14810 8.0 EID 50 6wNude BLAB / c10HT1080G3PBS-6wNude BLAB / c10HT1080

[0149] 2) Multiple administration experiments using nude BALB / c mice

[0150] Thirty 6-week-old nude BALB / c mice were purchased from Orient Bio and housed according to the above Table 3. 5X10 7 100 μL of HT1080 cells (cell / ml) were inoculated subcutaneously into nude BALB / c right flanks. After inoculation, the tumor size was 50 mm 3 ~100 mm 3 When the mice were injected with OncoK148 and OncoK148-318 10 in the tail vein as shown in Table 6 above, 9.0 EID 50 Each injection was 100 μl / mL. Additional injections were performed in the same manner on days 2 and 4. After the first injection, tumor size was measured using a digital caliper at 2-day intervals from day 1 until day 14, and survival rates were observed.

[0151]

[0152] 3) Lung metastasis measurement test using BALB / c mice

[0153] Thirty 6-week-old BALB / c mice were purchased from Orient Bio. They were housed according to the table 7 below. 5X10 7100 μL of 4T1 cells (cell / ml) were inoculated subcutaneously into the right flank of BALB / c mice. After inoculation, the tumor size was 50 mm 3 ~100 mm 3 When the mice were injected with OncoK148, OncoK148-318 10 into the tail vein as shown in Table 7 9.0 EID 50 / mL 100 ul was injected. Tumor size was measured daily using a digital caliper from day 1 after injection until day 16, and survival rates were observed. On day 17, a complete autopsy was performed to determine lung weight and the extent of lung metastasis. Lung metastasis was recorded when a single tumor was observed macroscopically.

[0154] OncoK148-318 efficacy test using BALB / c mice Group Virus name (live virus) Injection dose Age Livestock Number of livestock Injection cancer cell line G1 OncoK148-318 10 8.0 EID 50 6wBLAB / c104T1G2OncoK14810 8.0 EID 50 6wBLAB / c104T1G3PBS-6wBLAB / c104T1

[0155]

[0156] Experimental results

[0157] 1. Production of OncoK148-318 virus and confirmation of cytokine expression

[0158] Successful rescue of oncoK148-318 after transfection was confirmed by hemagglutination. The oncoK148-318 gene was further confirmed by three passages in 10-day-old SPF cells, confirming the absence of mutations in the hGM-CSF and hIL-12a gene sequences. Successful expression of hGM-CSF and hIL-12a was confirmed by ELISA (Figs. 9a, 9b).

[0159]

[0160] 2. OncoK148-318 virus titer and ICPI index

[0161] The final titers of OncoK148-318 and OncoK148, K148 / 08 viruses were confirmed in the eggs. When the highest titers of the two viruses were confirmed, K148 10 9.5 EID 50 / mL, OncoK148 is 10 9.5 EID 50 / mL, OncoK148-318 is 10 9.0 EID 50 10 in / mL 0.5 EID 50 A titer as low as / mL was observed.

[0162] Additionally, OncoK148-318 was confirmed to be lentogenic with an ICPI of 0.55, and OncoK148 was confirmed to be mesogenic with an ICPI of 1.15. From the above results, it was found that the insertion of 318 nucleotides before the L gene affected the replication ability of the OncoK148-318 virus, resulting in a decrease in the final titer and ICPI.

[0163]

[0164] 3. Comparative study of the killing activity of OncoK148 and OncoK148-318 using nude BALB / c mice inoculated with HT1080.

[0165] In mice vaccinated with a single dose of OncoK148 or OncoK148-318, we observed a significant slowdown in HT1080 growth compared to the PBS group (Fig. 10). Furthermore, in mice vaccinated with multiple doses of OncoK148 or OncoK148-318, we observed that HT1080 growth was halted and remained relatively constant over time compared to the PBS group (Fig. 11). In both experiments, no differences were observed between OncoK148 and OncoK148-318.

[0166]

[0167] 4. Comparative study of the killing activity of OncoK148 and OncoK148-318 using BALB / c mice inoculated with 4T1.

[0168] From the 6th day after OncoK148 and OncoK148-318 inoculation, a significant difference in tumor size was observed compared to the PBS group, and finally, on the 16th day after inoculation, it reached 200 mm. 3 Differences were observed (Fig. 12a). On the 21st day after vaccination (17th day after virus vaccination), none of the 10 OncoK148 mice had metastasis to the lungs, only 2 out of 10 OncoK148-318 mice had metastasis, and all PBS mice had metastasis (Table 8).

[0169] 4T1 metastasis to lungs in BALB / c mice. Pulmonary metastasis. G1 OncoK 148-31820% (2 / 10), G3 OncoK 1480% (0 / 10), G2 PBS 100% (10 / 10).

[0170] In terms of lung weight, significantly less OncoK148 and OncoK148-318-administered individuals were observed compared to the PBS group (Fig. 12b). As a result, it was confirmed that OncoK148-318 showed similar efficacy in killing ability compared to OncoK148, while being attenuated to the extent that it satisfies the ICPI of 0.7 or less, which is the current domestic standard for using NDV in BL2.

Claims

1. A recombinant Newcastle disease virus vector comprising a nucleic acid molecule encoding hGM-CSF and a nucleic acid molecule encoding hIL-12alpha.

2. A recombinant Newcastle disease virus vector in claim 1, wherein the hGM-CSF is composed of an amino acid sequence encoded by the nucleotide sequence number 9.

3. A recombinant Newcastle disease virus vector in claim 1, wherein the hIL-12alpha is composed of an amino acid sequence encoded by the nucleotide sequence number 10.

4. A recombinant Newcastle disease virus vector in claim 1, wherein the Newcastle disease virus genome comprises genes of NP, P, M, F, HN, and L, and the nucleic acid molecule encoding hGM-CSF is inserted between the P gene and the M gene.

5. A recombinant Newcastle disease virus vector according to claim 1, wherein the Newcastle disease virus genome comprises genes of NP, P, M, F, HN, and L, and the nucleic acid molecule encoding hIL-12alpha is inserted between the M gene and the F gene.

6. In the first paragraph, the Newcastle disease virus genome comprises genes of NP, P, M, F, HN, and L, and the recombinant Newcastle disease virus vector is a recombinant Newcastle disease virus vector in which the cleavage site peptide 111-GGKQGR / L-117 at the 111th to 117th amino acid positions of the F gene is replaced with 111-GRRQKR / F-117.

7. A recombinant Newcastle disease virus vector comprising the nucleotide of sequence number 18 in claim 1.

8. A recombinant Newcastle disease virus vector in claim 1, wherein the Newcastle disease virus genome sequentially contains genes of NP, P, M, F, HN, and L, and a nucleotide of sequence number 19 is inserted between the HN and L genes.

9. A recombinant Newcastle disease virus vector comprising the nucleotide of sequence number 20 in claim 8.

10. A pharmaceutical composition for treating cancer, comprising a recombinant Newcastle disease virus vector of any one of claims 1 to 9 as an active ingredient.

11. A pharmaceutical composition for treating cancer, wherein the pharmaceutical composition according to claim 10 reduces metastasis of cancer.

Images