Genetically modified non-human animal with human or chimeric TL1a

Abstract

Provided are genetically modified non-human animals that express a human or chimeric (e.g., humanized) TIL1A, and methods of use thereof.

Description

GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC TL1A

[0001] CLAIM OF PRIORITY

[0002] This application claims the benefit of Chinese Patent Application App. No. 202311667117.0, filed on December 7, 2023. The entire contents of the foregoing application are incorporated herein by reference.TECHNICAL FIELD

[0003] This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) tumor necrosis factor (TNF) -like ligand 1A (TL1A) , and methods of use thereof.BACKGROUND

[0004] The traditional drug research and development typically use in vitro screening approaches. However, these screening approaches cannot provide the body environment (such as tumor microenvironment, stromal cells, extracellular matrix components and immune cell interaction, etc. ) , resulting in a higher rate of failure in drug development. In addition, in view of the differences between humans and animals, the test results obtained from the use of conventional experimental animals for in vivo pharmacological test may not reflect the real disease state and the interaction at the targeting sites, resulting in that the results in many clinical trials are significantly different from the animal experimental results.

[0005] Therefore, the development of humanized animal models that are suitable for human antibody screening and evaluation will significantly improve the efficiency of new drug development and reduce the cost for drug research and development.SUMMARY

[0006] This disclosure is related to an animal model with human TL1A or chimeric TL1A. The animal model can express human TL1A or chimeric TL1A (e.g., humanized TL1A) protein in its body. It can be used in the studies on the function of TL1A gene, and can be used in the screening and evaluation of anti-human TL1A antibodies or drugs targeting TL1A. In addition, the animal models prepared by the methods as described herein can be used in drug screening, pharmacodynamics studies, treatments for immune-related diseases, and cancer therapy for human TL1A target sites; they can also be used to facilitate the development and design of new drugs, and save time and cost. In summary, this disclosure provides a powerful tool for studying the function of TL1A protein and a platform for screening drugs for treating diseases (e.g., cancer, inflammatory disorders, or autoimmune diseases)

[0007] In one aspect, the disclosure provides a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric tumor necrosis factor (TNF) -like ligand 1A (TL1A) . In some embodiments, the sequence encoding the human or chimeric TL1A is operably linked to an endogenous regulatory element at the endogenous TL1A gene locus in at least one chromosome. In some embodiments, the sequence encoding a human or chimeric TL1A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TL1A (NP_005109.2 (SEQ ID NO: 2) ) . In some embodiments, the sequence encoding a human or chimeric TL1A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 9. In some embodiments, the sequence encoding a human or chimeric TL1A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2. In some embodiments, the animal is a mammal (e.g., a monkey, a rodent, a mouse, or a rat) . In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous TL1A or expresses a decreased level of endogenous TL1A as compared to TL1A expression level in a wild-type animal. In some embodiments, the animal has one or more cells expressing human or chimeric TL1A.

[0008] In one aspect, the disclosure provides a genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous TL1A with a sequence encoding a corresponding region of human TL1A at an endogenous TL1A gene locus. In some embodiments, the sequence encoding the corresponding region of human TL1A is operably linked to an endogenous regulatory element at the endogenous TL1A locus, and one or more cells of the animal expresses a human or chimeric TL1A. In some embodiments, the animal does not express endogenous TL1A or expresses a decreased level of endogenous TL1A as compared to TL1A expression level in a wild-type animal. In some embodiments, the replaced sequence encodes all or a portion of the extracellular region of TL1A. In some embodiments, the animal has one or more cells expressing a chimeric TL1A having a cytoplasmic region, a transmembrane region, and an extracellular region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the extracellular region of human TL1A (NP_005109.2 (SEQ ID NO: 2) ) . In some embodiments, the extracellular region of the chimeric TL1A has a sequence that has at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, or 195 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TL1A (e.g., amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2) . In some embodiments, the sequence encoding a region of endogenous TL1A comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TL1A gene. In some embodiments, the animal is a mouse. In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous TL1A gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous TL1A gene locus.

[0009] In one aspect, the disclosure provides a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous TL1A gene locus, a sequence encoding a region of endogenous TL1A with a sequence encoding a corresponding region of human TL1A. In some embodiments, the sequence encoding the corresponding region of human TL1A comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of a human TL1A gene. In some embodiments, the sequence encoding the corresponding region of human TL1A comprises a portion of exon 1, exon 2, exon 3, and a portion of exon 4, of a human TL1A gene. In some embodiments, the sequence encoding the corresponding region of human TL1A encodes amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2. In some embodiments, the region comprises all or a portion of the extracellular region of TL1A. In some embodiments, the sequence encoding a region of endogenous TL1A comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TL1A gene. In some embodiments, the animal is a mouse, and the sequence encoding a region of endogenous TL1A comprises a portion of exon 1, exon 2, exon 3, and a portion of exon 4 of the endogenous TL1A gene.

[0010] In one aspect, the disclosure provides a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a humanized TL1A polypeptide, wherein the humanized TL1A polypeptide comprises at least 20 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human TL1A, wherein the animal expresses the humanized TL1A polypeptide. In some embodiments, the humanized TL1A polypeptide has at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, or 195 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of human TL1A extracellular region (e.g., amino acids 57-251, 58-251, or 60-251 of SEQ ID NO: 2) . In some embodiments, the humanized TL1A polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2. In some embodiments, the nucleotide sequence is operably linked to an endogenous TL1A regulatory element of the animal. In some embodiments, the chimeric TL1A polypeptide comprises an endogenous TL1A transmembrane region and / or an endogenous TL1A cytoplasmic region. In some embodiments, the nucleotide sequence is integrated to an endogenous TL1A gene locus of the animal. In some embodiments, the humanized TL1A polypeptide has at least one mouse TL1A activity and / or at least one human TL1A activity.

[0011] In one aspect, the disclosure provides a method of making a genetically-modified animal cell that expresses a chimeric TL1A, the method comprising: replacing at an endogenous TL1A gene locus, a nucleotide sequence encoding a region of endogenous TL1A with a nucleotide sequence encoding a corresponding region of human TL1A, thereby generating a genetically-modified animal cell that includes a nucleotide sequence that encodes the chimeric TL1A, wherein the animal cell expresses the chimeric TL1A.

[0012] In some embodiments, the animal is a mouse. In some embodiments, the chimeric TL1A comprises a human or humanized TL1A extracellular region; and a transmembrane and / or a cytoplasmic region of mouse TL1A. In some embodiments, the nucleotide sequence encoding the chimeric TL1A is operably linked to an endogenous TL1A regulatory region, e.g., promoter. In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is interleukin 23 alpha subunit (IL23A) , interleukin 12 beta subunit (IL12B) , tumor necrosis factor alpha (TNFA) , tumor necrosis factor receptor 1 (TNFR1) , tumor necrosis factor receptor 2 (TNFR2) , programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , 4-1BB, cluster of differentiation 3 (CD3) , and / or lymphocyte-activation gene 3 (LAG3) . In some embodiments, the animal or mouse further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, and / or LAG3.

[0013] In one aspect, the disclosure provides a method of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has a tumor; and b) determining inhibitory effects of the therapeutic agent to the tumor. In some embodiments, the therapeutic agent is an anti-TL1A antibody (e.g., an anti-human TL1A antibody) . In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, determining inhibitory effects of the anti-TL1A antibody to the tumor involves measuring the tumor volume in the animal. In some embodiments, the cancer is lung cancer, leukemia, colon cancer, head and neck cancer, kidney cancer, pancreatic cancer, or gastric cancer.

[0014] In one aspect, the disclosure provides a method of determining effectiveness of an anti-TL1A antibody and an additional therapeutic agent for the treatment of cancer, comprising: a) administering the anti-TL1A antibody and the additional therapeutic agent to the animal as described herein, wherein the animal has a tumor; and b) determining inhibitory effects on the tumor. In some embodiments, the animal further comprises a sequence encoding a human or chimeric PD-1, a human or chimeric PD-L1, and / or a human or chimeric CTLA4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody. In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, determining inhibitory effects of the treatment involves measuring the tumor volume in the animal. In some embodiments, the animal has lung cancer, leukemia, colon cancer, head and neck cancer, kidney cancer, pancreatic cancer, or gastric cancer.

[0015] In one aspect, the disclosure provides a method of determining effectiveness of a therapeutic agent for treatment an immune disorder (e.g., an autoimmune disease) , comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has the immune disorder; and b) determining effects of the therapeutic agent to the immune disorder.

[0016] In one aspect, the disclosure provides a method of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising: a) administering the therapeutic agent to the animal as described herein, wherein the animal has the inflammation; and b) determining effects of the therapeutic agent to the inflammation. In some embodiments, the inflammation is caused by an agent comprising bacteria, virus, DSS or LPS) . In some embodiments, the therapeutic agent is an anti-TL1A antibody (e.g., an anti-human TL1A antibody) . In some embodiments, determining inhibitory effects of the anti-TL1A antibody to the inflammation involves measuring body weight, inflammation in body sites, stool hardness, blood in the stool, and / or histopathological score (e.g., colon histopathological score) of the animal. In some embodiments, the inflammation comprises inflammatory bowel diseases (IBD) , Crohn’s disease, ulcerative colitis, acute or chronic colitis, bacteria-induced inflammation, LPS-induced inflammation, virus-induced inflammation, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, or scleroderma.

[0017] In one aspect, the disclosure provides a method of determining effectiveness of an anti-TL1A antibody and an additional therapeutic agent for the treatment of inflammation, comprising: a) administering the anti-TL1A antibody and the additional therapeutic agent to the animal as described herein, wherein the animal has an inflammation; and b) determining inhibitory effects on the inflammation. In some embodiments, the additional therapeutic agent comprises steroids (e.g., prednisone, methylprednisolone, dexamethasone, hydrocortisone, betamethasone, or triamcinolone) , non-steroidal anti-inflammatory drugs (NSAIDs) , biologic agents (e.g., TNF inhibitors, interleukin inhibitors, B cell modulators, or T cell modulators) , immunosuppressive agents, Janus Kinase (JAK) Inhibitors, disease-modifying antirheumatic drugs (DMARDs) , monoclonal antibodies, intravenous immunoglobulin (IVIG) , other targeted therapies, or any combination thereof. In some embodiments, determining inhibitory effects of the treatment involves measuring body weight, inflammation in body sites, stool hardness, blood in the stool, and / or histopathological score (e.g., colon histopathological score) of the animal. In some embodiments, the animal has inflammatory bowel diseases (IBD) , Crohn’s disease, ulcerative colitis, acute or chronic colitis, bacteria-induced inflammation, LPS-induced inflammation, virus-induced inflammation, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, or scleroderma.

[0018] In one aspect, the disclosure provides a method of determining toxicity of a therapeutic agent comprising: a) administering the therapeutic agent to the animal as described herein; and b) determining effects of the therapeutic agent to the animal. In some embodiments, the therapeutic agent is an anti-TL1A antibody. In some embodiments, determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.

[0019] In one aspect, the disclosure provides a protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following: (a) an amino acid sequence set forth in SEQ ID NO: 1, 2, or 9; (b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1, 2, or 9; (c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, or 9; (d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and (e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9.

[0020] In one aspect, the disclosure provides a nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following: (a) a sequence that encodes the protein as described herein; (b) SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11; (c) a sequence that is at least 90%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11; and (d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11.

[0021] In one aspect, the disclosure provides a cell comprising the protein as described herein and / or the nucleic acid as described herein.

[0022] In one aspect, the disclosure provides an animal comprising the protein as described herein and / or the nucleic acid as described herein.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are as described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0024] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.DESCRIPTION OF DRAWINGS

[0025] FIG. 1 is a schematic diagram showing TL1A gene locus in mouse and human (not to scale) .

[0026] FIG. 2 is a schematic diagram showing a humanized TL1A gene locus in mouse (not to scale) .

[0027] FIG. 3 is a schematic diagram showing an exemplary TL1A gene targeting strategy and an exemplary targeting vector V1 design (not to scale) .

[0028] FIG. 4 is a schematic diagram showing the flippase recombination target (FRT) recombination process in TL1A gene humanized mice (not to scale) .

[0029] FIG. 5 is a schematic diagram showing an exemplary TL1A gene targeting strategy and an exemplary targeting vector V2 design (not to scale) .

[0030] FIG. 6 shows PCR identification results ofF1 generation mice by primers L-GT-F and L-GT-R. M is a marker. WT is a wild-type control. H2O is a control.

[0031] FIG. 7 shows Southern Blot results of cells ofF1 generation mice af ter recombination using the A Probe and 5’ Probe. WT is a wild-type control. F1-01, F1-02, F1-03, and F1-04 represent F1 generation mouse#01, #02, #03, and#04.

[0032] FIG. 8 shows the production of soluble TL1A protein in bone marrow dendritic cells of C57BL / 6 wild-type mice (+ / +) and TL1A gene-humanized homozygous mice (H / H) .

[0033] FIG. 9A shows the alignment between human TL1A amino acid sequence (NP_005109.2; SEQ ID NO: 2) and mouse TL1A amino acid sequence (NP_796345.4; SEQ ID NO: 1) .

[0034] FIG. 9B shows the alignment between human TL1A amino acid sequence (NP_005109.2; SEQ ID NO: 2) and rat TL1A amino acid sequence (NP_665708.1; SEQ ID NO: 39) .

[0035] FIG. 10 shows the amino acid sequences and nucleotide sequences described in this disclosure.DETAILED DESCRIPTION

[0036] This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) tumor necrosis factor (TNF) -like ligand 1A (TL1A) , and methods of use thereof. Tumor necrosis factor (TNF) -like ligand 1A (TL1A) , also known as TNFSF15, is a member of the tumor necrosis factor (TNF) ligand superfamily, and also known as vascular growth inhibitory factor (VEGI) . Due to the differences in physiology and pathology between animals and humans, as well as the complexity of genes, for example, TL1A has only 66%homology between humans and mice. To construct an effective humanized TL1A animal model, one must consider various factors such as genetic engineering techniques, immune system compatibility, and physiological relevance to human conditions. Research and development of new drugs remains the biggest challenge.

[0037] In addition, the non-human animals obtained by the methods as described herein can also be mated with other genetically humanized non-human animals to obtain multi-gene humanized animal models, which can be used to screen and evaluate the efficacy of human drugs and combination drugs targeting this signaling pathway. The methods as described herein have broad application prospects in academic and clinical research.

[0038] In view of the value of TL1A in the field of inflammatory immunotherapy and the potential value in the field of anti-tumor therapy, in order to further explore its relevant biological properties, improve the effectiveness of preclinical efficacy trials, improve the success rate of research and development, and make preclinical trials more effective and minimize R&D failures, the field urgently needs to develop non-human animal models of TL1A-related signaling pathways.

[0039] Experimental animal models are an indispensable research tool for studying the effects of TL1A-specific antibodies. Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish (e.g., zebra fish) and so on. However, there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal’s homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. Alarge number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide better animal models for drug screening.

[0040] Tumor necrosis factor (TNF) -like ligand 1A (TL1A) .

[0041] TL1A is a cytokine expressed in various cell types including, but not limited to, endothelial cells (e.g., vascular endothelial cells) , synovial fibroblasts, monocytes, macrophages, dendritic cells, and T cells.

[0042] TL1A can exist in either membrane-bound or soluble forms, both of which are functional and capable of exerting diverse immunological effects. TL1A is a type 2 transmembrane protein that self-assembles into stable trimers by interacting with TNF homology domain. The soluble TL1A (sTL1A) was produced by alternative splicing or TNF-α-converting enzyme (TACE) cleavage. TL1A can be markedly up-regulated by TNF and IL-1α. Expression of TL1A in dendritic cell (DC) and macrophage is increased when the cells were triggered by toll-like receptors 4, TLR11, or Fc region of IgG (FcγR) . TL1A binds to its receptor death receptor 3 (DR3) , activates downstream signaling, and then participates in innate and adaptive immune homeostasis. Furthermore, TL1A can promote the degradation ofVEGF's membrane receptor VEGFR1 while upregulating the expression of the free form ofVEGFR1. Therefore, it can convert the pro-angiogenesis signal caused by VEGF / VEGFR1 into an inhibitory angiogenesis signal. TNFSF15 can inhibit the phosphorylation ofVEGFR2 caused by VEGF, thus blocking the increase in vascular permeability mediated by VEGFR2, which allows TNFSF15 to be used to treat pathological diseases related to increased vascular permeability.

[0043] TL1A plays an important role in immune regulation and inflammatory diseases. The TL1A / DR3 cytokine system has emerged as a crucial component of mucosal immunity and intestinal homeostasis. Preclinical studies have uncovered a central, albeit multifaceted, function of TL1A in enhancing the immune response during inflammation. It has been shown that TL1A plays important roles in the pathogenesis of inflammatory autoimmune diseases, such as inflammatory bowel disease, rheumatoid arthritis (RA) , psoriatic arthritis (PsA) , and ankylosing spondylitis (AS) . these diseases. In recent years, TL1A, as an important mediator of inflammation, has attracted much attention because anti-TL1A antibody treatment may be a promising therapeutic approach in inflammatory disorders.

[0044] A detailed description of TL1A and its function can be found, e.g., in Migone T., et al. " TL1A Is a TNF-like Ligand for DR3 and TR6 / DcR3 and Functions as a T Cell Costimulator. " Immunity 16 (2002) : 479; Xu w., et al. " Role of TL1A in Inflammatory Autoimmune Diseases: A Comprehensive Review. " Fronters in Immunology 13: 891328 (July 14, 2022) ; Solitano V., et al. "TL1A inhibition for inflammatory bowel disease treatment: From inflammation to fibrosis. " Med 5 (2024) : 386; each of which is incorporated by reference in its entirety.

[0045] In human genomes, TL1A gene (Gene ID: 9966) locus has four exons, exon 1, exon 2, exon 3, and exon 4 (FIG. 1) . The human TL1A protein also has, from N-terminus to C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. Human TL1A lacks an N-terminal signal anchor but contains a hydrophobic transmembrane region as a signal anchor. The nucleotide sequence for human TL1A mRNA is NM_005118.4, and the amino acid sequence for human TL1A is NP_005109.2 (SEQ ID NO: 2) . The location for each exon and each region in human TL1A nucleotide sequence and amino acid sequence is listed below:

[0046] Table 1

[0047] The human TL1A gene (Gene ID: 9966) is located in Chromosome 9 (NC_000009.12) of the human genome, which is located from 114784635 to 114806039 (GRCh38. p14 (GCF_000001405.40) ) . The 5’ -UTR is from 114,806,039 to 114,806,013, exon 1 is from 114,806,039 to 114,805,803, intron 1 is from 114,805,802 to 114,793,569, exon 2 is from 114,793,568 to 114,793,526, intron 2 is from 114,793,525 to 114,792,455, exon 3 is from 114,792,454 to 114,792,407, intron 3 is from 114,792,406 to 114,790,907, exon 4 is from 114,790,906 to 114,784,652, and the 3’ -UTR is from 114,790,451 to 114,784,652, based on transcript NM_005118.4. All relevant information for human TL1A locus can be found in the NCBI website with Gene ID: 9966, which is incorporated by reference herein in its entirety.

[0048] According to UniProt ID: O95150, the extracellular region of human TL1A is a topological domain with a sequence corresponds to amino acids 57-251 of SEQ ID NO: 2.

[0049] In mice, TL1A gene locus has four exons, exon 1, exon 2, exon 3, and exon 4 (FIG. 1) . The mouse TL1A protein also has, from N-terminus to C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. Mouse TL1A lacks an N-terminal signal anchor but contains a hydrophobic transmembrane region as a signal anchor as well. The nucleotide sequence for mouse TL1A mRNA is NM_177371.4, the amino acid sequence for mouse TL1A is NP_796345.4 (SEQ ID NO: 1) . The location for each exon and each region in the mouse TL1A nucleotide sequence and amino acid sequence is listed below:

[0050] Table 2

[0051] The mouse TL1A gene (Gene ID: 326623) is located in Chromosome 4 of the mouse genome, which is located from 63642837 to 63663296 (GRCm39 (GCF_000001635.27) ) . The 5’-UTR is from 63,663,350 to 63,663,322, exon 1 is from 63,663,350 to 63,663,046, intron 1 is from 63,663,045 to 63,652,534, exon 2 is from 63,652,533 to 63,652,491, intron 2 is from 63,652,490 to 63,651,604, exon 3 is from 63,651,603 to 63,651,565, intron 3 is from 63,651,564 to 63,648,281, exon 4 is from 63,648,280 to 63,642,840, and the 3’ -UTR is from***to 63,642,840, based on transcript NM_177371.4. All relevant information for mouse TL1A locus can be found in the NCBI website with Gene ID: 17086, which is incorporated by reference herein in its entirety.

[0052] According to UniProt ID: Q8C567, the extracellular region of mouse TL1A is a topological domain with a sequence corresponds to amino acids 61-252 of SEQ ID NO: 1.

[0053] FIG. 9A shows the alignment between human TL1A amino acid sequence (NP_005109.2; SEQ ID NO: 2) and mouse TL1A amino acid sequence (NP_796345.4; SEQ ID NO: 1) . Thus, the corresponding amino acid residue or region between human and mouse TL1A can be found in FIG. 9A.

[0054] TL1A genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for TL1A (tnfsf15) in Rattus norvegicus (rat) is 252878, the gene ID for TL1A in Macaca mulatta (Rhesus monkey) is 703189, the gene ID for TL1A in Canis lupus familiaris (dog) is 481688, the gene ID for TL1A in Sus scrofa (pig) is 100624969, and the gene ID for TL1A (tnfsf15) in Xenopus tropicalis (frog) is 100494382. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety.

[0055] FIG. 9B shows the alignment between human TL1A amino acid sequence (NP_005109.2; SEQ ID NO: 2) and rat TL1A amino acid sequence (NP_665708.1; SEQ ID NO: 33) . Thus, the corresponding amino acid residue or region between human and rat TL1A can be found in FIG. 9B.

[0056] The present disclosure provides human or chimeric (e.g., humanized) TL1A nucleotide sequences and / or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, cytoplasmic region, transmembrane region, and / or extracellular region, are replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, cytoplasmic region, transmembrane region, and / or extracellular region, are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 755, or 756 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 245, 250, 251, or 252 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, exon 4, cytoplasmic region, transmembrane region, and / or extracellular region. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, and / or exon 4 (e.g., a portion of exon 1, exons 2 and 3, and a portion of exon 4) are replaced by a region, a portion, or the entire sequence of the human exon 1, exon 2, exon 3, and / or exon 4 (e.g., a portion of exon 1, exons 2 and 3, and a portion of exon 4) .

[0057] In some embodiments, a “region” or “portion” of the cytoplasmic region, transmembrane region, extracellular region, exon 1, exon 2, exon 3, and / or exon 4 is deleted.

[0058] In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) TL1A nucleotide sequence. In some embodiments, the chimeric (e.g., humanized) TL1A nucleotide sequence encodes a TL1A protein comprising a cytoplasmic region, transmembrane region, and extracellular region. In some embodiments, the extracellular region comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100%identical to amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2. In some embodiments, the extracellular region comprises all or part of human TL1A extracellular region. In some embodiments, the extracellular region comprises at least 1, 2, 3, 4, or 5 amino acids at the C-terminus of endogenous TL1A extracellular region. In some embodiments, the transmembrane region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 40-60 of SEQ ID NO: 1. In some embodiments, the transmembrane region comprises all or part of endogenous TL1A transmembrane region. In some embodiments, the cytoplasmic region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-39 of SEQ ID NO: 1. In some embodiments, the cytoplasmic region comprises all or part of endogenous TL1A cytoplasmic region. In some embodiments, the genome of the animal comprises a sequence that is at least 90%, 95%, or 100%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11.

[0059] In some embodiments, the genetically-modified non-human animal as described herein comprises a sequence encoding a human or humanized TL1A protein. In some embodiments, the TL1A protein comprises, from N-terminus to C-terminus, a cytoplasmic region, transmembrane region, and extracellular region. In some embodiments, the humanized TL1A protein comprises a human or humanized extracellular region. In some embodiments, the humanized TL1A protein comprises an endogenous extracellular region. In some embodiments, the humanized TL1A protein comprises a human or humanized transmembrane region. In some embodiments, the humanized TL1A protein comprises an endogenous transmembrane region. In some embodiments, the transmembrane region has a signal anchor region. In some embodiments, the signal anchor region contains hydrophobic amino acid residues, allowing it to interact with the lipid bilayer of the membrane. In some embodiments, the signal anchor region can direct TL1A protein to the appropriate membrane (e.g., the endoplasmic reticulum in eukaryotic cells) during translation. In some embodiments, the signal anchor region can embed TL1A protein into the membrane, ensuring it remains localized and often orients the protein correctly. In some embodiments, the humanized TL1A protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized TL1A protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized TL1A protein comprises an endogenous cytoplasmic region, an endogenous transmembrane region, and a human or humanized extracellular region. In some embodiments, the humanized TL1A protein comprises an endogenous sequence that corresponds to amino acids 1-60, 1-62, or 1-65 of SEQ ID NO: 1.

[0060] In some embodiments, the genetically-modified non-human animal as described herein comprises a human or humanized TL1A gene. In some embodiments, the humanized TL1A gene comprises 4 exons. In some embodiments, the humanized TL1A gene comprises humanized exon 1, human exon 2, human exon 3, and / or humanized exon 4. In some embodiments, the humanized TL1A gene comprises 3 introns. In some embodiments, the humanized TL1A gene comprises human intron 1, human intron 2, and / or human intron 3. In some embodiments, the humanized TL1A gene comprises 2 introns. In some embodiments, the humanized TL1A gene comprises human introns 1 and 2, or human introns 2 and 3. In some embodiments, the humanized TL1A gene comprises human or humanized 5’ UTR. In some embodiments, the humanized TL1A gene comprises human or humanized 3’ UTR. In some embodiments, the humanized TL1A gene comprises endogenous 5’ UTR. In some embodiments, the humanized TL1A gene comprises endogenous 3’ UTR.

[0061] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) TL1A nucleotide sequence and / or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse TL1A mRNA sequence (e.g., NM_177371.4) , mouse TL1A amino acid sequence (e.g., SEQ ID NO: 1) , or a portion thereof (e.g., 5’ UTR, a portion of exon 1, a portion of exon 4, and 3’ UTR) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human TL1A mRNA sequence (e.g., NM_005118.4) , human TL1A amino acid sequence (e.g., SEQ ID NO: 2) , or a portion thereof (e.g., a portion of exon 1, exons 2 and 3, and a portion of exon 4) .

[0062] In some embodiments, the sequence encoding amino acids 66-252 of mouse TL1A (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TL1A (e.g., amino acids 61-251, 57-251, or 58-251 of human TL1A (SEQ ID NO: 2) ) .

[0063] In some embodiments, the sequence encoding amino acids 61-252 of mouse TL1A (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TL1A (e.g., amino acids 61-251, 57-251, or 58-251 of human TL1A (SEQ ID NO: 2) ) .

[0064] In some embodiments, the sequence encoding amino acids 63-252 of mouse TL1A (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TL1A (e.g., amino acids 61-251, 57-251, or 58-251 of human TL1A (SEQ ID NO: 2) ) .

[0065] In some embodiments, the sequence encoding amino acids 66-74, 75-252, 61-252, 62-252, 63-652, or 66-252 of mouse TL1A (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TL1A (e.g., amino acids 61-70, 71-251, 57-251, 58-251, or 61-251 of human TL1A (SEQ ID NO: 2) ) . In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse TL1A promotor, an inducible promoter, an enhancer, and / or mouse or human regulatory elements.

[0066] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 100, 200, 300, 400, 500, 572, 600, 700, 750, 752, 760, 780, 800, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6255, or 6500 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from part of or the entire mouse TL1A nucleotide sequence (e.g., a portion of exon 1, exons 2 and 3, and a portion of exon 4 ofNM_177371.4) .

[0067] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 100, 150, 200, 250, 300, 400, 500, 550, 600, 650, 700, 750, 785, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5217, 5500, or 5777 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as part of or the entire mouse TL1A nucleotide sequence (e.g., 5’ UTR, a portion of exon 1, aportion of exon 4, and 3’ UTR ofNM_177371.4) .

[0068] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 100, 150, 200, 250, 300, 400, 500, 550, 600, 650, 700, 750, 785, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5217, 5500, or 5777 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from part of or the entire human TL1A nucleotide sequence (e.g., 5’ UTR, a portion of exon 1, aportion of exon 4, and 3’ UTR ofNM_005118.4) .

[0069] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 100, 200, 300, 400, 500, 572, 600, 700, 750, 752, 760, 780, 800, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6255, or 6500 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as part of or the entire human TL1A nucleotide sequence (e.g., a portion (at least 5 bp) of exon 1, exons 2 and 3, and a portion (at least 50 bp) of exon 4 ofNM_005118.4) .

[0070] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 197, 200, 210, 220, 230, 240, 250, or 251 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire mouse TL1A amino acid sequence (e.g., amino acids 66-252, 61-252, 62-252, or 63-252 of NP_796345.4 (SEQ ID NO: 1) ) .

[0071] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 61, 62, 63, 64, 65, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 251 or 252 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire mouse TL1A amino acid sequence (e.g., amino acids 1-65, 1-60, 1-61, or 1-62 of NP_796345.4 (SEQ ID NO: 1) ) .

[0072] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 61, 62, 63, 64, 65, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 251 or 252 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire human TL1A amino acid sequence (e.g., amino acids 1-61, 1-57, or 1-58 of NP_005109.2 (SEQ ID NO: 2) ) .

[0073] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, 195, 200, 210, 220, 230, 240, 250, or 251 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire human TL1A amino acid sequence (e.g., amino acids 61-251, 57-251, or 58-251 of NP_005109.2 (SEQ ID NO: 2) ) .

[0074] The present disclosure also provides a humanized TL1A mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0075] a) an amino acid sequence shown in SEQ ID NO: 1, 2, or 9;

[0076] b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9;

[0077] c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 1, 2, or 9 under a low stringency condition or a strict stringency condition;

[0078] d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9;

[0079] e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

[0080] f) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9.

[0081] The present disclosure also provides a humanized TL1A amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0082] a) all or part of amino acids 61-251, 57-251, or 58-251 of SEQ ID NO: 2;

[0083] b) an amino acid sequence have a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 61-251, 57-251, or 58-251 of SEQ ID NO: 2;

[0084] c) an amino acid sequence that is different from amino acids 61-251, 57-251, or 58-251 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and

[0085] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 61-251, 57-251, or 58-251 of SEQ ID NO: 2.

[0086] The present disclosure also provides a humanized TL1A amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0087] a) all or part of amino acids 1-65 of SEQ ID NO: 1;

[0088] b) an amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 254-325 of SEQ ID NO: 1;

[0089] c) an amino acid sequence that is different from amino acids 1-65 of SEQ ID NO: 1 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and

[0090] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 1-65 of SEQ ID NO: 1.

[0091] The present disclosure also relates to a TL1A nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

[0092] a) a nucleic acid sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11, or a nucleic acid sequence encoding a homologous TL1A amino acid sequence of a humanized mouse TL1A;

[0093] b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11 under a low stringency condition or a strict stringency condition;

[0094] c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11;

[0095] d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9;

[0096] e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9;

[0097] f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and / or

[0098] g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9.

[0099] The present disclosure further relates to a TL1A genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 7 or 8.

[0100] The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 1, 2, or 9, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 1, 2, or 9 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0101] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 1, 2, or 9 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0102] The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 7 or 8, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 7 or 8 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0103] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0104] The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are as described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, or 1400 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 245, 250, 251, 252, 260, 270, 280, 290, 300, 304, 310, 320, or 325 amino acid residues.

[0105] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

[0106] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or(ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

[0107] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of4, and a frameshift gap penalty of5.

[0108] The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g., leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.

[0109] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) TL1A from an endogenous non-human TL1A locus.

[0110] Genetically modified animals

[0111] As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal’s genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an endothelial cell, a vascular endothelial, a fibroblast, an immune cell, a T cell, an antigen presenting cell, a macrophage, a dendritic cell, a monocyte, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous TL1A locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

[0112] As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

[0113] As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

[0114] As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

[0115] As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be, e.g., a human exon or a chimeric exon.

[0116] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized TL1A gene or a humanized TL1A nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human TL1A gene, at least one or more portions of the gene or the nucleic acid is from a non-human TL1A gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an TL1A protein. The encoded TL1A protein is functional or has at least one activity of the human TL1A protein or the non-human TL1A protein, e.g., activated by Lipopolysaccharide (LPS) .

[0117] In some embodiments, the humanized TL1A gene comprises a nucleotide sequence of 50～15378 (contiguous or non-contiguous) that is identical to human TL1A gene (SEQ ID NO: 7) . In some embodiments, the nucleotide sequence is 50～15378 bp, or 208～780 bp, e.g., at least 50, 100, 200, 300, 400, 500, 550, 600, 700, 750, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or 15378 nucleotides. In some embodiments, the nucleotide sequence is no more than 572, 752, 780, 6255, 6583, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or 15378 nucleotides.

[0118] In some embodiments, the part of exon 1 of the human TL1A gene includes 5 bp～237 bp (e.g., 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, or 237 bp) continuous or non-contiguous nucleotide sequence. In some embodiments, the part of exon 1 of the human TL1A gene includes a nucleotide sequence encoding all or part of the extracellular region, e.g., 5～30 bp continuous or non-contiguous nucleotides encoding the extracellular region amino acid sequence. In some embodiments, the part of exon 4 of the human TL1A gene includes 50 bp to 6255bp, such as 50, 100, 150, 200, 250, 300, 350, 400, 450, 452, 455, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 6100, 6200, or 6255 bp (continuous or non-contiguous) nucleotide sequence. In some embodiments, the part of exon 4 of the human TL1A gene includes the coding region in exon 4. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized TL1A protein or a humanized TL1A polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human TL1A protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human TL1A protein. The humanized TL1A protein or the humanized TL1A polypeptide is functional or has at least one activity of the human TL1A protein or the non-human TL1A protein.

[0119] In some embodiments, the humanized TL1A protein includes a polypeptide sequence of 20-251 amino acids (contiguous or non-contiguous) that is identical to human TL1A protein. In some embodiments, the polypeptide sequence is 20-251 or 20-195 amino acids in length, e.g., 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, or 195 amino acids.

[0120] In some embodiments, the extracellular region is human or humanized. In some embodiments, the cytoplasmic region is human or humanized. In some embodiments, the transmembrane region is human or humanized. In some embodiments, both the extracellular region and transmembrane are human or humanized. In some embodiments, both the transmembrane and cytoplasmic regions are endogenous.

[0121] The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable fertilized egg cells or embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

[0122] In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

[0123] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm) , 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL / 6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB / c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB / c-50%12954 / Sv; or 50%C57BL / 6-50%129) . In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola) , C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, or CBA / H background.

[0124] In one aspect, the non-human animal is a mammal. In one aspect, the non-human animal is a small mammal, e.g., a jerboa. In one embodiment, the genetically humanized non-human animal is a rodent. In one embodiment, the rodent is selected from the group consisting of mice, rats and hamsters. In one embodiment, the rodent is selected from the murine family. In one embodiment, the genetically modified animal is selected from a group consisting of hamsteridae (e.g., mouse-like hamsters) , hamsteridae (e.g., hamsters, New World rats and mice, voles) , murine superfamily (e.g., true mouse and rats, gerbils, spiny rats, and crested rats) , Falkomuridae (e.g., climbing mice, rock mice, tailed rats, Madagascar rats and mice) , Dormocidae (e.g., spiny dormouse) and Moleidae (e.g., mole rats, bamboo rats, and zokors) families. In a specific embodiment, the genetically modified rodent is selected from the group consisting of true mice or rats (Muridae) , gerbils, spiny rats and crested rats. In one embodiment, the genetically modified mouse is from a member of the family Muridae. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0125] In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0126] The animal can have one or more other genetic modifications, and / or other modifications, that are suitable for the particular purpose for which the humanized TL1A animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and / or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and / or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD / SCID mice, IL2Rγknockout mice, NOD / SCID / γcnull mice (Ito, M. et al., NOD / SCID / γcnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) : 3175-3182, 2002) , nude mice, and Rag1 and / or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, agenetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human TL1A locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD / SCID mice, IL-2Rγknockout mice, NOD / SCID / γcnull mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD-Prkdcscid IL-2rγnull mice, NOD-Rag 1- / --IL2rg- / - (NRG) mice, Rag 2- / --IL2rg- / - (RG) mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature TL1A coding sequence with human mature TL1A coding sequence.

[0127] Genetically modified non-human animals can comprise a modification at an endogenous non-human TL1A locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature TL1A protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the mature TL1A protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., fertilized egg cells, ES cells, or somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous TL1A locus in the germline of the animal.

[0128] Genetically modified animals can express a human TL1A and / or a chimeric (e.g., humanized) TL1A from endogenous mouse loci, wherein the endogenous mouse TL1A gene has been replaced with a human TL1A gene and / or a nucleotide sequence that encodes a region of human TL1A sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human TL1A sequence. In various embodiments, an endogenous non-human TL1A locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature TL1A protein.

[0129] In some embodiments, the genetically modified mice can express the human TL1A and / or chimeric TL1A (e.g., humanized TL1A) from endogenous loci that are under control of mouse promoters and / or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human TL1A or chimeric TL1A (e.g., humanized TL1A) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human TL1A or the chimeric TL1A (e.g., humanized TL1A) expressed in animal can maintain one or more functions of the wild-type mouse or human TL1A in the animal. For example, the expressed TL1A and TL1A / DR3 signaling can be activated by LPS. Furthermore, in some embodiments, the animal does not express endogenous TL1A. In some embodiments, the animal expresses a decreased level of endogenous TL1A as compared to TL1A expression level in a wild-type animal. As used herein, the term “endogenous TL1A” refers to TL1A protein that is expressed from an endogenous TL1A nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

[0130] The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TL1A (NP_005109.2SEQ ID NO: 2) . In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 7 or 8.

[0131] The genome of the genetically modified animal can comprise a replacement at an endogenous TL1A gene locus of a sequence encoding a region of endogenous TL1A with a sequence encoding a corresponding region of human TL1A. In some embodiments, the sequence that is replaced is any sequence within the endogenous TL1A gene locus, e.g., exon 1, exon 2, exon 3, exon 4, 5’ -UTR, 3’ -UTR, intron 1, intron 2, intron 3, or any combination thereof. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous TL1A gene. In some embodiments, the sequence that is replaced is a portion of exon 1, exons 2 and 3, and a portion of exon 4, of an endogenous mouse TL1A gene locus.

[0132] The genetically modified animal can have one or more cells expressing a human or chimeric TL1A (e.g., humanized TL1A) having, from N-terminus to C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. In some embodiments, the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the extracellular region of human TL1A. In some embodiments, the extracellular region of the humanized TL1A has a sequence that has at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, or 251 amino acids (e.g., contiguously or non-contiguously) that are identical to the extracellular region of human TL1A. In some embodiments, the extracellular region of the humanized TL1A has a sequence that has at least 1, 2, 3, 4, or 5 amino acids (contiguously or non-contiguously) that are identical to the C-terminal 1-5 amino acids in the extracellular region of endogenous TL1A (e.g., mouse TL1A) . In some embodiments, the extracellular region described herein does not include the signal peptide. Because human TL1A and non-human TL1A (e.g., mouse TL1A) sequences, in many cases, are different, antibodies that bind to human TL1A will not necessarily have the same binding affinity with non-human TL1A or have the same effects to non-human TL1A. Therefore, the genetically modified animal having a human or a humanized extracellular region can be used to better evaluate the effects of anti-human TL1A antibodies in an animal model.

[0133] In some embodiments, the transmembrane comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the transmembrane region of endogenous TL1A (e.g., amino acids 40-60 of SEQ ID NO: 1) . In some embodiments, the transmembrane region of the humanized TL1A has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 amino acids (contiguously or non-contiguously) that are identical to the transmembrane region of endogenous TL1A (e.g., mouse TL1A) . In some embodiments, the cytoplasmic comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the cytoplasmic of endogenous TL1A (e.g., amino acids 1-39 of SEQ ID NO: 1) . In some embodiments, the cytoplasmic region of the humanized TL1A has a sequence that has at least 10, 15, 20, 25, 30, 35, 36, 37, 38, or 39 amino acids (contiguously or non-contiguously) that are identical to the cytoplasmic region of endogenous TL1A (e.g., mouse TL1A) .

[0134] In some embodiments, the entire transmembrane region and the entire cytoplasmic region of the humanized TL1A described herein are derived from endogenous sequence.

[0135] In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of exon 1, exon 2, exon 3, and / or exon 4 of human TL1A; a portion or the entire sequence of the extracellular region; or a portion or the entire sequence of amino acids 61-251, 58-251, or 57-251 of SEQ ID NO: 2.

[0136] In some embodiments, the genome of the genetically modified animal comprises a portion of exon 1, exons 2 and 3, and a portion of exon 4 of human TL1A gene. In some embodiments, the portion of exon 1 includes at least 5, 10, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 235, 236, or 237 nucleotides. In some embodiments, the portion of exon 1 includes 30 nucleotides. In some embodiments, the portion of exon 1 includes a nucleotide of at least 5 bp. In some embodiments, the portion of exon 4 includes at least 50, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430, 440, 445, 450, 452, 455, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 6100, 6200, or 6255 nucleotides. In some embodiments, the portion of exon 4 includes 452 nucleotides. In some embodiments, the portion of exon 4 includes a nucleotide of at least 50 bp.

[0137] In some embodiments, the non-human animal can have, at an endogenous TL1A gene locus, a nucleotide sequence encoding a chimeric human / non-human TL1A polypeptide, wherein a human portion of the chimeric human / non-human TL1A polypeptide comprises all or a portion of the human TL1A extracellular region, and wherein the animal expresses a functional TL1A on a surface of a cell of the animal. The human portion of the chimeric human / non-human TL1A polypeptide can comprise an amino acid sequence encoded by a portion of exon 1, exons 2 and 3, and / or a portion of exon 4 of human TL1A. In some embodiments, the human portion of the chimeric human / non-human TL1A polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99%identical to amino acids 61-251 of SEQ ID NO: 2. In some embodiments, the transmembrane region includes a sequence corresponding to the entire or part of amino acids 40-60 of SEQ ID NO: 1. In some embodiments, the cytoplasmic region includes a sequence corresponding to the entire or part of amino acids 1-39 of SEQ ID NO: 1.

[0138] In some embodiments, the non-human portion of the chimeric human / non-human TL1A polypeptide comprises the entire transmembrane region and / or the entire cytoplasmic region of an endogenous non-human TL1A polypeptide.

[0139] Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous TL1A locus, or homozygous with respect to the replacement at the endogenous TL1A locus.

[0140] In some embodiments, the humanized TL1A locus lacks a human TL1A gene 5’ -UTR. In some embodiment, the humanized TL1A locus comprises an endogenous (e.g., mouse) 5’ -UTR. In some embodiments, the humanization comprises an endogenous (e.g., mouse) 3’ -UTR. In appropriate cases, it may be reasonable to presume that the mouse and human TL1A genes appear to be similarly regulated based on the similarity of their 5’ -flanking sequence. As shown in the present disclosure, humanized TL1A mice that comprise a replacement at an endogenous mouse TL1A locus, which retain mouse regulatory elements but comprise a humanization of TL1A encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized TL1A are grossly normal.

[0141] The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) .

[0142] In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

[0143] In some embodiments, the non-human mammal expresses a protein encoded by a humanized TL1A gene.

[0144] In addition, the present disclosure also relates to a DSS-induced colitis non-human mammal modal, a LPS-induced inflammation / sepsis non-human mammal modal, a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

[0145] The present disclosure further relates to a cell, cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, the non-human mammal treated with inflammation stimulators (e.g., LPS or DSS) , or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, the non-human mammal treated with inflammation stimulators (e.g., LPS or DSS) , or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

[0146] The present disclosure also provides non-human mammals produced by any othe methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized TL1A in the genome of the animal.

[0147] In some embodiments, the non-human mammal comprises the genetic construct as described herein (e.g., gene construct as shown in FIGS. 2, 3, 4, and / or 5) . In some embodiments, a non-human mammal expressing human or humanized TL1A is provided. In some embodiments, the tissue-specific expression of human or humanized TL1A protein is provided.

[0148] In some embodiments, the expression of human or humanized TL1A in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System / Tet-On System, or Tamoxifen System.

[0149] Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a mouse.

[0150] Genetic, molecular and behavioral analyses for the non-human mammals described above can be performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

[0151] The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cells can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human TL1A protein can be detected by a variety of methods.

[0152] There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized TL1A protein.

[0153] In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous TL1A gene, wherein the disruption of the endogenous TL1A gene comprises deletion of exon 1, exon 2, exon 3, and / or exon 4, or part thereof of the endogenous TL1A gene.

[0154] In some embodiments, the disruption of the endogenous TL1A gene comprises deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, and exon 4 of the endogenous TL1A gene.

[0155] In some embodiments, the disruption of the endogenous TL1A gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2 and / or intron 3of the endogenous TL1A gene. In some embodiments, the disruption of the endogenous TL1A gene further comprises deletion of one or more introns or part of introns selected from the group consisting of introns 1-3, introns1-2 or introns 2-3 of the endogenous TL1A gene.

[0156] In some embodiments, wherein the deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 550, 560, 561, 570, 576, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 5000, 5500, 5600, 5700, 5777, or more nucleotides.

[0157] In some embodiments, the disruption of the endogenous TL1A gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 251, or 252 nucleotides of exon 1, exon 2, exon 3, and / or exon 4 (e.g., deletion of at least 5 nucleotides from exon 1, exons 2 and 3, and at least 50 nucleotides from exon 4) .

[0158] Vectors

[0159] The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the TL1A gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired / donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the TL1A gene genomic DNAs in the length of 100 to 10,000 nucleotides.

[0160] In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000070.7; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000070.7.

[0161] In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 63663073 to the position 63667349 of the NCBI accession number NC_000070.7; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 63643878 to the position 63647828 of the NCBI accession number NC_000070.7.

[0162] In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 63663073 to the position 63664140 of the NCBI accession number NC_000070.7; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 63645928 to the position 63647828 of the NCBI accession number NC_000070.7.

[0163] In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, about 5 kb, about 5.5 kb, about 6 kb, about 6.5 kb, about 7 kb, about 7.5 kb, about 8 kb, about 9 kb, about 10 kb, about 11 kb, about 12 kb, about 13 kb, about 14 kb, about 15 kb, about 15.2 kb, about 15, 4 kb, or about 16 kb.

[0164] In some embodiments, the region to be altered is exon 1, exon 2, exon 3, and / or exon 4 of TL1A gene (e.g., a portion of exon 1, exons 2 and 3, and a portion of exon 4 of mouse TL1A gene) .

[0165] The targeting vector can further include one or more selectable markers, e.g., positive or negative selectable markers. In some embodiments, the positive selectable marker is a Neo gene or Neo cassette. In some embodiments, the negative selectable marker is a diphtheria toxin A chain (DTA) gene.

[0166] In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 3; and the sequence of the 3’ arm is shown in SEQ ID NO: 4. In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 5; and the sequence of the 3’ arm is shown in SEQ ID NO: 6.

[0167] In some embodiments, the sequence is derived from human (e.g., 114784635-114806039 of NC_000009.12; or 208-780 ofNM_005118.4) . For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human TL1A gene, preferably exon 1, exon 2, exon 3, and / or exon 4 the human TL1A gene. In some embodiments, the nucleotide sequence of the humanized TL1A gene encodes the entire or the part of human TL1A protein with the NCBI accession number NP_005109.2 (SEQ ID NO: 2) .

[0168] The disclosure also provides vectors for constructing a humanized animal model or a knock-out model. In some embodiments, the vectors comprise a sgRNA sequence, wherein the sgRNA sequence targets TL1A gene, and the sgRNA is unique on the target sequence of the gene to be altered, and meets the sequence arrangement rule of5’ -NNN (20) -NGG3’ or 5’ -CCN-N (20) -3’ ; and in some embodiments, the targeting site of the sgRNA in the mouse TL1A gene is located on the exon 1, exon 2, exon 3, exon 4, intron 1, intron 2, intron 3, upstream of exon 1, or downstream of exon 4 of the mouse TL1A gene.

[0169] In some embodiments, the targeting sequence is shown as SEQ ID NO: 14. Thus, the disclosure provides sgRNA sequences for constructing a genetic modified animal model. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 14 and 15. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 16 and 18. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 17 and 19. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 20 and 22. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 21 and 23.

[0170] In some embodiments, the disclosure relates to a plasmid construct (e.g., pT7-sgRNA) including the sgRNA sequence, and / or a cell including the construct.

[0171] The disclosure also relates to a cell comprising the targeting vectors as described above.

[0172] In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

[0173] In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

[0174] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0175] Methods of making genetically modified animals

[0176] Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

[0177] Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous TL1A gene locus, a sequence encoding a region of an endogenous TL1A with a sequence encoding a corresponding region of human or chimeric TL1A. In some embodiments, the replacement occurs in a fertilized egg cell, a germ cell, a somatic cell, ablastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

[0178] FIG. 3 and FIG. 5 show humanization strategies for a mouse TL1A locus. The targeting strategies involve a vector comprising a 5’ homologous arm, a human TL1A gene fragment, and a 3’ homologous arm. The process can involve replacing endogenous TL1A sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and the homologous recombination is used to replace endogenous TL1A sequence with human TL1A sequence.

[0179] Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous TL1A locus (or site) , a nucleic acid sequence encoding a region of endogenous TL1A with a sequence encoding a corresponding region of human TL1A. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, and / or exon 4 of a human TL1A gene. In some embodiments, the sequence includes a portion of exon 1, exons 2 and 3, and a portion of exon 4 of a human TL1A gene (e.g., nucleic acids 208-780 ofNM_005109.2) . In some embodiments, the endogenous TL1A locus is exon 1, exon 2, exon 3, and / or exon 4 of mouse TL1A. In some embodiments, the sequence includes a portion of exon 1 and a portion of exon 4 of mouse TL1A gene (e.g., nucleic acids 208-237 and 329-780 ofNM_005109.2) .

[0180] In some embodiments, the methods of modifying a TL1A locus of a mouse to express a chimeric human / mouse TL1A peptide can include the steps of replacing at the endogenous mouse TL1A locus a nucleotide sequence encoding a mouse TL1A with a nucleotide sequence encoding a human TL1A, thereby generating a sequence encoding a chimeric human / mouse TL1A.

[0181] The present disclosure further provides a method for establishing a TL1A gene humanized animal model, involving the following steps:

[0182] (a) providing a cell (e.g., a fertilized egg cell) based on the methods described herein;

[0183] (b) culturing the cell in a liquid culture medium;

[0184] (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

[0185] (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

[0186] In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL / 6 mouse) .

[0187] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy) .

[0188] In some embodiments, the fertilized egg cells for the methods described above are C57BL / 6 fertilized egg cells. Other fertilized egg cells that can also be used in the methods as described herein include, but are not limited to, FVB / N fertilized egg cells, BALB / c fertilized egg cells, DBA / 1 fertilized eggs and DBA / 2 fertilized egg cells.

[0189] Fertilized egg cells can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg cell by microinjection ofDNA. For example, by way of culturing a fertilized egg cell after microinjection, a cultured fertilized egg cell can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.

[0190] In some embodiments, methods of making the genetically modified animal comprises modifying the coding frame of the non-human animal’s TL1A gene, e.g., by inserting a nucleotide sequence (e.g., DNA or cDNA sequence) encoding human or humanized TL1A protein, e.g., immediately after the endogenous regulatory element of the non-human animal’s TL1A gene. For example, one or more functional region sequences of the non-human animal’s TL1A gene can be knocked out, or inserted with a sequence, such that the non-human animal cannot express or expresses a decreased level of endogenous TL1A protein. In some embodiments, the coding frame of the modified non-human animal’s TL1A gene can be all or part of the nucleotide sequence from exon 1 to exon 4 of the non-human animal’s TL1A gene.

[0191] In some embodiments, methods of making the genetically modified animal comprises inserting a nucleotide sequence encoding human or humanized TL1A protein and / or an auxiliary sequence after the endogenous regulatory element of the non-human animal’s TL1A gene. In some embodiments, the auxiliary sequence can be a stop codon, such that the TL1A gene humanized animal model can express human or humanized TL1A protein in vivo, but does not express non-human animal’s TL1A protein. In some embodiments, the auxiliary sequence includes FRT, WPRE (WHP Posttranscriptional Response Element) , loxP, and / or polyA.

[0192] In some embodiments, the insertion refers to placing a target fragment directly between two adjacent bases without deleting nucleotides. For example, the target fragment can be a human TL1A gene, a humanized TL1A gene, a nucleotide sequence encoding a human or humanized TL1A protein, or a nucleotide sequence obtained by splicing human TL1A and non-human TL1A genes. In some embodiments, the target fragment can also be a partial nucleotide sequence of the human TL1A gene. Preferably, exon x+1 to exon 4 of the human TL1A gene can be inserted adjacent to exon x of the TL1A gene of non-human animals. For example, exon 2 to exon 4 of the human TL1A gene can be inserted adjacent to exon 1 of the TL1A gene of non-human animals; exons 3 and 4 of the human TL1A gene can be inserted adjacent to exon 2 of the TL1A gene of non-human animals.

[0193] In some embodiments, the method for making the genetically modified animal comprises:

[0194] (1) providing a plasmid comprising a human TL1A gene fragment, flanked by a 5’ homologous arm and a 3’ homologous arm, wherein the 5’ and 3’ homologous arms target an endogenous TL1A gene;

[0195] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous TL1A gene;

[0196] (3) modifying genome of a fertilized egg cell or an embryonic stem cell by using the plasmid of step (1) , the sgRNAs of step (2) , and Cas9;

[0197] (4) transplanting the fertilized egg cell obtained in step (3) into the oviduct of a pseudopregnant female mouse or transplanting the embryonic stem cell obtained in step (3) into a blastocyst which is then transplanted into the oviduct of a pseudopregnant female mouse to produce a child mouse that functionally expresses a humanized TL1A protein; and

[0198] (5) mating the child mouse obtained in step (2) to obtain a homozygote mouse,

[0199] In some embodiments, the fertilized egg cell is modified by CRISPR with sgRNAs that target a 5’ -terminal targeting site and a 3’ -terminal targeting site.

[0200] In some embodiments, the sequence encoding the humanized TL1A protein is operably linked to an endogenous regulatory element at the endogenous TL1A gene locus.

[0201] In some embodiments, the genetically-modified animal does not express an endogenous TL1A protein.

[0202] In some embodiments, the method for making the genetically modified animal comprises:

[0203] (1) providing a plasmid comprising a human or chimeric TL1A gene fragment, flanked by a 5’ homologous arm and a 3’ homologous arm, wherein the 5’ and 3’ homologous arms target an endogenous TL1A gene;

[0204] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous TL1A gene; and

[0205] (3) modifying genome of a fertilized egg cell or an embryonic stem cell by inserting the human or chimeric TL1A gene fragment into the genome.

[0206] Methods of using genetically modified animals

[0207] Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and / or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and / or protein assay and / or functional assay. Inclusion in the human transgene of upstream and / or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and / or regulation of the transgene.

[0208] In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.

[0209] Genetically modified animals that express human or humanized TL1A protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and / or the efficacy of these human therapeutics in the animal models.

[0210] In various aspects, genetically modified animals are provided that express human or humanized TL1A, which are useful for testing therapeutic agents that can decrease or block the interaction between the interaction between TL1A and anti-human TL1A antibodies, testing whether a therapeutic agent can increase or decrease the immune response, and / or determining whether an agent is an TL1A agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout) . In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor (e.g., lung cancer) or a blood cell tumor (e.g., a lymphocyte tumor, a B or T cell tumor) .

[0211] In some embodiments, the therapeutic agent (e.g., an anti-TL1A antibody) described herein can bind to TL1A expressed on the surface of multiple types of cells (e.g., endothelial cells or immune cells) and block the activation of inflammatory pathways, thereby treating inflammation. In some embodiments, the therapeutic agent (e.g., an anti-TL1A antibody) described herein can target TL1A expressed on the surface of dendritic cells, to inhibit bacterial infection (e.g., LPS stimulation) .

[0212] In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent (e.g., an anti-TL1A antibody or a TL1A-targeting drug) for the treatment of cancer. In some embodiments, the methods involve administering the therapeutic agent (e.g., an anti-human TL1A antibody or a TL1A-targeting drug) to the animal as described herein, wherein the animal has a cancer or tumor; and determining inhibitory effects of the therapeutic agent to the cancer or tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT.

[0213] In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the anti-TL1A antibody activates TL1A signaling pathways. In some embodiments, the anti-TL1A antibody does not activate TL1A signaling pathways. In some embodiments, the anti-TL1A antibody inhibits TL1A signaling pathways.

[0214] In some embodiments, the genetically modified animals can be used for determining whether an anti-TL1A antibody is a TL1A agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the therapeutic agent (e.g., anti-TL1A antibodies) on TL1A, e.g., whether the agent can activate immune cells (e.g., dendritic cells) , whether the agent can upregulate the immune response or downregulate immune response, and / or whether the agent can induce complement mediated cytotoxicity (CMC) or antibody dependent cellular cytotoxicity (ADCC) . In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., inflammatory disease, cancer, or autoimmune disease.

[0215] The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and / or determining tumor (volume) inhibition rate (TGITV) . The tumor growth inhibition rate can be calculated using the formula TGITV (%) = (1–TVt / TVc) ×100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

[0216] In some embodiments, the therapeutic agent (e.g., an anti-TL1A antibody or a TL1A-targeting drug) is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and / or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.

[0217] In some embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In a specific embodiment, the tumor is non-small cell lung cancer, metastatic colorectal cancer, cervical cancer, ovarian cancer, nasopharyngeal cancer, gastric cancer, glioma.

[0218] In some embodiments, the cancer described herein is lung cancer, leukemia, colon cancer, head and neck cancer, kidney cancer, pancreatic cancer, or gastric cancer.

[0219] In some embodiments, the therapeutic agent (e.g., an anti-TL1A antibody or a TL1A-targeting drug) is designed for treating various autoimmune diseases, including rheumatoid arthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, or scleroderma. In some embodiments, the anti-TL1A antibody is designed for treating various immune disorders, including allergy, asthma, and / or atopic dermatitis. Thus, the methods as described herein can be used to determine the effectiveness of a therapeutic agent (e.g., an anti-TL1A antibody or a TL1A-targeting drug) in inhibiting immune response. In some embodiments, the immune disorders described herein is graft versus host disease (GVHD) , psoriasis, allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc. In some embodiments, the therapeutic agent (e.g., an anti-TL1A antibody or a TL1A-targeting drug) is designed for treating various inflammations, e.g., bacteria-induced inflammation, LPS-induced inflammation, DSS-induced inflammation, or virus-induced inflammation. In some embodiments, the inflammation described herein includes both acute inflammation and chronic inflammation. Specifically, the inflammation includes but not limited to degenerative inflammation, exudative inflammation (e.g., serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotic inflammation, catarrhal inflammation) , proliferative inflammation, specific inflammation (e.g., tuberculosis, syphilis, leprosy, or lymphogranuloma) .

[0220] The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-TL1A antibody) . The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40%smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody) .

[0221] The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

[0222] In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and / or a therapeutic strategy.

[0223] The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the TL1A gene function, human TL1A antibodies, drugs for human TL1A targeting sites, the drugs or efficacies for human TL1A targeting sites, the drugs for immune-related diseases and antitumor drugs.

[0224] In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and / or other immunotherapies (e.g., T-cell adoptive transfer therapies) . For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the TL1A gene humanized non-human animal prepared by the methods described herein, the TL1A gene humanized non-human animal described herein, the double-or multi-humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized TL1A protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and / or other immunotherapies can treat the TL1A-associated diseases described herein. In some embodiments, the TCA-T, CAR-T, and / or other immunotherapies provides an evaluation method for treating the TL1A-associated diseases described herein.

[0225] Genetically modified animal model with two or more human or chimeric genes

[0226] The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric TL1A gene and a sequence encoding an additional human or chimeric protein.

[0227] In some embodiments, the additional human or chimeric protein can be interleukin 23 alpha subunit (IL23A) , interleukin 12 beta subunit (IL12B) , tumor necrosis factor alpha (TNFA) , tumor necrosis factor receptor 1 (TNFR1) , tumor necrosis factor receptor 2 (TNFR2) , programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , 4-1BB, cluster of differentiation 3 (CD3) , and / or lymphocyte-activation gene 3 (LAG3) .

[0228] The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

[0229] (a) using the methods of introducing human TL1A gene or chimeric TL1A gene as described herein to obtain a genetically modified non-human animal;

[0230] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

[0231] In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, and / or LAG3 gene. Some of these genetically modified non-human animals are described, e.g., in PCT / CN2017 / 090320, PCT / CN2017 / 099574, PCT / CN2017 / 099576, PCT / CN2022 / 113594, PCT / CN2021 / 095273, PCT / CN2022 / 096667, PCT / CN2020 / 113618, PCT / CN2019 / 128358, PCT / CN2020 / 128201, PCT / CN2022 / 131092, and PCT / CN2021 / 085053; each of which is incorporated herein by reference in its entirety.

[0232] In some embodiments, the TL1A humanization is directly performed on a genetically modified animal having a human or chimeric IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, and / or LAG3 gene.

[0233] As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-TL1A antibody and an additional therapeutic agent for the treatment of inflammation or cancer. The methods include administering the anti-TL1A antibody and the additional therapeutic agent to the animal, wherein the animal has inflammation or a tumor; and determining the inhibitory effects of the combined treatment to immune responses or the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, and / or LAG3.

[0234] In some embodiments, the combination treatment is designed for treating various inflammatory disorders as described herein, e.g., inflammatory bowel diseases (IBD) , Crohn’s disease, ulcerative colitis, acute or chronic colitis, bacteria-induced inflammation, LPS-induced inflammation, virus-induced inflammation, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, or scleroderma.

[0235] In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating inflammatory disorders that can be used alone or in combination with methods described herein, include but not limited to, treating the subject with steroids (e.g., prednisone, methylprednisolone, dexamethasone, hydrocortisone, betamethasone, or triamcinolone) , non-steroidal anti-inflammatory drugs (NSAIDs, e.g., Ibuprofen, naproxen, diclofenac, or celecoxib) , biologic agents (e.g., TNF inhibitors, interleukin inhibitors, B cell modulators, or T cell modulators) , immunosuppressive agents (e.g., methotrexate, azathioprine, cyclosporine, mycophenolate mofetil, or tacrolimus) , Janus Kinase (JAK) Inhibitors (e.g., tofacitinib, baricitinib, or upadacitinib) , disease-modifying antirheumatic drugs (DMARDs, e.g., methotrexate, sulfasalazine, hydroxychloroquine, or leflunomide) , monoclonal antibodies (e.g., belimumab or ustekinumab) , intravenous immunoglobulin (IVIG) , other targeted therapies (e.g., fingolimod or apremilast) , or any combination thereof.

[0236] In some embodiments, TNF inhibitors include but not limited to adalimumab, infliximab, or etanercept. In some embodiments, interleukin inhibitors include but not limited to tocilizumab (IL-6 inhibitor) , anakinra (IL-1 inhibitor) , ustekinumab (IL-12 / 23 inhibitor) , or secukinumab (IL-17 inhibitor) . In some embodiments, B cell Modulators include but not limited to Rituximab. T cell Modulators include but not limited to Abatacept.

[0237] In some embodiments, the combination treatment is designed for treating various cancers as described herein, e.g., a solid tumor, gynecologic cancer, breast cancer, colorectal cancer, gastric adenocarcinoma, lung adenocarcinoma, pancreatic cancer, or head and neck cancer.

[0238] In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and / or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the patient.

[0239] EXAMPLES

[0240] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0241] Materials and Methods

[0242] The following equipment and materials used in the following examples were obtained from several companies identified below:

[0243] C57BL / 6 mice were purchased from the National Institutes for Food and Drug Control National Rodent Laboratory Animal Resources Center.

[0244] Asel and restriction enzymes were purchased from NEB (Catalog numbers: R0526S and R3136S, respectively) .

[0245] Purified anti-mouse CD16 / 32 Antibody was purchased from BioLegend (Catalog number: 101302) .

[0246] Zombie NIRTM Fixable Viability Kit was purchased from BioLegend (Catalog number: 423106) .

[0247] BV480 Rat Anti-Mouse CD31 Antibody was purchased from BioLegend (Catalog number: 565629) .

[0248] TL1A Monoclonal Antibody (Tandys1a) , PerCP-eFluor 710TM, eBioscienceTM was purchased from Invitrogen (Catalog number: 46-7911-82) .

[0249] Polyclonal Rabbit anti‐Human TNFSF15 / TL1A / VEGI Antibody (PE, aa148‐175, IF, WB)LS‐C241951 was purchased from LSBio (Catalog number: LS-C241951-200) .

[0250] Mouse IgG1 kappa Isotype Control (P3.6.2.8.1) , PerCP-eFluorTM710, eBioscienceTM was purchased from Invitrogen, (Catalog number: 46-4714-80) .

[0251] Polyclonal Rabbit IgG Isotype Control Antibody (RPE) LS‐C149377 was purchased from LSBio, (Catalog number: LS-C149377) .

[0252] Human TL1A / TNFSF15 DuoSet ELISA was purchased from R&D SYSTEMS (Catalog number: DY1319-05) .

[0253] EXAMPLE 1: Mice with humanized TL1A gene

[0254] In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human or humanized TL1A protein, and the obtained genetically-modified non-human animal can express a human or humanized TL1A protein in vivo. The mouse TL1A gene (NCBI Gene ID: 326623, Primary source: MGI: 2180140, UniProt ID: Q5UBV8) is located at position 63642837 to 63663296 of chromosome 4 (NC_000070.7) . The mouse TL1A transcript is NM_177371.4, and the corresponding protein sequence NP_796345.4 is set forth in SEQ ID NO: 1. The human TL1A gene (NCBI Gene ID: 9966, Primary source: HGNC: 11931, UniProt ID: O95150) is located at position 114784635 to 114806039 of chromosome 9 (NC_000009.12) . The human TL1A transcript is NM_005118.4, and the corresponding protein sequence NP_005109.2 is set forth in SEQ ID NO: 2. Mouse and human TL1A gene loci are shown in FIG. 1.

[0255] All or part of nucleotide sequences encoding human TL1A protein can be introduced into the mouse endogenous TL1A locus, so that the mouse expresses human or humanized TL1A protein. Specifically, using gene-editing techniques, under control of mouse TL1A gene regulatory elements, a sequence (about 15.2 kb) starting from within exon 1 and ending within exon 4 of mouse TL1A gene was replaced with a corresponding sequence (about 15.4 kb) starting from within exon 1 and ending within exon 4 of human TL1A gene, to obtain a humanized TL1A gene locus as shown in FIG. 2. This method can make mouse with humanized TL1A gene.

[0256] As shown in the schematic diagram of the targeting strategy in FIG. 3, the targeting vector V1 contains homologous arm sequences upstream and downstream of the mouse TL1A gene, and an “A Fragment” containing DNA sequences of human TL1A gene. Specifically, the sequence of the upstream homologous arm (5’ homologous arm, SEQ ID NO: 3) is identical to the nucleotide sequence of position 63663073-63667349 ofNCBI accession number NC_000070.7, and the sequence of the downstream homologous arm (3’ homologous arm, SEQ ID NO: 4) is identical to the nucleotide sequence of position 63643878-63647828 ofNCBI accession number NC_000070.7. The nucleotide sequence of human TL1A gene fragment (SEQ ID NO: 7) is identical to the nucleotide sequence of position 114790455-114805832 ofNCBI accession number NC_000009.12.

[0257] The connection between the 5’ end (upstream) of the human TL1A gene fragment and the mouse sequence was designed as: 5’ -TCCCATCCTCGCAGGACTTAGCACCCTCCTAATGGCTGGCCAGCTCCG GGGAGAGGCCTGTGTGCAGTTCCAGGTAAGCCACATGGCACTCTGACCT-3’ (SEQ ID NO: 10) , wherein the last “G” in the sequence of “TCCGG” is the last nucleotide of the mouse sequence, and the first “G” in the sequence is the first nucleotide of the human TL1A gene fragment. The connection between the 3’ end (downstream) of the human TL1A gene fragment and the mouse sequence was designed as: 5’ -ATCTCTTTGGTGGATTACACAAAAGAAGATAAAACCTTCTTTGGAGCCTTCTTACTA AGGAGAAAACCATCATTCCAAGGGGCTCCCCTGCCTCCTACTTTCCA-3’(SEQ ID NO: 11) , wherein the last “A” in the sequence of “TACTA” is the last nucleotide of the human TL1A gene fragment, and the first “T” in the sequence of is the first nucleotide of the mouse sequence.

[0258] The targeting vector also includes an antibiotic resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence (Neo) . Two site-specific recombination sites, the flippase recombination target (FRT) , arranged in the same direction flank the antibiotic resistance gene, forming a Neo cassette. The connection between the 5’ end of the Neo cassette and the human sequence was designed as: 5’ -TCCATACTATCACCAGTTGGCCAACTTTCCAAGTCTAGTGCAGAAATCCAA TCCTATTCTCTAGAAAGTATAGGAACTTCAGGTCTGAAGAGGAG-3’ (SEQ ID NO: 12) , wherein the last “A” in the sequence of “TCCAA” is the last nucleotide of the human sequence, and the first “G” in the sequence of is the first nucleotide of the Neo cassette. The connection between the 3’ end of the Neo cassette and the human sequence was designed as: 5’ -TTGCGGAACCCTTCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC CTCA CACCTAGAGTTCCTATACCTCTGAGACTCCAGAGGAAAGAACAAGACAGTGCAGAA G-3’ (SEQ ID NO: 13) , wherein the last “C” in the sequence of “ACTTC” is the last nucleotide of the Neo cassette, and the first G in the sequence of is the first nucleotide of the human sequence. The mRNA sequence transcribed from the humanized TL1A gene after his shown in SEQ ID NO: 8, and the amino acid sequence of the expressed humanized TL1A protein is in SEQ ID NO: 9.

[0259] Targeting vector was constructed using conventional methods, such as restriction enzyme digestion and ligation. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. The targeting vector verified by sequencing was electroporated and transfected into embryonic stem cells of C57BL / 6 mice, and the resulting cells were screened using positive clone selection marker genes to select the correct positive clone cells. The screened correct positive clone cells (black mice) were introduced into the blastocysts (white mice) , and the resulting chimeric blastocysts were transferred to the culture medium and then transplanted to the fallopian tubes of recipient female mice (white mice) , thereby generating F0 generation chimeric mice (black and white) . F0 generation chimeric mice and wild-type mice were backcrossed to obtain F1 generation mice, and then F1 generation heterozygous mice were mated with each other to obtain F2 generation homozygous mice. Positive mice were also mated with Flp tool mice to remove the positive clone screening marker genes (see FIG. 4, the schematic diagram of this process) , and then through mutual mating, homozygous mice with humanized TL1A genes were obtained.

[0260] In addition, the CRISPR / Cas9 system was also used for gene editing. The schematic diagram demonstrating an exemplary TL1A gene targeting strategy is shown in FIG. 5, where the targeting vector V2 contains the homology arm sequences upstream and downstream of the mouse TL1A gene, as well as the human TL1A fragment. The schematic diagram of the humanized TL1A locus after construction is shown in FIG. 2. The upstream 5’ homology arm sequence (SEQ ID NO: 5) has a nucleotide sequence identical to the nucleotide sequence from position 63663073 to 63664140 of the NCBI accession number NC_000070.7, and the downstream 3’ homology arm sequence (SEQ ID NO: 6) has a nucleotide sequence identical to the nucleotide sequence from position 63645928 to 63647828 of the NCBI accession number NC_000070.7. The nucleotide sequence of the human TL1A fragment (SEQ ID NO: 7) is identical to the nucleotide sequence at positions 114790455 to 114805832 ofNCBI accession number NC_000009.12. The mRNA sequence transcribed by the modified humanized TL1A gene is set forth in SEQ ID NO: 8, and the amino acid sequence of the expressed humanized TL1A protein is set forth in SEQ ID NO: 9.

[0261] The targeting vector was constructed using conventional methods, such as restriction enzyme digestion and ligation, or direct synthesis. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Targeting vectors with verified sequences were used for subsequent experiments.

[0262] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors. Specific sgRNA sequences were designed and synthesized that recognize the targeting site. The targeting site sequences of the sgRNAs on the TL1A gene locus are as follows:

[0263] sgRNA1 targeting site (SEQ ID NO: 14) : 5’ -ACAAAGCAAATACAGACCGGGGG-3’ ;

[0264] sgRNA2 targeting site (SEQ ID NO: 15) : 5’ -AGCCTGCCCGCCTACTAACAGGG-3’ .

[0265] UCA kit was used to detect the activity of the sgRNAs. After confirming that the sgRNAs can induce efficient Cas9 cleavage, restriction enzyme cleavage sites were added to its 5' end and a complementary strand to obtain a forward oligonucleotide and a reverse oligonucleotide, as shown in the table below. After annealing, the products were ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) , to obtain expression vector pT7-TL1A-1 and pT7-TL1A-2.

[0266] Table 3. sgRNA1 and sgRNA2 sequence list

[0267] The pT7-sgRNA vector was synthesized, which included a DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 24) , and was ligated to the backbone vector (Takara, Catalog number: 3299) after restriction enzyme digestion (EcoRI and BamHI) . The resulting plasmid was confirmed by sequencing to be the target plasmid. Pronuclear stage fertilized egg cells were taken from mice, such as C57BL / 6 mice. In vitro transcription products of pT7-TL1A-1 and pT7-TL1A-2 plasmids (using AmbionTM in vitro transcription kit to conduct the transcription according to the method provided in the product instruction) , targeting vector, and Cas9 mRNA were premixed and injected, using a microinjection instrument, into the cytoplasm or nucleus of mouse fertilized egg cells. Microinjection of fertilized egg cells was conducted according to the methods provided, e.g., in Andras Nagy, et al., "Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) "  (Chemical Industry Press, 2006) . Then, the injected fertilized egg cells were transferred to a suitable culture medium for a temporary culture before being transplanted into the fallopian tubes of recipient female mice for development. The resulting F0 generation mice were crossed and interbred to expand the population and establish a stable mouse strain carrying the humanized TL1A gene.

[0268] Table 4. F1 generation genotype PCR primer sequences and recombinant fragment size

[0269] The genotype of the somatic cells of the F1 generation mice can be identified by PCR analysis. The PCR primers are shown in Table 4. The identification results of some F1 generation mice are shown in FIG. 6. The results indicate that mice numbered F1-01, F1-02, F1-03, and F1-04 were positive mice (heterozygous) . The F1 generation mice identified by PCR as positive for humanized TL1A gene were further verified by Southern Blot to confirm whether there was random insertion. Specifically, genomic DNA from the mouse tail was extracted, which was digested with AseI or BamHI restriction enzyme respectively. Two probes were used for hybridization. The size of the probes and target fragments is shown in the table below. The Southern Blot detection results are shown in FIG. 7, along with the PCR and sequencing results, confirming that mice numbered F1-01, F1-02, and F1-03 were verified as positive heterozygous mice without random insertions. These results indicate that the TL1A gene humanized mice constructed using the methods described herein can be stably passaged without random insertions.

[0270] Table 5. Size of the probes and target fragments

[0271] The following primers were used for probe synthesis in Southern Blot assays:

[0272] 5’Probe-F (SEQ ID NO: 29) : 5’ -CATAATTCAAATGCCCTTCAGTGGG-3’ ,

[0273] 5’Probe-R (SEQ ID NO: 30) : 5’ -CTGACTTGGCTTGGCTCTTTCTGTC-3’ .

[0274] A Probe-F (SEQ ID NO: 31) : 5’ -TTCAGCTCTGTCAATATCAAGG-3’ ,

[0275] A Probe-R (SEQ ID NO: 32) : 5’ -GGCCAACAGCTTGCACAACAGC-3’ .

[0276] The mRNA expression of humanized TL1A gene in the TL1A gene humanized mice can be verified, e.g., by RT-PCR. Specifically, one 7-week-old female C57BL / 6 wild-type mouse and one 7-week-old female TL1A gene humanized homozygous mouse were selected. Lung tissue was collected after euthanasia by cervical dislocation, and RT-PCR detection was conducted using the primers listed in the table below. The detection results showed that in wild-type C57BL / 6 mice, only mouse TL1A mRNA was detected, whereas human TL1A mRNA was undetectable. In contrast, in mice homozygous for humanized TL1A gene, only human TL1A mRNA was detected.

[0277] Table 6. Size of the probes and target fragments

[0278] Similarly, the expression of humanized TL1A protein (chiTL1A) in mice can also be confirmed, e.g., by flow cytometry. Specifically, one 7-week-old male C57BL / 6 wild-type mouse and one 7-week-old male TL1A gene humanized homozygous mouse (H / H) were selected. Lung tissue was collected after euthanasia by cervical dislocation. Cells were stained with: Purified anti-mouse CD16 / 32 Antibody, Zombie NIRTM Fixable Viability Kit, BV480 Rat Anti-Mouse CD31 Antibody, Mouse IgG1 kappa Isotype Control (P3.6.2.8.1) (PerCP-eFluor 710 eBioscienceTM) , Polyclonal Rabbit IgG Isotype Control Antibody (RPE) , human-mouse cross-antibody Polyclonal Rabbit anti‐Human TNFSF15 / TL1A / VEGI Antibody (PE, aa148‐175, IF, WB)LS‐C241951, and TL1A Monoclonal Antibody (Tandys1a) (PerCP-eFluorTM710, eBioscienceTM) , and then subjected to flow cytometry analysis. The results verified the expression of TL1A protein in both C57BL / 6 wild-type mice (+ / +) and TL1A gene humanized homozygous mice (H / H) . Combined with the above RT-PCR results, these findings demonstrated that the homozygous mice carrying the humanized TL1A gene can normally produce the humanized TL1A protein.

[0279] In addition, to further determine the expression of soluble TL1A protein in TL1A gene humanized homozygous mice (H / H) . Three 6-week-old male wild-type C57BL / 6 mice (+ / +) and three 6-week-old male TL1A gene humanized homozygous mice (H / H) were selected respectively. Bone marrow was collected, and bone marrow-derived dendrites were isolated. The cells were stimulated with 1μg / mL LPS for 24 h. The supernatant was collected and the level of soluble TL1A protein was detected using the specific human TL1A ELISA kit, Human TL1A / TNFSF15 DuoSet ELISA. As shown in FIG. 8, soluble humanized TL1A protein was only detected in TL1A gene humanized homozygous mice (H / H) , proving that the humanized TL1A gene in homozygous mice function normally in vivo.

[0280] EXAMPLE 2: In vivo efficacy verification

[0281] The TL1A gene humanized mice prepared by the methods described herein (e.g., Example 1) can be used to evaluate the efficacy of agents targeting human TL1A protein. For example, TL1A gene humanized homozygous mice (H / H) mice can be randomly divided into a untreated group, a control group, and a treatment group. The control and treatment groups can be administered 100 ml of2%to 3%dextran sulfate (DSS) to establish the colitis model, and the untreated group can be given an equal volume of drinking water. After the model is established, the treatment group can randomly be selected to target human TL1A drugs, and the control group can be injected with an equal volume of normal saline. The body weight and stool hardness of the mice will be regularly measured. By comparing the mouse body weight, stool hardness, blood in the stool and colon HE pathology score, the in vivo safety and efficacy of the agents can be effectively evaluated.

[0282] EXAMPLE 3: Generation of double-or multi-gene humanized mice

[0283] The TL1A gene humanized mice generated using the methods described herein can also be used to generate double-or multi-gene humanized mouse models. For example, in Example 1, the embryonic stem cells or fertilized egg cells used for microinjection can be selected from mice containing other genetic modifications such as modified (e.g., human or humanized) IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, and / or LAG3 genes. Alternatively, embryonic stem cells or fertilized egg cells isolated from humanized TL1A mice described herein and gene recombination targeting technology can be used to obtain double-gene or multi-gene-modified mouse models of TL1A and other gene modifications. The homozygous or heterozygous TL1A gene humanized mice obtained by the methods described herein can also be mated with other genetically modified mice, and their offspring can be screened. According to Mendel’s law, it is possible to generate double-gene or multi-gene modified heterozygous mice comprising modified (e.g., human or humanized) TL1A gene and other genetic modifications. Then the heterozygous mice can be bred with each other to obtain homozygous double-gene or multi-gene modified mice.

[0284] OTHER EMBODIMENTS

[0285] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1.A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric tumor necrosis factor (TNF) -like ligand 1A (TL1A) .2.The animal of claim 1, wherein the sequence encoding the human or chimeric TL1A is operably linked to an endogenous regulatory element at the endogenous TL1A gene locus in at least one chromosome.3.The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric TL1A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TL1A (NP_005109.2 (SEQ ID NO: 2) ) .4.The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric TL1A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 9.5.The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric TL1A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2.6.The animal of any one of claims 1-5, wherein the animal is a mammal (e.g., a monkey, a rodent, a mouse, or a rat) .7.The animal of any one of claims 1-6, wherein the animal is a mouse.8.The animal of any one of claims 1-7, wherein the animal does not express endogenous TL1A or expresses a decreased level of endogenous TL1A as compared to TL1A expression level in a wild-type animal.9.The animal of any one of claims 1-8, wherein the animal has one or more cells expressing human or chimeric TL1A.10.A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous TL1A with a sequence encoding a corresponding region of human TL1A at an endogenous TL1A gene locus.11.The animal of claim 10, wherein the sequence encoding the corresponding region of human TL1A is operably linked to an endogenous regulatory element at the endogenous TL1A locus, and one or more cells of the animal expresses a human or chimeric TL1A.12.The animal of claim 10 or 11, wherein the animal does not express endogenous TL1A or expresses a decreased level of endogenous TL1A as compared to TL1A expression level in a wild-type animal.13.The animal of any one of claims 10-12, wherein the replaced sequence encodes all or a portion of the extracellular region of TL1A.14.The animal of any one of claims 10-13, wherein the animal has one or more cells expressing a chimeric TL1A having a cytoplasmic region, a transmembrane region, and an extracellular region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the extracellular region of human TL1A (NP_005109.2 (SEQ ID NO: 2) ) .15.The animal of claim 14, wherein the extracellular region of the chimeric TL1A has a sequence that has at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, or 195 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TL1A (e.g., amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2) .16.The animal of any one of claims 10-15, wherein the sequence encoding a region of endogenous TL1A comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TL1A gene.17.The animal of any one of claims 10-16, wherein the animal is a mouse.18.The animal of any one of claims 10-17, wherein the animal is heterozygous with respect to the replacement at the endogenous TL1A gene locus.19.The animal of any one of claims 10-18, wherein the animal is homozygous with respect to the replacement at the endogenous TL1A gene locus.20.A method for making a genetically-modified, non-human animal, comprising:replacing in at least one cell of the animal, at an endogenous TL1A gene locus, a sequence encoding a region of endogenous TL1A with a sequence encoding a corresponding region of human TL1A.21.The method of claim 20, wherein the sequence encoding the corresponding region of human TL1A comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of a human TL1A gene.22.The method of claim 20 or 21, wherein the sequence encoding the corresponding region of human TL1A comprises a portion of exon 1, exon 2, exon 3, and a portion of exon 4, of a human TL1A gene.23.The method of any one of claims 20-22, wherein the sequence encoding the corresponding region of human TL1A encodes amino acids 57-251, 58-251, or 61-251of SEQ ID NO: 2.24.The method of any one of claims 20-23, wherein the region comprises all or a portion of the extracellular region of TL1A.25.The method of any one of claims 20-24, wherein the sequence encoding a region of endogenous TL1A comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TL1A gene.26.The method of any one of claims 20-25, wherein the animal is a mouse, and the sequence encoding a region of endogenous TL1A comprises a portion of exon 1, exon 2, exon 3, and a portion of exon 4 of the endogenous TL1A gene.27.A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a humanized TL1A polypeptide, wherein the humanized TL1A polypeptide comprises at least 20 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human TL1A, wherein the animal expresses the humanized TL1A polypeptide.28.The animal of claim 27, wherein the humanized TL1A polypeptide has at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, or 195 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of human TL1A extracellular region (e.g., amino acids 57-251, 58-251, or 60-251 of SEQ ID NO: 2) .29.The animal of any one of claims 27-28, wherein the humanized TL1A polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 57-251, 58-251, or 61-251 of SEQ ID NO: 2.30.The animal of any one of claims 27-29, wherein the nucleotide sequence is operably linked to an endogenous TL1A regulatory element of the animal.31.The animal of any one of claims 27-30, wherein the chimeric TL1A polypeptide comprises an endogenous TL1A transmembrane region and / or an endogenous TL1A cytoplasmic region.32.The animal of any one of claims 27-31, wherein the nucleotide sequence is integrated to an endogenous TL1A gene locus of the animal.33.The animal of any one of claims 27-32, wherein the humanized TL1A polypeptide has at least one mouse TL1A activity and / or at least one human TL1A activity.34.A method of making a genetically-modified animal cell that expresses a chimeric TL1A, the method comprising:replacing at an endogenous TL1A gene locus, a nucleotide sequence encoding a region of endogenous TL1A with a nucleotide sequence encoding a corresponding region of human TL1A, thereby generating a genetically-modified animal cell that includes a nucleotide sequence that encodes the chimeric TL1A, wherein the animal cell expresses the chimeric TL1A.35.The method of claim 34, wherein the animal is a mouse.36.The method of claim 34 or 35, wherein the chimeric TL1A comprises a human or humanized TL1A extracellular region; and a transmembrane and / or a cytoplasmic region of mouse TL1A.37.The method of any one of 34-36, wherein the nucleotide sequence encoding the chimeric TL1A is operably linked to an endogenous TL1A regulatory region, e.g., promoter.38.The animal of any one of claims 1-19 and 27-33, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.39.The animal of claim 38, wherein the additional human or chimeric protein is interleukin 23 alpha subunit (IL23A) , interleukin 12 beta subunit (IL12B) , tumor necrosis factor alpha (TNFA) , tumor necrosis factor receptor 1 (TNFR1) , tumor necrosis factor receptor 2 (TNFR2) , programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , 4-1BB, cluster of differentiation 3 (CD3) , and / or lymphocyte-activation gene 3 (LAG3) .40.The method of any one of claims 20-26 and 34-37, wherein the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.41.The method of claim 40, wherein the additional human or chimeric protein is IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, and / or LAG3.42.A method of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-19, 27-33, 38, and 39, wherein the animal has a tumor; andb) determining inhibitory effects of the therapeutic agent to the tumor.43.The method of claim 42, wherein the therapeutic agent is an anti-TL1A antibody (e.g., an anti-human TL1A antibody) .44.The method of claim 42 or 43, wherein the tumor comprises one or more cancer cells that are injected into the animal.45.The method of any one of claims 42-44, wherein determining inhibitory effects of the anti-TL1A antibody to the tumor involves measuring the tumor volume in the animal.46.The method of any one of claims 42-45, wherein the cancer is lung cancer, leukemia, colon cancer, head and neck cancer, kidney cancer, pancreatic cancer, or gastric cancer.47.A method of determining effectiveness of an anti-TL1A antibody and an additional therapeutic agent for the treatment of cancer, comprisinga) administering the anti-TL1A antibody and the additional therapeutic agent to the animal of any one of claims 1-19, 27-33, 38, and 39, wherein the animal has a tumor; andb) determining inhibitory effects on the tumor.48.The method of claim 47, wherein the animal further comprises a sequence encoding a human or chimeric PD-1, a human or chimeric PD-L1, and / or a human or chimeric CTLA4.49.The method of claim 47 or 48, wherein the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody.50.The method of any one of claims 47-49, wherein the tumor comprises one or more cancer cells that are injected into the animal.51.The method of any one of claims 47-50, wherein determining inhibitory effects of the treatment involves measuring the tumor volume in the animal.52.The method of any one of claims 47-51, wherein the animal has lung cancer, leukemia, colon cancer, head and neck cancer, kidney cancer, pancreatic cancer, or gastric cancer.53.A method of determining effectiveness of a therapeutic agent for treatment an immune disorder (e.g., an autoimmune disease) , comprising:a)administering the therapeutic agent to the animal of any one of claims 1-19, 27-33, 38, and 39, wherein the animal has the immune disorder; andb)determining effects of the therapeutic agent to the immune disorder.54.A method of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising:a)administering the therapeutic agent to the animal of any one of claims 1-19, 27-33, 38, and 39, wherein the animal has the inflammation; andb)determining effects of the therapeutic agent to the inflammation.55.The method of claim 54, wherein the inflammation is caused by an agent comprising bacteria, virus, DSS or LPS) .56.The method of claim 54 or 55, wherein the therapeutic agent is an anti-TL1A antibody (e.g., an anti-human TL1A antibody) .57.The method of any one of claims 54-56, wherein determining inhibitory effects of the anti-TL1A antibody to the inflammation involves measuring body weight, inflammation in body sites, stool hardness, blood in the stool, and / or histopathological score (e.g., colon histopathological score) of the animal.58.The method of any one of claims 54-57, wherein the inflammation comprises inflammatory bowel diseases (IBD) , Crohn’s disease, ulcerative colitis, acute or chronic colitis, bacteria-induced inflammation, LPS-induced inflammation, virus-induced inflammation, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, or scleroderma.59.A method of determining effectiveness of an anti-TL1A antibody and an additional therapeutic agent for the treatment of inflammation, comprisinga) administering the anti-TL1A antibody and the additional therapeutic agent to the animal of any one of claims 1-19, 27-33, 38, and 39, wherein the animal has an inflammation; andb) determining inhibitory effects on the inflammation.60.The method of claim 59, wherein the additional therapeutic agent comprises steroids (e.g., prednisone, methylprednisolone, dexamethasone, hydrocortisone, betamethasone, or triamcinolone) , non-steroidal anti-inflammatory drugs (NSAIDs) , biologic agents (e.g., TNF inhibitors, interleukin inhibitors, B cell modulators, or T cell modulators) , immunosuppressive agents, Janus Kinase (JAK) Inhibitors, disease-modifying antirheumatic drugs (DMARDs) , monoclonal antibodies, intravenous immunoglobulin (IVIG) , other targeted therapies, or any combination thereof.61.The method of any one of claims 59-60, wherein determining inhibitory effects of the treatment involves measuring body weight, inflammation in body sites, stool hardness, blood in the stool, and / or histopathological score (e.g., colon histopathological score) of the animal.62.The method of any one of claims 59-61, wherein the animal has inflammatory bowel diseases (IBD) , Crohn’s disease, ulcerative colitis, acute or chronic colitis, bacteria-induced inflammation, LPS-induced inflammation, virus-induced inflammation, rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, or scleroderma.63.A method of determining toxicity of a therapeutic agent comprising:a) administering the therapeutic agent to the animal of any one of claims 1-19, 27-33, 38, and 39; andb) determining effects of the therapeutic agent to the animal.64.The method of claim 63, wherein the therapeutic agent is an anti-TL1A antibody.65.The method of claim 63 or 64, wherein determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.66.A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:(a) an amino acid sequence set forth in SEQ ID NO: 1, 2, or 9;(b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1, 2, or 9;(c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, or 9;(d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and(e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9.67.A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:(a) a sequence that encodes the protein of claim 66;(b) SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11;(c) a sequence that is at least 90%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11; and(d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 10, or 11.68.A cell comprising the protein of claim 66 and / or the nucleic acid of claim 67.69.An animal comprising the protein of claim 66 and / or the nucleic acid of claim 67.

Images