Recombinant wild type patatin-2 and mutants thereof

Abstract

The invention relates a recombinant wild type patatin-2 or mutant thereof. It also relates to polynucleotide expression vector, host cell and method for producing such recombinant proteins. It also relates to composition and product comprising such recombinant proteins.

Description

[0001] RECOMBINANT WILD TYPE PATATIN-2 AND MUTANTS THEREOF

[0002] TECHNICAL FIELD

[0003] The present invention relates generally to the field of recombinant potato proteins. For example, the present invention relates to recombinant wild type patatin-2 and mutants thereof. It also relates to polynucleotide expression vectors, hosts and methods for preparing / producing such a recombinant protein and mutants thereof. It also relates to compositions, food products, feeds, pet food products, food supplements and pharmaceutical products comprising such a recombinant protein and mutants thereof.

[0004] BACKGROUND OF THE INVENTION

[0005] Potato proteins, specifically patatin-2, are considered valuable plant proteins due to their nutritional properties, their non-allergenic nature, and their exceptional functional properties. Especially, they exhibit excellent emulsifying, foaming, and gel forming characteristics, rendering them highly desirable for various food applications, including dough, dairy product analogues and meat analogues.

[0006] Potato proteins, including patatin-2, can be isolated from potato juice using different processes. However, the process for isolation / separation of the potato proteins from glycoalkaloids and phenolic compounds present in potato juice is generally very tedious. Moreover, the resulting protein ingredients are often expensive in view of the tedious process.

[0007] Additionally, the resulting protein ingredients of such isolation / separation process are impure in terms of patatin-2 content. The isolation of patatin-2 is valuable in view of its properties. Compared to other proteins present in potato, patatin-2 is highly nutritious (PDCAAS around 1) and highly functional. For example, it has been shown by Ralet and Gueguen (Lebensm.- Wiss. u.- Technol. (2000) 33, 380-387) that the patatin fraction is able to form emulsions with good resistance to coalescence upon heat treatment, while emulsions produced with other potato protein fractions were not resistant to heat treatment. Additionally, producing a pure patatin-2 avoids having any protease inhibitors in the final product. Such inhibitors can interfere with processing steps.

[0008] Finally, the separation / isolation process may negatively affect the functional properties of the potato proteins, including patatin-2. For example, one common method for isolating potato proteins involves heat coagulation, but this process causes denaturation of the potato proteins, resulting in a loss of functionality. Attempts have also been made to produce native and wild-type potato proteins in microorganisms like Escherichia coli, but these efforts have yielded unsatisfactory results. Escherichia coli is not an ideal host for food products as it cannot secrete proteins, and the purification process often involves techniques like Ni-NTA affinity chromatography or the use of poly-histidine tags, which are not suitable for food applications. Moreover, the potato proteins are generally obtained with a limited yield with such methods.

[0009] In addition to the above, the use of wild-type patatin-2 per se may entail some disadvantages. Indeed, in its native state, shows lipase activity, in particular lipid acyl hydrolase activity which can cause sensory defects, in particular unwanted off-flavors in food products containing lipids. This undesirable activity is persistent in both the potato proteins isolated from potato juice or the potato proteins obtained by production in a microorganism. This endogenous lipase activity represents a challenge for food applications and still need to be tackled.

[0010] It would therefore be desirable to provide a recombinant wild type patatin-2.

[0011] It would also be desirable to provide recombinant proteins, in particular recombinant mutant proteins, with similar or same functionality as native, wild type patatin-2 but with reduced or without the lipase activity, in particular lipid acyl hydrolase activity.

[0012] It would be desirable that the recombinant wild type patatin-2 and the recombinant wild type patatin-2 mutants are suitable for food applications.

[0013] Any reference to prior art documents in this specification is not to be considered an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0014] SUMMARY OF THE INVENTION

[0015] The object of the present invention is to improve the state of the art, and in particular to provide recombinant wild type patatin-2 or mutant thereof, method for selecting wild type patatin-2 mutant, polynucleotide expression vector, host cells, production method, preparation method, composition and product that overcome the problems of the prior art and addresses the needs described above, or at least to provide a useful alternative.

[0016] The inventors were surprised to see that the object of the present invention could be achieved by the subject matter of the independent claims. The dependent claims further develop the idea of the present invention. Accordingly, a first aspect of the invention proposes a recombinant wild type patatin-2 or mutant thereof which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2. Preferably, the recombinant wild type patatin-2 or mutant thereof comprises or consists of an amino acid sequence having at least 90% sequence identity to wild type patatin-2.

[0017] A second aspect of the invention proposes a recombinant wild type patatin-2 mutant which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2, and which comprises one or more mutations and / or one or more nonnative post-translational modifications (PTMs), wherein said one or more mutations reduce or eliminate the lipid acyl hydrolase activity in the recombinant wild type patatin-2 mutant compared to the wild type patatin-2.

[0018] A third aspect of the invention proposes a recombinant wild type patatin-2 mutant which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2, and which comprises one or more mutations selected from the list consisting of S54A and D193A.

[0019] In some embodiment, the wild type patatin-2 of the first or second aspect of the invention or the recombinant wild type patatin-2 mutant of the first, second and / or third aspect of the invention is a wild type patatin-2 of Solanum tuberosum, preferably wild type patatin-2 of Solanum tuberosum consisting of SEQ ID NO:1.

[0020] In some embodiment, the wild type patatin-2 of the first and / or second aspect of the invention or the recombinant wild type patatin-2 mutant of the first, second and / or third aspect of the invention does not comprise an amino acid sequence consisting of at least three consecutive histidine residues.

[0021] A fourth aspect of the invention proposes a method for selecting wild type patatin-2 mutant having reduced or eliminated lipid acyl hydrolase activity which comprises the step of: a) providing one or several recombinant wild type patatin-2 mutants, wherein said recombinant wild type patatin-2 mutants have at least 80% sequence identity to wild type patatin-2 and comprise at least one mutation and / or at least one nonnative PTM , b) providing a wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum consisting of SEQ ID NO:1, c) measuring the lipid acyl hydrolase activity of the recombinant wild type patatin-2 mutant and the lipid acyl hydrolase activity of the wild type patatin-2, d) selecting one or several recombinant wild type patatin-2 mutants which have lipid acyl hydrolase activity which is reduced compared to wild type patatin-2 or which has no lipid acyl hydrolase activity.

[0022] A fifth aspect of the invention proposes a polynucleotide expression vector for expressing a recombinant wild type patatin-2 or a mutant thereof of the first, second and / or third aspect of the invention or recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention, which comprises a nucleic acid sequence encoding recombinant wild type patatin-2 or mutant thereof according to first, second and / or athird aspect of the invention or a nucleic acid sequence encoding recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention.

[0023] A sixth aspect of the invention proposes a host cell comprising the polynucleotide expression vector according to the fifth aspect of the invention.

[0024] A seventh aspect of the invention proposes a host cell expressing recombinant wild type patatin-2 or a mutant thereof according to the first, second and / or third aspect of the invention or expressing recombinant wild type patatin-2 selected according to the fourth aspect of the invention.

[0025] In some embodiment, the host cell of the sixth and / or seventh aspect of the invention is a microorganism cell, preferably a microorganism cell is a bacteria cell, a yeast cell, a fungal cell or microalgae cell. In some further embodiment, the host cell of the sixth or seventh aspect of the invention is a cell coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii, Pantoea agglomerans and Phaffia rhodozyma.

[0026] A eighth aspect of the invention proposes a method for producing one or several recombinant wild type patatin-2 or mutant thereof, comprising a) culturing a host cell of the sixth and / or seventh aspect of the invention in a culture medium under conditions sufficient to allow for expression of the one or several recombinant wild type patatin-2 or mutant thereof; and b) isolating the one or several recombinant wild type patatin-2 or mutant thereof from the culture medium.

[0027] A ninth aspect of the invention proposes a method for preparing one or several recombinant patatin-2 or a mutant thereof comprising the following steps:

[0028] (a) Fusing nucleic acid sequence encoding patatin-2 or mutant thereof to a mating factor alpha of Saccharomyces cerevisiae to receive a heterologous gene sequence,

[0029] (b) Integration of the heterologous gene sequence of step (a) into a polynucleotide expression vector;

[0030] (c) Introducing at least one copy of the polynucleotide expression vector of step (b) into the genome of Pichia pastoris;

[0031] (d) Selection of the cells which have taken up the polynucleotide expression vector containing the heterologous gene sequence;

[0032] (e) Collecting the secreted recombinant patatin-2 or mutant thereof.

[0033] The polynucleotide expression vector, host cell or method according to the fifth, sixth, seventh, eighth and / or ninth aspect of the invention, wherein the nucleic acid sequence encoding patatin-2 or mutant thereof has at least 70% sequence identity to SEQ ID NO:5 or 9.

[0034] A tenth aspect of the invention proposes a recombinant wild type patatin-2 or mutant thereof obtainable or obtained by the method according to the eighth or ninth aspect of the invention.

[0035] An eleventh aspect of the invention proposes a composition comprising a recombinant wild type patatin-2 or a mutant thereof according to the first, second, third and / or tenth aspect of the invention or comprising a recombinant wild type patatin-2 mutant selected according to the method of claim 7. In some embodiment, the composition is vegetarian or vegan.

[0036] A twelfth aspect of the invention proposes a product comprising a recombinant wild type patatin-2 or a mutant thereof according to the first, second, third and / or tenth aspect of the invention or recombinant wild type patatin-2 mutant selected according to the method of the fourth aspect of the invention, wherein the product is selected from the list consisting of food product, feed, pet food, food supplement and pharmaceutical product. In some embodiment, the product is vegetarian or vegan.

[0037] A thirteenth aspect of the invention proposes a food emulsion composition, preferably which is heat treated comprising:

[0038] -an edible fat component, and,

[0039] - a recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention.

[0040] A fourteenth aspect of the invention proposes a method for stabilizing food emulsion composition, said method comprises the addition of one or more of the recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention in a food emulsion composition comprising an edible fat component.

[0041] A fifteenth aspect of the invention proposes a method for producing a food emulsion composition, preferably heat-treated food emulsion composition which comprises the step of: a. Preparing a liquid mixture comprising : an edible fat component, and, a recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention, b. Treating, preferably homogenizing the liquid mixture of step a) to form food emulsion composition.

[0042] The invention allows the provision of a recombinant wild type patatin-2 which has a sequence identical to the wild type patatin-2. Additionally, the invention allows for the provision of recombinant wild type patatin-2 mutants that have sequences more or less similar to the wild type patatin-2. These obtained recombinant proteins, whether the wild type or the mutants, exhibit diverse functional and nutritional properties, including emulsifying properties and emulsion stability properties after heat treatment, making them suitable for use in various applications, including food applications. Advantageously, thedifferent recombinant proteins of the invention exhibit a decreased or abolished lipase which limits or avoids sensory defects, in particular off-flavours, when they are used in diverse applications, including food applications. Despite a decreased or abolished lipase activity, it has been observed that the different recombinant proteins exhibit good functional properties, including in stabilizing heat-treated emulsions. Additionally, they also have limited amount or even absence of anti-nutritional factors, in particular glycoalkaloids and alkaloids that are usually found in significant amount in potato protein ingredients.

[0043] These and other aspects, features and advantages of the invention will become more apparent to those skilled in the art from the detailed description of embodiments of the invention, in connection with the attached drawings.

[0044] BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1A shows a representative SDS-PAGE gel (NuPAGE 12% Bis-Tris) illustrating the production of recombinant wild type patatin-2 (SEQ ID NO:1) over the course of fermentation. M: Marker, 1: t=24h after induction 2: t= 30 h, 3: t=47 h, 4: 55 h, 5: 71 h, 6: 78 h, 7: 95 h 8: after harvest. The major band between 36.5 and 55.4 kDa is the protein of interest (recombinant wild type patatin-2 (SEQ ID NO:1)), 5 pL of culture supernatant were loaded per lane.

[0046] Figure IB shows a representative SDS-PAGE (NuPAGE 12% Bis-Tris) gel illustrating the production of recombinant patatin-2 mutant (SEQ ID NO:2) over the course of fermentation. M: Marker, 1: t=24h after induction 2: t= 30 h, 3: t=47 h, 4: 55 h, 5: 71 h, 6: 78 h, 7: 95 h 8: after harvest. The major band between 36.5 and 55.4 kDa is the protein of interest (recombinant patatin-2 mutant (SEQ ID NO:2)). 5 pL of culture supernatant were loaded per lane.

[0047] Figure 2 shows the cleavage of pNP-palmitate over time catalyzed by extracted potato protein, and two recombinantly produced patatin-2 (recombinant wild type patatin-2 with SEQ ID NO:1 and recombinant patatin-2 mutant with SEQ ID NO: 2),

[0048] Figure 3 shows far-UV CD spectra for recombinant wild type patatin-2 with SEQ ID NO:1(A) and recombinant patatin-2 mutant with SEQ ID NO: 2 (B) with experimental and fitted data using BeStSel software. The inset table and pie chart are indicating the relative composition of the secondary structure elements.

[0049] Figure 4 shows relative composition and transition temperature derived from far-UV CD spectra for recombinant wild type patatin-2 with SEQ ID NO:1 (A) and recombinant patatin-2 mutant with SEQ ID NO:2 (B) with experimental and fitted data using Global3 software was used forcing the fit with one thermal transition event.

[0050] Figure 5 shows average oil droplet diameter determined by laser granulometry at 20°C as a function of protein content at pH 7.0 after homogenization at 300 bars for 10 wt% sunflower emulsions. The different samples tested are :

[0051] Sodium caseinate,

[0052] Extracted potato protein from potato, recombinant wild type patatin-2 with SEQ ID NO:1, recombinant patatin-2 mutant with SEQ ID NO:2. Figure 6 shows emulsion stability at 0.5 wt% protein content after heat treatment at 145°C for 5 s. (A) Sodium caseinate, (B) Extracted potato protein from potato, (C) recombinant wild type patatin-2 with SEQ ID NO:1, (D) recombinant patatin-2 mutant with SEQ ID NO:2.

[0053] DETAILED DESCRIPTION OF THE INVENTION

[0054] As used herein, the words "comprise", "comprising" and the like are to be construed in an inclusive sense, that is to say, in the sense of "including, but not limited to", as opposed to an exclusive or exhaustive sense. Likewise, the terms "include," "including" and "or" should all be construed to be inclusive, unless such a construction is clearly prohibited from the context. Nevertheless, the compositions / products disclosed herein may lack any element that is not specifically disclosed herein. Thus, a disclosure of an embodiment using the term "comprising" includes a disclosure of embodiments "consisting essentially of" and "consisting of" the components identified.

[0055] As used in the specification, the word "about" should be understood to apply to each bound in a range of numerals. Moreover, all numerical ranges herein should be understood to include all integers, whole or fractions, within the range. Moreover, these numerical ranges should be construed as providing support for a claim directed to any number or subset of numbers in that range. For example, a disclosure of from 1 to 10 should be construed as supporting a range of from 1 to 8, from 3 to 7, from 1 to 9, from 3.6 to 4.6, from 3.5 to 9.9, and so forth.

[0056] As used in the specification, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a mutant" or "the mutant" includes one mutant but also two or more mutants.

[0057] Unless noted otherwise, all percentages in the specification refer to weight percent, where applicable.

[0058] Unless defined otherwise, all technical and scientific terms have and should be given the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0059] As used herein, the term "and / or" used in the context of "X and / or Y" should be interpreted as "X," or "Y," or "X and Y.". Similarly, "at least one ofX or Y" should be interpreted as "X," or "Y," or "both X and Y.". For example, "mutation(s) S54A and / or D193A" means "mutation S54A" or "mutation D193A" or "mutation S54A and mutation D193A". As used herein, the terms "example", "such as" and "e.g." particularly when followed by a listing of terms, are merely exemplary and illustrative and should not be deemed to be exclusive or comprehensive. But, a disclosure of an embodiment using the term "example" and "such as" includes a disclosure of embodiments" where the terms are exclusive and / or comprehensive.

[0060] As used in the specification, the term "substantially free" means that no more than about 0.5 weight percent, no more than about 0.1 weight percent of the excluded material remains. "Entirely free" typically means that at most only trace amount of the excluded material is present, and preferably, no detectable amount is present. Conversely, "substantially all" typically means that at least about 90 weight percent, preferably at least about 95 weight percent, and more preferably at least about 99 weight percent of the material is present.

[0061] As used herein, the term "protein" refers to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, amino acids that occur in nature and those that do not occur in nature, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[0062] As used herein, the term "recombinant protein" refers to a protein that is produced in a cell, e.g. recombinant host cell, of a different species or type as compared to the species or type of cell that produces the protein in nature, or that is produced in a cell, e.g. recombinant host cell, at a level at which it is not produced in nature.

[0063] As used herein, the term "recombinant host cell" or "host cell" as used herein refers to a host cell that comprises a recombinant polynucleotide. Thus, for example, a recombinant host cell may produce a polynucleotide or protein not found in the native (non-recombinant) form of the host cell, or a recombinant host cell may produce a polynucleotide or protein at a level that is different from that in the native (non-recombinant) form of the host cell. It should be understood that such term is intended to refer not only to the particular subject cell but also to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not be identical to the parent cell, but are still included within the scope of the term "recombinant host cell" or "host cell" as used herein. Not limitative examples of host cell include bacteria cell, yeast cell, fungal cell, plant cell, animal cell, in particular mammalian cell or any other suitable host cell known in the art. As used herein, the term "polynucleotide" as disclosed herein refers to both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A polynucleotide may be modified chemically or biochemically or may contain nonnatural or derivatized nucleotide bases. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates), charged linkages (e.g., phosphorothioates, phosphorodithioates), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids). Examples of modified nucleotides are known in the art (see, for example, Malyshev et al. 2014. Nature 509:385; Li et al. 2014. J. Am. Chem. Soc. 136:826). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, molecules in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structure such as the modifications found in "locked" polynucleotides.

[0064] As used herein, the term "recombinant polynucleotide" as used herein refers to a polynucleotide that has been removed from its naturally occurring environment, a polynucleotide that is not associated with all or a portion of a polynucleotide abutting or proximal to the polynucleotide when it is found in nature, a polynucleotide that is operatively linked to a polynucleotide that it is not linked to in nature, a polynucleotide that is altered, or a polynucleotide that does not occur in nature. The term can be used, e.g., to describe cloned DNA isolates, or a polynucleotide comprising a chemically synthesized nucleotide analog. A polynucleotide is also considered "recombinant" if it contains a genetic modification that does not naturally occur. For instance, an endogenous polynucleotide is considered a "recombinant polynucleotide" if it contains an insertion, deletion, or substitution of one or more nucleotides that is introduced artificially (e.g., by human intervention). Such modification can introduce into the polynucleotide a point mutation, substitution mutation, deletion mutation, insertion mutation, missense mutation, frameshift mutation, duplication mutation, amplification mutation, translocation mutation, or inversion mutation. The term includes a polynucleotide in a recombinant host cell's chromosome, as well as a polynucleotide that is not in a recombinant host cell's chromosome (e.g., a polynucleotide that is comprised in an episome). A recombinant polynucleotide in a recombinant host cell or organism may replicate using the in vivo cellular machinery of the recombinant host cell; however, such recombinant polynucleotide, although subsequently replicated intracellularly, is still considered recombinant for purposes of this invention.

[0065] As used herein, the term "sequence identity" as used herein in the context of amino acid sequences or nucleic acid sequences refers to the amino acid residues or nucleotides in the two sequences that are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over a stretch of at least 9 amino acid residues or nucleotides, at least 20 amino acid residues or nucleotides, at least 24 amino acid residues or nucleotides, at least 28 amino acid residues or nucleotides, at least 32 amino acid residues or nucleotides, or at least 36 or more amino acid residues or nucleotides. There are a number of different algorithms and methods well known to those skilled in the art that can be used to measure amino acid sequence identity and nucleic acid sequence identity. By way of example and without being limitative, the percentage identity of two amino acid or nucleic acid sequences may be calculated with CLUSTAL W (version 1.82, version 2), CLUSTAL omega, BLAST, EMBOSS matcher or MULTALIN.

[0066] As used herein, the term "lipid acyl hydrolase activity" refers to enzymatic activity of enzyme class EC 3.1.1. Especially, it refers to the enzymatic capacity of breaking down or hydrolyzing acyl bonds specifically in lipid molecules. This activity involves the cleavage of ester or amide bonds present in lipids, resulting in the release of fatty acids or other acyl groups.

[0067] As used herein, EC (Enzyme Committee) numbers refer to the definition of enzymatic activity and nomenclature given by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology as in force on 3rd July 2019.

[0068] As used herein the terms "open reading frame" and "ORF" are used interchangeably and refer to the nucleic acid sequence, in particular DNA or RNA sequence, translated into an amino acid sequence, which ranges from a translation start codon (e.g., ATG) to a stop codon (e.g., TGA, TAA, TAG).

[0069] The terms "operably linked", "operatively linked", "operably encodes", and "operably associated" are used herein interchangeably and refer to the functional linkage between a promoter (or terminator) and nucleic acid sequence, wherein the promoter initiates transcription of RNA corresponding to the DNA sequence. A heterologous DNA sequence is "operatively associated" with the promoter in a cell when RNA polymerase which binds the promoter sequence transcribes the coding sequence into mRNA which then in turn is translated into the protein encoded by the coding sequence.

[0070] As used herein, the term "pet" refers to a domestic animal, including companion animals such as domestic cats and dogs.

[0071] As used herein, the term "pet food " refers to a food composition designed for ingestion by a pet. A pet food product is typically a nutritionally balanced food product to provide a pet with all the essential nutrients it needs in the right quantities. The pet food product may also be part of nutritionally balanced pet food product that contains one or more further pet food components (e.g. a granulate), and wherein the pet food product together with these one or more further pet food components provide a nutritionally balanced product.

[0072] As used herein, the term "wet pet food product" means a pet food product having a moisture content from about 50% to about 90%, and in one aspect, from about 70% to about 90%.

[0073] As used herein, the term "dry pet food product" means a pet food product having a moisture content less than about 20%, and in one aspect, less than about 1 %, and in a specific aspect, less than about 10%.

[0074] As used herein, the term "semi-moist pet food product" means a pet food product having a moisture content from about 20% to about 50%, and in one aspect, from about 25% to about 35%.

[0075] As used herein, the term "feed" refers to a food composition designed for ingestion by a non-human animal different from pet. A feed typically includes ingredients such as grains, forages, minerals, vitamins, and additives, and is typically a nutritionally balanced food product to provide the targeted non-human animal different from pet with all the essential nutrients it needs in the right quantities. Feed is generally used for livestock, poultry, and other farm animals.

[0076] As used herein, the term "post-translational modification", or its acronym "PTM", as used herein refers to a modifications to a protein after biosynthesis (e.g., the covalent attachment of a chemical group to a protein). PTM can occur on the amino acid side chain of the protein or at its C- or N-termini. Non-limiting examples of suitable PTMs include glycosylation (i.e., covalent attachment to proteins of glycan groups (e.g., monosaccharides, disaccharides, polysaccharides, linear glycans, branched glycans, glycans with galf residues, glycans with sulfate and / or phosphate residues, D-glucose, D-galactose, D-mannose, L- fucose, N-acetyl-D-galactose amine, N-acetyl-D-glucose amine, N- acetyl-D-neuraminic acid, galactofuranose, phosphodiesters, N-acetylglucosamine, N-acetylgalactosamine, sialic acid, and combinations thereof; see, for example, Deshpande et al. 2008. Glycobiology 18(8):626) via C-linkage (i.e., C-glycosylation), N-linkage (i.e., N-glycosylation), or O- linkage (i.e., O- glycosylation), or via glypiation (i.e., addition of a glycosylphosphatidylinositol anchor) or phosphoglycosylation (i.e., linked through the phosphate of a phospho-serine)), phosphorylation (i.e., covalent attachment to proteins of phosphate groups), alkylation (i.e., covalent attachment to proteins of alkyl groups (e.g., methyl group in methylation, acetyl group in acetylation)), lipidation (i.e., covalent attachment of a lipid group (e.g., isoprenoid group in prenylation and isoprenylation (e.g., farnesol group in famesylation, geraniol group in geranylation, geranylgeraniol group in geranylgeranylation), fatty acid group in fatty acylation (e.g., myristic acid in myristoylation, palmitic acid in palmitoylation), glycosylphosphatidylinositol anchor in glypiation)), hydroxylation (i.e., covalent attachment of a hydroxide group), sumoylation (i.e., attachment to proteins of Small Ubiquitin-like Modifier (or SUMO) protein), nitrosylation (i.e., attachment to proteins of an NO group (e.g., S- nitrosylation)), nitrosothiolation (i.e., attachment to a cysteine thiol in a protein of an NO group (e.g., S-nitrosothiol)), glutathionylation (i.e., attachment to a cysteine thiol in a protein of a glutathione group (e.g., S -glutathionylation)), and tyrosine nitration (i.e., attachment to tyrosine residues of proteins of nitrate groups). PTMs of a recombinant patatin-2 can be native PTMs (e.g., plant PTMs, in particular potato PTMs), non-native PTMs, or mixtures of at least one native PTM and at least one non-native PTM. The term "non-native PTM" as used herein refers to a difference in one or more location(s) of one or more PTMs (e.g., glycosylation, phosphorylation) in a protein, and / or a difference in the type of one or more PTMs at one or more location(s) in a protein compared to the protein as it exists in potato, in particular Solanum tuberosum (i.e., the protein having "native PTMs"), preferably compared to the wild type patatin-2 of Solanum tuberosum i.e., the protein having "native PTMs"). The type and / or number and / or absence of and / or location of PTMs in a recombinant patatin-2 protein can confer properties to the protein or modify the properties of the protein.

[0077] As used herein, the term "wild type patatin-2 mutant", "or mutant thereof" and the like refers to a mutant version of the wild type patatin-2, i.e. this corresponds to the protein sequence of the wild type patatin-2 which comprise and so has undergone mutations and / or non-native PTMs compared to wild type patatin-2 sequence which is the reference. For avoidance of doubt, this may also be designated as "patatin-2 mutant". As used herein, the term "hexose" refers to a non-N-acetylated form when used independently from the term "N-acetylated". If a hexose is acetylated, it will be explicitly indicated by the term "N-acetylated hexose". Likewise, the term "hexose" refers to a nonphosphorylated form when used independently from the term "phosphorylated". If a hexose is phosphorylated, it will be explicitly indicated by the term "phosphorylated hexose".

[0078] In a first aspect, the invention relates to a recombinant wild type patatin-2 or a mutant thereof which comprises or consists of an amino acid sequence having at least 80%, preferably at least 90% sequence identity to wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0079] In a more preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant may comprise or consist of an amino acid sequence having at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0080] In an even more preferred embodiment, the recombinant wild type patatin-2 may comprise or consist of an amino acid sequence having 100% identity to wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0081] In a preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant does not comprise and / or was not linked to a poly-histidine tag sequence. In particular, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant does not comprise an amino acid sequence consisting of at least 3, preferably at least 6 consecutive histidine residues. In a further preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant does not comprise and / or was not linked to an amino acid sequence consisting of at most 20, preferably at most 15, more preferably at most 10 consecutive histidine residues. These poly-histidine tag sequences are usually used for facilitating the purification of recombinant proteins. However, the presence of poly-histidine tag sequences is not desirable in the present invention as they make the resulting recombinant proteins unsuitable for oral consumption by humans or pets as it can act as antinutritional factor. These tag sequences, for instance, render the recombinant proteins unsuitable for use in food applications. In an embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant was not obtained by purification with poly-histidine tag sequence. The number of consecutive histidine residues in the poly-histidine tag sequence is as provided above. In an embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant has been produced by a host cell. The host cell may be any host cells known in the prior art for the production of recombinant proteins. In particular, the host cell may be a microorganism cell, a plant cell or an animal cell, in particular a mammalian cell. The microorganism cell may be a bacteria cell, a yeast cell, a fungal cell or a microalgae cell. Preferably, the microorganism cell is a bacteria cell, a yeast cell or a fungal cell.

[0082] In a preferred embodiment, the host cell is a cell coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. In a more preferred embodiment, the host cell is a microorganism which is suitable for food applications. In particular, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. Even more preferably, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae and Aspergillus nidulans.

[0083] In an even more preferred embodiment, the host cell is a cell which is coming from the microorganism selected from the group consisting of Pichia pastoris and Aspergillus niger.

[0084] In a most preferred embodiment, the host cell is a cell which is coming from Pichia pastoris. In another most preferred embodiment, the host cell a cell which is coming from Aspergillus niger. In a preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant has not been produced by Escherichia coli. The recombinant proteins obtained with Escherichia coli are generally unsuitable for oral consumption by humans or pets, including are unsuitable for use in food applications. Indeed, they may produce endotoxins. Hence, E.coli may undesirable for the present invention.

[0085] The invention allows the provision of a recombinant wild type patatin-2 which has a sequence identical to the wild type patatin-2. Additionally, the invention allows for the provision of recombinant wild type patatin-2 mutants that have sequences more or less similar to the wild type patatin-2. These obtained recombinant proteins, whether the wild type or the mutants, exhibit diverse functional and nutritional properties, making them suitable for use in various applications, including food applications.

[0086] In a preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti- nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0087] In some embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant comprises non-native post-translational modification (PTM).

[0088] In a preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant comprises non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation .

[0089] In a further preferred embodiment, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally a phosphate. More preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0090] In a further preferred embodiment, the non-native post-translational modification on Asn92 is selected from the group consisting of: 2 N-acetylated hexoses and 9 hexoses, and,

[0091] 2 N-acetylated hexoses and 10 hexoses, and,

[0092] 2 N-acetylated hexoses and 11 hexoses, and,

[0093] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0094] 2 N-acetylated hexoses and 12 hexoses, and,

[0095] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0096] 2 N-acetylated hexoses and 13 hexoses, and,

[0097] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0098] 2 N-acetylated hexoses and 14 hexoses, and,

[0099] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0100] 2 N-acetylated hexoses and 15 hexoses, and,

[0101] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0102] 2 N-acetylated hexoses and 16 hexoses, and,

[0103] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0104] 2 N-acetylated hexoses and 17 hexoses, and,

[0105] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0106] It has been observed that not only the recombinant wild type patatin-2 mutant but also the recombinant wild type patatin-2 has decreased lipase activity which limits or avoids sensory defects. Without wishing to be bound by theory, it is believed that this decreased lipase activity may result (at least partly) from non-native PTMs, in particular by the appearance of non-native PTMs on asparagine residue which is at position 92.

[0107] In any one of the above embodiments, the Asn92 may be Asn92 of any targeted sequence, including the Asn92 of SEQ ID NO:1.

[0108] In some embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant has thermal transition point (also called "transition temperature") of 45- 60°C, preferably of 50-56°C, more preferably of about 55.5°C or 50.5°C. The thermal transition point may be measured as provided in the examples.

[0109] In some embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant has a lipase activity of less than lU / g of protein, preferably less than 0.5U / g of protein, more preferably less than 0.35 U / g of protein, even more preferably less than 0.2 U / g of protein. The lipase activity may be measured as provided in the example section. In a second aspect, the invention relates to a recombinant wild type patatin-2 mutant which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2, and which comprises one or more mutations and / or one or more PTMs, wherein said one or more mutations and / or one or more PTMs reduce or eliminate the lipid acyl hydrolase activity in the recombinant wild type patatin-2 mutant compared to the wild type patatin-2.

[0110] The lipid acyl hydrolase activity may be measured using well-known methods to measure such an enzymatic activity. For example, this may be measured with assays for the quantification of esterase / lipase activity based on p-nitrophenyl substrates. An example of such assays is described in Example 1.

[0111] In a preferred embodiment, the recombinant wild type patatin-2 mutant comprises or consists of an amino acid sequence having at least 81%, at least 82%, at least 83%, at least 85%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to wild type patatin-2, and which comprises one or more mutations and / or one or more PTMs, wherein said one or more mutations and / or said one or more PTMs reduce or eliminate the lipid acyl hydrolase activity in the recombinant wild type patatin-2 mutant compared to the wild type patatin-2.

[0112] In an embodiment, the recombinant wild type patatin-2 mutant has at most 99.8%, more preferably 99.5% sequence identity to wild type patatin-2.

[0113] In a preferred embodiment, the wild type patatin-2 is wild type patatin-2 of Solanum tuberosum. In a more preferred embodiment, the wild type patatin-2 is a wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0114] The reduction or elimination of lipase activity, in particular lipid acyl hydrolase activity in said mutants limits or avoids the sensory defects, in particular off-flavours, when used in diverse applications, including food applications. In addition, except the enzyme activity which is reduced or eliminated, these mutants may retain similar other functional properties and nutritional properties of wild-type patatin-2.

[0115] In a preferred embodiment, the recombinant wild type patatin-2 mutant does not comprise and / or was not linked to a poly-histidine tag sequence. In particular, the recombinant wild type patatin-2 mutant does not comprise an amino acid sequence consisting of at least 3, preferably at least 6 consecutive histidine residues. In a further preferred embodiment, the recombinant wild type patatin-2 mutant does not comprise and / or was not linked to an amino acid sequence consisting of at most 20, preferably at most 15, more preferably at most 10 consecutive histidine residues. The drawback of poly-histidine tag sequences is provided in the first aspect of the invention.

[0116] In an embodiment, the recombinant wild type patatin-2 mutant was not obtained by purification with poly-histidine tag sequence. The number of consecutive histidine residues in the poly-histidine tag sequence is as provided above.

[0117] In an embodiment, the recombinant wild type patatin-2 mutant has been produced by a host cell. The host cell may be any host cells known in the prior art for the production of recombinant proteins. In particular, the host cell may be a microorganism cell, a plant cell or an animal cell, in particular a mammalian cell. The microorganism cell may be a bacteria cell, a yeast cell, a fungal cell or a microalgae cell. Preferably, the microorganism cell is a bacteria cell, a yeast cell or a fungal cell.

[0118] In a preferred embodiment, the host cell is a cell coming from the microorganism selected from the group consisting of coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. In a more preferred embodiment, the host cell is a microorganism which is suitable for food applications. In particular, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. Even more preferably, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae and Aspergillus nidulans.

[0119] In an even more preferred embodiment, the host cell is a cell which is coming from the microorganism selected from the group consisting of Pichia pastoris and Aspergillus niger. In a most preferred embodiment, the host cell is a cell which is coming from Pichia pastoris. In another most preferred embodiment, the host cell a cell which is coming from Aspergillus niger.

[0120] In a preferred embodiment, the recombinant wild type patatin-2 mutant has not been produced by Escherichia coli. The drawback of the use of E.coli is provided in the first aspect of the invention.

[0121] In a preferred embodiment, the recombinant wild type patatin-2 mutant is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a- solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0122] In some embodiment, the recombinant wild type patatin-2 mutant has thermal transition point (also called "transition temperature") of 45-60°C, preferably of 50-56°C, more preferably of about 50.5°C. The thermal transition point may be measured as provided in the examples.

[0123] In some embodiment, the recombinant wild type patatin-2 mutant has a lipase activity of less than lU / g of protein, preferably less than 0.5U / g of protein, more preferably less than 0.35 U / g of protein, even more preferably less than 0.2 U / g of protein. The lipase activity may be measured as provided in the example section.

[0124] In a third aspect, the invention relates to a recombinant wild type patatin-2 mutant which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2, and which comprises one or more mutations selected from the list consisting of S54A and D193A.

[0125] In a preferred embodiment, the recombinant wild type patatin-2 mutant comprises or consists of an amino acid sequence having at least 81%, at least 82%, at least 83%, at least 85%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to wild type patatin-2, and which comprises one or more mutations selected from the list consisting of S54A and D193A. In an embodiment, the recombinant wild type patatin-2 mutant has at most 99.8%, preferably at most 99.5% sequence identity to wild type patatin-2.

[0126] In a preferred embodiment, the wild type patatin-2 is wild type patatin-2 of Solanum tuberosum. In a more preferred embodiment, the wild type patatin-2 is wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0127] In a more preferred embodiment, the recombinant wild type patatin-2 mutant comprises or consists of the amino acid sequence consisting of SEQ ID NO:2 (i.e. amino acid sequence of wild type patatin-2 of Solanum tuberosum with mutation S54A only), SEQ ID NO:3 (i.e. amino acid sequence of wild type patatin-2 of Solanum tuberosum with mutation D261A only) or SEQ ID NO:4 (i.e. amino acid sequence of wild type patatin-2 of Solanum tuberosum with both mutations S54A and D193A). Most preferably, the recombinant wild type patatin-2 mutant consists any of SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.

[0128] It is believed that recombinant wild type patatin-2 mutants, specifically those containing the mutation(s) S54A and / or D193A, exhibit a decreased or abolished lipase activity, in particular lipid acyl hydrolase activity compared to the wild type patatin-2, particularly the wild type patatin-2 derived from Solanum tuberosum. The reduction or elimination of lipid acyl hydrolase activity in these mutants serves to mitigate or prevent sensory defects, specifically off-flavors, when such mutant proteins are utilized in products intended for oral consumption by human or pet, including when used in food applications. Furthermore, except the enzyme activity which is reduced or eliminated, these mutants may also possess the advantage of retaining similar functional and nutritional properties as the wild-type patatin-2, particularly the wild type patatin-2 derived from Solanum tuberosum.

[0129] In some embodiment, the recombinant wild type patatin-2 mutants further comprise non-native post-translational modification (PTM), preferably non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation.

[0130] In a preferred embodiment, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally a phosphate. More preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose. In a further preferred embodiment, the non-native post-translational modification on Asn92 is selected from the group consisting of:

[0131] 2 N-acetylated hexoses and 9 hexoses, and,

[0132] 2 N-acetylated hexoses and 10 hexoses, and,

[0133] 2 N-acetylated hexoses and 11 hexoses, and,

[0134] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0135] 2 N-acetylated hexoses and 12 hexoses, and,

[0136] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0137] 2 N-acetylated hexoses and 13 hexoses, and,

[0138] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0139] 2 N-acetylated hexoses and 14 hexoses, and,

[0140] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0141] 2 N-acetylated hexoses and 15 hexoses, and,

[0142] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0143] 2 N-acetylated hexoses and 16 hexoses, and,

[0144] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0145] 2 N-acetylated hexoses and 17 hexoses, and,

[0146] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0147] Without wishing to be bound by theory, it is believed that non-native PTMs, in particular non-native PTMs on asparagine residue which is at position 92 may further reduce the lipase activity of the obtained patatin-2 mutants.

[0148] In any one of the above embodiments, the Asn92 may be Asn92 of any targeted protein sequence, including the Asn92 of any of SEQ ID NO:l-4.

[0149] In a preferred embodiment, the recombinant wild type patatin-2 mutant does not comprise and / or was not linked to a poly-histidine tag sequence. In particular, the recombinant wild type patatin-2 mutant does not comprise an amino acid sequence consisting of at least 3, preferably at least 6 consecutive histidine residues. In a further preferred embodiment, the recombinant wild type patatin-2 mutant does not comprise an amino acid sequence consisting of at most 20, more preferably at most 15, more preferably at most 10 consecutive histidine residues. The drawback of poly-histidine tag sequences is provided in the first aspect of the invention. In an embodiment, the recombinant wild type patatin-2 mutant was not obtained by purification with poly-histidine tag sequence. The number of consecutive histidine residues in the poly-histidine tag sequence is as provided above.

[0150] In an embodiment, the recombinant wild type patatin-2 mutant has been produced by a host cell. The host cell may be any host cells known in the prior art for the production of recombinant proteins. In particular, the host cell may be a microorganism cell, a plant cell or an animal cell, in particular a mammalian cell. The microorganism cell may be a bacteria cell, a yeast cell, a fungal cell or a microalgae cell. Preferably, the microorganism cell is a bacteria cell, a yeast cell or a fungal cell.

[0151] In a preferred embodiment, the host cell is a cell coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. In a more preferred embodiment, the host cell is a microorganism which is suitable for food applications. In particular, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. Even more preferably, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae and Aspergillus nidulans.

[0152] In an even more preferred embodiment, the host cell is a cell which is coming from the microorganism selected from the group consisting of Pichia pastoris and Aspergillus niger.

[0153] In a most preferred embodiment, the host cell is a cell which is coming from Pichia pastoris. In another most preferred embodiment, the host cell a cell which is coming from Aspergillus niger. In a preferred embodiment, the recombinant wild type patatin-2 mutant has not been produced by Escherichia coli. The drawback of the use of E.coli is provided in the first aspect of the invention.

[0154] In a preferred embodiment, the recombinant wild type patatin-2 mutant is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a- solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0155] In some embodiment, the recombinant wild type patatin-2 mutant has thermal transition point (also called "transition temperature") of 45-60°C, preferably of 50-56°C, more preferably of about 50.5°C. The thermal transition point may be measured as provided in the examples.

[0156] In some embodiment, the recombinant wild type patatin-2 mutant t has a lipase activity of less than 0.5U / g of protein, preferably 0.3U / g of protein, more preferably less than 0.2U / g of protein, even more preferably less than O.lU / g of protein. The lipase activity may be measured as provided in the example section.

[0157] In a fourth aspect, the invention relates to a method for selecting recombinant wild type patatin-2 mutant having reduced or eliminated lipid acyl hydrolase activity which comprises the step of: a) Providing one or several recombinant wild type patatin-2 mutants, wherein said recombinant wild type patatin-2 mutants have at least 80% sequence identity to wild type patatin-2 and comprise at least one mutation and / or at least one PTMs, b) providing a wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum consisting of SEQ ID NO:1, c) measuring the lipid acyl hydrolase activity of the recombinant wild type patatin-2 mutant and of the wild type patatin-2, d) selecting one or several recombinant wild type patatin-2 mutants which have lipid acyl hydrolase activity which is reduced compared to wild type patatin-2 or which has no lipid acyl hydrolase activity.

[0158] In a preferred embodiment, the wild type patatin-2 of step b) is derived from potato, preferably Solanum tuberosum. In other words, wild type patatin-2 is preferably not recombinant. For avoidance of doubt, the wild type patatin-2 of step b) is devoid of mutation and non-native PTMs compared to the wild type patatin-2, in particular wild type patatin-2 of Solanum tuberosum, more particularly wild type patatin-2 of Solanum tuberosum consisting of SEQ ID NO:1.

[0159] In an embodiment, the one or several recombinant wild type patatin-2 mutants are obtained before step a) by a step of production (or expression) of said one or several recombinant wild type patatin-2 mutants in host cells followed by a step of isolation said one or several recombinant wild type patatin-2 mutants.

[0160] The step of production of the one or several recombinant wild type patatin-2 mutants in host cells may be performed by any well-known methods which are suitable for the production of the recombinant proteins. In an embodiment, this step of production of the recombinant wild type patatin-2 mutants can be performed by the method according to the eighth or seventh aspect of the invention.

[0161] The host cell may be any host cells known in the prior art for the production of recombinant proteins. In particular, the host cell may be a microorganism cell, a plant cell or an animal cell, in particular a mammalian cell. The microorganism cell may be a bacteria cell, a yeast cell, a fungal cell or a microalgae cell. Preferably, the microorganism cell is a bacteria cell, a yeast cell or a fungal cell.

[0162] In a preferred embodiment, the host cell is a cell coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. In a more preferred embodiment, the host cell is a microorganism which is suitable for food applications. In particular, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia lipolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. Even more preferably, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia lipolytica, Aspergillus niger, Aspergillus oryzae and Aspergillus nidulans.

[0163] In an even more preferred embodiment, the host cell is a cell which is coming from the microorganism selected from the group consisting of Pichia pastoris and Aspergillus niger.

[0164] In a most preferred embodiment, the host cell is a cell which is coming from Pichia pastoris. In another most preferred embodiment, the host cell a cell which is coming from Aspergillus niger.

[0165] In an embodiment, the host cell is different from Escherichia coli. The drawback of the use of E.coli is provided in the first aspect of the invention .

[0166] The step of isolation of may be performed by any well known methods commonly employed for the isolation of proteins, in particular recombinant proteins. There are various techniques available for protein isolation, such as affinity chromatography, ion exchange chromatography, size exclusion chromatography, and protein precipitation methods. The specific method chosen will depend on factors such as the properties of the protein of interest, its solubility, and the desired purity level. A person skilled in the art would select an appropriate isolation method based on these considerations to effectively isolate the recombinant protein.

[0167] In a preferred embodiment, the one or several recombinant wild type patatin-2 mutants comprise or consist of an amino acid sequence having at least 81%, at least 82%, at least 83%, at least 85%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to wild type patatin-2 and comprise at least one mutation and / or at least one non-native PTM.

[0168] In an embodiment, the one or several recombinant wild type patatin-2 mutants have at most 99.8%, preferably at most 99.5% sequence identity to wild type patatin-2. The mutation(s) of the one or several recombinant wild type patatin-2 mutants may be any kind of mutations, including for example substitution, insertion, deletion, frameshift mutation and combination thereof.

[0169] The non-native PTMs may be any kind of PTMs such as but limited to glycosylation, phosphorylation, phosphoglycosylation, alkylation, lipidation, prenylation, isoprenylation, geranylation, geranylgeranylation, fatty acylation, hydroxylation, sumoylation, nitrosylatio, nitrosothiolation, glutathionylation, and tyrosine nitration. In a preferred embodiment, the non-native PTMs are selected from glycosylation, phosphorylation, phosphoglycosylation, alkylation, lipidation, prenylation, isoprenylation, geranylation, geranylgeranylation, fatty acylation, hydroxylation, sumoylation, nitrosylation, nitrosothiolation, glutathionylation, tyrosine nitration and combination thereof. In a more preferred embodiment, the non-native PTMs are selected from glycosylation, phosphorylation, and combination thereof.

[0170] In some embodiment, the non-native PTMs are different from the PTMs of Asn92 disclosed in the first aspect of the invention.

[0171] In some embodiment, the mutation(s) of the one or several recombinant wild type patatin-2 mutants are different from S54A and D193A.

[0172] In some embodiments, the recombinant wild type patatin-2 mutants may contain at least two mutations, wherein one of those mutations being S54A or D193A and wherein the other one of those mutations being different from S54A and D193A. Additionally, in some embodiments, the recombinant wild type patatin-2 mutants may comprise at least three mutations, with two of those mutations being S54A and D193A.

[0173] In a preferred embodiment, the wild type patatin-2 is wild type patatin-2 of Solanum tuberosum. In a more preferred embodiment, the wild type patatin-2 is a wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0174] The measurement of the lipid acyl hydrolase activity may be measured using well- known methods to measure such an enzymatic activity. For example, this may be measured with assays for the quantification of esterase / lipase activity based on p-nitrophenyl substrates. An example of such assays is described in Example 1.

[0175] In an embodiment, the one or several recombinant wild type patatin-2 mutants selected in step c) are recombinant wild type patatin-2 mutants which have lipid acyl hydrolase activity which is reduced by at least 1%, preferably by at least 5%, more preferably by at least 10%, more preferably by at least 15%, more preferably by at least 20%, more preferably by at least 25%, more preferably by at least 30%, more preferably by at least 35%, more preferably by at least 40%, more preferably by at least 45%, more preferably by at least 50%, more preferably by at least 55%, more preferably by at least 60%, more preferably by at least 65%, more preferably by at least 70%, more preferably by at least 75%, more preferably by at least 80%, more preferably by at least 85%, more preferably by at least 90%, and most preferably by at least 95%, more preferably by at least 96%, more preferably by at least 97%, more preferably by at least 98%, more preferably by at least 99%, even more preferably at least 99.5%, even more preferably by 100% compared to wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum which consists of SEQ ID NO:1.

[0176] This method allows for the identification of mutations and / or non-native PTMs that lead to a reduction or elimination of lipid acyl hydrolase activity in patatin-2. As a result, it allows for the identification of recombinant wild type patatin-2 mutants that exhibit decreased or no lipid acyl hydrolase activity. By utilizing this method, it is possible to pinpoint specific genetic alterations that result in the desired functional changes in patatin-2, enabling the development of mutant variants with modified enzymatic properties.

[0177] These mutants appear advantageous for different applications, including food applications. The reduction or elimination of lipase activity, in particular lipid acyl hydrolase activity in these mutants helps to minimize or prevent sensory defects, such as off-flavors, when utilized in various applications, including food applications. Additionally, except the enzyme activity which is reduced or eliminated, these mutants may retain similar functional and nutritional properties as the wild-type patatin-2.

[0178] In a preferred embodiment, the one or several recombinant wild type patatin-2 mutants selected in step c) are substantially free, more preferably free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a- chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0179] In some embodiment, the recombinant wild type patatin-2 mutant has thermal transition point (also called "transition temperature") of 45-60°C, preferably of 50-56°C, more preferably of about 50.5°C. The thermal transition point may be measured as provided in the examples. In a fifth aspect, the invention relates to a polynucleotide expression vector for expressing a recombinant wild type patatin-2 or a mutant thereof according to the first, second or third aspect of the invention or for expressing a recombinant wild type patatin-2 mutant selected according to the method of the fourth aspect of the invention. In particular, the polynucleotide expression vector comprises a nucleic acid sequence encoding said recombinant patatin-2 or mutant thereof according to the first, second or third aspect of the invention or a nucleic acid sequence encoding said recombinant wild type patatin-2 mutant selected according to the method of the fourth aspect of the invention.

[0180] The polynucleotide expression vector may be any well-known vector that is suitable for the production of recombinant proteins. For example, the polynucleotide expression vector may be pPIC9K plasmid, pPIC9Kalpha plasmid, the pPICZalpha plasmid, the pPIC6 plasmid, pPIC6alpha plasmid, the pPIC3.5K plasmid, the pGAPZalpha plasmid, the pAO815 plasmid, plasmids of the pET, pGEX or pUC series, the pKLACl plasmid and combination thereof.

[0181] In some embodiment, the polynucleotide expression vector may further comprise a nucleic acid sequence encoding signal sequence and / or a nucleic acid sequence encoding leader sequence.

[0182] In some embodiment, the polynucleotide expression vector may further comprise one or several nucleic acid sequences selected from the list consisting of origin of replication, selectable marker, transcription terminator, promoter and combination thereof. In some embodiment, the promoter may be a constitutively active promoter (e.g. GAP promoter) or an inducible promoter (e.g. AOX1 promoter).

[0183] The origin of replication, the selectable marker, the transcription terminator and the promoter may be any well-known origin of replication, selectable marker, transcription terminator and promoter suitable for the production of recombinant proteins. These different elements are generally chosen based on their compatibility with the desired recombinant production method and the specific host cell used for protein production.

[0184] For example, the promoter may be GAP promoter or AOX1 promoter.

[0185] For example, the selectable marker may be an antibiotic resistance gene, such as kanR gene cassette or zeocinR gene cassette.

[0186] For example, the transcription terminator may be AOD terminator, CYC1AOX terminator or AOX1 terminator. In some embodiment, the polynucleotide expression may comprise a promoter and a transcription terminator. In this embodiment, the nucleic acid sequence encoding the recombinant wild type patatin-2 or encoding the recombinant wild type patatin-2 mutant as described herein may be located between the promoter and the transcription terminator. In particular, the nucleic acid sequence encoding the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant, especially the Open Reading Frame (ORF) of the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant, is operably linked to the promoter and the transcription terminator. The promoter and the terminator may be as provided herein above. In a preferred embodiment, the promoter is AOX1 promoter and the transcription terminator is AOX1 terminator. The AOX1 promoter consists of SEQ ID NO: 15. The AOX1 terminator consists of SEQ ID NO: 16.

[0187] In a preferred embodiment, the nucleic acid sequence encoding the recombinant wild type patatin-2 or mutant thereof has at least 70% sequence identity to SEQ ID NO: 5 or SEQ ID NO:.

[0188] In a further preferred embodiment, the nucleic acid sequence encoding the recombinant wild type patatin-2 mutant has at least 70% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 9 and comprises one or more of the mutations selected from the list consisting of:

[0189] -A163G and optionally any one of: A165T, A165C and A165G, or;

[0190] -A578C and optionally any one of: T579A, T579G and T579C.

[0191] The nucleic acid sequence may be codon optimized for improving the expression of the corresponding recombinant protein in Pichia Pastoris. In particular, the nucleic acid sequence SEQ ID NO: 9 corresponds to the nucleic acid sequence SEQ ID NO: 5 that has been codon optimized for improving expression of the corresponding recombinant protein in Pichia pastoris.

[0192] In a more preferred embodiment, the nucleic acid sequence encoding wild type patatin-2 or mutant thereof has at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least

[0193] 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least

[0194] 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least

[0195] 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5 or SEQ ID

[0196] NO: 9. In an even more preferred embodiment, the nucleic acid sequence encoding wild type patatin-2 mutant has at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 9 and comprises one or more of the mutations selected from the list consisting of:

[0197] -A163G and optionally any one of: A165T, A165C and A165G, or;

[0198] -A578C and optionally any one of: T579A, T579G and T579C.

[0199] In a most preferred embodiment, the nucleic acid sequence encoding the wild type patatin-2 consists of SEQ ID NO: 5 or 9 and the nucleic acid sequence encoding the wild type patatin-2 mutant consists of any of:

[0200] - SEQ ID NOs: 6, 7, 8, 10, 11, 12, or;

[0201] SEQ ID NOs: 6 or 10 with one of the following mutation: T165A, T165C or T165G, or;

[0202] SEQ ID NOs: 7 or 11 with one of the following mutation: T579A, T579C or T579G, or;

[0203] SEQ ID NOs: 8 or 12 with one of the following mutation: T165A, T165C or T165G and with one of the following mutation: T579A, T579C or T579G.

[0204] The nucleic acid sequences SEQ ID NO: 9, 10, 11 and 12 correspond respectively to the nucleic acid sequences SEQ ID NO: 5, 6, 7 and 8 that have been codon optimized for improving expression of the corresponding recombinant protein in Pichia pastoris.

[0205] In a sixth aspect, the invention relates to a host cell comprising the polynucleotide expression vector according to the fifth aspect of the invention.

[0206] The host cell may be any host cells known in the prior art for the production of recombinant proteins. In particular, the host cell may be a microorganism cell, a plant cell or an animal cell. In a particular embodiment, the animal cell is a mammalian cell. The microorganism cell may be a bacteria cell, a yeast cell, a fungal cell or a microalgae cell. Preferably, the microorganism cell is a bacteria cell, a yeast cell or a fungal cell.

[0207] In a preferred embodiment, the host cell is a cell coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. In a more preferred embodiment, the host cell is a microorganism which is suitable for food applications. In particular, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia lipolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis, Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii (also known as Ashbya gossypii), Pantoea agglomerans and Phaffia rhodozyma. Even more preferably, the host cell is a cell which is coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Trichoderma reesei, Yarrowia lipolytica, Aspergillus niger, Aspergillus oryzae and Aspergillus nidulans.

[0208] In an even more preferred embodiment, the host cell is a cell which is coming from the microorganism selected from the group consisting of Pichia pastoris and Aspergillus niger.

[0209] In a most preferred embodiment, the host cell is a cell which is coming from Pichia pastoris. In another most preferred embodiment, the host cell a cell which is coming from Aspergillus niger.

[0210] In an embodiment, the host cell is different from Escherichia coli. The drawback of the use of E. coli is provided in the first aspect of the invention.

[0211] In a seventh aspect, the invention relates to a host cell expressing the recombinant wild type patatin-2 or a mutant thereof according to the first, second or third aspect of the invention or a wild type patatin-2 mutant selected according to the method of the fourth aspect of the invention.

[0212] The host cell may be a host cell as provided in the sixth aspect of the invention.

[0213] In an eighth aspect, the invention relates to a method for producing one or several recombinant wild type patatin-2 or mutant thereof, comprising a) culturing a host cell according to the sixth or seventh aspect of the invention in a culture medium under conditions sufficient to allow for expression of the one or several recombinant wild type patatin-2 or mutant thereof; and b) isolating the one or several recombinant wild type patatin-2 or mutant thereof from the culture medium.

[0214] The selection of the culture medium and conditions can be easily determined by a person skilled in the art based on various factors, including the type of host cell used in step a), the presence or absence of a selectable marker, and other relevant parameters. Factors such as the nutritional requirements of the host cell, the stability and expression of the recombinant protein, and the desired growth conditions can influence the choice of culture medium, and the specific conditions employed. A person skilled in the art would consider these different factors and would choose conditions and culture medium to optimize the growth of the host cell and production of the recombinant proteins.

[0215] The step b) of isolation of may be carried out using any well-known methods commonly employed for the isolation of proteins, in particular recombinant proteins. There are various techniques available for protein isolation, such as affinity chromatography, ion exchange chromatography, size exclusion chromatography, and protein precipitation methods. The specific method chosen will depend on factors such as the properties of the protein of interest, its solubility, and the desired purity level. A person skilled in the art would select an appropriate isolation method based on these considerations to effectively isolate the recombinant protein.

[0216] In a preferred embodiment, the one or several recombinant wild type patatin-2 or mutant thereof isolated in step b) are substantially free, more preferably free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti- nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0217] In a ninth aspect, the invention relates to a method for preparing one or several recombinant patatin-2 or a mutant.

[0218] The method comprises a step (a) of fusing nucleic acid sequence encoding wild type patatin-2 or mutant thereof to a mating factor alpha of Saccharomyces cerevisiae to receive a heterologous gene sequence, wherein said mating factor alpha of Saccharomyces cerevisiae consists of the nucleic acid sequence of SEQ ID NO: 14.

[0219] The method further comprises a step (b) of integration of the heterologous gene sequence of step (a) into a polynucleotide expression vector.

[0220] The method further comprises a step (c) of introducing at least one copy of the polynucleotide expression vector of step (b) into the genome of Pichia pastoris.

[0221] The method further comprises a step (d) of selection of the cells which have taken up the polynucleotide expression vector containing the heterologous gene sequence.

[0222] The method further comprises a step (e) of collecting the secreted recombinant wild type patatin-2 or mutant thereof.

[0223] In a preferred embodiment, in the method, the wild type patatin-2 or mutant thereof is / are expressed under control of the AOX1 promoter. In particular, the AOX1 promoter consists of the SEQ ID NO: 15.

[0224] In a preferred embodiment, the nucleic acid sequence encoding the recombinant wild type patatin-2 or mutant thereof has at least 70% sequence identity to SEQ ID NO: 5 or 9.

[0225] In a further preferred embodiment, the nucleic acid sequence encoding the recombinant wild type patatin-2 mutant has at least 70% sequence identity to SEQ ID NO: 5 or 9 and comprises one or more of the mutations selected from the list consisting of:

[0226] -A163G and optionally any one of: A165T, A165C and A165G, or;

[0227] -A578C and optionally any one of: T579A, T579G and T579C.

[0228] In a more preferred embodiment, the nucleic acid sequence encoding wild type patatin-2 or mutant thereof has at least 71%, at least 72%, at least 73%, at least 74%, at least

[0229] 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least

[0230] 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least

[0231] 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least

[0232] 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5 or 9.

[0233] In an even more preferred embodiment, the nucleic acid sequence encoding wild type patatin-2 mutant has at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 5 or 9 and comprises one or more of the mutations selected from the list consisting of: -A163G and optionally any one of: A165T, A165C and A165G, or;

[0234] -A578C and optionally any one of: T579A, T579G and T579C.

[0235] In a most preferred embodiment, the nucleic acid sequence encoding the wild type patatin-2 consists of SEQ ID NO: 5 or 9 and the nucleic acid sequence encoding the wild type patatin-2 mutant consists of any of:

[0236] - SEQ ID NOs: 6, 7, 8, 10, 11, 12, or;

[0237] SEQ ID NOs: 6 or 10 with one of the following mutation: T165A, T165C or T165G, or;

[0238] SEQ ID NOs: 7 or 11 with one of the following mutation: T579A, T579C or T579G, or;

[0239] SEQ ID NOs: 8 or 12 with one of the following mutation: T165A, T165C or T165G and with one of the following mutation: T579A, T579C or T579G.

[0240] The nucleic acid sequences SEQ ID NO: 9, 10, 11 and 12 correspond respectively to the nucleic acid sequences SEQ ID NO: 5, 6, 7 and 8 that have been codon optimized for improving expression of the corresponding recombinant protein in Pichia pastoris.

[0241] In a preferred embodiment, the secreted recombinant wild type patatin-2 or mutant thereof collected in step (e) is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti- nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0242] In a tenth aspect, the invention relates to a recombinant wild type patatin-2 or mutant thereof obtainable or obtained by the method according to the eighth or ninth aspect of the invention. In a preferred embodiment, recombinant wild type patatin-2 or mutant thereof is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a- solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0243] In some embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant comprises non-native post-translational modification (PTM).

[0244] In a preferred embodiment, the recombinant wild type patatin-2 or the recombinant wild type patatin-2 mutant comprises non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation.

[0245] In a further preferred embodiment, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally a phosphate. More preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0246] In a further preferred embodiment, the non-native post-translational modification on Asn92 is selected from the group consisting of:

[0247] 2 N-acetylated hexoses and 9 hexoses, and,

[0248] 2 N-acetylated hexoses and 10 hexoses, and,

[0249] 2 N-acetylated hexoses and 11 hexoses, and,

[0250] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0251] 2 N-acetylated hexoses and 12 hexoses, and,

[0252] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0253] 2 N-acetylated hexoses and 13 hexoses, and,

[0254] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0255] 2 N-acetylated hexoses and 14 hexoses, and,

[0256] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0257] 2 N-acetylated hexoses and 15 hexoses, and,

[0258] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0259] 2 N-acetylated hexoses and 16 hexoses, and,

[0260] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0261] 2 N-acetylated hexoses and 17 hexoses, and,

[0262] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0263] It has been observed that not only the recombinant wild type patatin-2 mutant but also the recombinant wild type patatin-2 has decreased lipase activity which limits or avoids sensory defects. Without wishing to be bound by theory, it is believed that this decreased lipase activity may result (at least partly) from non-native PTMs, in particular by the appearance of non-native PTMs on asparagine residue which is at position 92.

[0264] In any one of the above embodiments, the Asn92 may be Asn92 of any targeted sequence, including the Asn92 of SEQ ID NO:1.

[0265] In an eleventh aspect, the invention relates to a composition comprising a recombinant wild type patatin-2 or a mutant thereof according to the first, second, third or tenth aspect of the invention or a recombinant wild type patatin-2 mutant selected according to the method of the fourth aspect.

[0266] The composition may be in any form including but not limited to liquid, powder, solid, gel, capsule, tablet, lozenge, paste, pastille and any other well-known form.

[0267] In a preferred embodiment, the composition is an oral composition, i.e., a composition which is intended to be consumed via oral route. This includes composition intended to be consumed via oral route by a human or a non-human animal, such as a pet.

[0268] In an embodiment, the patatin-2 of the composition consists only of recombinant wild type patatin-2 or mutant thereof.

[0269] In an embodiment, the potato proteins of the composition consist only of recombinant wild type patatin-2 or mutant thereof.

[0270] In an embodiment, the plant proteins of the composition consist only of recombinant wild type patatin-2 or mutant thereof.

[0271] In an embodiment, the proteins of the composition consist only of recombinant wild type patatin-2 or mutant thereof.

[0272] In an embodiment, the composition is vegetarian. In another embodiment, the composition is vegan.

[0273] In a preferred embodiment, the composition is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine. In some embodiment, the composition is an emulsion and has a particle size D3,2 below 1.3 micron, preferably between 0.4 and 1 micron, more preferably between 0.5 and 0.8micron when measured by laser granulometry. The laser granulometry is preferably measured using a Mastersizer 3000 instrument (Malvern Instrument Limited, Worcestershire, UK) equipped with Hydro MV dispersion unit, in 20°C water. Such a low particle size D3,2 shows good emulsion stability, even after heat-treatment.

[0274] In some embodiment, the composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have a different non-native post-translational modification (PTM) pattern.

[0275] In a preferred embodiment, the composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have different non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation. Preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 5 to 20 hexoses and optionally 1 phosphorylated hexose. More preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0276] In a further preferred embodiment, the composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said at least two different forms have different non-native post-translational modification (PTM) on Asn92 and wherein said PTMs on Asn92 of said at least two different forms are selected from the group consisting of:

[0277] 2 N-acetylated hexoses and 9 hexoses, and,

[0278] 2 N-acetylated hexoses and 10 hexoses, and,

[0279] 2 N-acetylated hexoses and 11 hexoses, and,

[0280] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0281] 2 N-acetylated hexoses and 12 hexoses, and,

[0282] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and, 2 N-acetylated hexoses and 13 hexoses, and,

[0283] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0284] 2 N-acetylated hexoses and 14 hexoses, and,

[0285] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0286] 2 N-acetylated hexoses and 15 hexoses, and,

[0287] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0288] 2 N-acetylated hexoses and 16 hexoses, and,

[0289] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0290] 2 N-acetylated hexoses and 17 hexoses, and,

[0291] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0292] In some embodiment, the major form of the at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein in the composition is the form having a non-native post-translational modification (PTM) on Asn92 comprising 2 N- acetylated hexoses and 12 hexoses.

[0293] In a twelfth aspect, the invention relates to a product comprising a recombinant wild type patatin-2 or a mutant thereof according to the first, second, third or tenth aspect of the invention or a recombinant wild type patatin-2 mutant selected according to the method of the fourth aspect. The product is selected from the list consisting of food product, feed, pet food product, food supplement and pharmaceutical product.

[0294] Examples of food product include baked foods, baby food, beverage, liquid or powdered cocoa-containing beverage, liquid or powdered malt-containing beverage, bouillon, broth, chewing gum, chocolate, soluble coffee, cereal bars, cereals, coffee creamer, confectionery product, complete nutritional product, custard, dairy product, dressing, ready- to-drink, plant-based egg analogue, food additives, food for special medical purpose (FSMP), ice cream, plant-based ice cream analogue, medical food, medical nutrition product, nutritional product, oral nutritional supplement, plant-based dairy product analogue, plantbased meat analogue, porridge, powdered nutritional products to be reconstituted in milk before consumption, prepared meal product, protein mix, protein bar, protein shake, pudding, sauce, sherbet, snack, soup, spice, spread, vegetable puree and combination thereof.

[0295] The pet food product may be wet pet food product, semi-moist pet food product, dry pet food product or liquid pet food product. In an embodiment, the product is vegetarian. In another embodiment, the product is vegan.

[0296] In an embodiment, the potato protein of the product consists only of recombinant wild type patatin-2 or mutant thereof.

[0297] In an embodiment, the potato proteins of the composition consist only of recombinant wild type patatin-2 or mutant thereof.

[0298] In an embodiment, the plant proteins of the composition consist only of recombinant wild type patatin-2 or mutant thereof.

[0299] In an embodiment, the proteins of the composition consist only of recombinant wild type patatin-2 or mutant thereof.

[0300] In a preferred embodiment, the product is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0301] In some embodiment, the product is an emulsion and has a particle size D3,2 below 1.3 micron, preferably between 0.4 and 1 micron, more preferably between 0.5 and 0.8micron when measured by laser granulometry. The laser granulometry is preferably measured using a Mastersizer 3000 instrument (Malvern Instrument Limited, Worcestershire, UK) equipped with Hydro MV dispersion unit, in 20°C water. Such a low particle size D3,2 shows good emulsion stability, even after heat-treatment.

[0302] In some embodiment, the product may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have a different non-native post-translational modification (PTM) pattern.

[0303] In a preferred embodiment, the product may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have different non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation. Preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 5 to 20 hexoses and optionally 1 phosphorylated hexose. More preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0304] In a further preferred embodiment, the product may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said at least two different forms have different non-native post-translational modification (PTM) on Asn92 and wherein said PTMs on Asn92 of said at least two different forms are selected from the group consisting of:

[0305] 2 N-acetylated hexoses and 9 hexoses, and,

[0306] 2 N-acetylated hexoses and 10 hexoses, and,

[0307] 2 N-acetylated hexoses and 11 hexoses, and,

[0308] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0309] 2 N-acetylated hexoses and 12 hexoses, and,

[0310] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0311] 2 N-acetylated hexoses and 13 hexoses, and,

[0312] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0313] 2 N-acetylated hexoses and 14 hexoses, and,

[0314] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0315] 2 N-acetylated hexoses and 15 hexoses, and,

[0316] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0317] 2 N-acetylated hexoses and 16 hexoses, and,

[0318] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0319] 2 N-acetylated hexoses and 17 hexoses, and,

[0320] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0321] In some embodiment, the major form of the at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein in the product is the form having a non-native post-translational modification (PTM) on Asn92 comprising 2 N- acetylated hexoses and 12 hexoses. In a thirteenth aspect, the invention relates to a food emulsion composition comprising : an edible fat component, and, a recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention.

[0322] The edible fat component be any suitable edible fat component known in the art and include fats that are solid at room temperature (about 20°C) and fats that are liquid at room temperature (about 20°C), and / or mixtures thereof. Suitable fats include animal and nonanimal fats, and / or a mixture of non-animal and animal fats. In certain embodiments, the oil is selected from the list consisting of almond oil, avocado oil, castor oil, corn oil, cottonseed oil, flaxseed oil, grapeseed oil, hazelnut oil, mustard oil, peanut oil, palm oil, pecan oil, pistachio oil, rapeseed oil, rice bran oil, oat oil, olive oil, safflower oil, sesame oil, sunflower oil, walnut oil, vegetable oil blends, any fractions thereof, or mixtures thereof. In other embodiments the solid fat is selected from the list consisting of butter, coconut oil, clarified butter, lard, margarine, beef tallow, any fractions thereof, or mixtures thereof. Mixtures of fats and oils may also be used in food emulsion composition of the present invention. When one or more fats that are solid at room temperature are used, they are generally heated above their melting point to form a liquid before addition in the food emulsion composition.

[0323] In some embodiment, the food emulsion composition may comprise at least 0.5wt%, preferably at least lwt%, more preferably 3%, even more preferably at least 5wt.%, even more preferably at least 8wt.% edible fat component.

[0324] In some embodiment, the food emulsion composition may comprise at least 0.5wt%, preferably at most 70wt% fat, more preferably 50%, even more preferably at most 40wt.%, even more preferably at most 30wt.%., even more preferably at most 20wt.%, even more preferably at most 15wt.% edible fat component.

[0325] In some embodiment, the food emulsion composition may comprise at l-70wt.%, more preferably 5-30wt.% or 8-30wt.%„ even more preferably at most 5-20wt.% or 8-20wt.%, even more preferably at most 5-15wt.% or 8-15wt.%., most preferably about 10wt.% edible fat component. It has been observed that the recombinant wild type patatin-2 or mutants thereof of the invention effectively stabilize food emulsions, even emulsions comprising elevated amount of fat, i.e. fat above 5wt.%, preferably above 8wt.%.

[0326] The food emulsion composition comprises at least 0.1wt.%, preferably at least 0.2wt.%, more preferably 0.25wt.% of the recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention. In a preferred embodiment, the food emulsion composition comprises 0.1-20wt.% or 0.2-20wt.% or 0.25-20wt.%, more preferably 0.1-15wt.% or 0.2-15wt.% or 0.25-15wt.% even more preferably 0.1-10wt.% or 0.2-10wt.% or 0.25-10wt.%, even more preferably 0.1- 5wt.% or 0.2-5wt.% or 0.25-5wt.%, even more preferably 0.1-3wt.% or 0.2-3wt.% or 0.25- 3wt.%, even more preferably 0.1-lwt.% or 0.2-lwt.% or 0.25-lwt of the recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention.

[0327] The food emulsion composition is heat treated. In particular, the food emulsion composition has been heat treated at a temperature of at least 80°C, preferably of at least 100°C, more preferably of at least 120°C, even more preferably above 140°C. Also particularly, the food emulsion composition has been heat treated at a temperature of at most 300°C, preferably of at most 200°C, more preferably of at most 180°C, even more preferably of at most 150°C. In some embodiment, the food emulsion composition has been heat treated at a temperature of 80-300°C or 140-300°C, preferably 100-200°C or or 140-200°C, more preferably 120-180°C or 140-180°C.

[0328] The food emulsion composition has been heat treated for a period time sufficient to increase the shelf-stability of the food emulsion composition. For example, at a higher temperature, the period of time for the heating step may be shorter, and at lower temperatures the period of time for the heating step may be longer. The temperature and duration of heating may be adjusted and / or optimised to control the shelf-stability and other desired properties for the food emulsion composition (e.g. sensory, etc...). In some embodiment, the food emulsion composition has been heat treated for 1 second-15 minutes, preferably 1 second-10 minutes, more preferably 1 second-5 minutes, even more preferably 1 second-1 minute. The heat treatment may be carried out in an indirect manner, for example by means of a heat-plate exchanger. As a variant, it is possible to carry it out in a direct manner, for example by means of a jacketed holding unit or direct steam injection. The heat treatment heated may be carry out with high pressure thermal processing.

[0329] In some preferred embodiment, the food emulsion composition has been heat treated with ultra-high temperature treatment (UHT). UHT treatment is generally performed at temperature above 140°C. Accordingly, in this preferred embodiment, the food emulsion composition is UHT-treated food emulsion composition.

[0330] It has been observed that the recombinant wild type patatin-2 or mutants thereof of the invention not only effectively stabilize emulsions with significant amount of fat but also that they provide emulsions which remain heat stable even after high temperature treatment, including UHT. In particular, the food emulsion does not exhibit protein flocculation and / or protein precipitation.

[0331] Accordingly, the food emulsion composition is heat stable. By "heat stable", it is understood that the food emulsion does not exhibit phase separation, in particular protein flocculation and / or protein precipitation after a heat treatment as disclosed herein.

[0332] Phase separation may be assessed by visual inspection of the emulsion after heat treatment. In particular, protein flocculation and protein precipitation may be observed by the appearance of non-homogenous phase and grains / lumps in the emulsions. This can be further confirmed through sensory evaluation and tasting. Protein flocculation and protein precipitation generally results in the feeling of grittiness and / or graininess in mouth.

[0333] In a preferred embodiment, the food emulsion composition is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / orthe alkaloid is solanidine. In some embodiment, the food emulsion composition may be liquid or powdered, preferably liquid.

[0334] In some embodiment, the food emulsion composition is an oil-in-water or water-in-oil emulsion, preferably oil-in-water emulsion. The food emulsion composition may be selected from the list consisting of creamer, plantbased creamer analogue, milk analogue, dairy beverages, coffee mixes, cocoa-containing beverages, malt-containing beverages, soup, dressing, spread, sauce, culinary cream, culinary cream analogue, ice cream, plant-based ice-cream analogue, yogurt, plant-based yogurt analogue, fat-containing nutritional composition, infant formula, and mixtures thereof.

[0335] In a preferred embodiment, the food emulsion composition is creamer or a plant-based creamer analogue.

[0336] In some embodiment, the food emulsion composition may further comprise buffer salt, flavouring agent, amino acids, water, carbohydrates and mixtures thereof.

[0337] In some embodiment, the food emulsion composition may comprise added emulsifying agent different from the recombinant wild type patatin-2 or a mutant thereof as disclosed herein.

[0338] In some embodiment, the food emulsion composition does not comprise added emulsifying agent different from the recombinant wild type patatin-2 or a mutant thereof as disclosed herein. For example, the food emulsion composition is free from lecithin.

[0339] It has been observed that the recombinant wild type patatin-2 or mutants thereof of the invention can effectively stabilize emulsions without the need for additional emulsifying agent.

[0340] In some embodiment, the food emulsion composition has a particle size D3,2 below 1.3 micron, preferably between 0.4 and 1 micron, more preferably between 0.5 and 0.8micron when measured by laser granulometry. The laser granulometry is preferably measured using a Mastersizer 3000 instrument (Malvern Instrument Limited, Worcestershire, UK) equipped with Hydro MV dispersion unit, in 20°C water. Such a low particle size D3,2 shows good emulsion stability, even after heat-treatment.

[0341] In some embodiment, the food emulsion composition may be obtained or obtainable according to the method of the fifteenth aspect of the invention.

[0342] In some embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have a different non-native post-translational modification (PTM) pattern.

[0343] In a preferred embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have different non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation . Preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 5 to 20 hexoses and optionally 1 phosphorylated hexose. More preferably, the non- native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post- translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0344] In a further preferred embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said at least two different forms have different non-native post-translational modification (PTM) on Asn92 and wherein said PTMs on Asn92 of said at least two different forms are selected from the group consisting of:

[0345] 2 N-acetylated hexoses and 9 hexoses, and,

[0346] 2 N-acetylated hexoses and 10 hexoses, and,

[0347] 2 N-acetylated hexoses and 11 hexoses, and,

[0348] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0349] 2 N-acetylated hexoses and 12 hexoses, and,

[0350] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0351] 2 N-acetylated hexoses and 13 hexoses, and,

[0352] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0353] 2 N-acetylated hexoses and 14 hexoses, and,

[0354] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0355] 2 N-acetylated hexoses and 15 hexoses, and,

[0356] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0357] 2 N-acetylated hexoses and 16 hexoses, and,

[0358] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0359] 2 N-acetylated hexoses and 17 hexoses, and,

[0360] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0361] In some embodiment, the major form of the at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein in the food emulsion composition is the form having a non-native post-translational modification (PTM) on Asn92 comprising 2 N-acetylated hexoses and 12 hexoses.

[0362] In a fourteenth aspect of the invention relates to a method for stabilizing a food emulsion composition. Said method comprises the addition of a recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third ortenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention in a food emulsion composition comprising an edible fat component. The type of edible fat component, the level of edible fat component, the ingredients present in the food emulsion composition, the type of food emulsion composition, the level of glycoalkaloids and / or alkaloids in the food emulsion composition may be as disclosed in the thirteenth aspect of the invention.

[0363] The recombinant wild type patatin-2 or a mutant thereof may be added at the levels provided in the thirteenth aspect of the invention.

[0364] In some further embodiment, the food emulsion composition is further heat-treated. The heat treatment may be performed according to temperature and time conditions and heat treatment method as provided in the thirteenth aspect of the invention.

[0365] In a preferred embodiment, the food emulsion composition is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a-chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0366] In some embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have a different non-native post-translational modification (PTM) pattern.

[0367] In a preferred embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have different non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation. Preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 5 to 20 hexoses and optionally 1 phosphorylated hexose. More preferably, the non- native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post- translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0368] In a further preferred embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said at least two different forms have different non-native post- translational modification (PTM) on Asn92 and wherein said PTMs on Asn92 of said at least two different forms are selected from the group consisting of:

[0369] 2 N-acetylated hexoses and 9 hexoses, and,

[0370] 2 N-acetylated hexoses and 10 hexoses, and,

[0371] 2 N-acetylated hexoses and 11 hexoses, and,

[0372] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0373] 2 N-acetylated hexoses and 12 hexoses, and,

[0374] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0375] 2 N-acetylated hexoses and 13 hexoses, and,

[0376] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0377] 2 N-acetylated hexoses and 14 hexoses, and,

[0378] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0379] 2 N-acetylated hexoses and 15 hexoses, and,

[0380] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0381] 2 N-acetylated hexoses and 16 hexoses, and,

[0382] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0383] 2 N-acetylated hexoses and 17 hexoses, and,

[0384] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

[0385] In some embodiment, the major form of the at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein in the food emulsion composition is the form having a non-native post-translational modification (PTM) on Asn92 comprising 2 N-acetylated hexoses and 12 hexoses.

[0386] In some embodiment, after addition of the addition of a recombinant wild type patatin-2 or a mutant thereof, the resulting food emulsion composition has a particle size D3,2 below 1.3 micron, preferably between 0.4 and 1 micron, more preferably between 0.5 and 0.8micron when measured by laser granulometry. The laser granulometry is preferably measured using a Mastersizer 3000 instrument (Malvern Instrument Limited, Worcestershire, UK) equipped with Hydro MV dispersion unit, in 20°C water. Such a low particle size D3,2 shows good emulsion stability, even after heat-treatment.

[0387] In a fifteenth aspect of the invention, the invention relates to a method for producing a food emulsion composition, preferably heat-treated food emulsion composition. The food emulsion composition, preferably the heat-treated food emulsion composition may be as provided in the thirteenth aspect of the invention.

[0388] The method comprises the step a) of preparing a liquid mixture comprising : an edible fat component, and, a recombinant wild type patatin-2 or a mutant thereof according to any one of the first, second, third or tenth aspect of the invention or the recombinant wild type patatin-2 mutant selected according to the fourth aspect of the invention.

[0389] The liquid mixture, also called liquid pre-emulsion, may further comprise an aqueous liquid. For example, the aqueous liquid may be water, milk, plant-based milk analogue, fruit juice, vegetable juice or any mixture thereof. Preferably, the aqueous liquid is water or milk or plant-based milk.

[0390] The type of edible fat, the level of edible fat, the level of recombinant wild type patatin- 2 or a mutant thereof may be as provided in the thirteenth aspect of the invention.

[0391] The method further comprises a step b) of treating the liquid mixture of step a) to form food emulsion composition. The formation of a food emulsion composition is preferably performed by homogenizing the liquid mixture of step a). The homogenization step may be performed at a pressure above 50 bar. Preferably, the homogenizing step may be performed at a pressure of 50 bar to 700 bar. Further preferably, the homogenizing step may be performed at a pressure of 50 bar to 500 bar. More preferably, the homogenizing step may be performed at a pressure of 50 to 300 bar, from 100 to 300 bar or from 150 to 300 bar. In a preferred embodiment, the homogenization step may be performed at a temperature from 50°C to 70°C. More preferably, the step may be performed at a temperature from 55°C to 65°C.

[0392] The method may further comprise a step c) of heat treating the food emulsion composition to form a heat-treated food emulsion. The heat-treat step c) may be performed according to the heat treatment method, temperature conditions and time conditions provided in the thirteenth aspect of the invention.

[0393] The method may further comprise a step d) of drying the food emulsion composition of step b) or heat-treated food emulsion composition of step c) to form a powder. The drying may be performed by any methods well known for the drying of food products. For example, the drying step may be performed by freeze drying, spray drying, roller drying or vacuum drying.

[0394] The heat treatment step c) may be before or after the treatment step, preferably homogenization step b).

[0395] In some embodiment, the food emulsion composition obtained in step b) or the heat- treated food emulsion obtained in step c) has a particle size D3,2 below 1.3 micron, preferably between 0.4 and 1 micron, more preferably between 0.5 and 0.8 micron when measured by laser granulometry. The laser granulometry is preferably measured using a Mastersizer 3000 instrument (Malvern Instrument Limited, Worcestershire, UK) equipped with Hydro MV dispersion unit, in 20°C water. Such a low particle size D3,2 shows good emulsion stability even after heat-treatment at high temperature.

[0396] In a preferred embodiment, the food emulsion composition or the heat-treated food emulsion composition is substantially free, more preferably entirely free from glycoalkaloids and / or alkaloids. The limited presence or even absence of glycoalkaloids and alkaloids is advantageous. Indeed, glycoalkaloids and alkaloids are significantly present in potato and are also generally present in protein ingredients extracted from potato. The significant presence of glycoalkaloids and alkaloids is undesirable because they act as anti-nutritional factors. In a further preferred embodiment, the glycoalkaloids are selected from the list consisting of a- chaconine, a-solanine, a-solasonine and mixture thereof and / or the alkaloid is solanidine.

[0397] In some embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have a different non-native post-translational modification (PTM) pattern. In a preferred embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said different forms have different non-native post-translational modification (PTM) on Asn92. The non-native post-translational modification on Asn92 may be glycosylation . Preferably, the non-native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 5 to 20 hexoses and optionally 1 phosphorylated hexose. More preferably, the non- native post-translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 17 hexoses and optionally 1 phosphorylated hexose. Even more preferably, the non-native post- translational modification on Asn92 comprises 2 N-acetylated hexoses, 9 to 16 hexoses and optionally 1 phosphorylated hexose.

[0398] In a further preferred embodiment, the food emulsion composition may comprise at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein, wherein said at least two different forms have different non-native post- translational modification (PTM) on Asn92 and wherein said PTMs on Asn92 of said at least two different forms are selected from the group consisting of:

[0399] 2 N-acetylated hexoses and 9 hexoses, and,

[0400] 2 N-acetylated hexoses and 10 hexoses, and,

[0401] 2 N-acetylated hexoses and 11 hexoses, and,

[0402] 2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,

[0403] 2 N-acetylated hexoses and 12 hexoses, and,

[0404] 2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,

[0405] 2 N-acetylated hexoses and 13 hexoses, and,

[0406] 2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,

[0407] 2 N-acetylated hexoses and 14 hexoses, and,

[0408] 2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,

[0409] 2 N-acetylated hexoses and 15 hexoses, and,

[0410] 2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,

[0411] 2 N-acetylated hexoses and 16 hexoses, and,

[0412] 2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,

[0413] 2 N-acetylated hexoses and 17 hexoses, and,

[0414] 2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose. In some embodiment, the major form of the at least two different forms of the recombinant wild type patatin-2 as disclosed herein or at least two different forms of the recombinant wild type patatin-2 mutants as disclosed herein in the food emulsion composition is the form having a non-native post-translational modification (PTM) on Asn92 comprising 2 N-acetylated hexoses and 12 hexoses.

[0415] Sequences CTCCTCTTCAGAGTACAGAAGATTAAGTGAGACCTTCGTTTGTGCGGA TCC

[0416] Those skilled in the art will understand that they can freely combine all features of the present invention disclosed herein. In particular, features described for the products (e.g. of the present invention may be combined with the method of the present invention and vice versa. Further, features described for different embodiments of the present invention may be combined.

[0417] Furthermore, where known equivalents exist to specific features, such equivalents are incorporated as if specifically referred in this specification. Further advantages and features of the present invention are apparent from the figures and non-limiting examples.

[0418] EXAMPLES

[0419] Example 1: production of wild type patatin-2 and mutant thereof

[0420] Four wild type patatin-2 variants were produced in recombinant yeast strain (Pichia pastoris) strains: the wild type Patatin-2 with SEQ ID NO: 1 and three wild type patatin-2 mutants with SEQ ID NO:2-4. As the glycosylation enzymes in yeast are different than plant cells, the proteins produced by the yeast have a non-plant glycosylation pattern. The produced proteins can be used as a component in any of the compositions described herein.

[0421] The recombinant wild type Patatin-2 with SEQ ID NO: 1 and recombinant patatin-2 mutant with SEQ ID NO:2 were effectively produced as shows in figures 1 and 2.

[0422] Plasmids

[0423] Plasmids were constructed for the expression of each wild type patatin-2 protein variant. Each plasmid included the following components: an inducible promoter (e.g., AOX1 promoter) or a constitutive (GAP promoter) promoter, for each protein being expressed; a sequence encoding a signal peptide for each protein being expressed, derived either from the native wild type patatin-2 sequence or one from a yeast protein sequence (alpha mating factor); a sequence encoding the wild type patatin-2 variant to be expressed; a yeast transcription terminator sequence (e.g., AOX1, AOD, or CYC1) for each protein being expressed; a bacterial origin of replication from pUC19 to enable replication of the plasmid in E. coli; and a selectable marker cassette (e.g., kanR or zeocinR) to enable selection in bacteria and yeast with antibiotics.

[0424] For plasmid construction, the following plasmids were used: pGAPZalpha and pPICZalpha.

[0425] These plasmids were then integrated into wildtype P. pastoris for expression. The production of the proteins was detected by SDS-PAGE.

[0426] Strain Construction

[0427] Six plasmids were created, placing the expression of the different wild type patatin-2 variant under the control of either the methanol-induced promoter PAOX1 or the constitutive promoter PGAP with the full-length alpha mating factor signal peptide or the OST1 signal peptide placed directly before the protein.

[0428] Prior to transformation, 20 pg each plasmid was linearized by digestion with the restriction enzyme Sacl or PagL The digested plasmids were then purified and resuspended in 10 pl distilled water.

[0429] Competent Pichia pastoris cells were prepared as follows: A 500 mL culture of P. pastoris was grown to OD600 1.3-1.5) in YPD medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L dextrose) at 30 °C. Cells were centrifuged at 1500 x g for 5 min and then resuspended in 500 mL ice cold water. Cells were then centrifuged at 1500 x g for 5 min and then resuspended in 250 mL ice cold water. Cells were centrifuged at 1500 x g for 5 min and then resuspended in 20 mL of ice cold IM sorbitol. Cells were centrifuged at 1500 x g for 5 min and then resuspended in 1 mL ice cold IM sorbitol.

[0430] 80 pL of cells were combined with 10 pg of the linearized plasmid DNA in a chilled 2 mm electroporation cuvette, incubated for 5 min on ice and then subjected to a 1.5 kV pulse (25 pF, 200Q). Immediately afterwards, 1 mL of cold 1:1 YPD:1 M sorbitol was added and the cells were transferred to a 15 mL sterile culture tube. The cells were then incubated at 30 °C for 1-2 h without shaking. Finally, the cells were plated onto YPDS agar plates (10 g / L yeast extract, 20 g / L peptone, 20 g / L dextrose, IM sorbitol) containing 100 pg / mL zeocin and grown for two days at 30° C. Protein Production

[0431] Depending on the promoter (inducible or constitutive) different expression and cultivation strategies were employed (cf. 1.1. and 1.2).

[0432] Methanol-inducible promoter AOX1

[0433] Single colonies were picked from the agar plates and grown in MGY(H) medium (1.34% Yeast Nitrogen Base with ammonium sulfate and without amino acids 1% glycerol 4 x 10-5% biotin ± 0.004% histidine) at 30 °C and 250 rpm until OD600 2-6 was reached. Then cells were harvested by centrifugation at 1,500-3,000 x g for 5 minutes at room temperature, supernatant was discarded, and cells resuspended to an OD600 of 1.0 in MMH medium (1.34% YNB 4 x 10-5% biotin 0.5% methanol) to induce expression (approximately 100-200 ml). Cells were cultured in a 1-liter baffled flask at 30 °C. Every 24 hours 100% methanol was added to a final concentration of 0.5% methanol to maintain induction. Aliquots of 2 ml of the expression culture were taken at the following time points: 0, 1, 2, 3, 4 days. The samples were centrifuged immediately and kept at -20°C for analysis by SDS-PAGE.

[0434] Constitutive promoter GAP

[0435] 10 mL of YPD medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L dextrose) were inoculated with a single colony and grown overnight at 30 °C and 250 rpm. The next day 0.1 mL of the culture were used to inoculate 50 mL YPD in a 250 mL flask and the cells were cultured at 30 °C at 250 rpm. At timepoints t=0, 1, 2, 3, and 4 days, 2 mL samples were taken for analysis by SDS-PAGE. The samples were centrifuged immediately and the supernatant as well as the pellet were kept for further analysis at -20°C.

[0436] Purification of Patatin-2 variants

[0437] Patatin-2 was produced by tangential flow filtration using two filtration steps. A first high molecular weight filtration (300 kDa) was carried out to remove all high molecular weight contaminations. The permeate of this step was subsequently subjected to a 3 kDa ultrafiltration / diafiltration step to remove salts and low molecular weight components. The protein was then lyophilized and stored at room temperature until used.

[0438] Protein identification uence and -translational The protein was characterized by intact LC-MS and peptide LC-MS / MS. For the intact LC-MS analyses, 5 mg of lyophilized protein were resuspended in 150 pL of ABC buffer (100 mM ammonium bicarbonate , pH=7.9) and 450 pL denaturating and reducing buffer (6.25 M guanidine, 5.2 mM trisodium citrate, 19.2 mM DTT, pH=8.5). Samples were incubated at room temperature for 30 minutes and cleared by centrifugation at 16'000 x g for 10 minutes on a table-top centrifuge. The cleared supernatants were separated on a C4 column (Acquity UPLC Protein BEH C4, 300 A, 1.7 pm, 2.1 mm x 150 mm; Waters Corporation, Milford, MA) using a mobile phase composed of buffer A (0.1% TFA in water) and buffer B (0.1% TFA in acetonitrile:water at 90:10) and the following gradient at 0.5 mL / min: 10, 10, 35, 60, 95, 95, 10, and 10% (v / v) buffer B at 0, 2, 9, 32, 33, 34, 35, and 40 min, respectively. The MS signal was recorded from 2 to 32 min in full MS mode on a Thermo Q-Exactive HF (ThermoFisher Scientific, Waltham, MA; heater temperature, 100°C; sheath gas, 53; auxiliary gas, 14; sweep gas, 3; spray voltage, 3.5 kV; capillary temperature, 320°C; S-lens radiofrequency level (arbitrary units), 70; mass range, 800-2,000 m / z; resolution, 15,000; microscans, 5; automatic gain control target, 5e6; maximum injection time, 200 ms). MS data were deconvolved using BioPharma Finder and the ReSpect algorithm. For peptide LC-MS / MS, samples were resuspended in ABC buffer to reach a protein concentration of 1 mg / mL. 500 pL sample were reduced with 50 pL dithiothreitol 45 mM for 30 minutes at 60 °C and then alkylated with 50 pL iodoacetamide 100 mM in the dark at room temperature for 30 minutes. 100 pL of the reduced and alkylated solution was mixed with 5 pL trypsin at 0.2 pg / pL, and another one with 5 pL GluC at 0.2 pg / pL. Both solutions were incubated overnight at 37 °C. The digestion reactions were stopped by the addition of formic acid (1% final) and centrifuged at 16'000 x g for 10 minutes at room temperature. The cleared supernatants were separated on a C18 column (Acquity UPLC Protein BEH C18, 130 A, 1.7 pm, 1 mm x 150 mm; Waters Corporation, Milford, MA) using a mobile phase composed of buffer A (0.1% FA in acetonitrile:water 2:98) and B (0.1% FA in acetonitrile:water 80:20) and the following gradient at 75 pL / min: 2, 50, 100, 100, 2, and 2% (v / v) buffer B at 0, 60, 61, 63, 65, and 75 min, respectively. The MS signal was recorded from 0 to 65 min in a data-dependent manner (TOPIC) on a Thermo Q-Exactive HF (heater temperature, 150°C; sheath gas, 30; auxiliary gas, 10; sweep gas, 1; spray voltage, 3.5 kV; capillary temperature, 320°C; S-lens radiofrequency level (arbitrary units), 50; MSI parameters: mass range, 300-2,000 m / z; resolution, 120,000; microscans, 1; automatic gain control target, 3e6; maximum injection time, 100 ms; MS2 parameters: selection of the 10 most intense precursors; resolution, 30,000; microscans, 1; automatic gain control target, le5; maximum injection time, 50 ms; isolation window, 4 m / z; normalized collision energy, 30; dynamic exclusion, 10 s). MS / MS data were analyzed on BSI Peaks against the patatin sequences using the following parameters: precursor mass error tolerance: 10 ppm; fragment mass error tolerance: 0.02 Da; enzymes were specified for each sample; peptide length: 6-65 amino acids; fixed modification: carbamidomethylation; variable modifications: deamidation, HexNAc(2)Hex(l-14), HexNAc(2)Hex(6-14)Phos; 2 maximum variable modifications per peptide). The custom modifications for phosphorylated N-glycans were obtained by adding 79.9663 Da to the mass of the non-phosphorylated N-glycans (for instance, HexNAc(2)Hex(10) has a monoisotopic mass of 2026.68694 Da and HexNAc(2)Hex(10)Phos a mass of 2106.65324 Da). This allowed identification of the site of glycosylation as well as the type of glycosylation.

[0439] Overall, glycosylation patterns consisting of two N-acetyl hexoses and 9 to 16 hexoses were detected, and some glycosylation also included phosphorylated sugars (Table 2). Glycosylation in the patatin-2 only occurred at Asn92.

[0440] Table 2: Observed and theoretical mass corresponding to the patatin with the described post- translational modification (PTM).

[0441] Observed Theoretical PTM assigned Amass ppm

[0442] 42054.39 42055.55 +HexNAc(2)Hex(9) 27.6

[0443] 42217.62 42217.61 +HexNAc(2)Hex(10) 0.3

[0444] 42379.9 42379.66 +HexNAc(2)Hex(ll) 5.7

[0445] 42459.77 42459.63 +HexNAc(2)Hex(ll)Phos 3.5

[0446] 42541.95 42541.71 +HexNAc(2)Hex(12) 5.7

[0447] 42622.14 42621.68 +HexNAc(2)Hex(12)Phos 10.9

[0448] 42704 42703.76 +HexNAc(2)Hex(13) 5.4

[0449] 42784.24 42783.73 +HexNAc(2)Hex(13)Phos 11.9

[0450] 42866.16 42865.82 +HexNAc(2)Hex(14) 8.0

[0451] 42946.6 42945.78 +HexNAc(2)Hex(14)Phos 19.0

[0452] 43028.39 43027.87 +HexNAc(2)Hex(15) 12.0

[0453] 43108.22 43107.84 +HexNAc(2)Hex(15)Phos 9.0

[0454] 43190.29 43189.92 +HexNAc(2)Hex(16) 8.4

[0455] 43270.5 43269.89 +HexNAc(2)Hex(16)Phos 14.0 Measuring glycoalkaloids / alkaloids in patatin-2

[0456] Glycoalkaloids / alkaloids were measured using LC-MS. The extraction procedure was adapted from the European Reference Laboratory (EURL, Wageningen Food Safety Research) method "EURLMP-method 014 yl, 2023, Determination of glycoalkaloids in potatoes by LC[1]MS / MS, EURL mycotoxins and plant toxins, WFSR Wageningen University & Research". Briefly, an initial extraction of the sample was performed with a mixture of methanol:water:formic acid. After centrifugation, an aliquot of the resulting supernatant was ultra-centrifuged and the resulting extract was transferred in a vial for subsequent analysis. Analysis was conducted by Liquid Chromatography coupled to High Resolution Mass Spectrometry Analysis (LC-HRMS) (Orbitrap Exploris 480, Thermo Scientific).

[0457] Identification of each GAs was conducted according to Document SANTE / 11312 / 2021v2, from the European Commission and implemented Implemented by 01 / 01 / 2024, (https: / / food.ec. europa. eu / system / files / 2023- ll / pesticides_mrl_guidelines_wrkdoc_2021-11312.pdf) criteria, using reference analytical standards. Quantification was performed by means of an external calibration curve (range 0.5 - 50 mg / kg in-sample-concentration). Limit of quantification is 0.5 mg / kg for each of the six molecules studied.

[0458] In contrast to patatin extracted commercially from potato (Solanic®200, Avebe, Veendam, The Netherlands), all tested glycoalkaloids / alkaloids were below the limit of detection (0.5 mg / kg) in the recombinant protein samples.

[0459] Table 3: Levels of glycoalkaloids / alkaloids expressed in mg per kg of protein. Limit of detection is 0.5 mg / kg.

[0460] Analysis of lipid acyl hydrolase activity

[0461] Before measuring the activity of the proteins, recombinantly produced patatin-2 was purified by fast protein liquid chromatography (FPLC) using a MonoQ column and Lipid acyl hydrolase activity was measured using a slightly modified protocol based on Hirayama et al. (Biochimica et Biophysica Acta-Enzymology (1975), volume 384, issue 1, 127-137). As substrate p-nitrophenyl (pNP) palmitate was used, however, other fatty acid esters of saturated fatty acids of a chain length from 2 to 18 carbon atoms (Sigma) can be used. First, a 10 pM protein solution in 100 mM Tris-HCI buffer pH 7.0 and a pNP-esters solution of suitable concentration (in H2O + 1% Trition X-100) are prepared. If necessary, the p-NP stock solution was sonicated in a water bath for 30 min. For the assay, 250 pl of the p-NP stock solution were mixed with 350 pl of the protein containing Tris-HCI buffer. The enzyme reaction was monitored at 410 nm. To correlate the measured absorbance to a concentration of cleaved pNP substrate, a standard curve of p-nitrophenol was measured over a suitable concentration range.

[0462] The measured lipase activity as a function of time is presented on Figure 2. The specific enzymatic of extracted potato protein was determined to be 12 U / g of protein, while both the recombinantly produced wild type patatin-2 protein (0.32 U / g of protein) and the mutant patatin-2 (0.14 U / g of protein) have strongly reduced lipase activity.

[0463] Although the invention has been described by way of example, it should be appreciated that variations and modifications may be made without departing from the scope of the invention as defined in the claims.

[0464] Determination of the molecular folding of recombinantly produced patatin using circular dichroism spectroscopy

[0465] The folding of the recombinantly produced patatin-2 was investigated by means of circular dichroism spectroscopy. A Chirascan™ V100 spectrometer (Applied Photophysics Ltd, Leatherhead, UK) was used to record spectra in the far-UV region (180-260 nm) to determine the secondary structure of the protein. In addition, a temperature ramp experiment was performed on the secondary structure measurement to assess the thermal transitions of the proteins and the corresponding denaturation temperatures. Measurements were performed at wavelengths ranging from 260 down to 180 nm using a bandwidth of 1 nm, with a step of 1 nm and a time-per-point of 1 s (0.5 for the temperature ramp). The average of 5 scans recorded at 25°C, corrected by the average of 5 scans of blank solution recorded in the exact same conditions, is reported. Thermal stability was assessed with a stepped-temperature ramp ranging from 25°C to 95°C (2°C steps, tolerance + / - 0.2°C, temperature probed into the samples, 1 scan), following a heating rate of l°C / min and a settling time of 1 min. At the end of the ramp, the temperature returned to initial point and a final measurement was performed. The protein concentration was in the range 0.06-0.07 mg / mL at pH 7.0 and a quartz cuvette with a pathlength of 0.5 mm was used. For secondary structure determination, spectra were deconvoluted and fitted using the BeStSel web server (https: / / bestsel.elte.hu / index.php) derived from DSSP (Dictionary of Secondary Structure in Proteins). For determination of the denaturation temperature, the Global3 software was used forcing the fit with one thermal transition event.

[0466] Figure 3 shows the far-UV spectra obtained for both the recombinantly produced wildtype patatin-2 protein (3A) and the mutant patatin-2 (3B). The data show a typical profile for a protein containing both 0-sheets and a-helix secondary structure elements with a positive band of molar ellipticity at 195 nm and two negative peaks at 208 and 222 nm. This proofs that the recombinant patatin-2 were properly folded after production and purification steps. The fitting of the experimental data using the BeStSel programme allows to extract relative contents in secondary structure elements and shows very similar composition for both variants indicating that the mutation had not influenced to much the protein structure compared to the wildtype protein.

[0467] Finally, the thermal transitions of the two proteins are shown on Figure 4 when applying a temperature ramp. A single transition temperature could be determined with 2 preferential folded structures existing below and above this temperature (Figure 4 A&B). The cross-over point corresponds to equimolar concentration of both forms and the thermal transition point which was found to be 55.5+ / -0.2°C for the recombinant wildtype patatin- 2protein (Figure 4A) and 50.5+ / -0.2°C for the patatin-2 mutant (Figure 4B). These transition temperatures are comparable to that described for patatin extracted from potato, i.e. around 45 to 55°C (Pots A.M., De Jongh H.H J., Gruppen H., Hamer R.J., Voragen A. GJ. Heat-induced conformational changes of patatin, the major potato tuber protein. (1998). European Journal of Biochemistry, 252:1, 66 - 72.

[0468] Measurement of emulsifying properties of recombinantly produced patatin-2

[0469] The emulsifying capacity and emulsion stabilizing properties of recombinantly produced patatin-2 were measured and compared to extracted potato protein and sodium caseinate. To this end, 20 g of o / w emulsions with a protein content between 0.1-1 wt% and 10 wt% oil (sunflower) were prepared at pH7.0. After preparing the protein dispersion at room temperature in demineralized water, the samples were mixed with sunflower oil and homogenized using the Emulsiflex C5 microfluidizer (Avestin Europe GmbH, Mannheim, Germany) operating at 300 bars. Then, the particle size distribution of the emulsions was determined by laser granulometry using a Mastersizer 3000 instrument (Malvern Instrument Limited, Worcestershire, UK) equipped with Hydro MV dispersion unit, in 20°C water. The sunflower refractive index 1.469 was used for the dispersed phase and 1.33 for the continuous phase with a particle absorption index of 0.01 for the calculation. The surface averaged diameter D3,2 was derived from the size distributions and plotted as function of the protein content to compare the various protein emulsifying capacity (Figure 5). As an acceptance criterion for good emulsion in terms of whiteness and stability, the D32< oil droplet size must be below 1.0 pm as it would indicate that the emulsion droplets are not flocculated nor coalesced (McClements DJ. Critical Review of Techniques and Methodologies for Characterization of Emulsion Stability. (2007). Critical Reviews in Food Science and Nutrition, 47:7, 611 - 649). In addition, the heat stability of the obtained emulsion was tested at a protein content of 0.5 wt% by submittingthe samples poured in a 35 mLglass tube to a UHT treatment at 145°C for 5 s using a Discover microwave oven (300 W max. power) equipped with an Explorer 12 autosampler (CEM Corporation, Matthews, NC, USA). The particle size distribution was then determined again (Figure 6). Figure 5 clearly shows that recombinant patatin-2 can produce stable emulsions with a droplet size below 1 micron up to 0.25 wt%, comparably to sodium caseinate reference protein or extracted potato protein. When submitted to a UHT treatment at a protein content of 0.5 wt%, sodium caseinate and extracted potato protein emulsions showed a size peak below 1 micron but also at higher diameters which is a sign for partial coalescence or flocculation (Figure 6A&B). On the contrary, emulsions stabilize by recombinant wild type patatin-2 or recombinant patatin-2 mutant exhibited a monodisperse distribution with a droplet size peak below 1 micron, indicating very high heat stability (Figure

[0470] 6 C&D).

[0471] Conclusions The presented data shows that patatin-2 can be efficiently produced by precision fermentation. The recombinantly produced proteins do not contain any glycoalkaloids and have a glycosylation at Asn92. Furthermore, the recombinantly produced wildtype protein shows significantly reduced lipase activity. By introducing mutations, the lipase activity can be reduced further. Potentially, the significantly reduced lipase activity originates from the different glycosylation pattern, including at Asn92, in yeast compared to potato. The recombinantly produced patatin-2 exhibit a proper molecular folding and a transition temperature around 50-55°C. The recombinant proteins are able to stabilize with a protein content as little as 0.25 wt% and emulsions are heat stable to UHT heat treatment. Although the invention has been described by way of example, it should be appreciated that variations and modifications may be made without departing from the scope of the invention as defined in the claims.

Claims

CLAIMS1. A recombinant wild type patatin-2 or mutant thereof which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2.

2. A recombinant wild type patatin-2 or mutant thereof according to claim 1, which has at least 90% sequence identity to wild type patatin-2.

3. A recombinant patatin-2 mutant which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2, and which comprises one or more mutations and / or one or more non-native post-translational modifications (PTMs), wherein said one or more mutations and / or said one or more non-native PTMs reduce or eliminate the lipid acyl hydrolase activity in the recombinant wild type patatin-2 mutant compared to the wild type patatin-2.

4. A recombinant patatin-2 mutant which comprises or consists of an amino acid sequence having at least 80% sequence identity to wild type patatin-2, and which comprises one or more mutations selected from the list consisting of S54A and D193A.

5. A recombinant patatin-2 according to claim 1 or 2 or a recombinant wild type patatin- 2 mutant according to any of claims 1 to 4, wherein the wild type patatin-2 is a wild type patatin-2 of Solanum tuberosum, preferably wild type patatin-2 of Solanum tuberosum consisting of SEQ ID NO:1.

6. A recombinant wild type patatin-2 according to claim 1, 2 or 5 or recombinant patatin- 2 mutant according to any of claims 1 to 5 which does not comprise an amino acid sequence consisting of at least three consecutive histidine residues.

7. A recombinant wild type patatin-2 according to any one of claims 1, 4 or 5 or recombinant patatin-2 mutant according to any of claims 1 to 5, which comprises non- native post-translational modification (PTM) on Asn92.

8. A recombinant wild type patatin-2 of claim 7 or recombinant patatin-2 mutant according of claim 7, wherein the non-native post-translational modification on Asn92 may be glycosylation.

9. A recombinant wild type patatin-2 of claim 7 or 8 or recombinant patatin-2 mutant according of claim 7 or 8, wherein the non-native post-translational modification on Asn2 comprises 2 N-acetylated hexoses and 5-20, more preferably 9-17, even more preferably 9-16 hexoses, and optionally 1 phosphorylated hexose.

10. A recombinant wild type patatin-2 of any one of claims 7-9 or recombinant patatin-2 mutant according of any one of claims 7-9, the non-native post-translational modification on Asn92 is selected from the group consisting of:2 N-acetylated hexoses and 9 hexoses, and,2 N-acetylated hexoses and 10 hexoses, and,2 N-acetylated hexoses and 11 hexoses, and,2 N-acetylated hexoses and 10 hexoses and 1 phosphorylated hexose, and,2 N-acetylated hexoses and 12 hexoses, and,2 N-acetylated hexoses and 11 hexoses and 1 phosphorylated hexose, and,2 N-acetylated hexoses and 13 hexoses, and,2 N-acetylated hexoses and 12 hexoses and 1 phosphorylated hexose, and,2 N-acetylated hexoses and 14 hexoses, and,2 N-acetylated hexoses and 13 hexoses and 1 phosphorylated hexose, and,2 N-acetylated hexoses and 15 hexoses, and,2 N-acetylated hexoses and 14 hexoses and 1 phosphorylated hexose, and,2 N-acetylated hexoses and 16 hexoses, and,2 N-acetylated hexoses and 15 hexoses and 1 phosphorylated hexose, and,2 N-acetylated hexoses and 17 hexoses, and,2 N-acetylated hexoses and 16 hexoses and 1 phosphorylated hexose.

11. A method for selecting patatin-2 mutant having reduced or eliminated lipid acyl hydrolase activity which comprises the step of:a) providing one or several recombinant patatin-2 mutants, wherein said recombinant patatin-2 mutants have at least 80% sequence identity to patatin-2 and comprise at least one mutation and / or at least one non-native PTM, b) providing a wild type patatin-2, preferably wild type patatin-2 of Solanum tuberosum, more preferably wild type patatin-2 of Solanum tuberosum consisting of SEQ ID NO:1, c) measuring the lipid acyl hydrolase activity of the recombinant patatin-2 mutant and the lipid acyl hydrolase activity of the wild type patatin-2, d) selecting one or several recombinant patatin-2 mutants which have lipid acyl hydrolase activity which is reduced compared to wild type patatin-2 or which has no lipid acyl hydrolase activity.

12. A polynucleotide expression vector for expressing a recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or recombinant patatin-2 mutant selected according to the method of claim 11, which comprises a nucleic acid sequence encoding recombinant wild type patatin-2 or mutant thereof according to any one of claims 1 to 10 or a nucleic acid sequence encoding recombinant patatin-2 mutant selected according to the method of claim 11.

13. A host cell comprising the polynucleotide expression vector according to claim 12.

14. A host cell expressing recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or expressing recombinant wild type patatin-2 selected according to method of claim 11.

15. The host cell of claim 13 or 14, wherein the host cell is a microorganism cell, preferably a microorganism cell is a bacteria cell, a yeast cell, a fungal cell or microalgae cell.

16. The host cell according to any one of claims 13 to 15, wherein the host cell is a cell coming from the microorganism selected from the group consisting of Bacillus Licheniformis, Pichia pastoris, Kluyveromyces lactis, Saccharomyces cerevisiae, Escherichia coli cell, Trichoderma reesei, Yarrowia Hpolytica, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Neurospora crassa, Bacillus subtilis,Streptomyces lividans, Streptococcus thermophilus, Cryptococcus curvatus, Fusarium venenatum, Rhodosporidium toruloides, Eremothecium gossypii, Pantoea agglomerans and Phaffia rhodozyma.

17. A method for producing one or several recombinant wild type patatin-2 or mutant thereof, comprising a) culturing a host cell of any one of claims 13 to 16 in a culture medium under conditions sufficient to allow for expression of the one or several recombinant wild type patatin-2 or mutant thereof; and b) isolating the one or several recombinant wild type patatin-2 or mutant thereof from the culture medium.

18. A method for preparing one or several recombinant patatin-2 or a mutant thereof comprising the following steps:(a) Fusing nucleic acid sequence encoding patatin-2 or mutant thereof to a mating factor alpha of Saccharomyces cerevisiae to receive a heterologous gene sequence,(b) Integration of the heterologous gene sequence of step (a) into a polynucleotide expression vector;(c) Introducing at least one copy of the polynucleotide expression vector of step (b) into the genome of Pichia pastoris;(d) Selection of the cells which have taken up the polynucleotide expression vector containing the heterologous gene sequence;(e) Collecting the secreted recombinant patatin-2 or mutant thereof.

19. The polynucleotide expression vector, host cell or method according to any one of claims 12-13, 15-18, wherein the nucleic acid sequence encoding patatin-2 or mutant thereof has at least 70% sequence identity to SEQ ID NO:5 or 9.

20. A recombinant wild type patatin-2 or mutant thereof obtainable or obtained by the method according to any one of claims 17 to 18.

21. A composition comprising a recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or 20 or comprising a recombinant patatin-2 mutant selected according to the method of claim 11.

22. A product comprising a recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or 20 or recombinant patatin-2 mutant selected according to the method of claim 11, wherein the product is selected from the list consisting of food product, feed, pet food, food supplement and pharmaceutical product.

23. A composition according to claim 21 or a product according to claim 22, which is vegetarian or vegan.

24. A food emulsion composition, preferably which is heat treated comprising: an edible fat component, and, a recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or 20 or recombinant patatin-2 mutant selected according to the method of claim 11.

25. A food emulsion according to claim 24, which is a creamer or plant-based creamer analogue.

26. A recombinant wild type patatin-2 according to claim 1, 2, 5, 6-10 or 20; or recombinant wild type patatin-2 mutant according to any of claims 1 to 10 or 20; or a composition according to claim 21 or 23 or a product according to claim 22-23, which is substantially free, preferably entirely free from glycoalkaloids.

27. A method for stabilizing food emulsion composition, said method comprises the addition of one or more of the recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or 20 or recombinant patatin-2 mutant selected according to the method of claim 11 in a food emulsion composition comprising an edible fat component.

28. A method according to claim 27, wherein the food emulsion composition is further heat-treated.

29. A method for producing a food emulsion composition, preferably heat-treated food emulsion composition which comprises the step of: a. Preparing a liquid mixture comprising : an edible fat component, and, a recombinant wild type patatin-2 or a mutant thereof according to any one of claims 1 to 10 or 20 or recombinant patatin-2 mutant selected according to the method of claim 11, b. Treating, preferably homogenizing the liquid mixture of step a) to form food emulsion composition.

30. A method according to claim 29, wherein the method further comprises a step c) of heat treating the food emulsion composition of step b) to form a heat-treated food emulsion.

31. A method according to claim 30, wherein the method further comprises a step d) of drying the food emulsion composition of step b) or heat-treated food emulsion composition of step c) to form a powder.

Images