Aptamers for intraoperative glioblastoma staining and method for using same

Abstract

The invention relates to the field of biotechnology and medicine, and more particularly to agents for visualizing glioblastoma in humans and to methods for diagnosing brain tumours in humans, and more specifically to visualizing glioblastoma in humans. The invention discloses DNA aptamers which are specific to glioblastoma cells and can be used for the intraoperative staining of brain tumour cells, said DNA aptamers being characterized in that they have a high specificity and affinity to glioblastoma cells.

Description

[0001]Aptamers for intraoperative staining of glioblastoma and a method for using them Technical field The invention relates to the field of biotechnology and medicine, namely to means for visualizing human glioblastoma and to methods for diagnosing human brain tumors, in particular, to visualizing human glioblastoma. State of the art Glioblastoma multiforme, or glioblastoma, belongs to a group of brain tumors known as astrocytomas. Glioblastoma is the most dangerous and most common of all primary brain tumors in adults. This type of tumor is characterized by aggressive biological behavior, expressed in uncontrolled cellular proliferation, resistance to apoptosis and increased angiogenesis; as well as progressive invasion into normal brain parenchyma and extreme genomic instability. Glioblastoma is also characterized by significant heterogeneity at the cytopathological, transcriptional and genomic levels.A characteristic feature of glioblastoma is its infiltrative growth and lack of clear boundaries. Treatment-resistant tumors are common. Among the problems of intraoperative visualization of glial tumors is the difficulty of determining their true boundaries. Tissue areas interpreted as white matter edema of the brain often represent a zone of tumor cell infiltration, while tumor contrast enhancement reflects only the radiologically visible (macroscopic) extent of brain damage, and not the true extent of tumor invasion (Use of perfusion CT in dynamic monitoring of the results of combined and complex treatment of brain gliomas Zhuravleva M.A., Shershever A.S., Benzion D.L. Radiation diagnostics and therapy. 2012. No. 2. P.58-64.).In order to accurately determine the localization of tumor cells, a method of intraoperative visualization (fluorescent-guided surgery) was proposed, which can provide visualization of neoplasms in real time using specific or non-specific fluorescent dyes and a surgical fluorescence microscope or other similar equipment. Today, the most common surgical microscope in medical centers is OPMI Pentero (Carl Zeiss), which has three fluorescence modules in a complete set: Blue 400 with an operating range of 405-650 nm; Yellow 560 (540-690 nm); Infrared 800 (820-900 nm). These fluorescence modules are designed to register three registered substances used for intraoperative visualization of glioblastoma: Alasens, fluorescein and indocyanine green.The most widely used drug in surgical practice is “Alasens” based on 5-aminolevulinic acid, which is a precursor of protoporphyrin (PP) IX in the human body (Stummer, W. Intraoperative Detection of Malignant Gliomas by 5-Aminolevulinic Acid-induced Porphyrin Fluorescence / W.Stummer, S. Stocker, S. Wagner, H. Stepp, C. Fritsch, CE Alwin, R. Kiefmann, H. Reulen / / Neurosurgery. 1998 – V.42 – I.3 – P.518-526). The fluorescence spectrum of PP IX is characterized by two maxima: at 635 and 710 nm, excitation occurs at 405 nm. The disadvantages of the drug include the lack of targeted delivery, which can lead to false positive and false negative results, as well as increased background noise due to the accumulation of 5-aminolevulinic acid in areas with increased metabolism.Sodium fluorescein emits in the visible spectrum (450-600 nm) and at sufficiently high doses of the dye, removal of stained tissue is possible even without the use of a special fluorescence microscope (https: / / doi.org / 10.3171 / 2016.7.JNS16232). The disadvantages of the drug include high background noise due to autofluorescence, since biological tissue itself emits in this wavelength range. Another substance that can passively accumulate in tumor tissue is indocyanine green (760-820 nm), which has been used in neurosurgery since 2003 for intraoperative assessment of aneurysms, arteriovenous malformations, and cortical perfusion (Applications of indocyanine green in brain tumor surgery: review of clinical evidence and emerging technologies. Clare W. Teng, Vincent Huang, Gabriel R. Arguelles, Cecilia Zhou, Steve S. Cho, Stefan Harmsen, John YK Lee. Neurosurg Focus 50 (1): E4, 2021).Despite their widespread use and proven effectiveness, drugs that passively accumulate in tissues have significant drawbacks (Quicker, deeper and stronger imaging: A review of tumor-targeted, nearinfrared fluorescent dyes for fluorescence-guided surgery in the preclinical and clinical stages. Jianhua Jiao, Jingliang Zhang, Fa Yang, Wei Song, Donghui Han, Weihong Wen, Weijun Qin.European Journal of Pharmaceutics and Biopharmaceutics 152 (2020) 123–14): • non-specific drug uptake by cells may result in tissue areas with increased metabolism (e.g. inflammatory sites) emitting fluorescence in the same way as cancer tissue; • due to angiogenesis and vascularization of solid tumors, which lead to the growth and “tangled” nature of blood vessels, drug access to cancer cells may be difficult, and as a result, they will remain unstained; • non-specific drug accumulation in tissues may result in background noise emitted by adjacent healthy cells that have “absorbed” the drug in small quantities.To avoid these problems, non-specific fluorophores should be conjugated with tumor-specific ligands, such as antibodies, peptides, or aptamers (Quicker, deeper and stronger imaging: A review of tumor-targeted, nearinfrared fluorescent dyes for fluorescence-guided surgery in the preclinical and clinical stages. Jianhua Jiao, Jingliang Zhang, Fa Yang, Wei Song, Donghui Han, Weihong Wen, Weijun Qin. European Journal of Pharmaceutics and Biopharmaceutics 152 (2020) 123–14). Aptamers are small (5–30 kDa) single-stranded DNA or RNA molecules that carry a letter code of nucleotides in their primary sequence, so they can be easily synthesized and modified. To date, various aptamers specific to glioblastoma tumor markers have already been obtained (The Role of RNA and DNA Aptamers in Glioblastoma Diagnosis and Therapy: A Systematic Review of the Literature.Silvia Nuzzo, Valentina Brancato, Alessandra Affinito, Marco Salvatore, Carlo Cavaliere, Gerolama Condorelli. Cancers 2020, 12, 2173; doi:10.3390 / cancers12082173). Among them are DNA and RNA aptamers specific to markers such as nucleolin, EGFR, VEGF, PDGFR, Tenascin-C. The main limitations for the use of aptamers in clinical practice are their sensitivity to nucleases in body fluids and the likelihood of non-penetration through the BBB. An analogue of the present invention is document RU2654665, which describes a method for visualizing human glioblastoma using aptamers, including treating brain tissue with a DNA aptamer obtained using cell-SELEX technology with alternating positive and negative selection and linked to a fluorescent label, characterized in that the brain tissue is treated with a DNA aptamer.Another analogue of the invention is DNA aptamers (Gli-233, Gli-55), disclosed in the document Anna S Kichkailo et al / Development of DNA aptamers for visualization of glial brain tumors and detection of circulating tumor cells / Mol Ther Nucleic Acids, 2023, 32: 267- 288 (doi: 10.1016 / j.omtn.2023.03.015). This document discloses DNA aptamers (Gli-233, Gli-55) capable of specifically binding to glial tumor cells in vitro, ex vivo and in vivo for visualization diagnostics of central nervous system tumors. Thus, intraoperative visualization of glioblastoma is a popular and developing area, and the development of new solutions for intraoperative visualization of glioblastoma is an urgent task.Disclosure of the invention The objective of the present invention is to develop and create a means for intraoperative staining of brain tumor cells, as well as to increase the specificity and affinity of the method for visualizing human glioblastoma tissue during surgery. The stated objective is achieved by obtaining a DNA aptamer specific to brain tumor cells and having the sequence SEQ ID NO: 1, SEQ ID NO: 2. In particular embodiments of the invention, the tumor is a glioblastoma. In particular embodiments of the invention, the DNA aptamer is conjugated with a fluorescent label. More specifically, the fluorescent label is an infrared dye or a dye in the range of 400-700 nm. In some embodiments of the invention, the fluorescent label is Cy 7.5, photoditazine, FAM, Cy 5 or Cy 5.5.The subject of the present invention is also a combination of DNA aptamers specific for brain tumor cells and having the sequences of SEQ ID NO: 1 and SEQ ID NO: 2. The subject of the present invention is also the use of a DNA aptamer according to the invention or a combination of DNA aptamers according to the invention for intraoperative staining of brain tumor cells. In addition, the present invention includes a composition for intraoperative staining of brain tumor cells, comprising an effective amount of at least one DNA aptamer according to the invention and at least one pharmaceutically acceptable excipient. In particular embodiments of the invention, the pharmaceutically acceptable excipient is a buffer. More specifically, the buffer is a phosphate buffer containing Ca ions. 2+ and Mg 2+. In particular embodiments of the invention, the DNA aptamer is conjugated to a fluorescent label. More specifically, the fluorescent label is an infrared dye or a dye in the range of 400-700 nm. In some embodiments of the invention, the fluorescent label is Cy 7.5, photoditazine, FAM, Cy 5 or Cy 5.5. In particular embodiments, the composition of the invention is a spray. In particular embodiments, the composition of the invention includes two DNA aptamers characterized by the sequences SEQ ID NO: 1 and SEQ ID NO: 2. The subject of the present invention is also a method for intraoperative staining of brain tumor cells,comprising treating brain tissue with a composition according to the invention. In particular embodiments of the invention, treating brain tissue is carried out by spraying the composition in the form of a spray. In particular embodiments of the invention, treating brain tissue is carried out after removing the main necrotic focus of the tumor. As a result of implementing the invention, the following technical results are achieved: - DNA aptamers specific to brain tumor cells, in particular, glioblastoma, are obtained, which can be used for intraoperative staining of brain tumor cells; - DNA aptamers, as well as their combination, according to the invention are characterized by high specificity and affinity of DNA aptamers to brain tumor cells, in particular, glioblastoma; - DNA aptamers according to the invention provide increased accuracy in determining the true boundaries of a brain tumor, in particular, glioblastoma, during surgery,and as a result of using said DNA aptamers or a combination thereof, the effectiveness of treating an oncological disease of the brain is increased; - the DNA aptamers of the invention do not have an acute toxic effect; - an effective composition for intraoperative staining of brain tumor cells has been obtained, comprising DNA aptamers or a combination thereof, which allows for effective staining of brain tumor cells, in particular, glioblastoma, provides increased accuracy in determining the true boundaries of a brain tumor, in particular, glioblastoma, during surgery, and as a result of using said composition, the effectiveness of treating an oncological disease of the brain is increased; - the composition of the invention does not have an acute toxic effect; - an effective method for intraoperative staining of brain tumor cells has been developed, comprising treating brain tissue with the composition of the invention,which will allow to determine the localization of tumor cells with high accuracy, will provide effective visualization of brain tumor cells in real time. Detailed disclosure of the invention Brief description of the drawings Figure 1. Secondary and tertiary structures of aptamers Gli-233, Gli-233nt, Gli-55, Gli- Figure 2. Analysis of specificity and affinity of aptamers Gli-233, Gli-233nt, Gli- 55, Gli-55_3L: (A) Histogram of aptamers binding to glioblastoma and breast cancer (BC) cell cultures, as well as cells isolated from the brain of a healthy mouse. (B) Flow cytometry data for glioblastoma and breast cancer cells incubated with FAM-labeled (green fluorescent label) Gli-233nt and Gli-55_3L. (C) Histogram of aptamer binding to astrocytes and neurospheres in glioblastoma cultures. Figure 3. Evaluation of alkaline phosphatase, ALT, alpha-amylase, bilirubin,cholesterol and total protein in the blood plasma of mice after administration of the combination of aptamers Gli-233nt and Gli-55_3L. Figure 4. Light (A1, B1, C1) and IR (A2) microscopy of the mouse brain (A1, arrow 2), skull tumor (A1, arrow 1), cross-section of the brain (B1) and organs (C1) with orthotopically xenografted glioblastoma after surface application of the aptamer mixture. Hematoxylin and eosin staining confirmed the formation of glial tumors in the mouse brain (A1.1-A1.4) and inside the skull (B1.1, B1.2). Figure 5. Rationale for the applicability of aptamers for fluorescence-guided glial tumor surgery demonstrated on orthotopically xenografted rabbit brain glioblastoma and PET / CT imaging with, 11C-methionine (A3). Primary culture of glial tumor (A1) transplanted into rabbit brain through intracranial windows (A2). Light (B1) and IR microscopy (B2-B3) of rabbit glial tumors after superficial intracranial application of the aptamers of the invention. Hematoxylin and eosin staining confirmed the formation of glial tumors in the rabbit brain (C1, C2). The rabbit brain without glioblastoma was not stained with the aptamer combination, since it did not emit in the IR range (D1-light microscopy, D2-D3-IR microscopy). Figure 6. Specific staining of glial tumor cells in surgically removed glioblastoma tissues. In panels A1 and B1, aptamers were used to stain glioblastoma multiforme (A1) and sarcomatoid area (B1) tissues. Panel C1 shows staining with a non-specific oligonucleotide (C1) that does not bind to glial tumors. Adjacent hematoxylin and eosin-stained sections were used for comparison in panels A2, B2, and C2.Figure 7. Fluorescence microscopy of aptamers (A1-A3) at concentrations of 0 μM (1); 1 μM (2) and 2 μM (3). Glial tumor tissues incubated with aptamers labeled with Cy 7.5 (No. 1 – Gli-233nt, No. 2 – Gli-55_3L) at concentrations of 1 – 8 μM under the IR module of a Zeiss Kinevo 900 surgical microscope. In panel A, aptamers labeled with Cy 7.5 were in 1.5 ml vials. In panel B, tissue samples were in a 96-well plate. Figure 8. Glioblastoma tissues incubated with aptamers at concentrations of 0 μM (A), 1 μM (B), 2 μM (C), 3 μM (D), 5 μM (E), and 8 μM (F) and visualized using the IR module of a Zeiss Kinevo 900 surgical microscope. Figure 9. Distribution of aptamers with IR dye in healthy mice after intravenous administration in the light field and IR fluorescence. Mice before injection (A1- A2), 5 minutes (B1-B2), 40 minutes (C1-C2), 90 minutes (D1-D2), and 24 hours (E1-E2) after tail vein injection.Accumulation of aptamers in organs (F): brain, kidneys, spleen, liver, intestine, gallbladder, lungs, heart. Figure 10. Distribution of IR-labeled aptamers in healthy mice with an intracranial window after subcutaneous injection, recorded in the light field (A1-D1) and IR fluorescence (A2-D2). Mice 5 minutes (A1-A2), 40 minutes (B1-B2), 90 minutes (C1-C2). Accumulation of aptamers in organs (D1-D2): 1 - brain, 2 - kidneys, 3 - spleen, 4 - liver, 5 - intestine, 6 - gallbladder, 7 - lungs, 8 - heart. Figure 11. Distribution of IR-labeled aptamers in mice after tail vein injection, recorded in the light field (A1-E1) and IR fluorescence (A2- E2). Mice 5 minutes (A1-A2), 40 minutes (B1-B2), 90 minutes (C1-C2, D1-D2). Accumulation of aptamers in organs (E1-E2): brain, intracranial tumor, kidneys, spleen, intestine, liver, lungs, heart.Definitions (Terms) For a better understanding of the present invention, certain terms and abbreviations used in the present specification are provided below. The following definitions apply herein unless otherwise indicated. In the present specification and in the following claims, unless the context otherwise requires, the words "have," "include," and "comprise," or variations thereof, such as, for example, "has," "having," "includes," "including," "comprises," or "containing," are to be understood as including the stated integer or group of integers, but not excluding any other integer or group of integers. These terms are not intended to be construed as "consists only of." Also, herein, the recitation of numerical ranges by endpoints includes all numbers included in that range.The term "DNA aptamer" in the context of the present invention refers to single-stranded oligonucleotides that adopt a specific tertiary structure allowing them to bind to molecular targets with high specificity and affinity. The sequences of the aptamers of the invention are as follows: SEQ ID NO: 1 TTCCACTGCAACAACTGAACGGCTGGAA Gli-233nt SEQ ID NO: 2 CTAGCATTCCTGGCGTTATTAACGGAGCAGTCCTGTGGAGTGGG Gli-55_3L The nucleotide sequence numbers referred to in this document correspond to the number in the Sequence Listing (SEQ ID NO) according to Standard ST.26, which is part of the present description of the invention. In the event of a discrepancy in the structure of the sequences between the reference in the text of the description and the corresponding sequence in the Sequence Listing according to Standard ST.26, the data given in the text of the description shall prevail.The preparation of the aptamer according to the present invention can be carried out using standard methods in the art. Non-limiting examples of techniques for preparing aptamers include in vitro, in vivo selection of aptamers followed by sequencing and chemical synthesis, which are commercially available, molecular modeling or in silico selection (using computer technologies) followed by chemical synthesis. Detectable reagents (labels) for optical imaging include, for example, fluorescein, a fluorescein derivative, and a number of other fluorescent compounds such as Cy3, Cy2, Cy5, Cy 7, Cy7.5, the Alexa Fluor® family of fluorescent labels (Molecular Probes, Inc.), carboxyfluorescein (FAM) and fluorescein isothiocyanate (FITC), photodithazine, fluorescent nanoclusters, Brillrant Violet and other fluorescent labels with emission and emission spectra in the range of 400-700 nm, 700-900 nm.The coupling of the aptamer of the present invention and the label to obtain the labeled aptamer of the present invention can be carried out using conjugation techniques well known to those skilled in the art. The result is a covalent bond between the aptamer of the present invention and the label. Conjugation can include coupling primary amines at the 5'-end of the aptamer of the present invention to the label during chemical synthesis of the aptamer. Conjugation can also be carried out by streptavidin-biotin, amino group-carboxyl group interactions, depending on what modifications the aptamer and dye have, or via cholesterol in the case where the dye is enclosed in a liposome and the aptamer has cholesterol for binding. An "effective amount" is the amount of DNA aptamer (or combination of DNA aptamers) applied to tumor cells that is most likely to produce the desired response.The exact amount required may vary depending on various factors. The term "pharmaceutically acceptable excipient" as used herein refers to substances that do not interfere with the biological activity and properties of DNA aptamers and are acceptable for use in medicine. In particular embodiments of the invention, the pharmaceutically acceptable excipient is a carrier and / or a solvent. More particularly, the pharmaceutically acceptable excipient is a buffer, such as a phosphate buffer containing Ca ions. 2+ and Mg 2+. The term "intraoperatively" in this document means "during surgery". Carrying out the invention The method for visualizing human glioblastoma according to the invention is carried out as follows. After removal of the central necrotic tumor focus during surgery, brain tissue is treated with a DNA aptamer having the sequence SEQ ID NO: 1 or SEQ ID NO: 2 (hereinafter Gli-233nt and Gli-55_3L, respectively) or a combination thereof, linked to an IR dye or other fluorescent labels, in particular, with Cy 7.5, in final concentrations of 50 nM - 7 μM depending on the choice of dye and recording equipment. In this case, said DNA aptamers or a combination thereof can be used in a composition in which said DNA aptamers or a combination thereof are diluted in phosphate buffered saline containing, in particular, 10 g / l Ca 2+ and 10 g / l Mg 2+, pH 7.4. After localization of the luminescence foci, the stained areas are removed, and then the composition of the invention is applied again, in particular in the form of a spray. The procedure is repeated several times depending on the depth of tumor growth. Visualization of glioblastoma tissue is carried out using an IR module of a surgical fluorescence microscope or other similar equipment. The aptamers of the invention were synthesized using an automated phosphoramidite (aminophosphate) method, which is based on the use of phosphoramidite nucleotide monomers with acid-sensitive protective groups. In this process, an activating agent binds each monomer to a growing oligonucleotide chain on a solid support. After each binding step, the phosphate bond of the unstable phosphoramidite monomer is oxidized, turning into a phosphate monomer. Then deblocking occurs, which prepares the oligonucleotide for the next synthesis cycle.Upon completion of all cycles, the oligonucleotide with the desired sequence is cleaved from the solid support. As a result, oligonucleotides with a given sequence were obtained. Secondary structures of aptamers were predicted using the mFold program (10.1093 / nar / gkg595), taking into account the folding temperature and the presence of ions in the solution. Tertiary structures of aptamers were constructed using the SimRNA (10.1093 / nar / gkv1479) and VMD (10.1016 / 0263-7855(96)00018-5, https: / / doi.org / 10.1038 / s41598-017-01348-5) programs. Molecular dynamics simulations of 200 ns duration were performed using the GROMACS 2019.8 package (https: / / doi.org / 10.1016 / j.softx.2015.06.001). The Amber14sb force field (10.1021 / acs.jctc.5b00255) and the TIP3P model (10.1063 / 1.445869) for water were used for the simulations. The aptamer was dissolved in a periodic cubic cell with water. The negative charge of the aptamers was compensated by Na+ ions. Additional Na+ ions. + and Cl –were added to the system to achieve a concentration of 0.15 M. Molecular dynamics simulations were performed in the NPT ensemble (at constant number of particles N, pressure P and temperature T) at 310 K and 1 atm pressure using a rate-controlled thermostat (10.1063 / 1.2408420) and at 1 bar pressure using a Parrinello-Raman barostat (doi.org / 10.1063 / 1.328693). Clustering analysis of the obtained trajectories was performed using the quality threshold algorithm implemented in the VMD program (10.1101 / gr.9.11.1106). The secondary and tertiary structures of the aptamers of the invention (B, D Fig. 1), as well as their analogs (A, C Fig. 1), are shown in Figure 1. Molecular dynamics simulations were performed for the aptamers of the invention to simulate in vitro conditions: solution, temperature and the presence of ions.Tertiary structures of aptamers obtained from cluster analysis of 200 ns MD (molecular dynamics) trajectories represent the structure of aptamers in solution and are shown in Figure 1. Binding of aptamers Gli-233, Gli-233nt, Gli-55, Gli-55_3L was assessed by flow cytometry. Cultures obtained from glioblastoma tissues, breast cancer and cells isolated from the brain of healthy mice were used for the experiment (Figure 2 A). As shown in Figure 2 B, glioblastoma cells obtained from the cultures consisted of two types: astrocytes and neurospheres, which are clusters of neuronal stem cells. In all cases, aptamers demonstrated better binding to astrocytes than to neurospheres, although binding to neurospheres was observed (Figure 2 C). In breast cancer cells, the scatter plot showed a uniform distribution. Figure 2B shows an example of flow cytometry of the Gli-233nt and Gli-55_3L aptamers.2C shows a histogram obtained for the aptamers Gli-233, Gli-55, Gli-233nt and Gli-55_3L in comparison with a non-specific oligonucleotide (AG FAM) and a DNA library of oligonucleotides. As can be seen from the data obtained, Gli-233nt and Gli-55_3L had a higher percentage of binding to glioblastoma cells and a lower percentage of binding to breast cancer cells and cells isolated from the brain of a healthy mouse, compared with other aptamer analogs. To develop a composition according to the invention (in particular, in the form of a spray), including aptamers according to the invention, synthesized with a Cy 7.5 label, aptamers Gli-233nt and Gli-55_3L according to the invention were used for intraoperative staining. In addition, it was shown that the aptamers Gli-233nt and Gli-55_3L according to the invention, in particular those labeled with Cy 7.5, do not have an acute toxic effect (Fig. 3). Acute toxicity of Gli-233nt and Gli-55_3L labeled with Cy 7.5, assessed by changes in blood biochemical parameters: total protein level, cholesterol level and bilirubin level; alanine aminotransferase (ALT) activity, alkaline phosphatase activity and alpha-amylase activity. These parameters were chosen because they reflect the functions of the pancreas, kidneys and liver. The total protein level indicates protein metabolism in the body, as well as the function of the liver and kidneys. Bilirubin is a bile pigment formed during the breakdown of proteins containing heme (hemoglobin, myoglobin, cytochrome), may indicate excessive destruction of red blood cells (hemolytic jaundice, etc.) and impaired bilirubin excretion from the body. Alpha-amylase, a digestive enzyme secreted primarily by the pancreas and salivary glands, found in minimal quantities in other tissues, may exhibit changes in activity in case of poisoning, dysfunction of the pancreas and salivary glands, and renal failure.Alanine aminotransferase, an enzyme present in liver cells, shows increased activity when liver cells are damaged. Alkaline phosphatase, an enzyme found in most tissues with predominant localization in the liver, bones, and placenta, shows higher activity when liver, bone, and kidney tissue is damaged. Cholesterol, an important metabolite synthesized in the liver and used for hormone synthesis, bile acid production, and vitamin D synthesis, also plays a role in regulating cell membrane permeability. Cholesterol concentration provides insight into liver function and a wide range of metabolic pathways. Studies have shown that all measured serum biochemical parameters in mice in both the control and experimental groups remained within the normal range (Miroshnikov MV, Makarova MN Variability of blood biochemical parameters and establishment of reference intervals in preclinical studies. Part 4: Mice. Laboratory Animals for Science. 2021; 3.https: / / doi.org / 10.29296 / 2618723X-2021-03-08; Krasnikova ES, Karmeeva YS, Aledo MM, Krasnikov AV, Kalganov SA Hemato-biochemical status of laboratory mice with a GM corn based diet 2019 IOP Conf. Ser.: Earth Environ. Sci.315042005). Thus, it is shown that the aptamers Gli-233nt and Gli-55_3L according to the invention, labeled with Cy 7.5, as well as the composition according to the invention containing them, do not have an acute toxic effect on the body of mice. Example 1. Intraoperative staining of glioblastoma in an animal model (mice) To conduct the study, glioblastoma was transplanted into mice with immunosuppression. The first group of mice were injected with the drug via the tail vein 30 minutes before dissection, while the second group of mice were injected directly onto the brain under inhalation anesthesia. The brain and organs of the mice, fixed in formalin, were examined under an operating microscope with an infrared module.Figure 4 shows photographs of the brain and organs of mice that underwent intraoperative model staining of glioblastoma using the aptamers of the invention applied directly to the brain (Fig. 4 A1-A2) and those that received the drug intravenously (Fig. 4 B1-B2). As can be seen in the photographs, the surface application of the drug is sufficient for visualization under a surgical microscope with an IR module. Visualization of tumor areas is allowed (A2) with good contrast. In addition, the cross-section shows that the aptamers penetrated the brain by 3-4 mm in 3 minutes. It is also metabolized in the liver (Fig. 4 C2). Example 2. Intraoperative Staining of Glioblastoma in an Animal Model (Rabbit) PET / CT imaging was used to monitor the development of orthotopically xenografted human glioma in the brain of rabbits. 11 C-methionine (Fig. 5 A3). Accumulation 11C-methionine was observed in the trephination area of ​​the rabbit brain, namely in both areas of the transplanted glioma (Fig. 5 A3). The brain tissue not affected by glioblastoma and the brain area with growing tumor were stained with the combination of aptamers of the invention and fixed in formalin for analysis using a surgical fluorescence microscope (Fig. 5 B1-B3). The analysis revealed infrared fluorescence of the rabbit glioblastoma under a surgical fluorescence microscope. Unstained brain tissue and healthy brain tissue stained with aptamers did not emit fluorescence in this wavelength range (Fig. 5 D1-D3). Brain tissue with glioma stained with aptamers demonstrated stable fluorescence in the infrared region of the spectrum. Hematoxylin and eosin staining confirmed the presence of glial tumor formations in the rabbit brain and skull (Fig. 5 C1-C2).The results confirm the potential of using infrared dye-labeled aptamers as an intraoperative dye for detection and visualization of human glioma in a rabbit model. Thus, the method may be of significant importance for improving surgical accuracy and tumor removal in patients with glioma. Example 3. Staining of postoperative glioblastoma tissue using FAM-labeled aptamers. Postoperative human tissues were incubated with 1 ng / ml yeast RNA for 30 min on a shaker. After that, it was washed twice and incubated with 50 nM FAM-labeled Gli-233nt or Gli-55_3L for 30 min on a shaker and fixed in 10% buffered formalin solution. The volume of the fixative was 10 times the size of the embedded tissue. The samples were subjected to standard histological processing based on isopropyl alcohol with subsequent impregnation with paraffin. Next, sections of paraffin blocks were applied to the glass.One part of the sections was left for confocal microscopy without additional staining; the next part was stained with hematoxylin and eosin dyes to confirm tissue morphology. Histological sections of brain tissues of mice and rabbits, into which human glioblastoma cells were transplanted, were fixed in formalin solution, stained with hematoxylin and eosin dyes to confirm tissue morphology. For confocal visualization, Nexcope NIB900 (Ningbo Yongxin Optics Co., Ltd., China) and LSM 780 NLO confocal microscope (Carl Zeiss, Germany) were used; images were processed using ZEN2 software. Comparison with histological analysis of hematoxylin and eosin showed that the aptamers of the invention specifically bind to glioblastoma. FAM-labeled Gli-233nt and Gli-55_3L at a concentration of 50 nM were combined together and used for tissue staining ex vivo. Histological analysis showed that the aptamers did indeed stain glial tumors (Fig.6 A1-A2, B1-B2) compared to the FAM-non-specific oligonucleotide, which did not stain (Fig. 6 C1-C2) the brain tumor tissues. The aptamers of the invention specifically bound to the glial tumor cells, as evidenced by the distinct staining pattern of the multiform region of glioblastoma (Fig. 6 A1-A2), as well as the clearly distinguishable sarcomatoid region of the glial tumor (Fig. 6 B1-B2). Example 4. Study of the aptamers of the invention in different concentrations Different concentrations of the aptamers of the invention labeled with Cy 7.5 for surgery were evaluated using a fluorescence surgical microscope. Figures 7 and 8 show postoperative glioblastoma tissues to which aptamers were applied at concentrations from 1 to 8 μM. A particular variant of the concentration of aptamers Gli-233nt and Gli-55_3L is 5 μM. Example 5. Evaluation of the mechanism and time of elimination of aptamers from the body of mice.The main goal of the intraoperative staining modeling experiment was to choose the aptamer administration strategy: intravenous injection or surface application. Surface application allows to reduce the drug dose and potential toxic effect on the patient, as well as to reduce the risk of oligonucleotide degradation in the blood by nucleases. Intravenous administration allows to stain the entire tumor area immediately before surgery, which can help the surgeon. However, there is a risk that the drug may not penetrate the blood-brain barrier. Healthy mice and mice with orthotopically transplanted human glioblastoma were used to determine the optimal strategy for aptamer administration. The circulation time of aptamers in the blood was estimated in healthy mice after intravenous and subcutaneous administration (Fig. 9) near the trepanation hole of the skull (Fig. 10). IR fluorescence of aptamers in mice was estimated using the Fluor i In Vivo imaging system (South Korea).Before injection, no background IR fluorescence was observed in the mice (Fig. 9 A1-A2). Five minutes after tail vein injection, the mice’s bodies also did not emit sufficient fluorescence (Fig. 9 B1-B2). However, after 40 minutes, the aptamers were distributed throughout the body (Fig. 9 C1-C2). Ninety minutes after injection, the dye was visible in the peritoneal cavity (Fig. 9 D1-D2), and accumulated in the liver, gall bladder, kidneys, and intestine (Fig. 9 F1-F2). After 24 hours, residual fluorescence was visualized only in the tail in case the vein was ruptured during injection (Fig. 9 E1-E2). When applied intracranially, aptamers were visualized on the head at the application site for at least 90 minutes (Fig. 10 A1-A2-C1-C2). It was also metabolized in the liver and spleen, filtered by the kidneys and excreted through the intestine. After 2 hours, it could still be seen in the brain at the application site (Fig. 10 D1-D2).In mice with orthotopically xenografted gliomas, a similar distribution of the drug was observed when administered intravenously (Fig. 11). Forty minutes after injection, the combination of Gli-233nt and Gli-55_3L aptamers could be visualized in the infrared spectra of the brain at the site where the tumor was transplanted. After 90 minutes, the tumor remained visible and became visible in the abdomen (Fig. 11 D2). It could be observed that the aptamers accumulated in the liver, gall bladder, kidneys and intestine (Fig. 11 E2). Although the invention has been described with reference to the disclosed embodiments, it will be apparent to those skilled in the art that the specific experiments described in detail are provided merely for the purpose of illustrating the present invention and should not be considered as limiting the scope of the invention in any way. It will be understood that various modifications can be made without departing from the spirit of the present invention.

Claims

Claims of the invention 1. A DNA aptamer specific for brain tumor cells and having the sequence SEQ ID NO: 1 or SEQ ID NO:

2.

2. The DNA aptamer of claim 1, wherein the tumor is a glioblastoma.

3. The DNA aptamer of claim 1, wherein the DNA aptamer is conjugated with a fluorescent label.

4. The DNA aptamer of claim 1, wherein the fluorescent label is an infrared dye or a dye in the range of 400-700 nm.

5. The DNA aptamer of claim 4, wherein the fluorescent label is Cy 7.5, photoditazine, FAM, Cy 5 or Cy 5.

5.

6. Use of the DNA aptamer of claim 1 for intraoperative staining of brain tumor cells.

7. A composition for intraoperative staining of brain tumor cells, comprising an effective amount of at least one DNA aptamer according to claim 1, and at least one pharmaceutically acceptable excipient.

8. The composition according to claim7, wherein the pharmaceutically acceptable excipient is a buffer.

9. The composition of claim 8, wherein the buffer is a phosphate buffer containing Ca ions. 2+ and Mg 2+.

10. The composition of claim 7, wherein the DNA aptamer is conjugated to a fluorescent label.

11. The composition of claim 10, wherein the fluorescent label is an infrared dye or a dye in the range of 400-700 nm.

12. The composition of claim 11, wherein the fluorescent label is Cy 7.5, photoditazine, FAM, Cy 5 or Cy 5.

5.

13. The composition of claim 7, which is a spray.

14. The composition of claim 7, including two DNA aptamers characterized by the sequences SEQ ID NO: 1 and SEQ ID NO:

2.

15. A method for intraoperative staining of brain tumor cells, comprising treating brain tissue with the composition of any one of claims 7-14.

16. The method according to claim 15, wherein the treatment of the brain tissue is carried out by spraying the composition in the form of a spray.

17. The method according to claim 15, wherein the treatment of the brain tissue is carried out after removal of the main necrotic focus of the tumor.

Images