Recombinant yeast strain for synthesizing aromatic compound, and construction method for and use of recombinant yeast strain
By gene editing and metabolic pathway modification of Saccharomyces cerevisiae QL35, a recombinant yeast strain was constructed, which solved the problems of insufficient yield and high production costs of aromatic compounds in the prior art, achieved efficient and low-cost aromatic compounds production, and maintained the stability of hereditary traits.
Patent Information
- Application Number
- PCT/CN2023/141696
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-14
- Filing Date
- 2023-12-25
- Publication Date
- 2025-06-19
AI Technical Summary
When fermenting and synthesizing aromatic compounds, the existing engineered strains have insufficient yield and high production costs. The genetic traits of industrial strains are unstable, and additional aromatic amino acids or gene expression inducers are required.
By gene editing Saccharomyces cerevisiae QL35, overexpressing gene 3DSD, and appropriate knockout and metabolic pathway modification, a recombinant yeast strain was constructed, which can efficiently synthesize aromatic compounds and reduce production costs when glucose is a carbon source.
High yield production of aromatic compounds is achieved, production costs are reduced, and genetic traits are maintained during long-term fermentation without the need for additional aromatic amino acids or gene expression inducers.
Smart Images

Figure CN2023141696_19062025_PF_FP_ABST
Abstract
Description
A recombinant yeast strain for synthesizing aromatic compounds, and its construction method and application Technical Field
[0001] The present invention relates to the technical field of synthetic biology, and in particular to a recombinant yeast strain for synthesizing aromatic compounds, a construction method and an application thereof. Background Art
[0002] Aromatic compounds are organic compounds containing benzene rings in their chemical molecules, including a series of compounds modified with functional groups such as alcohols and carboxyl groups attached to their side chains. For example, protocatechuic acid (Pca) and coumaric acid (Cou) not only possess antioxidant, antibacterial, and detoxifying properties but also have widespread applications in materials synthesis, feed production, food preservation, and other fields. Protocatechuic acid, as an intermediate, can be used to synthesize important organic chemical raw materials such as catechol, muconic acid, and adipic acid; coumaric acid, due to its strong conductivity, can be used in liquid crystal photosensitive materials. Furthermore, coumaric acid has extensive agricultural applications as a plant growth promoter and long-lasting fungicide. However, the extraction of aromatic compounds from natural resources is hampered by low production efficiency, cumbersome separation and purification steps, and the inability to produce them in large quantities, hindering the development of related industries.
[0003] In recent years, the production of aromatic compounds through microbial fermentation has attracted widespread attention due to its relatively low cost, high controllability, and freedom from production environment restrictions. While the engineered strains currently used in fermentation processes can produce relatively high concentrations of aromatic compounds, their yields need to be further improved. Furthermore, some industrial strains exhibit genetic instability due to factors such as plasmid expression or substrate feedback inhibition. Furthermore, the fermentation process requires the addition of additional aromatic amino acids or gene expression inducers to the culture medium, increasing industrial production costs.
[0004] Summary of the Invention
[0005] Based on this, the purpose of the present invention is to provide a recombinant yeast strain for synthesizing aromatic compounds and its construction method and application, aiming to reduce the production cost of fermentation synthesis of aromatic compounds by existing engineered strains and further increase the yield of such compounds.
[0006] The technical solutions of the present invention are as follows:
[0007] In a first aspect of the present invention, a recombinant yeast strain for synthesizing aromatic compounds is provided, wherein the recombinant yeast strain for synthesizing aromatic compounds is based on Saccharomyces cerevisiae QL35 and undergoes one of the following modifications (a) to (f):
[0008] (a) Overexpressed gene 3DSD;
[0009] (b) Overexpression of the 3DSD gene and knockout of the TKL1 and TKL2 genes;
[0010] (c) overexpression of the 3DSD gene and knockout of the TKL1, TKL2, and TAL1 genes; or, overexpression of the 3DSD gene and knockout of the TKL1, TKL2, TAL1, and NQM1 genes;
[0011] (d) overexpression of the gene 3DSD and knockout of genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2;
[0012] (e) overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the glyoxylate cycle genes ICL1 and MLS1 and the genes PCK1 and UdhA;
[0013] (f) Overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the glyoxylate cycle genes ICL1 and MLS1 and PCK1 and UdhA; and then performing adaptive evolution.
[0014] Optionally, the recombinant yeast strain for synthesizing aromatic compounds is based on Saccharomyces cerevisiae QL35 and is further transformed after the transformation and evolution of (f):
[0015] Knockout of AtPAL2, AtC4H, and AtATR2 genes, and overexpression of 3DSD gene; Knockout of FjTAL gene, and overexpression of 3DSD gene; or
[0016] The gene 3DSD was knocked out, and the genes AtATR2, AtC4H and AtATR2 were overexpressed.
[0017] Optionally, the gene 3DSD is a codon-optimized gene 3DSD, the nucleotide sequence of the codon-optimized gene 3DSD is as shown in SEQ ID NO: 1, or the nucleotide sequence of the codon-optimized gene 3DSD has at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 1.
[0018] Optionally, the gene UdhA is a codon-optimized gene UdhA, the nucleotide sequence of the codon-optimized gene UdhA is as shown in SEQ ID NO: 2, or the nucleotide sequence of the codon-optimized gene UdhA has at least 70% homology to the nucleotide sequence shown in SEQ ID NO: 2.
[0019] A second aspect of the present invention provides a method for constructing a recombinant yeast strain for synthesizing aromatic compounds, wherein the construction method comprises:
[0020] Using Saccharomyces cerevisiae QL35 as the chassis, perform gene editing using the CRISPR / Cas9 gene editing system according to one of the following (a) to (f):
[0021] (a) Overexpressed gene 3DSD;
[0022] (b) Overexpression of the 3DSD gene and knockout of the TKL1 and TKL2 genes;
[0023] (c) overexpression of the 3DSD gene and knockout of the TKL1, TKL2, and TAL1 genes; or, overexpression of the 3DSD gene and knockout of the TKL1, TKL2, TAL1, and NQM1 genes;
[0024] (d) overexpression of the gene 3DSD and knockout of genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2;
[0025] (e) overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the glyoxylate cycle genes ICL1 and MLS1 and the genes PCK1 and UdhA;
[0026] (f) Overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the glyoxylate cycle genes ICL1 and MLS1 and PCK1 and UdhA; and then performing adaptive evolution.
[0027] Optionally, the construction method further includes:
[0028] After the transformation and evolution of (f), the following transformations are performed:
[0029] Knockout of AtPAL2, AtC4H, and AtATR2 genes, and overexpression of 3DSD gene; Knockout of FjTAL gene, and overexpression of 3DSD gene; or
[0030] The gene 3DSD was knocked out, and the genes AtATR2, AtC4H and AtATR2 were overexpressed.
[0031] The third aspect of the present invention provides the use of the recombinant yeast strain for synthesizing aromatic compounds as described above and / or the recombinant yeast strain for synthesizing aromatic compounds obtained by the construction method as described above in synthesizing aromatic compounds.
[0032] A fourth aspect of the present invention provides a method for synthesizing an aromatic compound, wherein the recombinant yeast strain for synthesizing an aromatic compound as described above and / or the recombinant yeast strain for synthesizing an aromatic compound obtained by the construction method as described above is fermented to synthesize the aromatic compound.
[0033] Optionally, the aroma compound comprises protocatechuic acid and / or p-coumaric acid.
[0034] Optionally, the culture medium used for the fermentation includes glucose and / or ethanol.
[0035] Beneficial Effects: The present invention utilizes a metabolic pathway design and modification strategy, using Saccharomyces cerevisiae QL35 as a base for modification, to generate a recombinant yeast strain that overexpresses the gene 3DSD, capable of synthesizing aromatic compounds. Based on this, the metabolic pathways of the resulting recombinant yeast strain were modified to reshape a new pathway for synthesizing erythrose 4-phosphate, blocking the phosphoenolpyruvate decomposition pathway, strengthening the glyoxylate cycle, and indirectly activating the tricarboxylic acid cycle to meet the basic growth needs of the strain. This also reduces unnecessary carbon loss and energy consumption, driving carbon flow toward aromatic compound biosynthesis. To maintain growth, the recombinant yeast strain of the present invention must synthesize sufficient acetyl phosphate and convert it into acetyl-CoA for cellular utilization. This process also produces a large amount of aromatic compound synthesis substrate. To relieve substrate feedback inhibition, the recombinant yeast strain drives the aromatic compound synthesis pathway to achieve high yields, resulting in coupled yeast strain growth and product synthesis. The recombinant yeast strain provided by the present invention can synthesize aromatic compounds in high yields using glucose as a carbon source. Furthermore, the need for the addition of additional aromatic amino acids or gene expression inducers to the culture medium further reduces costs. Furthermore, the coupled strain maintains stable genetic traits during long fermentation periods. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] FIG1 is a diagram showing the transformation pedigree of the recombinant yeast strains for synthesizing aromatic compounds in an embodiment of the present invention.
[0037] FIG2 is a schematic diagram of the metabolic pathway of the recombinant yeast strain for synthesizing aromatic compounds in an embodiment of the present invention.
[0038] Figure 3 is a graph showing the results of evaluating the ability of strain Ar01 to synthesize protocatechuic acid and p-coumaric acid in Example 1 of the present invention, wherein A is a graph showing the statistical results of protocatechuic acid and p-coumaric acid production and growth OD values, and B is a graph showing the peaks of liquid chromatography analysis of protocatechuic acid and p-coumaric acid standards, and extracted and purified samples of fermentation broths of Saccharomyces cerevisiae QL35 and strain Ar01.
[0039] FIG4 is a graph showing the statistical results of protocatechuic acid and p-coumaric acid production and growth OD values of strains Ar02, Ar03, and Ar04 in Example 2 of the present invention.
[0040] FIG5 is a graph showing the results of evaluating the ability of strains Ar05, Ar06, and Ar07 to synthesize protocatechuic acid and p-coumaric acid in Example 2 of the present invention, wherein A is a graph showing the yield of protocatechuic acid and p-coumaric acid, and B is a graph showing the growth curve.
[0041] 6A is a statistical result graph of the protocatechuic acid and p-coumaric acid production and growth OD value of strain Ar08 in Example 3 of the present invention in different carbon source culture media, and B is a growth curve result graph of strains Ar08 and Ar04.
[0042] FIG7 is a graph showing the results of evaluating the ability of the evolved strains Evo1, Evo2, and Evo3 to synthesize protocatechuic acid and p-coumaric acid in Example 4 of the present invention, wherein A is a growth curve graph and B is a graph showing the statistical results of protocatechuic acid and p-coumaric acid production.
[0043] FIG8 is a graph showing the results of evaluating the ability of strains ME01 and ME02 to synthesize protocatechuic acid and p-coumaric acid in Example 5 of the present invention, wherein A is a statistical graph showing the production of protocatechuic acid and p-coumaric acid and the growth OD value, and B is a graph showing the growth curve.
[0044] FIG9 is a graph showing the statistical results of p-coumaric acid production and growth OD value of strain ME03 in Example 6 of the present invention. DETAILED DESCRIPTION
[0045] The present invention provides a recombinant yeast strain for synthesizing aromatic compounds, as well as a preparation method and application thereof. To clarify the objectives, technical solutions, and effects of the present invention, the present invention is described in further detail below. It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention.
[0046] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0047] In the present invention, the English abbreviations in standard font represent enzymes or proteins, and the English abbreviations in italics represent genes. For example, TKL1 represents transketolase, and TKL1 represents the gene encoding transketolase (i.e., transketolase gene);
[0048] NQM1 stands for transaldolase, and NQM1 stands for a gene encoding transaldolase (also known as a transaldolase gene).
[0049] The present invention provides a recombinant yeast strain for synthesizing aromatic compounds. The recombinant yeast strain for synthesizing aromatic compounds is based on Saccharomyces cerevisiae QL35, and the strain QL35 overexpresses a codon-optimized phosphoketolase (BbXFPK) gene from Bifidobacterium (i.e., gene BbXFPK, whose Genbank accession number is AY518216), and undergoes one of the following modifications (a) to (f):
[0050] (a) Overexpression of the gene 3DSD (i.e., protocatechuate synthase gene);
[0051] (b) Overexpression of the 3DSD gene and knockout of the TKL1 and TKL2 genes (TKL1 and TKL2 are transketolase genes);
[0052] (c) overexpressing the 3DSD gene and knocking out the TKL1, TKL2, and TAL1 genes (TAL1 is a transaldolase gene); or, overexpressing the 3DSD gene and knocking out the TKL1, TKL2, TAL1, and NQM1 genes (TAL1 and NQM1 are transaldolase genes);
[0053] (d) Overexpression of the 3DSD gene and knockout of the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes (PYK1 and PYK2 are pyruvate kinase genes);
[0054] (e) overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the glyoxylate cycle genes ICL1 and MLS1 (ICL1 and MLS1 are the isocitrate lyase gene and malate synthase gene, respectively), and PCK1 and UdhA (PCK1 and UdhA are the phosphoenolpyruvate carboxykinase gene and transhydrogenase gene, respectively);
[0055] (f) Overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the genes PCK1 and UdhA in the glyoxylate cycle pathway; and then performing adaptive evolution.
[0056] The embodiment of the present invention uses a metabolic pathway design and transformation strategy to transform Saccharomyces cerevisiae QL35 as a chassis to obtain a recombinant yeast strain that overexpresses 3DSD, which can synthesize aromatic compounds. Then, based on this, the metabolic pathway is transformed to obtain a recombinant yeast strain that reshapes the new pathway for Saccharomyces cerevisiae to synthesize erythrose 4-phosphate (E4P), blocks the phosphoenol pyruvate (PEP) decomposition pathway, strengthens the glyoxylate cycle pathway, and indirectly activates the tricarboxylic acid cycle to supply the basic needs of strain growth; at the same time, it reduces unnecessary carbon loss and energy consumption, and drives carbon flow to the synthesis of aromatic compounds. The recombinant yeast strain provided by the present invention can synthesize aromatic compounds with high yields using glucose as a carbon source, and does not require the addition of additional aromatic amino acids and gene expression inducers to the culture medium, which can further reduce costs. The details are as follows:
[0057] As shown in Figure 1, the recombinant yeast strain Ar01 was generated by transformation according to step (a). In the present invention, strain Ar01 was constructed by overexpressing 3DSD, capable of simultaneously synthesizing protocatechuic acid and p-coumaric acid. After fermentation, strain Ar01 produced 421.3 mg / L of protocatechuic acid and 120.8 mg / L of p-coumaric acid, respectively.
[0058] As shown in FIG1 , according to step (b), based on strain Ar01, genes TKL1 and TKL2 (Genbank accession numbers 856188 and 852414, respectively) were knocked out, and the resulting recombinant yeast strain was designated as strain Ar02.
[0059] As shown in FIG1 , in one modification method according to step (c), the gene TAL1 (Genbank accession number 851068) was knocked out based on strain Ar02, and the resulting recombinant yeast strain was designated as strain Ar03.
[0060] As shown in Figure 1, in another modification method according to (c), the NQM1 gene (Genbank accession number 852934) was knocked out from strain Ar03, resulting in a recombinant yeast strain designated as strain Ar04. Alternatively, strain Ar04 was derived from strain Ar01 by knocking out the genes TKL1, TKL2, TAL1, and NQM1. Strain Ar04 can only synthesize E4P, an essential substrate for aromatic compound metabolism, by cleaving fructose-6-phosphate (F6P) through the BbXFPK function overexpressed in the chassis strain QL35. Specifically, strain Ar04 can only synthesize E4P, an essential substrate for aromatic compound metabolism, through the BbXFPK pathway, and not through the non-oxidative pentose phosphate pathway. Specifically, as shown in Figure 2, wild-type Saccharomyces cerevisiae requires multiple steps in the non-oxidative pentose phosphate pathway to produce E4P, while the BbXFPK pathway requires only a single step from F6P to produce E4P. It can be seen that the strain Ar04 obtained by the transformation according to method (c) can shorten the steps of biosynthesis of aromatic compounds and reduce carbon loss.
[0061] In addition, as shown in Figure 2, the acetyl phosphate (AcP) product catalyzed by BbXFPK can be converted into acetyl coenzyme A (AcCoA) by phosphotransacetylase (CkPTA) from Clostridium kluyveri. Acetyl coenzyme A can enter the glyoxylate cycle to provide the substrate required for cell growth, thereby achieving the purpose of coupling aromatic compound synthesis and strain growth.
[0062] According to (d), the strain Ar04 was transformed by knocking out the genes PYK1 and PYK2. The resulting recombinant yeast strain was able to block the decomposition of PEP into pyruvate (Pyr), abolishing the competitive metabolic pathway for PEP synthesis.
[0063] As shown in Figure 1, in one modification method according to (e), the PYK1 and PYK2 genes were knocked out from strain Ar04, and the genes ICL1 and MLS1, as well as the genes PCK1 and UdhA, in the glyoxylate cycle pathway, were overexpressed to obtain a recombinant yeast strain coupled to aromatic compound synthesis and growth, designated as strain Ar08. In an embodiment of the present invention, as shown in Figure 2, by knocking out the PYK1 and PYK2 genes (Genbank accession numbers 851193 and 854529, respectively) in strain Ar04, the catalysis of PEP to pyruvate (Pyr) was prevented, thereby blocking the decomposition of PEP to pyruvate and abolishing the competitive metabolic pathway for PEP synthesis. The yeast strain Ar08 was constructed by simultaneously overexpressing the endogenous isocitrate lyase gene ICL1 (Genbank accession number 856794) and malate synthase gene MLS1 (Genbank accession number 855606), which are part of the glyoxylate cycle. This increased the expression levels of isocitrate lyase and malate synthase, strengthening the glyoxylate cycle. Intermediates in the pathway are transported to the mitochondria via transporters and enter the tricarboxylic acid (TCA) cycle. Furthermore, overexpression of the gene PCK1 (Genbank accession number 853972) increased the expression level of phosphoenolpyruvate carboxykinase (PCK1), recycling excess oxaloacetate in the cytoplasm and converting it to PEP, thereby relieving substrate feedback inhibition. Overexpression of the Escherichia coli (E. coli)-derived gene UdhA increased the expression level of transhydrogenase (UdhA), dynamically regulating the balance of NADPH and NADH in the recombinant yeast cells.
[0064] As shown in Figure 1, the recombinant yeast strain obtained by transformation and adaptive evolution according to (f) is denoted as strain Evo. Based on strain Ar08, the present invention improves the growth ability of the strain and increases the yield of aromatic compounds synthesized by the strain through adaptive laboratory evolution (adaptive evolution), thereby obtaining strain Evo (specifically Evo1, Evo2, and Evo3). The evolved strains Evo1, Evo2, and Evo3 undergo a mutation that inactivates hexokinase 2 (HXK2, the Genbank accession number of the HXK2 gene is 852639, and the nucleotide sequence is shown in SEQ ID NO: 3), thereby losing the phosphorylation function of glucose, thereby eliminating the glucose effect during the growth of Saccharomyces cerevisiae. Compared with strain Ar08, Evo1 has stronger growth ability and increased aromatic compound production. Evo1 can be a frameshift mutation formed by deleting the 24th base "A" of the gene HXK2. Evo2 may be a frameshift mutation in which 20 bases (sequence: GTGCTAGAGCTGCTAGATTG) are inserted after base 1185 of the gene HXK2. Evo3 may be a frameshift mutation in which base 82 of the gene HXK2 is mutated from "G" to "T" to obtain the stop codon TAG.
[0065] In some embodiments, the Evo2 strain is obtained by transformation and evolution of Saccharomyces cerevisiae QL35 as a chassis, wherein the recombinant yeast strain is further transformed as follows based on the Evo2 strain:
[0066] Knockout of genes AtPAL2 (phenylalanine ammonia lyase gene), AtC4H (cinnamate 4-hydroxylase gene) and AtATR2 (NADP + -cytochrome P450 reductase gene), and simultaneously overexpress the gene 3DSD, that is, integrate the 3DSD gene at the site of p-coumaric acid synthesis pathway 1; then, knock out the gene FjTAL (tyrosine ammonia lyase gene) and simultaneously overexpress the gene 3DSD, that is, integrate the 3DSD gene at the site of p-coumaric acid synthesis pathway 2; or,
[0067] The 3DSD gene was knocked out and the AtPAL2, AtC4H and AtATR2 genes were overexpressed.
[0068] Through the transformation of this embodiment, a strain that produces a single aromatic compound can be constructed. Based on the Evo2 strain obtained by transformation and evolution (f), the genes AtPAL2, AtC4H, and AtATR2 are knocked out, and the gene 3DSD is overexpressed; then, the gene FjTAL is knocked out, and the gene 3DSD is overexpressed to construct a strain that produces only protocatechuic acid. Based on the Evo2 strain obtained by transformation and evolution (f), the gene 3DSD is knocked out, and the genes AtPAL2, AtC4H, and AtATR2 are overexpressed to construct a strain that produces only p-coumaric acid.
[0069] As shown in Figure 1, after the transformation according to this embodiment, the resulting recombinant yeast strain is designated as strain ME02 or ME03. Specifically, as shown in Figure 2, based on strain Evo (specifically, Evo2), AtPAL2, AtC4H, and AtATR2 are knocked out, and the gene 3DSD is overexpressed. Furthermore, the gene FjTAL is knocked out, and the gene 3DSD is overexpressed, i.e., p-coumaric acid synthesis pathways 1 and 2 are knocked out to obtain strain ME02 (which can also be understood as knocking out coumaric acid synthesis pathway 1 to obtain strain ME01, and then knocking out p-coumaric acid synthesis pathway 2 to obtain strain ME02 based on strain ME01). This strain can only synthesize protocatechuic acid, with a yield of 2.02 g / L (4.8 times the protocatechuic acid yield of strain Ar01) in shake flask fermentation, and the protocatechuic acid yield is increased to 20.5 g / L in parallel bioreactor fermentation. Based on strain Evo2, the 3DSD gene was knocked out, thereby eliminating the protocatechuic acid synthesis pathway. Meanwhile, the AtPAL2, AtC4H, and AtATR2 genes were overexpressed to generate strain ME03, which can only synthesize p-coumaric acid, with a yield of 690 mg / L in shake flask fermentation (5.7 times that of strain Ar01). The recombinant yeast strain provided by this invention uses glucose as a carbon source, reducing production costs and maintaining genetic stability during fermentation.
[0070] In some embodiments, the gene 3DSD is a codon-optimized gene 3DSD, the nucleotide sequence of the codon-optimized gene 3DSD is as shown in SEQ ID NO: 1, or the nucleotide sequence of the codon-optimized gene 3DSD has at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 1.
[0071] In some embodiments, the gene UdhA is a codon-optimized gene UdhA, the nucleotide sequence of the codon-optimized gene UdhA is shown in SEQ ID NO: 2 (Genbank accession number of wild-type UdhA is 948461), or the nucleotide sequence of the codon-optimized gene UdhA has at least 70% homology to the nucleotide sequence shown in SEQ ID NO: 2.
[0072] An embodiment of the present invention further provides a method for constructing a recombinant yeast strain, wherein the construction method comprises:
[0073] Using Saccharomyces cerevisiae QL35 as the chassis, perform gene editing using the CRISPR / Cas9 gene editing system according to one of the following (a)-(g):
[0074] (a) Overexpressed gene 3DSD;
[0075] (b) Overexpression of the 3DSD gene and knockout of the TKL1 and TKL2 genes;
[0076] (c) overexpression of the 3DSD gene and knockout of the TKL1, TKL2, and TAL1 genes; or, overexpression of the 3DSD gene and knockout of the TKL1, TKL2, TAL1, and NQM1 genes;
[0077] (d) overexpression of the gene 3DSD and knockout of genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2;
[0078] (e) overexpressing the gene 3DSD, knocking out the genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2, and overexpressing at least one of the genes ICL1, MLS1, PCK1, and UdhA;
[0079] (f) overexpressing the 3DSD gene, knocking out the TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2 genes, and overexpressing at least one of the ICL1, MLS1, PCK1, and UdhA genes; and then performing adaptive evolution;
[0080] (g) overexpressing the gene 3DSD, knocking out the genes TKL1, TKL2, TAL1, NQM1, PYK1 and PYK2, and overexpressing the genes ICL1, MLS1, PCK1 and UdhA; then performing adaptive evolution; knocking out the genes AtPAL2, AtC4H and AtATR2 in the evolved strain, and overexpressing the gene 3DSD; knocking out the gene FjTAL, and overexpressing the gene 3DSD; or,
[0081] The 3DSD gene was knocked out in the evolved strain, while the AtATR2, AtC4H and AtATR2 genes were overexpressed.
[0082] The embodiment of the present invention uses a metabolic pathway design and transformation strategy to transform Saccharomyces cerevisiae QL35 as a chassis to obtain a recombinant yeast strain that overexpresses 3DSD, which can synthesize aromatic compounds. Then, based on this, the metabolic pathway is transformed to obtain a recombinant yeast strain that reshapes a new pathway for synthesizing E4P, blocks the PEP decomposition pathway, strengthens the glyoxylate cycle pathway, and indirectly activates the tricarboxylic acid cycle to supply the basic needs of strain growth; at the same time, it reduces unnecessary carbon loss and energy consumption, and drives carbon flow to the synthesis of aromatic compounds. The recombinant yeast strain provided by the present invention can synthesize aromatic compounds (such as protocatechuic acid and coumaric acid) in high yields using glucose as a carbon source, and at the same time, there is no need to add additional aromatic amino acids (as substrates) or gene expression inducers to the culture medium, which can further reduce costs. In addition, the growth-coupled recombinant yeast strain can maintain genetic trait stability during the fermentation process.
[0083] Of course, the gene knockout method used in this embodiment can also be other technologies that can achieve the same effect, such as gene mutation, RNA interference technology, low-intensity promoter replacement, etc.
[0084] The present invention also provides the use of the recombinant yeast strain for synthesizing aromatic compounds as described above in the present invention in synthesizing aromatic compounds.
[0085] The embodiments of the present invention also provide the use of a recombinant yeast strain for synthesizing aromatic compounds obtained by the construction method described above in the embodiments of the present invention in synthesizing aromatic compounds.
[0086] The present invention also provides the use of the recombinant yeast strain for synthesizing aromatic compounds as described above in the present invention and the recombinant yeast strain for synthesizing aromatic compounds obtained by the construction method described above in the present invention in synthesizing aromatic compounds.
[0087] The recombinant yeast strain for synthesizing aromatic compounds in the embodiment of the present invention can produce aromatic compounds during the fermentation process.
[0088] An embodiment of the present invention further provides a method for synthesizing an aromatic compound, which comprises the steps of:
[0089] The aromatic compound is synthesized by fermenting the recombinant yeast strain for synthesizing aromatic compounds described above in the embodiments of the present invention, or by fermenting the recombinant yeast strain for synthesizing aromatic compounds obtained by the construction method described above in the embodiments of the present invention, or by fermenting the recombinant yeast strain for synthesizing aromatic compounds described above in the embodiments of the present invention and the recombinant yeast strain for synthesizing aromatic compounds obtained by the construction method described above in the embodiments of the present invention. The embodiments of the present invention provide a simple method for synthesizing aromatic compounds, which can be achieved by fermenting the recombinant yeast strain for synthesizing aromatic compounds described above in the embodiments of the present invention.
[0090] In some embodiments, the aromatic compounds include, but are not limited to, protocatechuic acid and / or p-coumaric acid. In other words, among the recombinant yeast strains derived from Saccharomyces cerevisiae QL35 by engineering different metabolic pathways, some can simultaneously synthesize protocatechuic acid and p-coumaric acid, some can synthesize only protocatechuic acid, some can synthesize only p-coumaric acid, and some can synthesize other aromatic compounds.
[0091] In some embodiments, the culture medium used in the fermentation includes glucose and / or ethanol (glucose and / or ethanol as a carbon source). In some specific embodiments, the culture medium includes, but is not limited to, rich medium (YP) containing glucose and / or ethanol, synthetic complete medium (SC) containing glucose and / or ethanol, and inorganic salt medium (Delft) containing glucose and / or ethanol. The recombinant yeast strain provided by the present invention uses glucose or ethanol as a carbon source, which is relatively low in cost.
[0092] The following describes it in detail through specific examples.
[0093] The genotype of Saccharomyces cerevisiae QL35 used in the following examples is:
[0094] MATa ura3-52 can1Δ::CAS9-natNT2 TRP1 LEU2 HIS3 gpp1ΔXII-2::(GPM1p-AtPAL2-FBA1t)+(TDH3p-AtC4H-CYC1t)+(tHXT7p-AtATR2-pYX212t)+(PGK1p-CYB5-ADH1t)X-3::(TPI1p-EcaroL-pYX212t)+(ADH1t-ARO7 G141S -TEF1p)+(PGK1p-ARO4 K229L -CYC1t)X-4::(CYC1t-ARO1-TPI1p)+(TDH3p-ARO2-ADH1t)+(TDH2t-ARO3 K222L-TEF1p)X-2::(GPM1p-PHA2-CYC1t)XI-3::(TEF1p-FjTAL-TDH2t) + (FBA1t-MtPDH1-TDH3p) The reference is (Liu Q, Yu T, Li X, et al. Rewiring carbon metabolism in yeast for high level production of aromatic chemicals. Nature communications, 2019, 10.1:1-13.).
[0095] The recombinant yeast strains for synthesizing aromatic compounds in the following examples were all constructed based on the CRISPR / Cas9 gene editing technology, with reference to the literature (Mans R, van Rossum HM, Wijsman M, et al. CRISPR / Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Research, 2015, 15.1).
[0096] Unless otherwise specified in the following examples, all materials used are commercially available products.
[0097] Example 1
[0098] (1) Using Saccharomyces cerevisiae QL35 as the chassis, we overexpressed the codon-optimized gene 3DSD (SEQ ID NO: 1) to construct a recombinant yeast strain, Ar01, capable of simultaneously synthesizing protocatechuic acid and p-coumaric acid. The specific steps are as follows:
[0099] Reference (Mikkelsen MD, Buron LD, Salomonsen B, et al.Microbial production of indolylglucosinolate through engineering of a multi-gene pathway in a versatile yeast expression platform.Metabolic engineering, 2012, 14.2: 104-111.) Saccharomyces cerevisiae XI-1 site-specific recognition gRNA primer (GAAAGATAAATGATCGCAATGCGATGTTAGTTTAGGTTTTAGAGCTAGAAATAGCAAGT, underlined to specifically recognize the site of Saccharomyces cerevisiae chromosome) was designed and used to amplify 2 μm fragments. The reaction system is the reaction system 1 shown in Table 1 below.
[0100] Table 1. Reaction system 1
[0101] The pROS10 plasmid backbone was amplified by PCR using primers F and R (primer F and primer R were both GATCATTTATCTTTCACTGCGGAGAAG). The reaction system was the reaction system 2 shown in Table 2 below.
[0102] Table 2. Reaction system 2
[0103] The 2 μm fragments amplified by PCR and purified from the product and the pROS10 plasmid backbone were used to construct the pROS10 guide RNA plasmid specified in the present invention (which can be denoted as pROS10-xxx, where xxx represents the recognition site). For example, the XI-1 site was used as the recognition site. Taking the XI-1 site as an example, the wild-type Saccharomyces cerevisiae genome was used as a PCR amplification template, and the XI-1 upstream repair fragment was amplified using primers XI-1 UP F (ATTTGTGTGAAGGAATAGTGACG) and XI-1UP-(link xi-1dw) R (GATTTGCCAATGCCAAGAAACAATGGGCTTGGTATTCCG); the XI-1 downstream repair fragment was amplified using primers XI-1DW (link xi-1 up) F (CGGAATACCAAGCCCATTGTTTCTTGGCATTGGCAAATCTCT) and XI-1 DW R (AAGAGCCGAGTCCCCATCAG). Add 50 ng of each upstream and downstream fragments and perform upstream and downstream fragment fusion PCR with the above-mentioned primers XI-1 UP F and XI-1 DW R (see Microbial production of indolylglucosinolate through engineering of a multi-gene pathway in a versatile yeast expression platform).
[0104] The overexpression gene module fusion is an upstream repair fragment, a promoter (using a universal promoter, TDH3p, CCW12p, TEF1p, tHXK7p and TDH1p are selected in this example), a gene, a terminator (using a universal terminator, ADH1t, CYC1t, TDH2t, PYK1t, DIT1t, FBA1t and TPS1t are selected in this example) and a complete expression cassette of the downstream repair fragment, which is added to the PCR reaction system at a molar concentration ratio of 1:3:5:3:1. No primers are added to the PCR reaction system, and the first round of PCR is performed according to the procedure shown in Table 3 below. The first round PCR product is used as a template, primers XI-1 UP F and primers XI-1 DW R are added, and a second round of PCR amplification is performed according to the following reaction procedure.
[0105] Table 3. PCR program
[0106] After the purification of the PCR amplification product, the repair fragment (upstream and downstream fragment fusion) or the gene overexpression module (upstream fragment-promoter-gene-terminator-downstream fragment fusion) and the pROS10 guide RNA plasmid were operated according to the following Saccharomyces cerevisiae chemical reagent transformation method (refer to the literature Gietz RD, Schiestl RH. High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method. Nature protocols, 2007, 2.1: 31-34.) to obtain a recombinant yeast strain. The specific steps are as follows: Pick fresh monoclonal yeast to 2mL YPD medium (10g / L yeast extract, 20g / L peptone, 20g / L glucose) and culture overnight in a shaker at 30°C and 200rpm. Take an appropriate amount of seed bacterial solution and transfer it to 20mL YPD medium to make the initial diluted bacterial solution concentration reach OD 600 =0.2, and cultured in a shaking incubator at 30°C and 200 rpm until the bacterial solution concentration reached OD 600 =0.6. The culture medium was removed by centrifugation, and the cell pellet was resuspended in 1 mL of sterile deionized water. After centrifugation at 3000 g for 1 minute, the supernatant was removed and the cell pellet was resuspended in 1 mL of 0.1 M lithium acetate. After centrifugation at 3000 g for 1 minute, the supernatant was removed to obtain yeast competent cells. The yeast competent cells were transformed into recombinant yeast using the Saccharomyces cerevisiae chemical reagent transformation method, and each transformation system was aliquoted into OD values according to the transformation requirements. 600 =1, and obtained strain Ar01 (the corresponding recombinant yeast strains were obtained by referring to the above method in the following examples). The yeast chemical reagent transformation system is shown in Table 4 below.
[0107] Table 4. Yeast chemical reagent transformation system
[0108] (2) In order to evaluate the ability of the modified strains to synthesize protocatechuic acid and p-coumaric acid, Saccharomyces cerevisiae QL35 and strain Ar01 were fermented in shake flasks for evaluation. The specific steps of the evaluation method are as follows: a single clone was picked from the YPD plate and cultured in 2 mL DelftD (2%) medium (yeast inorganic salt medium with 2% glucose as the carbon source, references see Jensen NB, Strucko T, Kildegaard KR, et al. EasyClone: method for iterative chromosomal integration of multiple genes Saccharomyces cerevisiae. FEMS yeast research, 2014, 14.2: 238-248) to culture the seed bacterial liquid. Take an appropriate amount of seed bacterial liquid and transfer it to 20 mL DelftD (2%) medium to make the initial inoculation bacterial liquid OD 600 = 0.2, 30 ° C, 200 rpm shake flask culture. After 4 days of fermentation, 0.5 mL of the bacterial solution was added with an equal volume of 100% ethanol, and the mixture was thoroughly shaken in an oscillator at 2000 rpm for 10 min. Then, it was centrifuged at 13000 rpm for 10 min. The supernatant was filtered through a 0.22 μm filter membrane and tested by liquid chromatography-mass spectrometry for quantitative analysis.
[0109] The quantitative analysis method is as follows: The liquid chromatography mass spectrometer uses a Phenomenex Kinetex C18 column (100×2.1mm, particle size 2.6μm), the column oven is 30°C, and the injection volume is 2μL. Mobile phase A: deionized water containing 0.1% formic acid, mobile phase B: acetonitrile containing 0.1% formic acid, and the mobile phase flow rate is 0.2mL / min. The mass spectrometer electrospray voltage is set to 3.0kV, the carrier gas is N2 (purity greater than 99%), the flow rate is 120L / h, and the drying gas temperature is 400°C. The target product (protocatechuic acid charge-to-mass ratio is [MH]) is detected in ESI negative ion mode. — =153.1, the charge-to-mass ratio of p-coumaric acid is [MH] — =163.1).
[0110] The statistical results of the production of the two aromatic compounds are shown in FIG3 . The quantitative production of protocatechuic acid and p-coumaric acid in the fermentation product of strain Ar01 is 421.3 mg and 120.8 mg per liter of fermentation broth, respectively, recorded as 421.3 mg / L and 120.8 mg / L (the mg / L in the yield evaluation results of the present invention refers to the number of mg of protocatechuic acid or p-coumaric acid per liter of fermentation broth).
[0111] In the following Examples 2-3, referring to the method of Example 1, the primers shown in Table 5 were used to construct the pROS10 guide RNA plasmid for knocking out the corresponding gene.
[0112] Table 5. Primer table
[0113] The underline indicates the 20-base region specifically recognized in the yeast genome.
[0114] Example 2 Knockout of the non-oxidative pentose phosphate pathway to reshape the E4P metabolic pathway
[0115] Referring to Example 1, using the primers in Table 5, pROS10 guide RNA plasmids were constructed to knock out the genes TKL1, TKL2, TAL1, and NQM1 in the non-oxidative pentose phosphate pathway. Using the Ar01 strain described in Example 1 as the starting strain, strain Ar02 was constructed by knocking out the TKL1 and TKL2 genes; strain Ar03 was constructed by knocking out the TKL1, TKL2, and TAL1 genes; and strain Ar04 was constructed by knocking out the TKL1, TKL2, TAL1, and NQM1 genes.
[0116] Strain Ar04 utilizes the BbXFPK pathway rather than the non-oxidative pentose phosphate pathway to synthesize E4P, reducing E4P futile recycling. This reconstructed metabolic pathway allows F6P to directly generate E4P, synthesizing 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP), which then enters the shikimate metabolic pathway. Following the evaluation method described in Example 1, strains Ar02, Ar03, and Ar04 were fermented in yeast mineral medium for four days. Their ability to synthesize protocatechuic acid and p-coumaric acid was evaluated, and the results are shown in Figure 4. The yields of protocatechuic acid and p-coumaric acid in the fermentation product of strain Ar02 were 196.28 mg / L and 82.36 mg / L, respectively; the yields of protocatechuic acid and p-coumaric acid in the fermentation product of strain Ar03 were 186.96 mg / L and 72.35 mg / L, respectively; the yields of protocatechuic acid and p-coumaric acid in the fermentation product of strain Ar04 were 179.96 mg / L and 89.47 mg / L, respectively.
[0117] Referring to the evaluation method in Example 1, strain Ar04 was deleting the BbXFPK gene to obtain strain Ar05. Subsequently, a blank plasmid was overexpressed in strain Ar05 to obtain strain Ar06, and a BbXFPK plasmid was overexpressed in strain Ar05 to obtain strain Ar07. Strains Ar05, Ar06, and Ar07 were fermented in shake flasks in SC medium (synthetic complete medium) lacking three aromatic amino acids (phenylalanine, tyrosine, and tryptophan). Strain Ar05 was also fermented in SC medium containing these three aromatic amino acids for four days, and aromatic compound production was evaluated. The results are shown in Figure 5 . It can be seen that strain Ar05, which lacks both the non-oxidative pentose phosphate pathway and the BbXFPK pathway, is unable to grow in SC medium. However, by supplementing the three aromatic amino acids (3AA) or re-supplementing BbXFPK, the recombinant strains (Ar05 + 3AA and Ar07 in Figure 5 ) regained growth ability. It was further demonstrated that strain Ar04 could only rely on heterologous overexpression of BbXFPK to maintain cell growth and synthesize metabolites.
[0118] Example 3 Knockout of PYK1 and PYK2 genes to increase PEP synthesis flux
[0119] Referring to the method in Example 1, the primers in Table 5 were used to construct the pROS10 guide RNA plasmid for knocking out the PYK1 and PYK2 genes. Based on strain Ar04 obtained in Example 2, the PYK1 and PYK2 genes, which are involved in the conversion of PEP to pyruvate, were knocked out. Specifically, the following steps were performed: knocking out the PYK1 gene while simultaneously overexpressing the endogenous Saccharomyces cerevisiae genes ICL1, MLS1, and PCK1; and knocking out the PYK2 gene while simultaneously overexpressing the codon-optimized Escherichia coli gene UdhA (SEQ ID NO: 2), resulting in strain Ar08.
[0120] Referring to the evaluation method of Example 1, strain Ar08 was fermented in YPD (2% glucose as a carbon source) medium and YPED (2% ethanol and 0.2% glucose as a mixed carbon source) medium to evaluate the ability of Ar08 to synthesize protocatechuic acid and p-coumaric acid. The results of the production of protocatechuic acid and p-coumaric acid are shown in Figure 6A (which is the result of 4 days of fermentation). In addition, strains Ar04 and Ar08 were tested for their growth ability under YPD (2% glucose as a carbon source) medium conditions, and their growth curves are shown in Figure 6B. It can be seen that strain Ar08 cannot grow normally when glucose is used as a carbon source, mainly because the key endogenous yeast genes related to its growth (TKL1, TKL2, TAL1, NQM1, PYK1 and PYK2) have been knocked out.
[0121] Example 4 Improving the growth ability of strain Ar08 by adaptive evolution
[0122] Three monoclones of strain Ar08 obtained in Example 3 were taken and adaptively evolved respectively. The specific operation is as follows: the above-mentioned strain uses a rich medium with a mixed carbon source of ethanol and glucose (2% ethanol and 0.2% glucose are added to YP) as the starting medium. As the phenotype of the evolved strain changes, the amount of ethanol is gradually reduced and the percentage of glucose is increased for subculture. When the evolved strain no longer continues to grow in a rich medium with glucose as the carbon source (2% glucose is added to YP), it is switched to an inorganic salt medium containing 2% glucose (2% glucose is added to Delft) for subculture. The evolutionary process starts from a rich medium and gradually increases the growth environment of the strain by adjusting the medium conditions. In this process, in order to maintain growth, the strain enriches mutations that are beneficial to growth, thereby achieving the effect of adaptive evolution. Finally, three strains, Evo1, Evo2 and Evo3, evolved, and then the whole genomes of Evo1, Evo2 and Evo3 were resequenced. The above three strains all had HXK2 gene mutations. Among them, Evo1 lost its function after the 24th base "A" was deleted, forming a frameshift mutation; Evo2 lost its function after the 1185th base was inserted, forming a frameshift mutation; Evo3 could not express the complete HXK2 protein after the 82nd base was mutated from "G" to "T" to obtain the termination codon TAG.
[0123] Referring to the evaluation method of Example 1, the evolved strains were evaluated by shake flask fermentation using yeast inorganic salt medium. The growth ability of the evolved strains is shown in Figure 7A, and the statistical results of the aromatic compound production are shown in Figure 7B (which are the results of 4 days of fermentation). It can be seen that Evo1, Evo2 and Evo3 have stronger growth ability and the ability to synthesize aromatic compounds than Ar08. The reason is that the gene HXK2 mutant strains Evo1, Evo2 and Evo3 have lost the activity of phosphorylating glucose, thereby eliminating the glucose effect of the evolved strains. Among them, Evo2 is the strain with the highest production of two aromatic compounds (protocatechuic acid and p-coumaric acid).
[0124] Example 5 Construction of a cell factory for high production of a single aromatic compound
[0125] Referring to the method of Example 1, using the primers in Table 5, based on Evo2 of Example 4, by knocking out one site of the p-coumaric acid synthesis pathway (i.e., knocking out the genes AtPAL2, AtC4H, and AtATR2) and adding one copy of 3DSD, the strain ME01 was transformed into a strain that only produces protocatechuic acid. Based on the ME01 strain, the p-coumaric acid synthesis pathway site 2 was knocked out (i.e., the gene FiTAL was knocked out) and one copy of 3DSD was added to obtain the ME02 strain (with a total of three copies of 3DSD). In the strain Evo2, 3DSD was knocked out, and the genes AtPAL2, AtC4H, and AtATR2 were overexpressed at the same time, abolishing the protocatechuic acid synthesis pathway, and transformed into a strain that can only produce p-coumaric acid, obtaining the strain ME03.
[0126] Following the evaluation method described in Example 1, strains Evo2, ME01, and ME02 were evaluated for their ability to produce aroma compounds through shake flask fermentation using yeast mineral salt medium. The statistical results for protocatechuic acid production are shown in Figure 8A (results from 4 days of fermentation). Strain ME02 produced only protocatechuic acid at a yield of 2.02 g / L (4.8 times that of strain Ar01). The yield and dry cell weight of strain ME02 in parallel bioreactor experiments are shown in Figure 8B.
[0127] According to the evaluation method in Example 1, strains Ev02 and ME03 were shake-flask fermented for 4 days to evaluate their ability to synthesize aromatic compounds. The results are shown in Figure 9. It can be seen that they can only synthesize p-coumaric acid with a yield of 690 mg / L (5.7 times the yield of strain Ar01).
[0128] In summary, the present invention reshapes the yeast's E4P synthesis pathway, blocks the PEP decomposition pathway, and strengthens the glyoxylate cycle to indirectly activate the TCA cycle, which provides the basic growth requirements of the strain. This also reduces unnecessary carbon loss and energy consumption, driving carbon flow toward aromatic compound biosynthesis. The recombinant strain improved aromatic compound production through adaptive evolution and discovered the molecular mechanism by which HXK2 inactivation can enhance aromatic compound synthesis. Ultimately, a recombinant yeast strain chassis cell capable of sustained and stable aromatic compound production was constructed.
[0129] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.
Claims
1. A recombinant yeast strain for synthesizing aromatic compounds, characterized in that, The recombinant yeast strain for synthesizing aromatic compounds uses Saccharomyces cerevisiae QL35 as the chassis and is modified in one of the following (a) to (f): (a) Overexpress the gene 3DSD; (b) Overexpress the gene 3DSD and knockout the genes TKL1 and TKL2; (c) Overexpress the gene 3DSD and knockout the genes TKL1, TKL2, and TAL1; or, overexpress the gene 3DSD and knockout the genes TKL1, TKL2, TAL1, and NQM1; (d) Overexpress the gene 3DSD and knockout the genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2; (e) Overexpress the gene 3DSD, knockout the genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2, and overexpress at least one of the genes ICL1 and MLS1 on the glyoxylate cycle pathway and the genes PCK1 and UdhA; (f) Overexpress the gene 3DSD, knockout the genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2, and overexpress at least one of the genes ICL1 and MLS1 on the glyoxylate cycle pathway and the genes PCK1 and UdhA; then perform adaptive evolution.
2. The recombinant yeast strain for synthesizing aromatic compounds according to claim 1, characterized in that, After the recombinant yeast strain for synthesizing aromatic compounds using Saccharomyces cerevisiae QL35 as the chassis is modified and evolved according to (f), it is further modified as follows: Knockout the genes AtPAL2, AtC4H, and AtATR2, and simultaneously overexpress the gene 3DSD; knockout the gene FjTAL, and simultaneously overexpress the gene 3DSD; or, Knockout the gene 3DSD, and simultaneously overexpress the genes AtATR2, AtC4H, and AtATR2.
3. The recombinant yeast strain for synthesizing aromatic compounds according to claim 1, characterized in that, The gene 3DSD is the codon-optimized gene 3DSD, and the nucleotide sequence of the codon-optimized gene 3DSD is as shown in SEQ ID NO: 1 or the nucleotide sequence of the codon-optimized gene 3DSD has at least 70% homology with the nucleotide sequence shown in SEQ ID NO:
1.
4. The recombinant yeast strain for synthesizing aromatic compounds according to claim 1, characterized in that, The gene UdhA is the codon-optimized gene UdhA, and the nucleotide sequence of the codon-optimized gene UdhA is as shown in SEQ ID NO: 2 or the nucleotide sequence of the codon-optimized gene UdhA has at least 70% homology with the nucleotide sequence shown in SEQ ID NO:
2.
5. A method for constructing a recombinant yeast strain for synthesizing aromatic compounds, characterized in that, The construction method includes: Using Saccharomyces cerevisiae QL35 as the chassis, and performing gene editing on the strain according to one of the following (a) to (f) using the CRISPR / Cas9 gene editing system: (a) Overexpress the gene 3DSD; (b) Overexpress the gene 3DSD and knockout the genes TKL1 and TKL2; (c) Overexpress the gene 3DSD and knockout the genes TKL1, TKL2, and TAL1; or, overexpress the gene 3DSD and knockout the genes TKL1, TKL2, TAL1, and NQM1; (d) Overexpress the gene 3DSD and knockout the genes TKL1, TKL2, TAL1, NQM1, PYK1, and PYK2; (e) Overexpress the gene 3DSD, knockout the genes TKL1, TKL2, TAL1, NQM1, PYK1 and PYK2, and overexpress at least one of the genes ICL1 and MLS1 on the glyoxylate cycle pathway and the genes PCK1 and UdhA; (f) Overexpress the gene 3DSD, knockout the genes TKL1, TKL2, TAL1, NQM1, PYK1 and PYK2, and overexpress at least one of the genes ICL1 and MLS1 on the glyoxylate cycle pathway and the genes PCK1 and UdhA; then perform adaptive evolution.
6. The construction method according to claim 5, characterized in that, The construction method further includes: After the modification and evolution in (f), perform the following modifications: Knockout the genes AtPAL2, AtC4H and AtATR2, and simultaneously overexpress the gene 3DSD; knockout the gene FjTAL, and simultaneously overexpress the gene 3DSD; or, Knockout the gene 3DSD, and simultaneously overexpress the genes AtPAL2, AtC4H and AtATR2.
7. Use of the recombinant yeast strain for synthesizing aromatic compounds according to any one of claims 1-4 and / or the recombinant yeast strain for synthesizing aromatic compounds obtained by using the construction method according to any one of claims 5-6 in the synthesis of aromatic compounds.
8. A method for synthesizing an aromatic compound, characterized in that, It includes the steps: Ferment the recombinant yeast strain for synthesizing aromatic compounds according to any one of claims 1-4 and / or the recombinant yeast strain for synthesizing aromatic compounds obtained by using the construction method according to any one of claims 5-6 to synthesize the aromatic compound.
9. The synthesis method according to claim 8, characterized in that,The aromatic compound includes protocatechuic acid and / or p-coumaric acid.
10. The synthesis method according to claim 8, characterized in that, The culture medium used for the fermentation includes glucose and / or ethanol.
Citation Information
Patent Citations
Compositions and methods for the biosynthesis of vanillin or vanillin beta-d-glucoside
CN105063104A
Improved selectivity of the production of vanilloids in a recombinant unicellular host
CN106574269A
Saccharomyces cerevisiae engineering bacteria and application thereof in preparation of protocatechuic acid
CN113234611A
Method of producing a low molecular weight organic compound in a cell
US20060275877A1