Duplex specific PCR assays for the detection of adulteration with cow's milk in goat and sheep dairy products
A duplex specific Touchdown PCR method effectively addresses the challenge of detecting cow's milk adulteration in goat and sheep dairy products by using species-specific primers and a temperature reduction protocol, achieving sensitive and specific detection even at low adulteration levels.
Patent Information
- Application Number
- PCT/EP2024/085574
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-11
- Filing Date
- 2024-12-11
- Publication Date
- 2025-06-19
AI Technical Summary
Existing methods for detecting adulteration of goat and sheep dairy products with cow's milk are limited by low sensitivity and unsuitability for heat-treated materials, leading to misclassification and nonspecific product formation due to high DNA sequence homology among ruminant species.
A duplex specific PCR (Touchdown PCR) method is developed using species-specific primers for bovine, sheep, and goat DNA, which employs an initial high annealing temperature followed by progressive reduction, allowing for precise detection of cow's milk adulteration in goat and sheep dairy products even at 1% concentration.
The method achieves sensitive and specific detection of cow's milk adulteration in goat and sheep dairy products, with melting analysis confirming the presence of two DNA targets, thereby ensuring accurate identification and quantification of adulteration.
Smart Images

Figure EP2024085574_19062025_PF_FP_ABST
Abstract
Description
[0001] DUPLEX SPECIFIC PCR ASSAYS FOR THE DETECTION OF ADULTERATION
[0002] WITH COW'S MILK IN GOAT AND SHEEP DAIRY PRODUCTS
[0003] Technical field
[0004] The current invention belongs to the field of biotechnology and specifically refers to a PCR amplification detection method suitable for the detection of adulteration with cow's milk in goat and sheep dairy products.
[0005] Background
[0006] Milk is the most consumed liquid food in the world due to its high nutritional value, organoleptic properties, and relatively low cost. However, in recent decades, milk has been found to be the fourth most vulnerable product to food adulteration due to its lower price and high seasonal availability. Commercial adulteration includes mixing expensive, high-quality milk such as buffalo, sheep, and goat milk with cow milk, which is cheaper and seasonally available (Giglioti et al., 2022). Assessing the authenticity of dairy products is important not only from an economic perspective, but also because of consumers' medical requirements (e.g., allergies to certain milk proteins), religious practices, or other personal choices (Ortea et al., 2016). Another important issue is the protection of the characteristics and reputation of traditional cheeses with Protected Designation of Origin (PDO) and Protected Geographical Indication (PGI), as described in Commission Regulation (EC) 1151 / 2012, which requires milk from certain species and / or in certain quantities (Kritikou et al., 2022, Kastanos et al., 2022, Tsakali et al., 2019).
[0007] In an effort to overcome these problems and gain consumer confidence, laws have been enacted throughout the world. A variety of analytical methods have been proposed to comply with these regulations. As described in a review by Mafra, Honrado, and Amaral (Mafra et al., 2022), these methods are mainly based on proteins or lipids and include electrophoresis, immunochemistry, chromatography, and mass spectrometry. The major drawbacks of all these techniques were their relatively low sensitivity and their unsuitability for heat-treated material or for discrimination between closely related materials. This fact led to the rapid development of molecular methods because DNA is highly persistent during food processing and can retain retrievable sequence-specific information after an amplification reaction (PCR) (Woolfe & Primrose, 2004). These methods include DNA sequencing, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), multiplex PCR, quantitative PCR (qPCR), and simple sequence repeats (SSR) or microsatellites, while new methods such as high- resolution melting PCR (HRM), digital droplet PCR (ddPCR), isothermal amplification (e.g.., loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification, strand displacement amplification, helicase-dependent amplification, and rolling circle amplification) and next-generation sequencing (NGS) are beginning to overtake the performance of previous methods in terms of specificity, sensitivity, speed, and multiplexing (Boehme et al. 2019).
[0008] Ruminant milk can be easily used as a DNA source because it contains a large number of somatic cells, mainly leukocytes, but also epithelial cells of the milking mother, which contain genomic DNA suitable for PCR amplification (Bottero, 2003). In the milk of healthy cows, the cell concentration ranges from 107-104cells / ml and is highly dependent on clinical status (Herman, 2001). In the present study, the primer design was based on the mitochondrial cytochrome c gene, as it has been shown to be a suitable molecular marker for the classification and identification of closely related animal species (Rodrigues, 2017).
[0009] Due to the high homology between the three species, I have developed a much more specific and sensitive touch-down PCR protocol that has the potential to overcome problems that arise from the high similarity of DNA sequences between the different kinds of species (bovine, sheep, goat, etc). Using high annealing temperatures required for some primer-template combinations that are particularly useful for difficult-to-amplify templates, such as those with extensive secondary structures or high %GC content (Korbie & Mattick, 2008) this method aims to avoid misclassification and the formation of nonspecific products. The aim of the disclosed invention is to detect different DNA targets simultaneously in a single reaction, indicating adulteration of sheep or goat milk when there is an addition of cow milk.
[0010] Brief description of the invention
[0011] The current invention discloses a method of detecting two different DNA targets in a single reaction using Touchdown PCR (TD-PCR). TD-PCR uses an initial annealing temperature above the projected melting temperature (Tm) of the primers being used, then progressively transitions to a lower, more permissive annealing temperature over the course of successive cycles. Any difference in Tm between correct and incorrect annealing will produce an exponential advantage of twofold per cycle. The performance of hybridization and the overall success of the PCR method were evaluated using melting analysis, since Tm (the temperature at which half of the molecules are single-stranded) is a key property of each DNA target that allows the identification of different products and qualitative DNA detection, as suggested by many authors (Sakaridis et al. 2013, Agrimonti et al. 2015, Wajahat et al. 2022).
[0012] The first aspect of the invention is the design and development of primers to be used in the TD-PCR. The sequences of these primers are presented in Table 1 , the extended primers bovine and the external control are new primers.
[0013] Table 1: Sequences of the primers that were used in the developed duplex TD-PCR assays of this study.
[0014]
[0015] Another aspect of the invention is a TD-PCR detection method for sheep or goat derived admixtures with cow milk products in milk powder or milk liquid or dairy products (cheese, yogurt, etc) comprising of the following steps: first extracting the DNA of the product to be tested, then performing PCR amplification on the extracted genomic DNA using cattlespecific primers and sheep or goat -specific primers, and at the same time perform PCR amplification of bovine DNA as a negative control group, and PCR amplification of sheep or goat -derived DNA as a positive control group, while PCR cycles followed with temperature reduction. More specifically a program of pre-amplification for 10-20 cycles with annealing temperature above the Tm of the primers starting from a temperature of 10 degrees above the Tm of the primers and ending at a temperature of 5 degrees under the Tm of the primers, followed by PCR of 20 - 25 cycles using the final annealing temperature, followed by melting curve analysis was followed by temperature lowering,
[0016] Estimating by the number of melting curves the adulteration. One peak means not adulterated milk, and two peaks means the mixture of two types of milk.
[0017] The method is applied to two mixtures of goat milk products adulterated with cow milk and to sheep milk products adulterated with cow milk and it can identify adulteration even at 1 % of cow milk in the sheep or goat milk products.
[0018] In an embodiment, the PCR reaction conditions were: pre-denatu ration at 95°C for 1 to 10 min; denaturation at 95°C for 10 to 30 s, annealing at 50 to 70 °C for 1 min, extension at 70 to 74 °C for 10-60 secs, 40 cycles, and melting analysis.
[0019] In a preferred embodiment, the specific PCR reaction conditions that are followed are: initial denaturation at 95 °C for 3 min; followed by 16 cycles of 95 °C for 20 s, 67 °C (with a reduction of 1°C for each successive cycle) annealing for 30 s, 72 °C for 30 s; followed by 20 cycles of 95 °C for 20 s, 58 °C annealing for 30 s and a final extension at 72 °C for 30 s. Finally, melting analysis was again performed with a reduction of 0.1 °C / s within a temperature range of 90-72°C.
[0020] Another aspect of the invention is a TD-PCR detection kit for goat or sheep adulterated milk with cow milk (liquid or powder), comprising PCR reagent tubes, positive control, negative control, blank control, the required primers of table 1 and PCR reaction reagents and specifically PCR mix, upstream and downstream primers, DNA template and double distilled water, wherein the positive control is bovine DNA, the negative control is sheep DNA, goat DNA, configured to employ the previous methods for determining the adulteration percentage and the origins of the milk products.
[0021] Description of figures
[0022] Figure 1 : Assay optimization: Temperature of melting peaks obtained using qPCR assay using specific primers A) cow- goat assays before and after optimization, B) cow- sheep assays before and after optimization.
[0023] In A 101 is Before Optimization, 102 is 100% cow, 102 is 100% goat, in 104 is after Optimization and using extended primers, 105 is 100% cow, 106 is 100% goat.
[0024] In B 107 is Before optimization, 108 is 100% cow, 109 is 100% sheep, and in 110 is After optimization using extended primers, 111 is 100% cow, 112 is 100% sheep.
[0025] Figure 2: Analytical Specificity of the developed assays using raw milk from cow, sheep, goat, donkey, and buffalo for A) cow- goat assay and B) cow-sheep assay.
[0026] In A 201 is 100%goat, 202 is 100% cow, In B 203 is 100% sheep and 204 is 100% cow.
[0027] Figure 3: Melting curves analysis of both assays showing the sensitivity of cowsheep assay both in synthetic controls and raw samples (A and C respectively) and of cow-goat assay both in synthetic controls and raw samples (B and D respectively)
[0028] In A, 301 is 100% sheep, 302 is 100% bovine, 303 is 10% Bovine, 304 is 5% bovine, 305 is 1 % bovine.
[0029] In B is 306 100% goat, 307 is 100% bovine, 308 is 10% Bovine, 309 is 5% bovine, 310 is 1 % bovine.
[0030] In C 311 is 100% sheep, 312 is 100% bovine, 313 is 20% Bovine, 314 is 10% bovine, 315 is 5% bovine, 316 is 1% bovine. In D 317 is 100% goat, 318 is 100% bovine, 319 is 20% Bovine, 320 is 10% bovine, 321 is 5% bovine, 322 is 1% bovine
[0031] Figure 4: Application of the developed assay in 10 different commercially available milks (S1-S10) all from different brands available on the Greek market: Melting curves analysis of cow-goat assays in dairy commercially available milks.
[0032] Samples 1, 3, 4, 5 and 9 showed only one positive peak in Tm, verifying the presence of goat milk, indicating that these five samples are pure goat milk containing no cow milk whereas samples 6, 7, 8 and 10 showed two positive peaks in different Tm indicating the presence of cow milk.
[0033] Material and Methods
[0034] 2.1 Sample collection
[0035] To develop and validate the cow-goat and cow-sheep assays, reference DNA synthetic templates from each species’ cytochrome c oxidase subunit I mitochondrial gene (coxI DNA) were used (Integrated DNA Technologies, IDT). In addition, 8 commercial cow, 11 raw goat and 6 sheep milk samples were provided by local farmers. To enhance the specificity, 1 donkey and 1 buffalo milk samples were provided. Binary mixtures with decreasing cow DNA concentrations of 50, 20, 10, 5 and 1% (vol / vol) were also prepared. A synthetic control (DNA) was used as an external control to estimate the amount of DNA lost during the extraction protocol (% Recovery).
[0036] 2.2 DNA Extraction and Recovery Evaluation
[0037] 2.2.1 DNA Extraction
[0038] DNA was extracted from the milk samples using the DNEasy Blood and Tissue Kit (Qiagen, N.V). First, 1 ml of milk was centrifuged at 6000 rpm / 15 minutes and the supernatant was discarded. The remaining DNA pellet was treated according to the manufacturer’s instructions (spin-column protocol for non-nucleated mammalian blood). Briefly, 20pl proteinase-K and 200pl PBS were added to the pellet and incubated for 2 hours at room temperature. Then 200pl lysis buffer (AL) were added and incubated at 56°C / 10min. 1 Opl of 104(copies / pl) cfDNA were spiked into the solution as an external control.
[0039] After the addition of 200pl ethanol (100%), the solution was pipetted into the minispin columns, each time with the appropriate wash buffer. Finally, DNA was recovered after addition of 100pl elution buffer (AE) and its concentration was determined using NanoDrop (Thermo Scientific, U.S.A). The DNA extracts were stored in -20°C until use.
[0040] 2.2.2 Evaluation of DNA Recovery
[0041] The concentration and purity of total DNA were determined by absorbance measurements at 260 and 280 nm using the Nanodrop ND-ONE spectrophotometer (Thermo Fisher Scientific, Waltham, MA). In addition, 10A3 copies of the external DNA control added in the first step of the extraction procedure was amplified using specific primers by PCR to verify its presence and to evaluate the recovery of the whole process in all isolated DNAs (Table 1). The PCR reactions of the external DNA were performed under the following thermal cycling conditions: an initial denaturation at 95 °C for 2 min; 95 °C for 10 s for 40 cycles, 61 °C annealing for 15 s and a final extension at 72 °C for 15 s. Finally, melting analysis was performed with a reduction of 0.1 °C / s within a temperature range of 95-55°C. All amplification reactions were performed in a mixture (10 pL) containing 0.2 pL of dNTP mixture (10 mM), 2 pL of PCR buffer (5x), 1.2 pl of MgCI2(25mM), 0.15 pl BSA (10pg / pL), 0.3 pL of each primer (10 pM), 1pl of LC Green dye, 0.1 pl of Taq polymerase (5U / pl) and 1 pL of template DNA and brought to a final reaction volume of 10 pL with DNase / RNase-free water.
[0042] 2.3 Design of species-specific primers
[0043] Based on Giglioti et al. 2022, primers for cytochrome c oxidase subunit 1 of the mitochondrial gene (Genbank MZ668303, MZ782619, MZ782720 for bovine, goat and sheep, respectively) were designed de novo in silico, synthesized by IDT, and evaluated for performance (Table 1). Primer Premier 5.0 software (Premier Biosoft International) was used to avoid primer dimer formation, false priming sites, hairpin structure formation, and homology with other genes. All primers were designed to fit the assay conditions, such as amplicon sizes and melting temperatures. The specificities of all primers were first tested by homology searches using BLAST (Basic Local Alignment Search Tool - NCBI).
[0044] To perform perfect Tm differentiation in the PCR product calculated by melting analysis, specific extensions were added to the primer pair for bovine. Specifically, the bovine upstream primer consisted of a stem-loop extension of 43 bases (5 - GAAAGAAGGCGAGGACGGAAGAATGTGCGTCTCGCCTTCTTTC-3') and approximately 21 nucleotides (nt) of gene-specific sequence, whereas the bovine downstream primer consisted of approximately 22 nt of gene-specific sequence and a 10-base extension (5 -ATTCATTATC -3') at the 5' end.
[0045] Primer specificity and universality were verified by using synthetic controls for amplification and in raw goat, cow, and sheep milk provided by local farmers.
[0046] 2.4 Duplex TD-PCR protocols
[0047] We performed duplex touch down PCR (TD-PCR) with 1 pL DNA in a final volume of 10 pL. A PCR negative control containing no target was included in each test run. The reaction consisted of 1 pl of PCR buffer (5x) (Promega, U.S.A), 2 pl of MgCh (25mM), 0.2 pl of dNTP mix (10mM), 0.5 pl of (10pg / pl) BSA, 0.6 pl of 0.5M TMAC (tetramethylammonium chloride), 1 pl LC Green fluorescent dye and 0.1 pl of Taq polymerase (5 U / pl). After we optimized the primer concentrations, 0.2pM of the bovine-specific primers and 0.5pM of the sheep-specific primers were set for the cow x sheep assay, while equal amounts of 0.6pM of both primers were preferred for the cow x goat assay. Samples were cycled in the MIC PCR cycler (Biomolecular Systems). The final PCR conditions were as follows: initial denaturation at 95 °C for 3 min; followed by 16 cycles of 95 °C for 20 s, 67 °C (with a reduction of 1°C for each successive cycle) annealing for 30 s, 72 °C for 30 s; followed by 20 cycles of 95 °C for 20 s, 58 °C annealing for 30 s and a final extension at 72 °C for 30 s. Finally, melting analysis was again performed with a reduction of 0.1 °C / s within a temperature range of 90-72°C. In addition, in order to verify the method’s results, two commercial kits for the detection of bovine DNA were used: the first was based on the ELISA immunoenzymatic reaction (RC bovino kit) while the second consisted of an immunochromatographic strip test (IC bovino kit). Both kits were used according to the manufacturers’ instructions (Zeulab S.L. Spain).
[0048] RESULTS
[0049] 3.1 ASSAY OPTIMIZATION
[0050] To optimize the assays for cow-sheep or cow-goat detection, we used DNA extracted from raw cow, sheep, and goat milks. In all cases, the final conditions were selected based on the best differentiation of the melting curve analysis. In addition, PCR protocols were optimized according to the final concentration of Magnesium, BSA, primer concentration and TMAC addition (Data not shown). Due to the presence of non-specific signals, further optimization was performed using a different number of PCR cycles and a different temperature program (Touch Down PCR). We also investigated the effects of PCR product size after finding in our initial experiments that the signals obtained for cow and goat DNA were of the same Tm. We hypothesized that by increasing the length of the cow target sequence we could achieve better discrimination between the different milk species. Therefore, we designed and tested 2 different bovine-specific primer pairs. One pair amplified short sequences and the other pair amplified longer sequences added extension (Table 1). We found that the larger the cow PCR product, the stronger the discrimination between the peaks of the melting curve analysis (Figure 1). Each species was confirmed by melting curve analysis: the pure samples showed melting curves with a single inflection point at a Tm value of 82°C, 80.5°C and 77°C for cow, goat and sheep respectively.
[0051] 3.2 VALIDATION OF THE DEVELOPED ASSAYS
[0052] 3.2.1 Specificity
[0053] The specificity of each specific primer was checked for the presence or absence of nonspecific amplifications using the temperature of the melting peak (°C). The primer designed for each species was specific and had no non-specific amplifications when compared to raw milk samples from the other species or synthetic DNA controls (Figure 2). Donkey and buffalo milk samples were also compared and showed no non-specific amplifications. Each specific primer exhibited a specific peak melting temperature (Figure).
[0054] 3.2.2 Sensitivity
[0055] To simulate milk adulteration practices in the laboratory, 2 sets of milk blends (cow and goat milk blends and cow and sheep milk blends) were used. The authentication test was performed with these blends. Cow and sheep or goat milk were mixed in different ratios: 1 , 5, 10, 20, and 50% (vol / vol) cow milk and 99, 95, 90, 80, and 50% (vol / vol) corresponding goat or sheep milk to produce binary milk mixtures. DNA isolated from these mixtures was analyzed using the developed assays. In addition, we used synthetic DNA control of each species to simulate the adulteration of goat or sheep DNA and verify the authentication ability of the developed assay. The results obtained with the developed Duplex TD-PCR method showed that the method could clearly detect the incorporated cow milk components (Figure 3) in goat or sheep milk, and the minimum LOD was 1% (vol / vol). as two peaks from the melting curves appeared even at 1% admixtures.
[0056] 3.2.3 Intra-assay repeatability
[0057] To evaluate the intra-assay repeatability of the developed assay, biased simulations were analyzed by mixing bovine milk with goat or sheep milk at ratios of 1% and 5% in triplicate. SD and CV% were calculated according to the minimum information for publication of quantitative Real-Time PCR experiments. Intraassay repeatability was assessed by analyzing triplicate samples within the same analytical run (Table 2). CV% for all cases were > 10% to verify the accuracy of the developed assay.
[0058] 3.2.4 Recovery - Quality Control
[0059] For the analysis of each milk sample, in each individual reaction 50 copies / pL of DNA-EC spiked to check the performance of DNA extraction and PCR detection. We evaluated the efficacy and analytical performance of all protocols and experimental conditions by quantifying the amounts of spiked exogenous control. The recovery rate of DNA-EC in each case was estimated in terms of the amount of an equivalent number of DNA-EC copies that we had added to the eluted DNA after the extraction step (corresponding to 100% recovery). The recoveries of all simulated samples were between 84% and 103%, confirming the accuracy of the developed assays. 3.3 Application of the developed assay in commercial goat milks
[0060] We used the semi-qualitative method established in this study to examine 10 commercial goat milk. The results of this test show that samples 1, 3, 4, 5, and 9 have only one positive peak in Tm that verifies goat milk, indicating that these five samples are pure goat milk that does not contain cow milk components. Melt curve analysis of samples 2, 6, 7, 8, and 10 also showed positive amplification in the Tm of the bovine PCR product, indicating that these five samples were adulterated with cow's milk to varying degrees. The double peaks of the above samples proved the amplification of both bovine and goat milk components (Figure 4).
[0061] 3.4 Direct Comparison study between the developed assay, ELISA and Rapid immunochromatographic test
[0062] We used the same samples to directly compare the developed assay to two commercially available kits based on ELISA and immonochromatographic test. For the comparison, DNA extracted from 10 commercial goat milks and two milk blends of 1% bovine-99% goat and 5% bovine-95% goat milk respectively was used.
[0063] Overall, all 12 DNA samples were tested by the three assays. Using the developed assay, we detected bovine milk in 5 out of 10 commercial goat milks whereas 5% and 1% mix milks were also detected. By using ELISA we detected bovine milk in 2 out of 10 commercial goat milks whereas 5% and 1% mix milks were not detected. The concordance between the developed assay and ELISA was fair, 7 / 10 (70%) (Table 3). More specifically, 5 samples were found negative by both assays, while 3 samples were found positive only by the developed assay. When we analyzed the results performing the Cohen’s kappa coefficient (K) test, we found that there was a “fair” agreement between these two methods that was not statistically significant (K = 0.400, Table 3).
[0064] The same comparison study was performed between rapid immunochromatographic test and the developed assay. By using rapid test, we detected bovine milk in 2 out of 10 commercial goat milks whereas 5% and 1% mix milks were not detected. The concordance between the developed assay and rapid test was higher than ELISA, 8 / 10 (80%) (Table 3). More specifically, 5 samples were found negative by both assays, while 2 samples were found positive only by the developed assay. When we analyzed the results performing the Cohen’s kappa coefficient (K) test, we found that there was a “moderate” agreement between these two methods that was not statistically significant (K = 0.600, Table 3). Table 2: Inter-assay repeatability: The cycle threshold (Ct) values of the duplex TD- assays
[0065] Table 3: Comparison between the developed TD-PCR cow-goat assay and a) ELISA and b) rapid immunochromatographic sticks for 10 commercial goat milks References
[0066] Agrimonti C, Pirondini A, Marmiroli M, Marmiroli N. A quadruplex PCR (qxPCR) assay for adulteration in dairy products. Food Chem. 2015 Nov 15;187:58-64. doi:10.1016 / j.foodchem.2015.04.017.
[0067] Bottero MT, Civera T, Anastasio A, Turi RM, Rosati S. Identification of cow's milk in "buffalo" cheese by duplex polymerase chain reaction. J Food Prot. 2002 Feb;65(2):362-6. doi: 10.4315 / 0362-028x-65.2.362.
[0068] Giglioti R, Polli H, Taina Azevedo B, Morita Katiki L, Eugenio Vercesi Filho A. Detection and quantification of adulteration in milk and dairy products: A novel and sensitive qPCR-based method. Food Chem (Oxf). 2022 Jan 10;4: 100074. doi: 10.1016 / j.fochms.2022.100074.
[0069] Herman BL. Determination of the animal origin of raw food by species-specific PCR. J Dairy Res. 2001 Aug;68(3):429-36. doi: 10.1017 / s0022029901004940.
[0070] Kastanos E, Papaneophytou C, Georgiou T, Demoliou C. A simple and fast triplex- PCR for the identification of milk's animal origin in Halloumi cheese and yoghurt. J Dairy Res. 2022 Aug 19:1-4. doi: 10.1017 / S0022029922000577.
[0071] Korbie DJ, Mattick JS. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat Protoc. 2008;3(9): 1452-6. doi: 10.1038 / nprot.2008.133.
[0072] Kritikou AS, Aalizadeh R, Damalas DE, Baria IV, Baessmann C, Thomaidis NS. MALDI-TOF-MS integrated workflow for food authenticity investigations: An untargeted protein-based approach for rapid detection of PDO feta cheese adulteration. Food Chem. 2022 Feb 15;370:131057. doi: 10.1016 / j.foodchem.2021.131057.
[0073] Mafra I, Honrado M, Amaral JS. Animal Species Authentication in Dairy Products. Foods. 2022 Apr 13; 11 (8): 1124. doi: 10.3390 / foodsl 1081124.
[0074] Ortea I, O'Connor G, Maquet A. Review on proteomics for food authentication. J Proteomics. 2016 Sep 16;147:212-225. doi: 10.1016 / j.jprot.2016.06.033.
[0075] Rodrigues MS, Morelli KA, Jansen AM. Cytochrome c oxidase subunit 1 gene as a DNA barcode for discriminating Trypanosoma cruzi DTUs and closely related species. Parasit Vectors. 2017 Oct 16;10(1):488. doi: 10.1186 / s13071 -017-2457-1. Sakaridis I, Ganopoulos I, Argiriou A, Tsaftaris A. A fast and accurate method for controlling the correct labeling of products containing buffalo meat using High Resolution Melting (HRM) analysis. Meat Sci. 2013 May;94(1):84-8. doi: 10.1016 / j.meatsci.2012.12.017.
[0076] Tsakali E, Chatzilazarou A, Houhoula D, Koulouris S, Tsaknis J, Van Impe J. A rapid HPLC method for the determination of lactoferrin in milk of various species. J Dairy Res. 2019 May;86(2):238-241. doi: 10.1017 / S0022029919000189.
[0077] Wajahat W, Azad ZRAA, Nazir S, Nasir G. Real Time-PCR coupled with melt curve analysis for detecting the authenticity of camel milk. J Food Sci Technol. 2022 Apr;59(4): 1538-1548. doi: 10.1007 / s13197-021-05164-8.
[0078] Woolfe M, Primrose S. Food forensics: using DNA technology to combat misdescription and fraud. Trends Biotechnol. 2004 May;22(5):222-6. doi:10.1016 / j.tibtech.2004.03.010.
Claims
Claims1. Primers for milk adulteration detection using TD-PCR with the sequences- GAAAGAAGGCGAGGACGGAAGAATGTGCGTCTCGCCTTCTTTCTTAATC TTACCTGGGTTTGGA- ATTCATTATCATTCATTATCGAAACCTAGAAATCCGATTGAC- TGTTAGCAACTCTTCAAGTTCCCT- AGGCAGGTAGGGCTGGAACA2. A TD-PCR detection method for sheep or goat derived admixtures with bovine milk products in milk powder or milk liquid comprising of the steps: extracting the DNA of the product to be tested performing PCR amplification on the extracted genomic DNA using the bovine -specific primers of claim 1 and the sheep specific primers TTTGGGATAATCTCCCATATT andCCCAATTGATATTATGGCTCAT) or goat specific primers CTTATTTTACCTGGATTTGGA and CAATAAATCCTAGAAACCCGA), and at the same time perform PCR amplification of bovine DNA as a negative control group, and PCR amplification of sheep or goat derived DNA as a positive control group, while PCR cycles follow with temperature reduction. More specifically a program of pre-denaturation, followed by denaturation, followed by annealing is followed while melting analysis is followed by temperature lowering, starting from a temperature of 10 degrees above the Tm of the primers and ending at a temperature of 5 degrees under the Tm of the primers.Estimating the existence of admixtures by the number of peaks of the melting curve analysis, one peak is no adulteration, two or more exhibits adulteration.3 A TD-PCR detection method for sheep or goat derived admixtures with bovine milk products in milk powder or milk liquid or dairy products (cheese, yogurt etc) according to claim 2, wherein the PCR reaction conditions were: pre-amplification for 10-20 cycles with annealing temperature above the Tm ofthe primers starting from a temperature of 10 degrees above the Tm of the primers and ending at a temperature of 5 degrees under the Tm of the primers, followed by PCR of 20 - 25 cycles using the final annealing temperature, followed by melting curve analysis was followed by temperature lowering A TD-PCR detection method for sheep or goat derived admixtures with bovine milk products in milk powder or milk liquid according to any of the claims 2 or 3, wherein the specific PCR reaction conditions that are followed are: initial denaturation at 95 °C for 3 min; followed by 16 cycles of 95 °C for 20 s, 67 °C (with a reduction of 1 °C for each successive cycle) annealing for 30 s, 72 °C for 30 s; followed by 20 cycles of 95 °C for 20 s, 58 °C annealing for 30 s and a final extension at 72 °C for 30 s. Finally, melting analysis is performed with a reduction of 0.1 °C / s within a temperature range of 90-72°C. A TD-PCR detection kit for goat or sheep adultered milk with bovine milk (liquid or powder), comprising PCR reagent tubes, positive control, negative control, blank control, the required primers of claim 1 and PCR reaction reagents and specifically PCR mix, upstream and downstream primers as describe in claim 2, DNA template and double distilled water, wherein the positive control is bovine DNA, the negative control is sheep DNA, goat DNA, configured to employ the method of any of the claims 2-4 for determining the adulteration percentage and the origins of the milk products.