Intrathecal dosage method

Abstract

The present invention relates to methods for determining the brain uptake, likelihood of effectiveness, and dosage of therapeutic agents that are administered intrathecally to the brain of a subject, particularly a human patient. The present invention further provides for the treatment of a subject within a patient subgroup identified by the method of the present invention, and / or with a dosage determined by the present invention.

Description

INTRATHECAL DOSAGE METHODTECHNICAL FIELD OF THE INVENTION

[0001] The present invention relates to methods for determining the brain uptake, likelihood of effectiveness, and dosage of therapeutic agents that are administered intrathecally to the brain of a subject, particularly a human patient. The present invention further provides for the treatment of a subject within a patient subgroup identified by the method of the present invention, and / or with a dosage determined by the present invention.BACKGROUND OF THE INVENTION

[0002] It is extremely challenging to deliver a therapeutic agent to the brain of a patient effectively, and to achieve a sufficient level of brain uptake that will correspond to the desired therapeutic outcome. One reason for this is because the vascular blood-brain barrier (BBB) impedes and alters the effective transport of therapeutic agents into brain tissue. A particular route for drug delivery to the brain is that of intrathecal administration, which involves injecting a therapeutic agent into the spinal canal or subarachnoid space to reach the cerebrospinal fluid (CSF), thereby bypassing the BBB.

[0003] However, intrathecal drug delivery is also not without its difficulties. Chief amongst these are the fact that, even when a therapeutic agent is given via intrathecal administration, it is very difficult to predict whether a sufficient amount / concentration of the agent will reach the brain to have the desired therapeutic effect. This may be caused by the variations in rates of CSF and metabolic free water production and reabsorption, as well as the existence of further barriers to the desired brain target site. Thus, it is generally very difficult to determine the effective dose of an agent that is to be administered intrathecally. Yet further complexity arises in that the amount (e.g. the %) of a given intrathecal dose that reaches the brain can vary significantly from patient to patient, in further ways that cannot necessarily be predicted.

[0004] Existing approaches to intrathecal administration of therapeutic agents lack precision for tailoring effective doses to individual patients, and fail to accommodate for variability in patient responses by making dynamic dosage adjustments. In this respect, existing guidelines for intrathecal dosages may not sufficiently consider individual patient factors. Thus, there is a need in the art for improved methods of predicting and providing effectivedoses of therapeutic agents to the brain, via intrathecal administration, which will enable improved treatment at a patient-specific level. Such methods must also not be overly invasive and uncomfortable to the patient, as this will reduce the overall acceptability, the likelihood of patient compliance and the feasibility of adjusting individual patient doses. Patients undergoing intrathecal administration are already subjected to intrusive injections and therefore it is particularly necessary to avoid further burdening these patients with additional stress and pain. It is also advantageous to avoid the need to carry out extensive, complicated and costly procedures such as brain imaging and CT scans for individual patients.

[0005] The present invention overcomes these issues in the art by providing new, improved methods of predicting, determining and providing effective intrathecal administration of therapeutic agents to the brain, which are advantageously non-invasive to the patient and are extremely efficient to carry out.SUMMARY OF THE INVENTION

[0006] The present invention relates to new methods and uses wherein, for a subject that has been administered an intrathecal dose of a therapeutic agent, the systemic amount of the therapeutic agent in the subject is determined, and used to determine effectiveness, brain uptake or a subsequent intrathecal dose of the therapeutic agent. In particular, the systemic amount of the therapeutic agent in such a subject has surprisingly been found to negatively correlate to the uptake of the intrathecal dose of the therapeutic agent in the brain of the subject, in a manner which is robust and reliable, allowing for patient-specific predictions of success and the ability to freely tailor subsequent doses.

[0007] Accordingly, in a first aspect, the present invention provides a method of determining the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent to determine the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject.

[0008] In a further aspect, the present invention provides method of determining thelikelihood of an intrathecal dose of a therapeutic agent to have a therapeutic effect on the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent in the subject to determine the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.

[0009] In a further aspect, the present invention provides a method of determining, in a subject who has been administered a prior intrathecal dose of a therapeutic agent, a further intrathecal dose of the therapeutic agent to be administered to the subject, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject after the administration of the prior intrathecal dose; and b) using the systemic amount of the therapeutic agent in the subject to determine a further intrathecal dose of the therapeutic agent to be administered to the subject.

[0010] In a further aspect, the present invention provides a therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.

[0011] In a further aspect, the present invention provides a method of treating a subject with a therapeutic agent, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 : Individual observed Cmax (nmol / L) of therapeutic agent in plasma versus therapeutic agent in head %ID (sum of grey matter, white matter, and brain cerebrospinal fluid) on Day 5. Procedures: A= 5 mL CSF and 5 mL flush, no exercise; B= 0.5 mL CSF and 0.5 mL flush, no exercise; C= 15 mL CSF and 15 mL flush, no exercise; D= 0.5 mL CSF and 0.5 mL flush, with exercise.DETAILED DESCRIPTION OF THE INVENTION

[0013] The present invention addresses a problem with the dosing of intrathecal administration. A known dose of a therapeutic agent can be administered intrathecally to a subject, but the amount of the therapeutic agent that is successfully taken up into the brain of the subject - and therefore the effectiveness and likelihood of success of the therapeutic agent - may vary widely, based on factors that may also be patient-specific. Thus, it is difficult to determine, for a given intrathecal dose, how effective that dose will be in a specific patient. In this respect, the present inventors sought to provide an improved method of determining brain uptake and providing adjusted intrathecal doses that does not involve an invasive procedure such as directly measuring the amount of the drug within the CSF or performing a CT scan, and the costly nature or potential dangerous and unwanted effects of such procedures.

[0014] Accordingly, the present invention relates to new methods and uses wherein, for a subject that has been administered an intrathecal dose of a therapeutic agent, the systemic amount of the therapeutic agent in the subject is determined and used to determine / predict effectiveness, brain uptake or a subsequent intrathecal dose of the therapeutic agent. In particular, the systemic amount of the therapeutic agent in such a subject (measured e.g. as the maximum concentration of the therapeutic agent in an in vitro plasma sample taken from the subject) has surprisingly been found to inversely correlate to the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject. Thus, the methods of the present invention exploit this phenomenon which is created by a prior intrathecal dose of the therapeutic agent, and measure the systemic amount of the therapeutic agent following the prior dose, to determine the brain uptake and effectiveness of the prior dose. Methods of the present invention can also determine a further intrathecal dose(s) of the therapeutic agent, e.g. to increase the dose if the systemic amount of the therapeutic agent is indicative of low brain uptake / effectiveness, or to maintain the dose if the systemic amount of the therapeutic agent isindicative of sufficient brain uptake / effectiveness. In carrying out these methods, the present inventors have found them to be surprisingly robust and reliable, e.g. providing success across varying patient specifics (age, BMI, sex etc.) and intrathecal dosage regimes. Further, the methods of the invention allow for patient-specific predictions of success and the tailoring of subsequent doses without the need for highly invasive and costly procedures.Methods of the invention

[0015] The methods of the present invention may generally take different forms, and it is to be understood that specific embodiments and features of any one method aspect of the present invention will also generally be applicable to the other methods which are aspects of the present invention. For example, the methods of the present invention may be methods of determining the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject, methods of determining the likelihood of an intrathecal dose of a therapeutic agent to have a therapeutic effect on the brain of a subject, and methods of determining a further intrathecal dose of a therapeutic agent to be administered to a subject. These methods are generally carried out on subjects who have received a (prior) intrathecal dose of the therapeutic agent in question. In an embodiment, the methods are generally carried out with the steps in the recited order. In an embodiment, the methods of the present invention comprise the recited steps. In an embodiment, the methods of the present invention consist of the recited steps.

[0016] In an embodiment, the methods of the present invention are in vitro methods. In an embodiment, the methods of the present invention are carried out on samples that have previously obtained from the subject in question. In an embodiment, the methods of the invention are carried out on samples. In an embodiment, the methods of the invention are carried out on in vitro samples. In an embodiment, an intrathecal dose of a therapeutic agent is a dose of the therapeutic agent that is / has been administered intrathecally. In an embodiment, an intrathecal dose of a therapeutic agent is the amount of a therapeutic agent that is / has been administered intrathecally. In an embodiment, an intrathecal dose of a therapeutic agent is a dose of the therapeutic agent that has been administered intrathecally. In an embodiment, an intrathecal dose of a therapeutic agent is the amount of a therapeutic agent that has been administered intrathecally. In an embodiment, the subject is a mammal. In an embodiment, the subject is a Rhesus macaque. In an embodiment, the subject is a human. In an embodiment, the subject is a mouse. In an embodiment, the subject is a human patient.

[0017] Intrathecal administration is a known, established route of administration. In an embodiment, intrathecal administration is administration to the CSF. In an embodiment, intrathecal administration is administration directly to the CSF. In this context, “directly” means that the vascular BBB is bypassed, but does not exclude the administered therapeutic agent from travelling e.g. through other minor structures and spaces to the CSF within the normal course of intrathecal administration. In an embodiment, intrathecal administration is administration into the spinal canal or subarachnoid space. In an embodiment, intrathecal administration is administration into the thecal sac.

[0018] In a first aspect, the present invention provides a method of determining the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent to determine the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject.

[0019] In an embodiment, determining the uptake of the therapeutic agent to the brain of the subject comprises determining the amount of the therapeutic agent that reaches the brain of the subject. In an embodiment, determining the uptake comprises determining whether the therapeutic agent is taken up into the brain of the subject. In an embodiment, determining the uptake comprises determining whether an effective amount of the therapeutic agent is taken up into the brain of the subject. In an embodiment, determining the uptake comprises determining the % of the intrathecal dose of the therapeutic agent that is taken up into the brain of the agent. In an embodiment, determining the uptake comprises determining the ratio between the amount of the intrathecal dose of the therapeutic agent that is taken up into the brain of the subject to the amount of the intrathecal dose of the therapeutic agent that is not taken up into the brain of the subject. In an embodiment, determining the uptake comprises determining the efficiency of the uptake of the intrathecal dose of the therapeutic agent. In an embodiment, the subject has previously been administered an intrathecal dose of the therapeutic agent. In an embodiment, the method per se does not comprise administering an intrathecal dose of the therapeutic agent to the subject. In an embodiment, the method determines the uptake of the intrathecal dose of the therapeutic agent. In an embodiment, the method determines the uptake of the previously administered intrathecal dose of the therapeutic agent.

[0020] In an embodiment, determining the systemic amount of the therapeutic agent in the subject comprises determining the amount of the therapeutic agent in the blood of the subject. In an embodiment, determining the systemic amount comprises determining the amount of the therapeutic agent in the plasma of the subject. In an embodiment, determining the systemic amount comprises determining the maximum systemic concentration of the therapeutic agent in the subject. In an embodiment, determining the systemic amount comprises determining the maximum concentration of the therapeutic agent in the blood of the subject. In an embodiment, determining the systemic amount comprises determining the maximum concentration of the therapeutic agent in the plasma of the subject. In an embodiment, the maximum concentration is the maximum concentration following the intrathecal dose that has (previously) been administered to the subject. In an embodiment, the blood of the subject is a sample of the blood of the subject. In an embodiment, the blood of the subject is an in vitro sample of the blood of the subject. In an embodiment, the plasma of the subject is a sample of the plasma of the subject. In an embodiment, the plasma of the subject is an in vitro sample of the plasma of the subject. In an embodiment, the systemic amount of the therapeutic agent in the methods of the present invention is the maximum concentration of the therapeutic agent in the blood / plasma of the subject following a previously administered intrathecal dose of the therapeutic agent, preferably wherein the blood / plasma is an in vitro sample. In an embodiment, the maximum concentration of the therapeutic agent “following” an intrathecal dose of the therapeutic agent is the maximum concentration that the therapeutic agent reaches in the subject (e.g. in the blood / plasma of the subject) as a result of the intrathecal dose of the therapeutic agent. In an embodiment, the maximum concentration is the maximum concentration of the previously administered intrathecal dose that can be detected in the blood / plasma of the subject, such as in an in vitro sample thereof. In an embodiment, “determining the amount of’ comprises measuring the amount of the therapeutic agent.. Any appropriate means for the therapeutic agent in question may be used to determine the systemic amount of the therapeutic agent. In an embodiment, chromatography (such as high- performance liquid chromatography or gas chromatography), enzyme-linked immunosorbent assay (ELISA), immunoassays, mass spectrometry, nuclear mass resonance or titrations may be used to determine the systemic amount of the therapeutic agent. In a preferred embodiment, ELISA is used. Preferably, human complement factor H ELISA (hELISA) is used. For example, in an embodiment wherein the therapeutic agent is an oligonucleotide, ELISA, PCR (such as quantitative PCR or digital droplet PCR), spectrophotometry, gel or capillaryelectrophoresis or mass spectrometry may be used to determine the systemic amount of the therapeutic agent. In a preferred embodiment wherein the therapeutic agent is an oligonucleotide, ELISA is used. Preferably wherein the therapeutic agent is an oligonucleotide, hELISA is used.

[0021] In an embodiment, the systemic amount is determined within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 hours of administering the (prior) intrathecal dose. In an embodiment, the systemic amount is determined between 1 and 24, between 1 and 48, or between 1 and 72 hours of administering the (prior) intrathecal dose. In an embodiment, the systemic amount is determined within 24 hours of administering the (prior) intrathecal dose. In an embodiment, the systemic amount is determined at least 24 hours after the (prior) intrathecal dose is administered. In an embodiment, the systemic amount is determined at least 48 hours after the (prior) intrathecal dose is administered. In an embodiment, the systemic amount is determined at least 72 hours after the (prior) intrathecal dose is administered. In an embodiment, the maximum systemic concentration is determined within 24 hours of administering the (prior) intrathecal dose, such as within any of the time points within 24 hours mentioned above. In an embodiment, the maximum systemic concentration of rugonersen is determined within 24 hours of administering the (prior) intrathecal dose, such as within any of the time points within 24 hours mentioned above.

[0022] In an embodiment, the systemic amount is determined within 24 days after the (prior) intrathecal dose is administered. In an embodiment, the systemic amount is determined between 1 to 24 days, between 2 to 24 days, optionally between 3 to 24 days after the (prior) intrathecal dose is administered. In an embodiment, the systemic amount is determined 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days and / or 24 days after the (prior) intrathecal dose is administered.

[0023] In an embodiment, the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject that is determined using the systemic amount is the uptake of the intrathecal dose within 1 day, at least 1 day after, at least 2 days after, at least 3 days after, at least 4 days after or at least 5 days after the administration of the intrathecal dose. In an embodiment, the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject that is determined using the systemic amount is the uptake of the intrathecal dose within 12 days, within 13 days, within 14 days, within 15 days, within 16 days, within 17 days, within18 days, within 19 days, within 20 days, or within 21 days after the administration of the intrathecal dose. In an embodiment, the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject that is determined using the systemic amount is the uptake of the intrathecal dose between 1 and 21 days, optionally between 5 and 12 days, after the administration of the intrathecal dose. In an embodiment, the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject that is determined using the systemic amount is the uptake of the intrathecal dose within 1 day, or 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after the administration of the intrathecal dose.

[0024] In an embodiment, the above-mentioned time ranges / points for determining the systemic amount and determining the uptake to the brain are used in conjunction in the methods of the present invention. In this respect, it is to be understood that the systemic amount is not necessarily determined at the same time point as the time point for which uptake to the brain is determined using the systemic amount. Accordingly, in an embodiment, the systemic amount of the therapeutic agent is measured within 1 hour, or between 1 and 48 hours after the (prior) intrathecal dose is administered, and is used to determine the uptake to the brain at a time point between 1 and 21 days after the (prior) intrathecal dose is administered. In an embodiment, the systemic amount of the therapeutic agent is measured between 24 and 48 hours after the (prior) intrathecal dose is administered, and is used to determine the uptake to the brain at a time point between 5 and 12 days after the (prior) intrathecal dose is administered. In highly preferred embodiments, the systemic amount is the maximum systemic concentration during the specified time, e.g. the maximum systemic concentration between 1 and 48 hours after the (prior) intrathecal dose is administered.

[0025] For the avoidance of doubt, a “day” constitutes a period of 24 hours, e.g. 24 hours following the (prior) intrathecal dose, and an “hour” constitutes a period of 60 minutes, e.g. 60 minutes following the (prior) intrathecal dose. For the avoidance of doubt, all ranges referring to days and hours herein include the days and hours that are stated, e.g. determining the systemic amount at least 24 hours after administration includes determining the systemic amount 1 day or 24 hours after administration. As another example, , determining the systemic amount 1 hour after administration includes determining the systemic amount at any time point between 1 hour (about 60 minutes) and 2 hours (about 120 minutes) after administration, e.g. at about 90 minutes after administration. As another example, determining the brain uptake 1day (e.g. about 24 hours) after administration includes determining the brain uptake at any time point between 1 day (about 24 hours) and 2 days (about 48 hours), e.g. at about 36 hours. Typically, the systemic amount will be calculated as the maximum systemic amount in the stated time period. Typically, the brain uptake will be calculated as the average, effective or therapeutically relevant brain uptake within the stated time period.

[0026] In an embodiment, there is an inverse correlation between the systemic amount and the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject. In an embodiment, the method (e.g. step b)) involves negatively correlating the systemic amount of the therapeutic agent with the uptake of the intrathecal dose of the therapeutic agent. Accordingly, in an embodiment, the method (e.g. step b)) involves negatively correlating the systemic amount of the therapeutic agent with the uptake of the intrathecal dose of the therapeutic agent, thereby determining the uptake of the intrathecal dose of the therapeutic agent.

[0027] In a further aspect, the present invention provides a method of determining the likelihood of an intrathecal dose of a therapeutic agent to have a therapeutic effect on the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent in the subject to determine the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.

[0028] In an embodiment, determining the likelihood of an intrathecal dose of a therapeutic agent to have a therapeutic effect on the brain of a subject comprises determining whether the intrathecal dose of the therapeutic agent will have a therapeutic effect on the brain of the subject.

[0029] In an embodiment, there is an inverse correlation between the systemic amount and the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject. In an embodiment, the method (e.g. step b)) involves negatively correlating the systemic amount of the therapeutic agent with the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.Accordingly, in an embodiment, the method (e.g. step b)) involves negatively correlating the systemic amount of the therapeutic agent with the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject, thereby determining the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.

[0030] In a further aspect, the present invention provides a method of determining, in a subject who has been administered a prior intrathecal dose of a therapeutic agent, a further intrathecal dose of the therapeutic agent to be administered to the subject, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject after the administration of the prior intrathecal dose; and b) using the systemic amount of the therapeutic agent in the subject to determine a further intrathecal dose of the therapeutic agent to be administered to the subject.

[0031] In an embodiment, the prior intrathecal dose of the therapeutic agent is an intrathecal dose of the therapeutic agent that has been administered to the subject prior to the method being carried out. In an embodiment, the prior intrathecal dose of the therapeutic agent is such that the systemic amount of the prior intrathecal dose in the subject can be determined, e.g. in step a) of the method. In an embodiment, the prior intrathecal dose of the therapeutic agent is such that the maximum systemic concentration of the prior intrathecal dose in the subject can be determined, e.g. in step a) of the method. In an embodiment, the maximum concentration is the maximum systemic concentration of the therapeutic agent that is reached due to the administration of the prior intrathecal dose of the therapeutic agent. It is to be understood herein that the prior intrathecal dose is not necessarily the first dose of the therapeutic agent that has been administered to the subject. However, in an embodiment, the prior intrathecal dose is the first dose of the therapeutic agent that has been administered to the subject.

[0032] It is to be understood that, in embodiments, the “further” intrathecal dose can be any further intrathecal dose that is to be administered to the subject. The further intrathecal dose can be the amount of a single further intrathecal dose or the individual amount of one or more further intrathecal doses, such as each of one or more further intrathecal doses, to be administered to the subject. The further intrathecal dose does not include or refer to the priorintrathecal dose. However, in certain embodiments, the further intrathecal dose may well be determined to be the same as the prior intrathecal dose. In an embodiment, the subject is prescribed the further intrathecal dose. In an embodiment, the method comprises prescribing the further intrathecal dose for the subject. In an embodiment, the further intrathecal dose is administered to the subject. In an embodiment, where specified, the method comprises administering the further intrathecal dose to the subject or providing the further intrathecal dose to the subject. Otherwise, in embodiments, the method does not comprise administering or providing the further intrathecal dose to the subject.

[0033] In an embodiment, there is an inverse correlation between the systemic amount and the further intrathecal dose of the therapeutic agent to be administered to the subject. In an embodiment, the method (e.g. step b)) involves negatively correlating the systemic amount of the therapeutic agent with the further intrathecal dose of the therapeutic agent to be administered to the subject. Accordingly, in an embodiment, the method (e.g. step b)) involves negatively correlating the systemic amount of the therapeutic agent with the further intrathecal dose of the therapeutic agent to be administered to the subject, thereby determining the further intrathecal dose of the therapeutic agent to be administered to the subject.

[0034] In an embodiment, the method comprises determining a further intrathecal dose that is predicted to have a therapeutic effect on the brain of the subject. Accordingly, in an embodiment, the further intrathecal dose has a therapeutic effect on the brain of the subject. In an embodiment, therapeutic effect is the beneficial therapeutic effect of the therapeutic agent. In an embodiment, the method comprises determining a further intrathecal dose that will have a therapeutic effect on the brain of the subject.

[0035] In an embodiment, the method comprises determining a further intrathecal dose that is predicted to have an increased therapeutic effect on the brain of the subject relative to the prior intrathecal dose. Accordingly, in an embodiment, the further intrathecal dose has an increased therapeutic effect on the brain of the subject relative to the prior intrathecal dose of the therapeutic agent. In an embodiment, an increased therapeutic effect means that the further intrathecal dose is more effective than the prior intrathecal dose. In an embodiment, an increased therapeutic effect means that the further intrathecal dose is effective, whereas the prior intrathecal dose was not effective. In an embodiment, the method comprises determining a further intrathecal dose that will have an increased therapeutic effect on the brain of the subject relative to the prior intrathecal dose.

[0036] In embodiments, the method may comprise determining any relevant aspect of the further intrathecal dose, including determining whether to administer a further intrathecal dose or not, determining the size of the intrathecal dose, determine the frequency of the intrathecal dose, and determining the amount of the intrathecal dose that is delivered to the brain. In an embodiment, the method comprises determining the size of the further intrathecal dose. In an embodiment, the method comprises determining the size of the further intrathecal dose to be increased. In an embodiment, the method comprises increasing the further intrathecal dose. In an embodiment, the method comprises increasing the further intrathecal dose relative to the prior intrathecal dose. In an embodiment, the method comprises decreasing the further intrathecal dose. In an embodiment, the method comprises decreasing the further intrathecal dose relative to the prior intrathecal dose. In an embodiment, the method comprises determining to administer a further intrathecal dose. In an embodiment, the method comprises determining not to administer a further intrathecal dose. In an embodiment, the further intrathecal dose is effective, e.g. more effective than the prior intrathecal dose. In an embodiment, the further intrathecal dose is safe, e.g. less likely to have an adverse effect than the prior intrathecal dose. In an embodiment, the method comprises determining the frequency of further intrathecal dose(s). In an embodiment, the method comprises determining to increase the frequency of one or more further intrathecal dose(s). In an embodiment, the method comprises determining the amount of the prior intrathecal dose that has reached the brain. In an embodiment, the method comprises determining the amount of a further intrathecal dose that will reach the brain.

[0037] In an embodiment, the method comprises comparing the systemic amount of the therapeutic agent with a pre-determined value or range. In an embodiment, the systemic amount of the therapeutic agent is compared or evaluated relative to a pre-determined value or range. In an embodiment, the pre-determined value or range corresponds to, is derived from or is the systemic amount of the therapeutic agent in a control subject or population that has been administered the (same) intrathecal dose of the therapeutic agent. In an embodiment, the predetermined value or range corresponds to the intrathecal dose of the therapeutic agent achieving a therapeutic effect on the brain of the subject. In an embodiment, the pre-determined value or range corresponds to the systemic amount of the therapeutic agent in a control subject or population wherein the intrathecal dose of the therapeutic agent achieved a therapeutic effect. In an embodiment, the pre-determined value or range corresponds to the intrathecal dose of the therapeutic agent achieving a therapeutically effective uptake to the brain of the subject. In anembodiment, the pre-determined value or range corresponds to the systemic amount of the therapeutic agent in a control subject or population wherein the intrathecal dose of the therapeutic agent achieved a therapeutically effective uptake to the brain. In an embodiment, and / or in combination, the pre-determined value corresponds to a safe amount of the therapeutic agent. For example, in an embodiment, the pre-determined value or range is a value or range of the systemic amount of the therapeutic agent in the subject that corresponds to the therapeutic agent achieving a safe therapeutic effect on the brain of the subject.

[0038] In embodiments, the pre-determined value or range is defined as the systemic amount of the therapeutic agent in a control population or subject, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50% of the intrathecal dose is taken up by the brain of the control subject. In an embodiment with a control population, the % brain uptake is the average (such as the mean) of the brain uptake in the control population. In embodiments of this type, the pre-determined value or range corresponds to the desired outcome or therapeutic effect of the therapeutic agent on the brain being achieved.

[0039] In an embodiment, the method comprises continuing with intrathecal administration to a subject if the systemic amount of the therapeutic agent in the subject indicates that intrathecal administration will be successful. In an embodiment, the method comprises not continuing with intrathecal administration to a subject if the systemic amount of the therapeutic agent in the subject indicates that intrathecal administration will not be successful. In an embodiment, the method comprises determining whether the systemic amount of the therapeutic agent in the subject is less than, equal to, within or greater than a predetermined value or range. Accordingly, in an embodiment, the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than a predetermined value or range or equal to or within a pre-determined value or range, determining that a further intrathecal dose of the therapeutic agent will be administered to the subject; or ii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, determining that a further intrathecal dose of the therapeutic agent will not be administered to the subject.

[0040] In an embodiment, the method comprises reducing the further dose of thetherapeutic agent if the systemic amount of the therapeutic agent in the subject indicates that the prior dose is greater than the dose needed to achieve the therapeutic effect, and / or greater than the desired or maximum safe dose to the brain. In an embodiment, the method comprises maintaining the further dose of the therapeutic agent if the systemic amount of the therapeutic agent in the subject indicates that the prior dose is suitable for achieving or achieves the therapeutic effect. In an embodiment, the method comprises increasing the further dose of the therapeutic agent if the systemic amount of the therapeutic agent indicates that the prior dose is smaller than the dose needed to achieve the therapeutic effect, an increased therapeutic effect, the desired therapeutic effect or the maximum therapeutic effect. Accordingly, in an embodiment, the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than a predetermined value or range, determining the further intrathecal dose of the therapeutic agent to be less than or the same as the prior intrathecal dose of the therapeutic agent that was administered to the subject; or ii) if the systemic amount of the therapeutic agent in the subject is the same as or within a pre-determined value or range, determining the further intrathecal dose of the therapeutic agent to be the same as the prior intrathecal dose of the therapeutic agent that was administered to the subject; or iii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, determining the further intrathecal dose of the therapeutic agent to be greater than the prior intrathecal dose of the therapeutic agent that was administered to the subject.

[0041] In an embodiment, a further dose “less than” the prior dose means substantially less than. In an embodiment, a further dose “the same as” the prior dose means substantially the same as. In an embodiment, a further dose “the same as” the prior dose means substantially the same as or equivalent to. In an embodiment, a further dose “the same as” the prior dose means that both doses achieve substantially the same therapeutic effect. In an embodiment, a further dose “greater than” the prior dose means that the further dose achieves a substantially greater therapeutic effect than the prior dose. In an embodiment, a further dose “greater than” the prior dose means that the further dose achieves a therapeutic effect that is not achieved or achievable by the prior dose.

[0042] In an embodiment, “determining” the further intrathecal dose means predicting the nature of the further intrathecal dose. In an embodiment, “determining” the further intrathecal dose means deciding the nature of the further intrathecal dose. In an embodiment, “determining” the further intrathecal dose means prescribing the further intrathecal dose to the subject. In an embodiment, the method further comprises administering the determined further intrathecal dose to the subject.

[0043] In an embodiment of any of the methods of the present invention, step a) comprises measuring the amount of the therapeutic agent in an in vitro sample obtained from the subject.

[0044] In an embodiment of any of the methods of the present invention, step a) comprises measuring the concentration of the therapeutic agent in the plasma of the subject.

[0045] In an embodiment of any of the methods of the present invention, the predetermined value is the same as, equivalent to or derived from the systemic amount of the therapeutic agent that was present in a control population / subject, wherein the control population / subject had a therapeutically effective brain uptake of the therapeutic agent. A surprising result of the present invention is that the negative correlation between the systemic amount of the therapeutic agent resulting from an intrathecal dose and the brain uptake of the intrathecal dose is extremely robust. It applies independently of the specific intrathecal administration procedure that is carried out, the flush and volume administered, and the exercise of the subject. It also applies independently of patient specifics such as age, sex and BMI, although the skilled person can take such factors into account to obtain an even more precise prediction / dose determination. As such, now that the invention has been realised, the systemic amount of a therapeutic agent following intrathecal administration that is known to correspond to an effective dose to the brain in a control population / subject can be taken as a reference value and compared to the systemic amount of the therapeutic agent in the subject of the method of the present invention. In an embodiment, the control subject is equivalent to the subject of the method of the present invention. In an embodiment, the control population comprises one or more individuals who are equivalent to the subject of the method of the present invention. In an embodiment, in this context “equivalent to” means having a correlation between intrathecal dose and brain uptake which is similar to or equivalent to that of the subject of the present invention.

[0046] In an embodiment, the method comprises designating the subject as a nonresponder to the therapeutic agent if the systemic amount of the therapeutic agent in the subject is greater than a pre-determined value or range. Preferably in this embodiment, the predetermined value or range is that of a responder control subject / population. In an embodiment, the method comprises designating the subject as a non-responder to the therapeutic agent if the systemic amount of the therapeutic agent in the subject is greater than or equal to a predetermined value or range. Preferably in this embodiment, the pre-determined value or range is that of a non-responder control subject / population. In an embodiment, the method comprises designating the subject as a responder to the therapeutic agent if the systemic amount of the therapeutic agent in the subject is less than a pre-determined value or range. Preferably in this embodiment, the pre-determined value or range is that of a non-responder control subject / population. In an embodiment, the method comprises designating the subject as a responder to the therapeutic agent if the systemic amount of the therapeutic agent in the subject is less than or equal to a pre-determined value or range. Preferably in this embodiment, the predetermined value or range is that of a responder control subject / population. In embodiments of this type, “responder” and “non-responder” may respectively mean “responder” and “non- responder” to an intrathecal dose of the therapeutic agent that is the same as, equivalent to or similar to the prior intrathecal dose of the therapeutic agent.Therapeutic agents

[0047] In an embodiment, the therapeutic agent is a drug, substance or composition. In an embodiment, the therapeutic agent is any agent capable of having a beneficial therapeutic effect. In an embodiment, the therapeutic agent is any agent capable of having a beneficial therapeutic effect on the brain of a subject. In an embodiment, the therapeutic agent is any drug targeting the brain of a subject. In an embodiment, the therapeutic agent is synthetic, man-made or does not occur in nature. In an embodiment, the therapeutic agent is any agent capable of treating, reversing, curing, preventing, ameliorating or otherwise directly improving a disease, infection or medical condition, or any of the symptoms thereof. Therapeutic agents are known to the skilled person and it is to be understood that the present invention is not limited to any particular therapeutic agent. In an embodiment, the therapeutic agent is suitable for intrathecal administration. In a preferred embodiment, the therapeutic agent is suitable for or capable of achieving its therapeutic effect via intrathecal administration. In an embodiment, the therapeutic agent is a therapeutic agent targeting the brain. In an embodiment, the therapeuticagent is suitable for / capable of targeting the brain when administered intrathecally. In an embodiment, the therapeutic agent has appropriate physiochemical properties, such as hydrophobicity, hydrophilicity, size, mass and charge, for intrathecal administration for safely having its therapeutic effect on the brain when administered intrathecally. In an embodiment, the therapeutic agent is capable of passing through the BBB and / or the blood-spinal cord barrier (BSCB). In an embodiment, the therapeutic agent has appropriate physiochemical properties for passing through the BBB and / or BSCB.

[0048] In an embodiment, the therapeutic agent is an RNAi (RNA interference) oligonucleotide, antibody, antibody-derived therapeutic or antigen-binding fragment thereof, monoclonal antibody, ScFv, Fab fragment, F(ab’2) fragment, minibody, nanobody, bispecific antibody, immunotoxin, antibody-drug conjugate, antisense oligonucleotide, small molecule, biologic, vaccine, polypeptide, enzyme, peptide therapeutic, nucleic acid-based therapy, cellular therapy, immunomodulator, enzyme inhibitor, hormone, cytokine or radiopharmaceutical. In a preferred embodiment, the therapeutic agent is an oligonucleotide, optionally selected from an antisense oligonucleotide, siRNA (small inhibitory RNA), miRNA (microRNA), other RNAi oligonucleotides, aptamers and other non-coding RNA, preferably an antisense oligonucleotide. In an embodiment, the therapeutic agent is rugonersen, nusinersen, tofersen, tadnersen, eteplirsen, inotersen, morphine, baclofen, methotrexate, hydrocortisone, cytarabine (Ara-C), cytotoxic agents, a local anaesthetic, clonidine, ziconotide, bupivacaine, fentanyl, sufentanil, morphine sulfate, hydromorphone, triamcinolone, or busulfan. In a preferred embodiment, the therapeutic agent is rugonersen, as defined herein.

[0049] In an embodiment, the therapeutic agent is an antisense oligonucleotide targeting a UBE3A suppressor. In an embodiment, the therapeutic agent is an antisense oligonucleotide targeting the SNHG14 long non-coding RNA transcript downstream of SNORD109B. Such antisense oligonucleotides are described in WO2017 / 081223A1, which is incorporated by reference herein in its entirety. In an embodiment, the therapeutic agent is an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to position 25278410 to 25419462 on human chromosome 15.

[0050] In an embodiment, the therapeutic agent is an antisense oligonucleotide comprising the sequence set forth in SEQ ID NO: 1 (TTACACTTAATTATACTTCC). In an embodiment, the therapeutic agent is an antisense oligonucleotide with the sequence consistingof SEQ ID NO: 1 (TTACACTTAATTATACTTCC). In an embodiment, the therapeutic agent is an antisense oligonucleotide wherein the oligonucleotide is the oligonucleotide compound TTAcActtaattatactTCC (CMP ID NO: 1) wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0051] In an alternative embodiment, the therapeutic agent is an antisense oligonucleotide comprising the sequence set forth in SEQ ID NO: 2 (AATTATTTATACACCATCAT). In an embodiment, the therapeutic agent is an antisense oligonucleotide with the sequence consisting of SEQ ID NO: 2(AATTATTTATACACCATCAT). In an embodiment, the therapeutic agent is an antisense oligonucleotide wherein the oligonucleotide is the oligonucleotide compoundAAtTaTttatacacCATcAT (CMP ID NO: 2) wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0052] The term “oligonucleotide” as used herein is known in the art and generally comprises a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is manmade, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.

[0053] The term “Antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded.

[0054] The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term“oligonucleotide motif sequence”. In some embodiments all the nucleotides of the oligonucleotide are present in the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence and may, optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0055] The term complementarity describes the capacity for Watson-Crick basepairing of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T) / uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non- modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0056] The term “% complementary” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to (i.e. form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which does not align (form a base pair) is termed a mismatch.

[0057] Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.

[0058] LNA nucleosides are modified nucleosides which comprise a linker group (referred to as a biradicle or a bridge) between C2’ and C4’ of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid(BNA) in the literature. Betta-D-oxy LNA nucleosides have the following structure:

[0059] A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In preferred embodiments at least 50% of the intemucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the intemucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the intemucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.

[0060] In embodiments, the therapeutic agent used in the present invention is comprised in a pharmaceutical composition comprising the therapeutic agent (which is preferably an antisense oligonucleotide) and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0061] WO 2007 / 031091 provides suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in W02007 / 031091.

[0062] Therapeutic agents used in the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration,extent of disease, or dose to be administered. In this respect, it will be apparent that most preferably the pharmaceutical composition is suitable for intrathecal administration.

[0063] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular with respect to oligonucleotide conjugates the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell, e.g. a target brain cell.Therapeutic uses

[0064] In a further aspect, the present invention provides a therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.

[0065] In a further aspect, the present invention provides a method of treating a subject with a therapeutic agent, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.

[0066] In a further aspect, the present invention provides the use of a therapeutic agent in manufacturing a medicament for treating a subject, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.

[0067] In an embodiment, any treatment of the invention may further comprise:i) if the systemic amount of the therapeutic agent was higher than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is greater than the prior intrathecal dose; or ii) if the systemic amount of the therapeutic agent was equal to or within the predetermined value or range, administering a further intrathecal dose of the therapeutic agent that is the same than the prior intrathecal dose; or iii) if the systemic amount of the therapeutic agent was lower than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is lower than or the same as the prior intrathecal dose.

[0068] In an embodiment, any treatment of the invention may first comprise administering the prior intrathecal dose to the subject. In an embodiment, the further intrathecal dose that is administered is determined by comparing the systemic amount of the therapeutic agent in the subject with a pre-determined value or range. In an embodiment, the size of the further intrathecal dose that is administered is determined by comparing the systemic amount of the therapeutic agent in the subject with a pre-determined value or range.

[0069] In an embodiment, any treatment of the invention may involve treating a patient subgroup with a further intrathecal dose of a therapeutic agent, wherein the patient subgroup is defined as patients who have received a prior intrathecal dose of the therapeutic agent and have been determined to possess a systemic amount of the therapeutic agent that is within or lower than a pre-determined value or range. In an embodiment, the method comprises measuring the systemic amount of the therapeutic agent. In an embodiment, the pre-determined value or range corresponds to that of a responder control subject or control population of nonresponders to the therapeutic agent. In an embodiment, a “responder” means a control subject / population who has / have been administered an intrathecal dose of the therapeutic agent which had the desired therapeutic effect. In an embodiment, the responder control subject / population has been administered the same intrathecal dose of the therapeutic agent as the prior intrathecal dose administered to the subject of the invention.

[0070] In an embodiment, any treatment of the present invention may comprise or consist of: a) administering a prior intrathecal dose of a therapeutic agent to a subject;b) measuring the systemic amount of the therapeutic agent in the subject, preferably the maximum systemic concentration of the therapeutic agent in the subject; c) comparing the systemic amount of the therapeutic agent in the subject with a predetermined value or range; d) determining that the systemic amount of the therapeutic agent in the subject is lower than or within the pre-determined value or range; and e) administering a further intrathecal dose to the subject.

[0071] In an embodiment, any treatment of the present invention may comprise or consist of: a) administering a prior intrathecal dose of a therapeutic agent to a subject; b) measuring the systemic amount of the therapeutic agent in the subject, preferably the maximum systemic concentration of the therapeutic agent in the subject; c) comparing the systemic amount of the therapeutic agent in the subject with a predetermined value or range; d) determining that the systemic amount of the therapeutic agent in the subject is lower than or within the pre-determined value or range; and e) administering a further intrathecal dose which is greater than the prior intrathecal dose to the subject.

[0072] In an embodiment, any treatment of the present invention may comprise or consist of: a) administering a prior intrathecal dose of a therapeutic agent to a subject; b) measuring the systemic amount of the therapeutic agent in the subject, preferably the maximum systemic concentration of the therapeutic agent in the subject; c) comparing the systemic amount of the therapeutic agent in the subject with a predetermined value or range;d) determining that the systemic amount of the therapeutic agent in the subject is greater than the pre-determined value or range; and e) administering a further intrathecal dose which is less than or the same as the prior intrathecal dose to the subject.

[0073] The term ’treatment’ as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.

[0074] In a preferred embodiment, the disease is Angelman syndrome. In an embodiment, the present invention involves the treatment or prevention of Angelman syndrome. In a preferred embodiment, the subject of the method of the present invention is an individual suffering from or susceptible to Angelman syndrome. In particularly preferred embodiments of these types, the therapeutic agent is an antisense oligonucleotide, preferably rugonersen or the antisense oligonucleotide defined as SEQ ID NO: 1, CMP ID NO: 1, SEQ ID NO: 2 or CMP ID NO: 2.Numbered paragraphs

[0075] The invention will now be further described by way of the following numbered paragraphs:1. A method of determining the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent to determine the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject.2. The method of paragraph 1, wherein there is an inverse correlation between the systemic amount and the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject.3. A method of determining the likelihood of an intrathecal dose of a therapeutic agent to have a therapeutic effect on the brain of a subject who has been administered the intrathecal dose ofthe therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent in the subject to determine the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.4. The method of paragraph 3, wherein there is an inverse correlation between the systemic amount and the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.5. The method of paragraph 3 or 4, wherein the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than, the same as or within a pre-determined value or range, c) determining the intrathecal dose of the therapeutic agent to be likely to have a therapeutic effect; or ii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, c) determining the intrathecal dose of the therapeutic agent to be unlikely to have a therapeutic effect.6. A method of determining, in a subject who has been administered a prior intrathecal dose of a therapeutic agent, a further intrathecal dose of the therapeutic agent to be administered to the subject, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject after the administration of the prior intrathecal dose; and b) using the systemic amount of the therapeutic agent in the subject to determine a further intrathecal dose of the therapeutic agent to be administered to the subject.7. The method of paragraph 6, wherein there is an inverse correlation between the systemic amount and the further dose of the therapeutic agent to be administered to the subject.8. The method of paragraph 6 or 7, wherein the method comprises determining a further intrathecal dose that is predicted to have a therapeutic effect on the brain of the subject.9. The method of any one of paragraphs 6 to 8, wherein the method comprises determining a further intrathecal dose that is predicted to have an increased therapeutic effect on the brain of the subject relative to the prior intrathecal dose.10. The method of any one of paragraphs 6 to 9, wherein the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than a predetermined value or range or equal to or within a pre-determined value or range, determining that a further intrathecal dose of the therapeutic agent will be administered to the subject; or ii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, determining that a further intrathecal dose of the therapeutic agent will not be administered to the subject.11. The method of any one of paragraphs 6 to 9, wherein the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than a predetermined value or range, determining the further intrathecal dose of the therapeutic agent to be less than or the same as the prior intrathecal dose of the therapeutic agent that was administered to the subject; or ii) if the systemic amount of the therapeutic agent in the subject is the same as or within a pre-determined value or range, determining the further intrathecal dose of the therapeutic agent to be the same as the prior intrathecal dose of the therapeutic agent that was administered to the subject; or iii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, determining the further intrathecal dose of the therapeutic agent to be greater than the prior intrathecal dose of the therapeutic agent that was administered to the subject.12. The method of any one of paragraphs 1 to 11, wherein step a) comprises measuring the amount of the therapeutic agent in an in vitro sample obtained from the subject.13. The method of any one of paragraphs 1 to 12, wherein step a) comprises measuring the concentration of the therapeutic agent in the blood or plasma of the subject.14. The method of any one of paragraphs 1 to 13, wherein the therapeutic agent is an oligonucleotide or small molecule, preferably wherein the therapeutic agent is an antisense oligonucleotide.15. The method of any one of paragraphs 1 to 14, wherein the therapeutic agent is an antisense oligonucleotide that induces expression of UBE3A.16. The method of any one of paragraphs 1 to 15, wherein the therapeutic agent is an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to position 25278410 to 25419462 on human chromosome 15.17. The method of any one of paragraphs 1 to 16, wherein the therapeutic agent is an antisense oligonucleotide wherein the oligonucleotide is the oligonucleotide compound TTAcActtaattatactTCC (CMP ID NO: 1) wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.18. The method of any one of paragraphs 1 to 17, wherein the pre-determined value is the same as, equivalent to or derived from the systemic amount of the therapeutic agent that was present in a control population / subject, wherein the control population / subject had a therapeutically effective brain uptake of the therapeutic agent.19. A therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.20. The therapeutic agent for use of paragraph 19, wherein the method further comprises: i) if the systemic amount of the therapeutic agent was higher than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is greater than the prior intrathecal dose; or ii) if the systemic amount of the therapeutic agent was equal to or within the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is the same than the prior intrathecal dose; or iii) if the systemic amount of the therapeutic agent was lower than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is lower than or the same as the prior intrathecal dose.21. A method of treating a subject with a therapeutic agent, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.22. The method of paragraph 21, wherein the method further comprises: i) if the systemic amount of the therapeutic agent was higher than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is greater than the prior intrathecal dose; or ii) if the systemic amount of the therapeutic agent was equal to or within the predetermined value or range, administering a further intrathecal dose of the therapeutic agent that is the same than the prior intrathecal dose; or iii) if the systemic amount of the therapeutic agent was lower than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is lower than or the same as the prior intrathecal dose.

[0076] The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention.EXAMPLES

[0077] A mixture of 10 mg rugonersen and radiolabelled [89Zr]DFO-rugonersen was administered to healthy male participants by intrathecal administration with different flush volumes. The fraction of the administered dose of rugonersen delivered to the brain (sum ofgrey matter, white matter and brain CSF, %ID) was quantified by PET / CT. In parallel, blood samples were collected at different time points to determine rugonersen plasma concentrations.

[0078] To quantify the amount of [89Zr]DFO-rugonersen in the brain region, the PET images were co-registered with MRI scans to define the volumes of interests (VOIs). As part of the normalization, the MRI image were divided into 6 segments: grey matter (GM), white matter (WM), CSF, non-brain soft tissue, skin and skull, and remaining tissue. The delivery to the head was calculated as the sum of GM, WM, and brain CSF.

[0079] Concentrations of rugonersen were measured by a specific and validated hELISA method. The lower limit of quantification of rugonersen was <0.049 nmol / L. Rugonersen concentrations measured from venous plasma samples and capillary plasma samples were both measured and determined to be comparable. Protocols for each measurement are as follows:

[0080] Venous Plasma: following IT administration of 10 mg [89Zr]DFO- rugonersen, rugonersen concentrations were first detected in venous plasma at 1 hour after administration (first postdose blood sampling time point) in 22 participants and at 2 hours after administration in 2 participants, and remained quantifiable up to 24 hours postdose in all 24 participants. The individual maximum rugonersen plasma concentrations ranged between 1.20 nmol / L and 7.90 nmol / L and were observed at 3 hours to 24 hours postdose.

[0081] Capillary Plasma: following IT administration of 10 mg [89Zr]DFO- rugonersen, rugonersen concentrations were first detected in capillary plasma at 2 hours after administration (first postdose blood sampling time point) in 24 participants and remained quantifiable up to 24 hours postdose in all 24 participants. The individual maximum rugonersen plasma concentrations ranged between 0.991 nmol / L and 7.14 nmol / L and were observed at 2 hours to 24 hours postdose.

[0082] All IT procedures showed similar kinetics in the brain uptake of [89Zr]DFO-rugonersen over the course of the study duration. Low uptake rates in the brain were observed on Day 1 and the highest uptake rate was observed on Day 2. Uptake values remained constant from Day 5 until the last measurement on Day 12. Brain uptake showed a large variation from 5% to 46%.

[0083] For each individual participant, the highest plasma concentration achievedwas determined (Cmax). Individual plasma Cmax concentrations (nmol / L) versus sum of %ID in the head (GM, WM, and brain CSF) observed on Day 5 are provided in Figure 1. Surprisingly, individuals showing a high plasma Cmax of rugonersen after the IT administration consistently show lower brain delivery assessed by PET imaging. This inverse correlation was observed independently of the IT administration procedure, and was observed in each of procedures A, B, C and D in Figure 1 (A= 5 mL CSF and 5 mL flush, no exercise; B= 0.5 mL CSF and 0.5 mL flush, no exercise; C= 15 mL CSF and 15 mL flush, no exercise; D= 0.5 mL CSF and 0.5 mL flush, with exercise).

[0084] Thus, the present inventors identified that the brain uptake and delivery of an intrathecal dose of a therapeutic agent within a subject can be determined as an inverse correlation to the systemic amount of the therapeutic agent present in the subject, following the intrathecal dose of the therapeutic agent. Thus, determining the systemic amount of a therapeutic agent in a subject following a prior intrathecal dose can be used to determine the brain uptake, likelihood of effectiveness and subsequent doses of the therapeutic agent. These findings are not considered to be limited to rugonersen, and it is considered that the skilled person can make appropriate adjustments to make similar determinations in the same way in respect of other intrathecal doses of appropriate therapeutic agents.

[0085] The disclosure illustratively described herein suitably can be practised in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. The terms "comprising", "comprises" and "comprised of as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms "comprising", "comprises" and "comprised of also include the term "consisting of. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the description and the appended claims.

[0086] The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (z.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0087] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description.

[0088] According to the invention all embodiments for oligonucleotides for use in a method are also considered to be methods of treatment and / or for use in the manufacture of a medicament.

[0089] The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

CLAIMS1. A method of determining the uptake of an intrathecal dose of a therapeutic agent to the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent to determine the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject.

2. The method of claim 1, wherein there is an inverse correlation between the systemic amount and the uptake of the intrathecal dose of the therapeutic agent to the brain of the subject.

3. A method of determining the likelihood of an intrathecal dose of a therapeutic agent to have a therapeutic effect on the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject; and b) using the systemic amount of the therapeutic agent in the subject to determine the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.

4. The method of claim 3, wherein there is an inverse correlation between the systemic amount and the likelihood of the intrathecal dose of the therapeutic agent to have a therapeutic effect on the brain of the subject.

5. The method of claim 3 or 4, wherein the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than, the same as or within a pre-determined value or range, c) determining the intrathecal dose of the therapeutic agent to be likely to have a therapeutic effect; or ii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, c) determining the intrathecal dose of the therapeutic agent to be unlikely to have a therapeutic effect.

6. A method of determining, in a subject who has been administered a prior intrathecal dose of a therapeutic agent, a further intrathecal dose of the therapeutic agent to be administered to the subject, the method comprising: a) determining the systemic amount of the therapeutic agent in the subject after the administration of the prior intrathecal dose; and b) using the systemic amount of the therapeutic agent in the subject to determine a further intrathecal dose of the therapeutic agent to be administered to the subject.

7. The method of claim 6, wherein there is an inverse correlation between the systemic amount and the further dose of the therapeutic agent to be administered to the subject.

8. The method of claim 6 or 7, wherein the method comprises determining a further intrathecal dose that is predicted to have a therapeutic effect on the brain of the subject, optionally wherein the method comprises determining a further intrathecal dose that is predicted to have an increased therapeutic effect on the brain of the subject relative to the prior intrathecal dose.

9. The method of any one of claims 6 to 8, wherein the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than a predetermined value or range or equal to or within a pre-determined value or range, determining that a further intrathecal dose of the therapeutic agent will be administered to the subject; or ii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, determining that a further intrathecal dose of the therapeutic agent will not be administered to the subject.

10. The method of any one of claims 6 to 8, wherein the method further comprises: i) if the systemic amount of the therapeutic agent in the subject is less than a predetermined value or range, determining the further intrathecal dose of the therapeutic agent to be less than or the same as the prior intrathecal dose of the therapeutic agent that was administered to the subject; or ii) if the systemic amount of the therapeutic agent in the subject is the same as or within a pre-determined value or range, determining the further intrathecal dose of thetherapeutic agent to be the same as the prior intrathecal dose of the therapeutic agent that was administered to the subject; or iii) if the systemic amount of the therapeutic agent in the subject is greater than a predetermined value or range, determining the further intrathecal dose of the therapeutic agent to be greater than the prior intrathecal dose of the therapeutic agent that was administered to the subject.

11. The method of any one of claims 1 to 10, wherein step a) comprises measuring the amount of the therapeutic agent in an in vitro sample obtained from the subject, optionally wherein step a) comprises measuring the concentration of the therapeutic agent in the blood or plasma of the subject.

12. The method of any one of claims 1 to 11, wherein the therapeutic agent is an oligonucleotide or small molecule, preferably wherein the therapeutic agent is an antisense oligonucleotide, optionally wherein the therapeutic agent is an antisense oligonucleotide that induces expression of UBE3 A, optionally wherein the therapeutic agent is an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to position 25278410 to 25419462 on human chromosome 15, optionally wherein the therapeutic agent is an antisense oligonucleotide wherein the oligonucleotide is the oligonucleotide compound TTAcActtaattatactTCC (CMP ID NO: 1) wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and all intemucleoside linkages are phosphorothioate intemucleoside linkages.

13. The method of any one of claims 1 to 12, wherein the pre-determined value is the same as, equivalent to or derived from the systemic amount of the therapeutic agent that was present in a control population / subject, wherein the control population / subject had a therapeutically effective brain uptake of the therapeutic agent.

14. A therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, the systemic amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to possess a systemic amount of the therapeutic agent which is higher than, equal to or within, or lower than a pre-determined value or range, wherein the method comprises administering a further intrathecal dose of the therapeutic agent.

5. The therapeutic agent for use of claim 14, wherein the method further comprises: i) if the systemic amount of the therapeutic agent was higher than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is greater than the prior intrathecal dose; or ii) if the systemic amount of the therapeutic agent was equal to or within the predetermined value or range, administering a further intrathecal dose of the therapeutic agent that is the same than the prior intrathecal dose; or iii) if the systemic amount of the therapeutic agent was lower than the pre-determined value or range, administering a further intrathecal dose of the therapeutic agent that is lower than or the same as the prior intrathecal dose.

Images