Anticancer composition for co-administration with anticancer agent, comprising novel peptide as active ingredient

Abstract

The present invention relates to a combination therapy of a TB511 peptide having an anticancer effect by specifically binding to CD18, and a cancer immunotherapy agent. The TB511 of the present invention specifically binds to CD18 having an activated form of M2-tumor-associated macrophages (M2-TAMs) contributing to tumor progression in the tumor microenvironment (TME), and thus induces apoptosis, does not exhibit toxicity against other tissue-resident macrophages that are not M2-TAMs, and, in various cancer models and humanized mouse models, increases the infiltration of tumor-killing cells and exhibits an antitumor effect, and particularly, exhibits a synergistic antitumor effect when used in combination with another cancer immunotherapy agent, and thus may be used as a cancer immunotherapy agent or a combination therewith.

Description

Anticancer composition for co-administration with an anticancer agent containing a novel peptide as an active ingredient

[0001] The present invention relates to a combination therapy of a TB511 peptide that specifically binds to CD18 and has an anticancer effect and an anticancer agent.

[0002] Conventional cancer treatments have been researched to either directly attack cancer cells or enhance the activity of the body's immune cells that attack cancer cells. However, these anticancer drugs also attack normal cells in addition to cancer cells, resulting in numerous side effects such as hair loss, nausea, and vomiting. Furthermore, they can cause additional reactions due to excessive proliferation of immune cells. Compared to conventional chemotherapy or radiation therapy, cancer immunotherapy utilizes the body's own immune system to treat cancer, minimizing side effects. Among these cancer immunotherapy techniques, cell therapy methods, which activate therapeutic immune cells such as T cells (including CAR-T cells), dendritic cells, and natural killer cells ex vivo and then directly inject them into the body, are actively being developed. Methods such as anticancer vaccines, which directly activate the body's own immune cells by injecting cancer antigens and immune-activating substances, are also being actively pursued. However, these cell therapies and cancer vaccines are mainly used for hematological malignancies, and most of them have a very low therapeutic efficacy in solid tumors. One reason for this is due to microenvironmental factors that suppress immune function around solid tumors. In fact, cells that reduce immune cell function in the tumor microenvironment (MDSC: myeoloid-derived stromal cells, Treg: regulatory T cells, TAM: tumor-associated macrophages) and immunosuppressive cytokines and metabolites are actively working, rapidly reducing the activity of immune-stimulating substances and therapeutic immune cells. Therefore, it is becoming increasingly important to develop treatments that have anticancer effects by controlling only the microenvironment surrounding tumor cells without directly affecting tumor cells or immune cells, thereby blocking nutrient supply to tumor cells and angiogenesis around tumor cells.The tumor microenvironment is considered a significant therapeutic target because it contributes to malignant cell proliferation and survival, angiogenesis, metastasis, abnormal adaptive immunity, and reduced response to hormones and chemotherapeutic agents.

[0003] The tumor microenvironment is composed of endothelial cells, inflammatory cells, and fibroblasts. In the 1970s, tumor-associated macrophages (TAMs) were identified as playing a crucial role in tumor growth. TAMs play a crucial role in the overall tumor microenvironment, including cancer growth and metastasis, and are classified into two phenotypes: tumor-suppressive M1 macrophages and tumor-supportive M2 macrophages. M1 macrophages possess potent antigen-presenting abilities and are generally activated by interferon-γ, lipopolysaccharide (LPS), and tumor necrosis factor (TNF)-α, exhibiting proinflammatory and bactericidal effects. M2 macrophages are known to promote immunosuppression, tumorigenesis, and angiogenesis by releasing various extracellular matrix components, angiogenic and chemotactic factors. In general, they are induced by IL-4 and IL-13, and are distinguished from M1 type tumor-associated macrophages by expressing markers such as arginase-1, mannose (MMR, CD206), scavenger receptors (SR-A, CD204), CD163, and IL-10. Tumor-associated macrophages present around tumors are closely related to tumor cell growth and metastasis, and it has been reported that the presence of a large number of M2 type tumor-associated macrophages around tumors in cancer patients is associated with poor patient prognosis and survival rate. M2 type macrophages produce cytokines such as IL-10, TGFβ, and CCL18 that promote cancer growth, and receptors such as PDL1 and B7-1 / 2 present on the surface of M2 type tumor-associated macrophages have been reported to suppress the antitumor activity of T cells and NK cells. Since tumor growth, differentiation, and metastasis occur actively in a microenvironment where a large number of M2-type tumor-associated macrophages exist, development of targeted therapeutics targeting M2-type tumor-associated macrophages is necessary.

[0004] Meanwhile, cancer cells express immune checkpoint proteins on their surface, which are used by normal cells to suppress immune cell activation in order to avoid the killing mechanism of immune cells. Recently, research on immune checkpoint inhibitor proteins as a method for treating cancer is actively being conducted. Among immune checkpoint inhibitor proteins, blocking PD-1 / PD-L1 binding in particular is very effective in cancer treatment, and it has been reported in academic circles that it has fewer side effects than other immune checkpoint inhibitor proteins (J. Naidoo et al. (2015) Annals of Oncology, Lucia Gelao et al. (2014) Toxins, Gorge K. Philips et al (2015) International Immunology). The PD-1 receptor is expressed on the surface of activated immune cell types, including T cells, B cells, and natural killer (NK) / natural killer T (NKT) cells (Goodman, Patel & Kurzrock, PD-1-PD-L1 immune-checkpoint blockade in B-cell lymphomas, Nature Reviews Clinical Oncology, 14:203-220, 2017). PD-1 is a negative regulator of T cell activation, and the interaction of PD-1 with one of its ligands, PD-L1, on the tumor surface represents an immune checkpoint blockade that reduces the ability of activated T cells to generate an effective immune response. Therapeutic antibodies targeting PD-1 or PD-L1 block ligand-receptor interactions and restore immune function to the tumor microenvironment.Several therapeutic monoclonal antibodies (mAbs) targeting PD-1 and PD-L1 are on the market, and anti-PD1 antibody treatments that inhibit the binding of PD-1 and PD-L1, such as Opdivo (nivolumab) from BMS, Keytruda (Pembrolizumab) from Merck, and Libtayo (Cemiplimab) developed by Regeneron, and anti-PD-L1 antibody treatments, such as Tecentriq (Atezolizumab) from Roche, Imfinzi (Durvalumab) from AstraZeneca, and Bavencio (Avelumab) from Merck Sereno, have received US FDA approval and are revolutionizing the treatment of intractable cancers in clinical trials.

[0005] An object of the present invention is to provide a chimeric antigen receptor comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2 as an antigen binding domain.

[0006] Furthermore, it is an object of the present invention to provide a recombinant vector comprising a gene encoding a chimeric antigen receptor.

[0007] In addition, it is an object of the present invention to provide a chimeric antigen receptor expressing cell transformed with a recombinant vector.

[0008] In addition, it is an object of the present invention to provide a T cell engager comprising a peptide of sequence number 1 or sequence number 2.

[0009] In addition, it is an object of the present invention to provide a pharmaceutical composition for preventing or treating cancer.

[0010] In addition, it is an object of the present invention to provide a combination for preventing or treating cancer.

[0011] In addition, it is an object of the present invention to provide a composition for diagnosing cancer.

[0012] In addition, the purpose of the present invention is to provide a method for preventing or treating cancer.

[0013] To solve the above problem, the present invention provides a chimeric antigen receptor comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2 as an antigen binding domain.

[0014] Additionally, the present invention provides a recombinant vector comprising a gene encoding the chimeric antigen receptor.

[0015] Additionally, the present invention provides a chimeric antigen receptor expressing cell transformed with the recombinant vector.

[0016] Additionally, the present invention provides a T cell engager comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2.

[0017] In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising a peptide of the above sequence number 1 or sequence number 2, a chimeric antigen receptor, a chimeric antigen receptor expressing cell, or a T cell engager as an active ingredient.

[0018] In addition, the present invention provides a combination for preventing or treating cancer, comprising a peptide of the above-described sequence number 1 or sequence number 2, a chimeric antigen receptor, a chimeric antigen receptor expressing cell, or a T cell engager; and an immunotherapy agent, a chemotherapeutic agent, or an antibody-drug conjugate (ADC).

[0019] In addition, the present invention provides a composition for diagnosing cancer, comprising a peptide of sequence number 1 or sequence number 2, a chimeric antigen receptor, a chimeric antigen receptor expressing cell, or a T cell engager as an active ingredient.

[0020] In addition, the present invention provides a method for preventing or treating cancer, comprising a step of administering the pharmaceutical composition or the combination to a subject.

[0021] TB511 of the present invention induces apoptosis by specifically binding to CD18 of activated form of M2-Tumor-associated macrophages (M2-TAMs) that contribute to tumor progression in the tumor microenvironment (TME), and does not exhibit toxicity to tissue-resident macrophages other than M2-TAMs, and increases the infiltration of tumor killer cells and exhibits antitumor effects in various cancer models and humanized mouse models, and in particular, exhibits a synergistic antitumor effect when combined with other immunotherapy drugs, and thus can be utilized as an immunotherapy drug or a combination thereof.

[0022] Figures 1 to 11 are diagrams analyzing the target of TB511 and analyzing the relationship between CD18, the target of TB511, and the progression of solid tumors:

[0023] Figure 1: Target protein analysis process of TB511;

[0024] Figure 2: Verification results of CD18 knockdown cells;

[0025] Figure 3: Cell viability analysis results;

[0026] Figure 4: Results of direct binding analysis of TB511 and CD18;

[0027] Figure 5: Results of localization analysis of TAMpep and CD18 in M2 macrophages;

[0028] Figures 6 and 7: Results of CD18 expression analysis in solid tumors; and

[0029] Figures 8 to 11: Results of CD18 expression analysis according to macrophage subtype.

[0030] Figures 12 to 15 are diagrams showing the results of analysis of membrane proteins of M0, M1, and M2 macrophages that bind to TAMpep.

[0031] Figure 12: Proteins extracted from M0 macrophages;

[0032] Figure 13: Proteins extracted from M1 macrophages;

[0033] Figure 14: Proteins extracted from M2 macrophages; and

[0034] Figure 15: Ratios of M2 / M0 and M2 / M1.

[0035] Figures 16 and 17 are diagrams showing the results of analyzing the binding affinity of TAMpep to CD18:

[0036] a: Binding affinity of TAMpep to CD18; and

[0037] b: Binding affinity of anti-CD18 antibody to CD18.

[0038] Figures 18 to 26 are diagrams analyzing the cytotoxicity induction effect through CD18 structure-specific targeting of TB511:

[0039] Figure 18: Results of protein-peptide interaction modeling analysis;

[0040] Figure 19: Results of CD18 binding site analysis of TB511;

[0041] Figures 20 and 21: Cytotoxicity analysis results of TB511 depending on CD18 activation;

[0042] Figure 22: Results of analysis of CD18 activation level according to tumor microenvironment induction;

[0043] Figure 23: Results of analysis of CD18 activation levels according to macrophage subtypes;

[0044] Figures 24 and 25: Apoptosis analysis results of TB511 according to macrophage subtype; and

[0045] Figure 26: Results of analysis of CD18 activation levels in tumor tissue.

[0046] Figures 27 to 34 are diagrams analyzing the internalization and endosomal escape of TB511 in M2 macrophages:

[0047] Figure 27: Results of distribution analysis of TB511 in M2 macrophages;

[0048] Figures 28 to 30: Results of 3D spatial trajectory analysis of TB511.

[0049] Figure 31: Results of localization analysis of early endosome antigen 1 (EEA1) and TB511-Cy5 in endosomes following treatment with CPZ (chlorpromazine), M*?*CD (methyl-_-cyclodextrin), or CyD (cytochalasin D);

[0050] Figure 32: Results of TB511-induced apoptosis analysis according to treatment with CPZ (chlorpromazine), M_CD (methyl-_-cyclodextrin), or CyD (cytochalasin D);

[0051] Figure 33: Results of localization analysis of early endosome antigen 1 and TB511-Cy5 in endosomes according to treatment; and

[0052] Figure 34: Results of TB511-induced apoptosis analysis following Baf-A1 (bafilomycin A1) or CQ (chloroquine) treatment.

[0053] Figures 35 to 53 are diagrams analyzing the antitumor effect of TB511:

[0054] Figures 35 to 37: Antitumor effect of TB511 in a mouse model of immunotherapy-unresponsive tumors (Cold tumors);

[0055] Figures 38 to 41: Antitumor effect of TB511 in a mouse model of immunotherapy-responsive tumors (Hot tumors);

[0056] Figures 42 to 47: Results of selective targeting analysis of TB511 on macrophage subtypes in tumor tissue; and

[0057] Figures 49 to 51: Results of macrophage count analysis in normal and tumor tissues.

[0058] Figures 52 to 55 are diagrams analyzing the tumor targeting of TB511 through a biological distribution analysis of TB511 in a breast cancer mouse model.

[0059] Figures 56 to 72 are diagrams analyzing immune cell changes caused by TB511 in the TME:

[0060] Figures 56 and 57: Results of analysis of changes in CD8+ T and NK cells in prostate cancer (PC) specimens;

[0061] Figures 58 and 59: Results of analysis of the effects of CD8+ T and NK cells on the antitumor effect of TB511 in prostate cancer (PC) specimens;

[0062] Figure 60: Process for manufacturing NK or CD8 deficient colon cancer mouse model;

[0063] Figures 61 to 63: Results of cell viability analysis in the control group (isotype control), CD8+ T cell depletion group (CD8 depletion), and NK cell depletion group (NK depletion) in a prostate cancer cell line injection mouse model;

[0064] Figures 64 and 65: Results of analysis of the number of tumor-infiltrating CD8+ T cells and the number of exhausted CD8+ T cells in a lung cancer cells (LLC) injection mouse model;

[0065] Figures 66 and 67: Results of analysis of the number of anti-tumor immune cells in colorectal cancer (CRC) cells;

[0066] Figures 68 and 69: Results of CD8+ T and Granzyme B+ cell count analysis;

[0067] Figure 70: Manufacturing process of CD8 deficient colon cancer mouse model;

[0068] Figure 71: Antitumor effect of TB511 in control mice; and

[0069] Figure 72: Antitumor effect of TB511 in a CD8-deficient colon cancer mouse model.

[0070] Figures 73 to 76 are diagrams analyzing the number of CD8+ T and NK cells in the blood of a CD8 deficient mouse model (a) or an NK deficient mouse model (b).

[0071] Figures 77 to 93 are diagrams evaluating the clinical potential of TB511:

[0072] Figure 77: Process for manufacturing a humanized prostate cancer mouse model;

[0073] Figure 78: Antitumor effect of TB511 in immunodeficient mice;

[0074] Figure 79: Antitumor effect of TB511 in humanized prostate cancer mice;

[0075] Figures 80 to 82: Analysis of human immune cells infiltrating the TME;

[0076] Figure 83: Process for manufacturing a humanized lung cancer mouse model;

[0077] Figure 84: Antitumor effect of TB511 in immunodeficient mice;

[0078] Figure 85: Antitumor effects of TB511 alone, anti-PD-1 antibody alone, and TB511 and anti-PD-1 antibody combination in humanized lung cancer mice;

[0079] Figures 86 to 88: Cell count analysis results of M2-TAMs (CD86+CD11b+ / CD45+ cells);

[0080] Figures 89 to 91: Cell count analysis results of depleted CD8+ T-cells (PD-1+CD8+ / CD45+ cells); and

[0081] Figures 92 and 93: CD8+ cell counts in each group determined by immunohistochemical staining in humanized non-small cell lung cancer (NSCLC) tumor tissues.

[0082] Figures 94 to 99 are diagrams analyzing the synergistic effect of combined administration of TB511 and an immune checkpoint inhibitor.

[0083] Figure 94: Process for manufacturing hPD-L1 MC38 tumor-humanized PD-1 mouse model;

[0084] Figure 95: Tumor volume of the control group;

[0085] Figure 96: Tumor volume in the anti-PD-1 monotherapy group;

[0086] Figure 97: Tumor volume in the TB511 monotherapy group;

[0087] Figure 98: Tumor volume of the group administered with combination of TB511 and anti-PD-1 antibody; and

[0088] Figure 99: Survival rate of mice in each group.

[0089] Figures 100 to 105 are diagrams analyzing the anticancer effect of combined administration of TB511 and oxaliplatin.

[0090] Figure 100: Manufacturing process of colon cancer mouse model and drug administration;

[0091] Figure 101: Tumor volume of the control group;

[0092] Figure 102: Tumor volume of the control group;

[0093] Figure 103: Tumor volume in the TB511 monotherapy group;

[0094] Figure 104: Tumor volume in the oxaliplatin monotherapy group; and

[0095] Figure 105: Tumor volume of the combination therapy group of TB511 and oxaliplatin.

[0096] Figures 106 to 108 are diagrams analyzing tumor weight and body weight changes according to combined administration of TB511 and oxaliplatin.

[0097] Fig. 106: Size of tumor tissue;

[0098] Fig. 107: Changes in the weight of tumor tissue; and

[0099] Fig. 108: Weight change of the mouse.

[0100] Figures 109 to 113 are diagrams analyzing the decrease in M2-like tumor associated macrophages (TAMs) in the tumor microenvironment (TME) following combined administration of TB511 and oxaliplatin.

[0101] Figures 109 and 110: Flow cytometry analysis results for macrophage populations within the TME;

[0102] Figure 111: M1-like TAMs (CD86+ F4 / 80+ cells within CD45+ CD11b+ cells);

[0103] Figure 112: M2-like TAMs (CD206+ F4 / 80+ cells within CD45+ CD11b+); and

[0104] Fig. 113: M1 / M2 ratio.

[0105] Figures 114 to 117 are diagrams showing the analysis of induction of cytotoxic T cell infiltration into the TME by combined administration of TB511 and oxaliplatin.

[0106] Figure 114: Flow cytometry analysis results for lymphocyte distribution within the TME;

[0107] Figure 115: CD4 T cells (CD45+ CD3+ CD4+ cells);

[0108] Figure 116: CD8 T cells (CD45+ CD3+ CD8+ cells); and

[0109] Figure 117: NK cells (CD45+ CD3+ NKp46+ cells).

[0110] Figure 118 is a diagram showing the triple-negative breast cancer mouse model setup and drug process.

[0111] Figure 119 is a diagram showing the results of an analysis of the anticancer effect according to the combined administration of TB511 and paclitaxel.

[0112] Figures 120 to 125 are diagrams showing the results of tumor inhibition analysis according to the combined administration of TB511 and PADCEV in a human pancreatic cancer mouse model.

[0113] Figure 120: Tumor sample 43 days after tumor inoculation;

[0114] Figure 121: Tumor volume over time after tumor inoculation;

[0115] Figures 122 and 123: Graphs showing immunohistochemical staining of Ki67 for tumor tissue and quantification of Ki67 positive cells; and

[0116] Figures 124 and 125: Results of immunofluorescence staining analysis of E-cadherin and Vimentin in tumor tissue.

[0117] Figures 126 to 131 are diagrams showing the results of analysis of the reduction of M2 macrophages in tumor tissues following combined administration of TB511 and PADCEV.

[0118] Figures 126 and 127: Graphs showing the results of immunohistochemical staining of CD163 and actin in tumor tissue and the quantification of CD163 positive cells;

[0119] Figures 128 and 129: Results of immunohistochemical staining of CD18 in tumor tissue and quantification of CD18 positive cells; and

[0120] Figures 130 and 131: Graphs showing the results of immunohistochemical staining of Kim127 and CD11b in tumor tissue and the quantification of Kim127 and CD11b positive cells.

[0121] Figures 132 and 133 are diagrams showing the results of an analysis of the increase in CD8 T cells in tumor tissues following combined administration of TB511 and PADCEV.

[0122] Figure 132: Results of immunofluorescence staining analysis of CD8 in tumor tissue; and

[0123] Figure 133: Graph quantifying the number of CD8 positive cells.

[0124] Figures 134 to 141 are diagrams showing the results of an association analysis of TB511 with macrophages and CD8 T cells expressing activated CD18 in normal tissues.

[0125] Figures 134 to 137: Flow cytometry analysis results for macrophages using anti-Kim127, anti-CD18, anti-CD11b, and anti-CD45 antibodies; and

[0126] Figures 138 to 141: Flow cytometry analysis results for CD8 T cells using anti-Kim127, anti-CD18, anti-CD8, and anti-CD45 antibodies.

[0127] Figures 142 to 156 are diagrams showing the results of analysis on immune cell regulation in the tumor microenvironment following combined administration of TB511 and PADCEV.

[0128] Figures 142 to 145: Cell clusters within tumor tissue; and

[0129] Figures 146 to 149: UMAP analysis results for cell clusters within tumor tissue.

[0130] Figures 150 to 153: Pie charts showing the proportion of cell types in cell clusters within tumor tissue; and

[0131] Figures 154 and 155: Cell population (%) for each cell type.

[0132] Figures 156 to 159 are diagrams showing the results of an analysis of the effect of TB511 on the activation of CD8 T cells in a tumor microenvironment.

[0133] Figures 156 and 157: Exhausted genes (white arrows) and activator genes (red arrows) of CD8 T cells in tumor tissue; and

[0134] Figures 158 and 159: CTLA4, FOXP3, LAG3, GZMB, IFNG, and PDCD1 gene expression levels.

[0135] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are provided as examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.

[0136] Additionally, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the customs of the field to which the present invention pertains. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout this specification, when a part is said to "include" a certain component, unless specifically stated otherwise, this does not mean that other components are excluded, but rather that other components may be included.

[0137] Unless otherwise defined, all technical terms used in this invention have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of the present invention. The contents of all publications cited herein as references are incorporated herein by reference.

[0138] Throughout this specification, the conventional one-letter and three-letter codes for naturally occurring amino acids are used, as well as generally accepted three-letter codes for other amino acids, such as Aib (α-aminoisobutyric acid) and Sar (N-methylglycine). Furthermore, amino acids referred to herein by abbreviations are described according to the IUPAC-IUB nomenclature as follows:

[0139] Alanine: A, arginine: R, asparagine: N, aspartic acid: D, cysteine: C, glutamic acid: E, glutamine: Q, glycine: G, histidine: H, isoleucine: I, leucine: L, lysine: K, methionine: M, phenylalanine: F, proline: P, serine: S, threonine: T, tryptophan: W, tyrosine: Y, and valine: V.

[0140]

[0141] In one aspect, the present invention relates to a chimeric antigen receptor (CAR) comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2 as an antigen binding domain.

[0142] In one embodiment, the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 can specifically bind to M2 macrophages or M2 tumor associated macrophages (M2 TAMs).

[0143] In one embodiment, the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 can specifically bind to CD18.

[0144] In one embodiment, the peptide may comprise a variant thereof or an analog thereof.

[0145] In the present invention, the peptide preferably has the amino acid sequence described above, but is not limited thereto. According to a preferred embodiment of the present invention, the peptide preferably has a high ratio of the amino acid sequence of 50% or more, preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, and most preferably 100%.

[0146] In the present invention, the peptide may also include a targeting sequence, a tag, a labeled residue, or an additional amino acid sequence designed for a specific purpose, such as increasing the half-life or stability of the peptide. Furthermore, the peptide of the present invention may be linked to coupling partners, such as effectors, drugs, prodrugs, toxins, peptides, or delivery molecules.

[0147] In the present invention, the peptide can be prepared in the form of a pharmaceutically acceptable salt. Specifically, a salt can be formed by adding an acid, for example, an inorganic acid (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, etc.), an organic carboxylic acid (e.g., haloacetic acids such as acetic acid, trifluoroacetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid), and an organic sulfonic acid including an acidic sugar (e.g., glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), an acidic polysaccharide (e.g., hyaluronic acid, chondroitin sulfate, arginic acid), a sulfonic acid sugar ester such as chondroitin sulfate (e.g., methanesulfonic acid, p-toluenesulfonic acid), etc.

[0148] The term "peptide" used in the present invention refers to an amino acid polymer, which may include not only natural amino acids but also non-protein amino acids as components.

[0149] The term "peptide variant" as used herein refers to a corresponding amino acid sequence that contains at least one amino acid difference (substitution, insertion, or deletion) compared to a reference sequence. In certain embodiments, a "variant" has high amino acid sequence homology and / or conservative amino acid substitutions, deletions, and / or insertions compared to a reference sequence.

[0150] The term "peptide analogue" as used herein may include analogues in which the side chain or alpha-amino acid backbone of an amino acid is substituted with one or more other functional groups. Examples of side chain or backbone-modified peptide analogues include, but are not limited to, hydroxyproline, in which the pyrrolidine ring is substituted with a hydroxy group, or N-methyl glycine "peptoids." The types of peptide analogues are well known in the art.

[0151] As used herein, the term "conservative amino acid substitution" refers to a modification of a variant that involves replacing one or more amino acids with amino acids having similar biochemical properties that do not result in a loss of the biological or biochemical function of the peptide. A "conservative amino acid substitution" is a substitution that replaces an amino acid residue with an amino acid residue having a similar side chain. Classes of amino acid residues having similar side chains are well known and defined in the art. These classes include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with beta-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0152] Peptides according to the present invention can be prepared using standard synthetic methods, recombinant expression systems, or any other method known in the art. Accordingly, peptides according to the present invention can be synthesized by a number of methods, including, for example, methods including:

[0153] (a) a method of synthesizing a peptide stepwise or by fragment assembly by means of a solid-phase or liquid-phase method, and isolating and purifying the final peptide product; or

[0154] (b) a method of expressing a nucleic acid construct encoding a peptide in a host cell and recovering the expression product from the host cell culture; or

[0155] (c) a method for performing cell-free in vitro expression of a nucleic acid construct encoding a peptide and recovering the expression product; or

[0156] A method for obtaining fragments of a peptide by any combination of (a), (b) and (c), then linking the fragments to obtain a peptide, and recovering the peptide.

[0157] The term "CAR (chimeric antigen receptor)" used in the present invention refers to a non-naturally occurring receptor capable of conferring specificity for a specific antigen to immune effector cells. CARs typically consist of an extracellular domain (Ectodomain), a transmembrane domain, and an intracellular domain (Ectodomain).

[0158] The above extracellular domain includes an antigen recognition region, and the transmembrane domain of the CAR is connected to the extracellular domain and may be derived from a natural or synthetic source. If derived from a naturally occurring source, it may be derived from a membrane-bound or membrane-permeable protein, and may be a portion derived from a membrane-permeable region of various proteins such as the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD 154 or CD8. The sequence of such a transmembrane domain can be obtained from, but is not limited to, documents known in the art that disclose membrane-permeable region portions of membrane-permeable proteins.

[0159] Additionally, if the above-described transmembrane domain is synthetic, it may primarily contain hydrophobic amino acid residues such as leucine and valine, for example, a triplet of phenylalanine, tryptophan, and valine may be present in the synthetic transmembrane domain, but is not limited thereto. Sequence information on such transmembrane domains may be obtained from, but is not limited to, literature known in the art regarding synthetic transmembrane domains.

[0160] In the CAR of the present invention, the intracellular domain is a part of the domain of the CAR existing within a cell, and is connected to the transmembrane domain. The intracellular domain of the present invention may include an intracellular signaling domain that is characterized by causing T cell activation, preferably T cell proliferation, when an antigen binds to the antigen binding site of the CAR. The intracellular signaling domain is not particularly limited in type as long as it is a part that transmits a signal capable of causing T cell activation when an antibody binds to the antigen binding site existing outside the cell, and various types of intracellular signaling domains may be used. Examples thereof include an immunoreceptor tyrosine-based activation motif or ITAM, and the ITAM includes, but is not limited to, those derived from CD3 zeta (ξ, zeta), FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, CD66d, or FcεRIγ.

[0161] CARs comprise a single-chain fragment variable region (scFv) of an antibody specific for a tumor-associated antigen (TAA) that couples via the hinge and transmembrane regions to the cytoplasmic domain of a T-cell signaling molecule. Most conventional lymphocyte activation moieties comprise T-cell costimulatory (e.g., CD28, CD137, OX40, ICOS, and CD27) domains in tandem with a T-cell triggering (e.g., CD3ζ) moiety. CAR-mediated adoptive immunotherapy allows CAR-transplanted cells to directly recognize TAAs on target tumor cells in a non-HLA-restricted manner.

[0162] In one aspect, the present invention relates to a recombinant vector comprising a gene encoding the chimeric antigen receptor.

[0163] In one aspect, the present invention relates to a chimeric antigen receptor expressing cell transformed with the recombinant vector.

[0164] In one embodiment, the chimeric antigen receptor expressing cell can be a chimeric antigen receptor expressing macrophage (CAR-macrophage), a chimeric antigen receptor expressing T (CAR-T) cell, a chimeric antigen receptor expressing-gamma-delta T (CAR-Gamma-delta T) cell, or a natural killer (CAR-NK) cell.

[0165] The term "chimeric antigen receptor-expressing T (CAR-T) cell" used in the present invention refers to a T cell expressing a CAR. The chimeric antigen receptor-expressing T (CAR-T) cell has the advantage of: i) recognizing a cancer antigen in a manner independent of HLA (human leukocyte antigen), and thus being able to treat cancers that evade the action of anticancer drugs by reducing HLA expression on the cell surface; ii) being independent of HLA type, and thus being able to be used for treatment regardless of the patient's HLA type; and iii) being able to produce a large amount of cancer-specific T cells in a short period of time, and thus being able to exhibit an excellent anticancer effect.

[0166] The above T cells are CD4 + T cells (helper T cells, TH cells), CD8 + There are T cells (cytotoxic T cells, CTL), memory T cells, regulatory T cells (Treg cells), natural killer T cells, etc., and in the present invention, the T cells into which the CAR is introduced are preferably CD8 + T cells, but are not limited to these.

[0167] In one aspect, the present invention relates to a T-cell engager comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2.

[0168] In one embodiment, the T cell engager may be, for example, a bispecific T cell engager (BiTE). BiTEs are a class of artificial bispecific monoclonal antibodies, which are fusion proteins composed of amino acid sequences from four different genes or two single-chain variable region fragments (scFvs) of different antibodies on a single peptide chain of about 55 kilodaltons. One of the scFvs binds to T cells via the CD3 receptor, and the other binds to tumor cells via a tumor-specific molecule. Similar to other bispecific antibodies, and unlike conventional monoclonal antibodies, BiTEs form a link between T cells and tumor cells. This allows T cells to exert cytotoxic activity on tumor cells independently of the presence of MHC I or costimulatory molecules by producing proteins such as perforin and granzymes. These proteins enter the tumor cells and initiate apoptosis of the cells.

[0169] In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating cancer, comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2, a chimeric antigen receptor of the present invention, a cell expressing a chimeric antigen receptor of the present invention, or a T cell engager of the present invention as an active ingredient.

[0170] In one embodiment, the cancer may be a non-responsive or responsive cancer to an immunotherapy agent, may be a solid cancer, and may preferably be, but is not limited to, breast cancer, colon cancer, or pancreatic cancer.

[0171] In one embodiment, the composition may be an immunotherapy agent.

[0172] In one embodiment, the composition may be characterized by an increased anticancer effect when administered in combination with a chemotherapeutic agent or an antibody-drug conjugate (ADC), but is not limited thereto.

[0173] In one embodiment, the antibody-drug conjugate (ADC) may be, but is not limited to, an anti-Nectin-4 antibody drug conjugate (PADCEV).

[0174] The pharmaceutical composition of the present invention can be used as a single therapy, but can also be used in combination with other conventional biological therapies, chemotherapy, or radiotherapy, and when such combination therapy is performed, cancer can be treated more effectively. When the present invention is used for the prevention and treatment of cancer, chemotherapeutic agents that can be used together with the composition include cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluorouracil, Examples of radiation therapy that can be used with the composition of the present invention include X-ray irradiation and γ-ray irradiation.

[0175] In one embodiment, the composition of the present invention may further comprise an immunogenic apoptosis inducer, wherein the immunogenic apoptosis inducer may be at least one selected from the group consisting of an anthracycline-based anticancer agent, a taxane-based anticancer agent, an anti-EGFR antibody, a BK channel agonist, bortezomib, a cardiac glycoside, a cyclophosphamide-based anticancer agent, a GADD34 / PP1 inhibitor, LV-tSMAC, Measles virus, bleomycin, mitoxantrone, or oxaliplatin, and the anthracycline-based anticancer agent may be daunorubicin, doxorubicin, epirubicin, idarubicin, pixantrone, sabarubicin, or It could be valrubicin, and the taxane family of anticancer drugs could be paclitaxel or docetaxel.

[0176] The pharmaceutical composition for preventing or treating cancer of the present invention can increase the cancer treatment effect of conventional anticancer drugs through the cancer cell killing effect by administering it together with a chemical anticancer drug (anticancer agent), etc. The combined administration can be performed simultaneously with or sequentially with the anticancer agent. Examples of the anticancer agent include DNA alkylating agents such as mechloethamine, chlorambucil, phenylalanine, mustard, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), streptozotocin, busulfan, thiotepa, cisplatin, and carboplatin; Anti-cancer antibiotics include, but are not limited to, dactinomycin (actinomycin D), plicamycin, and mitomycin C; and plant alkaloids include, but are not limited to, vincristine, vinblastine, etoposide, teniposide, topotecan, and iridotecan.

[0177] In the present invention, the term “prevention” means any act of inhibiting or delaying the occurrence, spread, and recurrence of cancer by administering a pharmaceutical composition according to the present invention.

[0178] The term "treatment" as used herein refers to any action that kills cancer cells or improves or beneficially alters the symptoms of cancer through administration of the composition of the present invention. Those skilled in the art to which the present invention pertains will be able to accurately determine the criteria for diseases for which the composition of the present invention is effective and determine the degree of improvement, enhancement, and treatment by referencing materials provided by the Korean Medical Association and other sources.

[0179] The term "therapeutically effective amount" used in combination with the active ingredient in the present invention means the amount of a pharmaceutically acceptable salt of the composition effective in preventing or treating the target disease, and the therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as the administration method, the target site, the condition of the patient, etc. Therefore, the dosage for use in humans should be determined as an appropriate amount by taking both safety and efficacy into consideration. It is also possible to estimate the amount used in humans from the effective amount determined through animal testing. Such considerations in determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed.(2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed.(1990), Mack Publishing Co.

[0180] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects. The effective dosage level may be determined based on factors including the patient's health condition, cancer type and severity, drug activity and sensitivity to the drug, administration method, administration time, administration route and excretion rate, treatment period, combination or concurrent use of drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by those skilled in the art.

[0181] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable additive. At this time, the pharmaceutically acceptable additive may include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, maltose, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, and talc. The pharmaceutically acceptable additive according to the present invention is preferably included in the composition in an amount of 0.1 to 90 parts by weight, but is not limited thereto.

[0182] The composition of the present invention may also include a carrier, diluent, excipient, or a combination of two or more thereof commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, and examples thereof include compounds described in Merck Index, 13th ed., Merck & Co. Inc., saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and a mixture of one or more of these components. If necessary, other common additives such as antioxidants, buffers, and bacteriostatic agents may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into a main-use dosage form such as an aqueous solution, suspension, or emulsion, or into pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or ingredient using an appropriate method in the field or the method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

[0183] The composition of the present invention can be administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or locally in the form of an injection) or orally, depending on the intended method, and the dosage range varies depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease. The daily dosage of the composition according to the present invention is 0.0001 to 10 mg / ml, preferably 0.0001 to 5 mg / ml, and it is more preferable to administer it once or several times a day.

[0184] Liquid preparations for oral administration of the composition of the present invention include suspensions, solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc.

[0185] In one aspect, the present invention relates to a combination for preventing or treating cancer, comprising a peptide having sequence number 1 or 2 of the present invention, a chimeric antigen receptor of the present invention, a cell expressing a chimeric antigen receptor of the present invention, or a T cell engager of the present invention; and an immunotherapy agent, a chemotherapeutic agent, or an antibody-drug conjugate (ADC).

[0186] In one embodiment, the immunotherapy agent may be an immune checkpoint inhibitor, an immunosuppressant modulating drug, a cancer vaccine, an immunoadjuvant, an immune cell for cancer treatment, an immune cell activation cofactor, an antibody for cancer treatment, or a cytokine required to maintain the activity of an immune cell for cancer treatment.

[0187] In one embodiment, the immune checkpoint inhibitor can be an inhibitor of CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, BTLA, B7H3, B7H4, TIM3, KIR, TIGIT, CD47, VISTA or A2aR, an anti-PD-1 antibody, an anti-PDL-1 antibody, an anti-CTLA4, or an antigen-binding fragment of such an antibody that specifically binds to PD-1, PDL-1, or CTLA4, or a combination thereof.

[0188] In one embodiment, the immune checkpoint inhibitor can be an anti-PD1 antibody nivolumab or pembrolizumab, an anti-PD-L1 antibody atezolizumab, avelumab, or durvalumab, an anti-CTLA-4 antibody tremelimumab or ipilimumab, or a combination thereof.

[0189] In one embodiment, the combination may further comprise a chemotherapeutic agent or radiation.

[0190] In one embodiment, the chemotherapeutic agent may be a pro-apoptotic peptide, an immunogenic apoptosis inducer or an anticancer agent, and may be selected from the group consisting of SN-38 (7-Ethyl-10-hydroxy-camptothecin), daunorubicin, doxorubicin, epirubicin, idarubicin, pixantrone, sabarubicin, valrubicin, paclitaxel, docetaxel, mechloethamine, chlorambucil, phenylalanine, mustard, cyclophosphamide, Ifosfamide, carmustine (BCNU), lomustine (CCNU), streptozotocin, busulfan, thiotepa, cisplatin, carboplatin, dactinomycin (actinomycin D), plicamycin, mitomycin C, vincristine, vinblastine, teniposide, topotecan, iridotecan, uramustine, melphalan, bendamustine, dacarbazine, temozolomide, altretamine, Duocarmycin, nedaplatin, oxaliplatin, satraplatin, triplatin tetranitrate,5-fluorouracil, 6-mercaptopurine, capecitabine, cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, thioguanine, etoposide, mitoxantrone, izabepilone, vindesine, vinorelbine, estramustine, maytansine, It may be selected from the group consisting of DM1 (mertansine, mertansine), DM4, dolastatin, auristatin E, auristatin F, monomethyl auristatin E (MMAE), monomethyl auristatin F, and derivatives thereof, and preferably at least one selected from the group consisting of oxaliplatin, pemetrexed, cisplatin, gemcitabine, carboplatin, fluorouracil (5-FU), cyclophosphamide, paclitaxel, vincristine, etoposide, and doxorubicin, and most preferably oxaliplatin. Or it could be paclitaxel.

[0191] In one embodiment, the antibody-drug conjugate may be PADCEV (anti-Nectin-4 antibody drug conjugate).

[0192] The PADCEV of the present invention is an antibody-drug conjugate (ADC). Specifically, PADCEV is an FDA-approved drug called enfortumab vedotin, used to treat urothelial carcinoma, including bladder cancer.

[0193] Nectin-4 is a protein overexpressed in cancer cells, such as bladder cancer cells. When an anti-Nectin-4 antibody binds to Nectin-4, the drug enters the cancer cell. Once inside the cell, MMAE is released, destroying microtubules and killing the cancer cell. It is typically used in patients with urothelial cancer, particularly those who have not responded to previous immunotherapy (e.g., PD-1 / PD-L1 inhibitors) or chemotherapy.

[0194] In one embodiment, the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention, the chimeric antigen receptor of the present invention, the chimeric antigen receptor expressing cell of the present invention, or the T cell engager of the present invention; and an immunotherapy agent, a chemotherapeutic agent, or an antibody-drug conjugate (ADC); may be administered simultaneously, separately, or sequentially.

[0195] In one aspect, the present invention relates to an anticancer adjuvant comprising, as an active ingredient, a peptide of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention, a chimeric antigen receptor of the present invention, a cell expressing a chimeric antigen receptor of the present invention, or a T cell engager of the present invention.

[0196] In one embodiment, the anticancer adjuvant of the present invention may be administered concurrently, separately, or sequentially with the immunotherapy agent.

[0197] In one embodiment, the immunotherapy agent may be an immune checkpoint inhibitor, an immunosuppressant modulating drug, a cancer vaccine, an immunoadjuvant, an immune cell for cancer treatment, an immune cell activation cofactor, an antibody for cancer treatment, or a cytokine required to maintain the activity of an immune cell for cancer treatment.

[0198] In one embodiment, the immune checkpoint inhibitor can be an inhibitor of CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, BTLA, B7H3, B7H4, TIM3, KIR, TIGIT, CD47, VISTA or A2aR, an anti-PD-1 antibody, an anti-PDL-1 antibody, an anti-CTLA4, or an antigen-binding fragment of such an antibody that specifically binds to PD-1, PDL-1, or CTLA4, or a combination thereof.

[0199] In one embodiment, the immune checkpoint inhibitor can be an anti-PD1 antibody nivolumab or pembrolizumab, an anti-PD-L1 antibody atezolizumab, avelumab, or durvalumab, an anti-CTLA-4 antibody tremelimumab or ipilimumab, or a combination thereof.

[0200] In one embodiment, the cancer that is the target of the pharmaceutical composition or combination of the present invention may be selected from the group consisting of ovarian cancer, breast cancer, lung cancer, non-small cell lung cancer, stomach cancer, liver cancer, prostate cancer, head and neck cancer, bladder cancer, colon cancer, colon cancer, pancreatic cancer, kidney cancer, bone marrow cancer, uterine cancer, melanoma, brain cancer and thyroid cancer, but preferably may be selected from the group consisting of breast cancer, lung cancer, non-small cell lung cancer, liver cancer, colon cancer, colon cancer, pancreatic cancer and brain cancer, and most preferably may be breast cancer, colon cancer or breast cancer, but is not limited thereto.

[0201] In one embodiment, the pharmaceutical composition or combination of the present invention may be administered at a concentration of TB511 of 100 to 300 nmol / kg, and oxaliplatin may be administered at a concentration of 1 to 2 mg / kg, but is not limited thereto.

[0202] In one embodiment, the pharmaceutical composition or combination of the present invention may be administered with TB511 at a concentration of 100 to 300 nmol / kg, and paclitaxel may be administered at a concentration of 3 to 7 mg / kg, but is not limited thereto.

[0203] In one embodiment, the pharmaceutical composition or combination of the present invention may be administered at a concentration of 100 to 300 nmol / kg of TB511, and the anti-Nectin-4 antibody drug conjugate (PADCEV) may be administered at a concentration of 3 to 7 mg / kg, but is not limited thereto.

[0204] In one aspect, the present invention relates to a composition for diagnosing cancer, comprising a peptide of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention, a chimeric antigen receptor of the present invention, a cell expressing a chimeric antigen receptor of the present invention, or a T cell engager of the present invention as an active ingredient.

[0205] In one embodiment, the composition may further comprise a label, and the label may be a chromogenic enzyme, a radioisotope, a chromophore, a luminescent material, a fluorescent material, a probe or a tag, and the fluorescent material may be a fluorescent material of the Cy (cyanine) series, Rhodamine series, Alexa series, BODIPY series or ROX series, and may be Nile Red, BODIPY (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene), cyanine, fluorescein, rhodamine, coumarine or Alexa.

[0206] In one aspect, the present invention relates to a method for preventing or treating cancer, comprising administering to a subject a pharmaceutical composition or combination of the present invention.

[0207] The term "subject" as used in the present invention refers to a subject requiring a method for preventing, controlling, or treating a disease, and may be used without limitation as a human, dog, monkey, cat, rodent, such as a mouse, genetically modified mouse, etc. More specifically, it refers to a mammal such as a human or non-human primate, mouse, rat, dog, cat, horse, cow, etc.

[0208] The present invention is described in more detail through the following examples. However, the following examples are intended only to concretize the content of the present invention and are not intended to limit the present invention.

[0209]

[0210] Example 1. TB511 peptide synthesis

[0211] To synthesize a peptide that targets and kills tumor-associated macrophages (TAMs), which mainly exist with an M2-like phenotype and contribute to tumor progression by establishing an immunosuppressive environment in the tumor microenvironment (TME), we synthesized and purified the TB511 peptide (SEQ ID NO: 1), which comprises a TAM-targeting peptide, TAMpep (SEQ ID NO: 2), and a pro-apoptotic peptide, dKLA (SEQ ID NO: 3), with a linker consisting of four glycines and one serine to minimize their interaction and folding, at GenScript (Piscataway, NJ, USA). The D-isomer, not the L-isomer, of KLA was used here to minimize its degradation in the body. Additionally, FITC or Cy5 (cyanine 5) was conjugated via an amide bond at the N-terminus of the peptide, and biotin was conjugated via an amide bond at the lysine residue at the C-terminus of the peptide. In addition, PEGylation was performed at the amino terminus of the peptide. All peptides were purified with a purity of more than 95%. TB511's payload, d(KLA), is a cationic and amphipathic α-helical peptide that can bind to and disrupt negatively charged mitochondrial membranes, but cannot pass through zwitterionic eukaryotic cells and therefore does not exhibit toxicity to eukaryotic cells.

[0212] Name Sequence SEQ ID NO: TB511[PEG2]VLTTGLPALISWIKRKRQQ-GGGGS-d[KLAKLAKKLAKLAK]1TAMpepVLTTGLPALISWIKRKRQQ2d(KLA)d(KLAKLAKKLAKLAK)3Cy5 Conjugated TB511Cy5-[PEG2] VLTTGLPALISWIKRKRQQGGGGS d[KLAKLAKKLAKLAK]biotinylated TAMpepVLTTGLPALISWIKRKRQQK-biotinFITC conjugated TAMpepFITC-VLTTGLPALISWIKRKRQQ

[0213]

[0214] Example 2. Target protein analysis of TB511

[0215] To identify the target protein of TB511, THP-1 monocyte cells were differentiated into M0, M1, or M2 macrophages, and proteomic analysis was performed. Specifically, THP-1 cells were differentiated into M0 macrophages by culturing them in complete media with 100 nM PMA (phorbol 12-myristate 13-acetate; Sigma-Aldrich, St. Louis, MO, USA) for 24 h. Additionally, to polarize into M1 or M2 cells, M0 cells were cultured for 72 h with 20 ng / mL recombinant human interferon-gamma (rhIFN-γ; Prospec, Rehovot, Israel) and 100 ng / mL lipopolysaccharides (LPS; Sigma-Aldrich), or 20 ng / mL recombinant human interleukin-4 (rhIL-4; Prospec) and 20 μg / mL rhIL-13 (Prospec) in RPMI 1640 medium supplemented with 5% FBS. Additionally, PC3 or A549 cells were grown in complete medium to 80% confluence, washed, cultured in serum-free medium for 24 h, and then filtered through a 0.2 μm syringe filter (Sartorius, Göttingen, Germany) to prepare tumor-conditioned medium (TCM), and M0 cells were polarized to M2-TAM by culturing them with 10% or 50% tumor-conditioned medium for 72 h.Afterwards, THP-1 macrophages differentiated into M0, M1, and M2 were disrupted using the Mem-PER Plus Membrane Protein Extraction Kit (Thermo Fisher Scientific, Waltham, MA, USA), and the cell lysates were incubated with biotinylated TAMpep for 1 h at room temperature. After incubation with streptavidin agarose resin (Thermo Fisher Scientific) for 30 min at room temperature, the resin was washed, and membrane-bound proteins were eluted from the resin. The eluted protein samples were analyzed by LC-MS / MS using a Q-Exactive mass spectrometer (Thermo Fisher Scientific). The LC-MS / MS data of each analyzed sample were analyzed using Proteome Discoverer, and the UniProt human database was used for label-free quantification. Proteomic analysis was performed using the ExDEGA (Excel-based Differentially Expressed Gene Analysis) tool (eBiogen, Seoul, Korea) (Fig. 1).

[0216] As a result, a total of 1,450 proteins were identified in M0, M1, and M2 macrophages, of which 54 preferentially bound to biotin-labeled TAMpep in M2 macrophages compared to M0 and M1 macrophages (Figs. 12 to 14). Among these proteins, CD18 was particularly highly expressed in myeloid lineage cell lines, such as macrophages, and was weakly expressed only in lymphoid cells (Fig. 15).

[0217]

[0218] Example 3. CD18 targeting analysis of TB511

[0219] To confirm that CD18 is a target protein of TB511, CD18-targeting sgRNA (sgRNA / CD18; GTTCAACGTGACCTTCCGGC) was transfected into M2-differentiated cas9 stable THP-1 cells (cas9 stable THP-1 cells), thereby performing CD18 / sgRNA knockdown. CD18 mRNA levels were analyzed by qRT-PCR to verify the generation of knockdown cells (Fig. 2). Subsequently, cells were treated with TB511 (3 μM) for 24 h, and cell viability was determined using the MTS assay. Additionally, the direct binding of TB511 to CD18 was analyzed by incubating cell lysates with scrambled or TAMpep peptide (0, 0.001, 0.01, 0.1, 1, or 10 μg), followed by incubation with biotinylated TAMpep, and performing PAGE analysis of the eluted proteins to separate the peptide-bound membrane proteins using Streptavidin Dynabeads (Thermo Fisher Scientific). In addition, immunofluorescence staining analysis was performed using FITC-labeled TAMpep and APC-conjugated anti-rabbit IgG secondary antibody (1:500, Invitrogen). In addition, the binding affinity of TAMpep to CD18 was analyzed.

[0220] Cell viability analysis results showed that cell viability was significantly reduced in CD18 / sgRNA knockdown cells treated with TB511 compared to mock-transfected cells (Fig. 3). In addition, immunoprecipitation analysis results showed that CD18 was immunoprecipitated with biotinylated TAMpep, and this binding was blocked in a concentration-dependent manner when pre-incubated with non-biotinylated TAMpep (Fig. 4), confirming the direct binding of TB511 to CD18. In addition, immunofluorescence staining analysis confirmed that TAMpep colocalized with CD18 in M2 macrophages (Fig. 5). In addition, analysis of the binding affinity of TAMpep to CD18 revealed that it was 1.963 X 10 -6 K of D The values ​​were shown in Figures 16 and 17, and it was confirmed that the binding affinity was at a similar level to that of the anti-CD18 antibody.

[0221]

[0222] Example 4. Analysis of CD18 tumor association

[0223] To determine whether CD18 is associated with the progression of solid tumors, particularly with the infiltration of M2 macrophages into tumor tissues, a tumor tissue array was used to determine the correlation between CD18 expression and tumor progression. Specifically, paraffin was removed from normal and tumor tissue slides from breast, colon, lung, liver, kidney, and skin using EZ prep (Ventana Medical Systems, #950-102) at 76°C for 4 minutes, followed by incubation with cell conditioning solution 1 (Ventana Medical Systems, #950-124) at 100°C for 24 minutes for antigen retrieval. The slides were treated with OptiView peroxidase inhibitor (Ventana Medical Systems, #760-700) for 4 minutes at 37°C and then incubated with anti-CD18 antibody (1:500, LSbio). Afterwards, the slides were visualized using the OptiView DAB IHC Detection Kit (Ventana Medical Systems, #760-700), and the images were scanned and analyzed using Aperio ImageScope software (Leica, Wetzlar, Germany).

[0224] As a result, the expression level of CD18 was found to be significantly higher in breast, colon, lung, liver, kidney, and skin tumor tissues than in breast, colon, lung, liver, kidney, and skin normal tissues (Figs. 6 and 7).

[0225]

[0226] Example 5. Analysis of CD18 expression according to macrophage subtypes

[0227] As in Example 2 above, THP-1 monocytes were differentiated into M0, M1, and M2 macrophages, and polarized with M2-TAM. The relative mRNA expression level of CD18 was analyzed by qRT-PCR, and the protein expression level was confirmed by Western blot analysis and immunofluorescence staining.

[0228] As a result, the expression levels of CD18 genes and proteins were found to be significantly higher in M2 macrophages and M2-TAM than in other subtypes of macrophages (Figs. 8 to 11).

[0229]

[0230] Example 6. Binding and Effect Analysis of TB511 on CD18 in Activated Structure

[0231] 6-1. Binding Modeling of TB511 and CD18

[0232] The binding of TB511 to CD18 was analyzed using protein-peptide interaction modeling. Specifically, based on the sequence of the cysteine-rich region of CD18 (Uniport _p05107, cysteine-rich tandem repeat region: 449-617), the 3D structure was constructed using the trRosetta algorithm (https: / / yanglab.nankai.edu.cn / trRosetta / ). Using the CD18 PDB file generated by trRosetta and the amino acid sequence of TB511, docking simulations of TB511 and CD18 were performed using the CABS-dock server (http: / biocomp.chem.uw.edu.pl / CABSdock / ). This resulted in the generation of 10 models. Additionally, 5 μg / mL CD18 protein (Abbexa) was reacted with FITC-conjugated TAMpep and alanine-substituted library peptides of TAMpep at room temperature for 2 hours, and the binding affinity between the peptides was analyzed using ELISA. Based on the results of the above binding affinity analysis, a representative model was selected from among the 10 models generated through the above docking simulation.

[0233] Protein-peptide interaction modeling analysis revealed that TB511 binding to the bent (closed) conformation of total CD18 was not predicted, whereas the open conformation of the cysteine-rich domain was strongly predicted to bind to TB511 (Fig. 18), suggesting that the lysine and tryptophan residues of TB511 are the major binding elements. Furthermore, binding affinity analysis using the alanine substitution library of TAMpep revealed that the A6 peptide, in which lysine was substituted with alanine, and the A12 peptide, in which tryptophan was substituted with alanine, exhibited significantly reduced binding to the CD18 protein (Fig. 19).

[0234]

[0235] 6-2. Analysis of CD18-specific binding and apoptosis induced by TB511 activation

[0236] To determine whether TB511 recognizes the active open conformation of CD18 and induces cytotoxicity through this, CD18 was activated in THP-1 cells and the cytotoxicity due to TB511 treatment was compared with that of the inactivated case. Specifically, THP-1 cells were treated with 1 mM manganese chloride tetrahydrate (Mn 2+ , Sigma-Aldrich) for 1 hour to activate resting THP-1 cells. Afterwards, activated THP-1 cells and inactivated control THP-1 cells were treated with TB511 (1 μM), respectively. Cell viability was confirmed by staining with Annexin V (APC) and 7AAD and analyzing the stained cells with a FACS Lyric System (BD Bioscience, NJ, USA).

[0237] As a result, apoptosis was significantly increased in CD18-activated THP-1 cells compared to control cells when treated with TB511 (Figs. 20 and 21). Therefore, it was confirmed that TB511 induces cytotoxicity by recognizing the activated, open conformation of CD18.

[0238]

[0239] 6-3. Analysis of CD18 Activation According to Tumor Microenvironment and Macrophage Subtype

[0240] To determine whether CD18 maintains an activated structure in the M2-TAM of the tumor microenvironment, THP-1 cells were treated with A549 tumor-conditioned medium, and the level of CD18 activation was analyzed by FACS using FITC-conjugated mAb KIM127 (Leinco Technologies, Pantone, MO, USA). In addition, THP-1 cells were differentiated into M0, M1, M2, and M2-TAM subtypes, and the degree of CD18 activation was analyzed.

[0241] As a result, the activation level of CD18 was found to significantly increase in a concentration-dependent manner by treatment with A549 tumor-conditioned medium (Fig. 22). Furthermore, among the subtypes of macrophages, the activation level of CD18 was highest in polarized M2-TAM cultured with tumor-conditioned medium (Fig. 23), confirming that M2-TAM maintains an activated form of CD18 in the TME.

[0242]

[0243] 6-4. Analysis of TB511-induced apoptosis by macrophage subtypes

[0244] To compare the extent of TB511-induced apoptosis in each macrophage subtype, THP-1 cells were differentiated into M0, M1, M2, or M2-TAM and treated with MitoTracker RedROX (Invitrogen) and caspase 3 / 7 reagent for 30 min, followed by TB511 (1 μM) treatment and live-cell imaging using restoration fluorescence microscopy (DeltaVison, NJ, USA).

[0245] As a result, caspase 3 / 7 activation by TB511 began in M2-TAM within 5 minutes of incubation with TB511 and reached a peak at 15 minutes. M2 macrophages appeared to be affected by TB511 to a lesser extent, but no caspase 3 / 7 activation was observed in M0 or M1 macrophages (Figs. 24 and 25). This confirmed that the conformational-specific binding between CD18 and TB511 resulted in selective cytotoxicity against M2-TAM among macrophage subtypes.

[0246]

[0247] 6-5. Analysis of the tumor association of activated CD18

[0248] Analysis of the level of activated open conformation of CD18 using tumor tissue array revealed that the level of activated CD18 (pan CD18 and KIM127-double positive) was significantly increased in tumor tissues compared to normal tissues of prostate, liver, breast, lung, and colon (Fig. 26), indicating that CD18 exists in an inactive form in most tissue-resident macrophages in normal cells, but changes to an activated form in the TME.

[0249]

[0250] Example 7. Analysis of M2 macrophage membrane dynamics and intracellular transport of TB511.

[0251] To track the cell membrane dynamics and intracellular transport of TB511, carboxylic acid-functionalized gold nanorods (AuNRs; Nanopartz, Salt Lake City, UT, USA) were conjugated with 1-ethyl-3-3-(dimethylaminopropyl)carbodiimide hydrochloride (Pierce, Rockford, IL, USA) and sulfo-N-hydroxysulfosuccinimide (Pierce) to TB511. Approximately 1.5 х 10 TB511 was incubated in M2 macrophages differentiated from THP-1. 9TB511-AuNRs were treated with 20 μL of particles / mL and incubated with MitoTracker Green (Invitrogen) and Hoechst 33342 (Invitrogen) for 0.5 h. Single-particle tracking images were acquired at 10 ms intervals using integrated multi-dimensional light-sheet microscopy (iMLSM). The acquired images were analyzed using ImageJ (NIH) and MATLAB (Mathworks, Torrance, CA, USA), and the 3D spatial trajectories (x, y, z) of individual peptide-AuNRs were super-localized using the astigmatism method. Additionally, the rotation and orientation of individual peptide-AuNRs were calculated by fitting the transverse surface plasmon resonance (TSPR) with cos2φ and the longitudinal surface plasmon resonance (LSPR) with sin2θ.In addition, to inhibit endocytosis, cells were treated with chlorpromazine (CPZ), a clathrin-mediated endocytosis (CME) inhibitor, methyl-β-cyclodextrin (MβCD), an inhibitor that inhibits both clathrin-mediated endocytosis and caveolae-mediated endocytosis, or cytochalasin D (CyD), an inhibitor that inhibits macropinocytosis (MP), or bafilomycin A1 (Baf-A1) or chloroquine (CQ) to inhibit acidification of early endosomes or maturation and association of endosomes with lysosomes. The locations of early endosome antigen 1 (EEA1) and TB511-Cy5 in endosomes were confirmed by immunofluorescence staining analysis.

[0252] As a result, the DIC (Differential interference contrast) and SRRF (Super-resolution radial fluctuations) images of M2 showed that TB511-AuNRs were distributed in the mitochondria and nucleus within the cells (Fig. 27). Analysis of the 3D spatial trajectories of individual peptide-AuNRs revealed that displacements and scattering intensity fluctuations in the x, y, and z directions were gradually lost (Figs. 28 to 30), confirming the binding of TB511-AuNRs to the membrane receptors of M2 macrophages. In addition, at a specific time of approximately 20-41 s, TB511-AuNRs showed less spatial movement and slower direction changes, confirming that they were packaged into the membrane and assembled into endocytosis apparatuses. After that, clear movements in the x, y, and z directions were observed, confirming that TB511-AuNRs were separated from the membrane and transported into the cell. Furthermore, treatment with inhibitors that inhibit cellular uptake revealed that CPZ and CyD inhibited the uptake of TB511 and reduced TB511-induced apoptosis, whereas MβCD did not induce apoptosis (Figs. 31 and 32). Furthermore, treatment with Baf-A1 and CQ increased the colocalization of EEA1 and TB511-Cy5 in endosomes, significantly reducing TB511-induced apoptosis (Figs. 33 and 34).

[0253] This indicates that TB511 was internalized into M2 macrophages through endocytosis, and then exited the endosome and entered the cytoplasm.

[0254]

[0255] Example 8. Analysis of the antitumor effect of TB511

[0256] 8-1. Antitumor effect on cold tumors that are not responsive to immunotherapy

[0257] To determine the antitumor effect of TB511 on Cold tumors, which have low responsiveness to immunotherapy and lack tumor antigens, a subcutaneous prostate cancer (PC) mouse model and an orthotopic hepatocellular carcinoma (HCC) mouse model were prepared and the antitumor effect of TB511 was evaluated. Specifically, to prepare a subcutaneous tumor mouse model, PC tumor cells were mixed 1:1 with Matrigel (Corning, NY, USA) and then subcutaneously injected into the right flank of 6-8 week-old C57BL / 6 or BALB / c mice (Taconic Biosciences, NY, USA). Tumor volumes were 50-100 mm 3 When reached, the tumor-bearing mice were divided into two groups, and the TB511-administered group was injected subcutaneously with TB511 at a dose of 200 nmol / kg every 3 days. To prepare an orthotopic tumor mouse model, the abdomen of the mice was incised, and hepa1-6-Luc cells were injected into the subserosal plane of the cecum or liver, and then sutured. 7 or 14 days after tumor injection, the mice were divided into two groups and injected subcutaneously with TB511 every 3 days, and D-luciferin (BioVision, Milpitas, CA, USA) was injected intraperitoneally at a dose of 3 mg per mouse to track tumor growth. Tumor diameters were measured using digital calipers, and tumor volumes were calculated using the following mathematical formula 1. The mice were evaluated once or twice a week using a NightOWL LB 983 in vivo imaging system (Berthold Technologies, Bad Wildbad, Germany), and 30 days after tumor injection, they were euthanized and tumor tissues were isolated.

[0258]

[0259] As a result, TB511 was shown to significantly inhibit tumor growth in a mouse model of immunotherapy-unresponsive tumors (Cold tumors) (Figs. 35 to 37).

[0260]

[0261] 8-2. Antitumor effect on immunotherapy-responsive tumors (hot tumors)

[0262] To confirm the antitumor effect of TB511 on hot tumors, which exhibit high responsiveness to immunotherapy and are characterized by immune activation of tumor antigens and infiltrating T cells, subcutaneous non-small cell lung cancer (NSCLC) or renal cell carcinoma (RCC) mouse models and orthotopic colorectal cancer (CRC) mouse models were prepared as in Example 8-1, and TB511 was administered thereto, and the antitumor effect was analyzed.

[0263] As a result, TB511 was shown to significantly inhibit tumor growth in an immunotherapy-responsive tumor (Hot tumors) mouse model (Figs. 38 to 41).

[0264]

[0265] Through this, it was confirmed that TB511 exhibited antitumor effects regardless of responsiveness to immunotherapy.

[0266]

[0267] 8-3. Analysis of TB511's M2-TAM Targeting in the Tumor Microenvironment

[0268] To determine whether the antitumor effect of TB511 is caused by targeting M2-TAM in the TME, M2-TAM (CD45) was expressed in PC and CRC tumor tissues. + F4 / 80 among gated cells + CD206 + ) and M1-TAM (CD45 +CD206 among gated cells + F4 / 80 + The cell counts (percentage of cells) were analyzed by FACS and the M1 / M2 ratio was calculated. In addition, to confirm the selective targeting of TB511 to macrophage subtypes, the cell counts of M1-TAM and M2-TAM in CRC tumor tissues after treatment with TB511, and the number of tissue-resident macrophages present in normal tissues including brain, skin, kidney, and liver were analyzed by immunohistochemistry (IHC).

[0269] As a result, the number of M2-TAM cells in PC and CRC tumor tissues was significantly reduced in the TB511-treated group compared to the control group, whereas the number of M1-TAM cells did not change significantly, indicating that the M1 / M2 ratio was significantly increased by TB511 administration (Figs. 42 to 47). In addition, the number of M2-TAM cells was reduced by TB511 treatment in tumor tissues, while the number of M1-TAM cells did not change, whereas the tissue-resident macrophage population (F4 / 80) in normal tissues + ) was found to be unaffected by TB511 treatment (Figs. 48 to 51).

[0270]

[0271] 8-4. Tumor Targeting Analysis of TB511

[0272] Cy5-labeled TB511 was injected into an orthotopic breast cancer mouse model, and the biodistribution of TB511 was investigated. Specifically, 4T1 breast cancer cells were injected into the mammary fat pad of mice at a density of 5X10 5An orthotopic breast cancer mouse model was prepared by injecting cells / mouse at a density of 10 cells / mouse, and 7 days later, Cy5-labeled TB511 or scrambled peptides (control) were intravenously injected at 2.5 mg / kg. Mice were anesthetized, and the distribution of TB511 in vivo was photographed and analyzed using IVIS Lumina II (PerkinElmer, Waltham, MA, USA).

[0273] As a result, 48 hours after injection, the fluorescent signal of TB511 was observed only in the injected breast tissue, not in the liver, lung, heart, kidney, or muscle, and showed a higher biological distribution in the tumor tissue compared to the control group (Figs. 52 to 55).

[0274]

[0275] Through this, we confirmed that TB511 specifically accumulates at tumor sites and selectively removes M2-TAM in the TME, but does not affect tissue-resident macrophages in normal tissues.

[0276]

[0277] Example 9. Analysis of immune cell changes caused by TB511 in the TME

[0278] 9-1. Immune cell reprogramming analysis

[0279] To determine whether immune cells are reprogrammed by the removal of M2-TAM by TB511, PC samples were treated with TB511 and CD4 + , CD8 + Changes in antitumor immune cell populations within the TME, such as NK cells, were analyzed by FACS, and these data were confirmed by t-SNE analysis. In addition, the antitumor effect of TB511 was confirmed by CD8 +To determine the influence of T and NK cells, anti-NK1.1 antibody (clone PK136; BioXcell) or anti-CD8 antibody (clone 2.43; BioXcell, Lebanon, NH, USA) was injected intraperitoneally 3 days and 1 day before tumor injection, and TRAMP-C2 cells, colon cancer cells, were mixed with Matrigel as in Example 8-1, and then injected weekly (control group: IgGa isotype (C1.18.4, BioXcell) injection) to prepare NK or CD8 deficient mouse models (Fig. 60). After that, CD8 among the peripheral blood mononuclear cells of the mice + The numbers of T and NK cells were analyzed. In addition, the antitumor effects of TB511 were analyzed in NK or CD8-deficient mouse models.

[0280] As a result, the NK cell population in PC increased significantly, while CD8 + The T cell population did not change statistically significantly (Figs. 56 and 57). In addition, NCAM1 expression was increased in PC specimens after TB511 treatment. + The number of NK cells was found to increase (Figs. 58 and 59). In addition, CD8 was found in the blood of NK or CD8 deficient mouse models. + The number of T and NK cells was significantly reduced by antibody treatment (Figs. 73 to 76). In addition, TB511 showed a significant decrease in the number of CD8 cells compared to the control group and CD8 + While it showed an antitumor effect in all T cell-deficient groups, it did not show an antitumor effect in the NK cell-deficient group (Figs. 61 to 63).

[0281]

[0282] 9-2. Analysis of tumor-infiltrating cell counts

[0283] Tumor-Infiltrated CD8 by TB511 Treatment in Immunotherapy-Reactive Tumors such as NSCLC and CRC + T cells (CD45 + CD8 + ) and exhausted CD8 + T cells (PD-1 + CD8 + The number of T) was confirmed by FACS analysis, and CD8 + T and Granzyme B + The number of cells was confirmed by IHC analysis. In addition, a CRC mouse model was created by injecting CT26 colon cancer cells and anti-CD8 antibodies (Fig. 70), and the antitumor effect of TB511 treatment was analyzed.

[0284] As a result, tumor-infiltrating CD8 in NSCLC + The number of T cells increased in the group administered TB511, and the depleted CD8 + The number of T cells was found to decrease (Figs. 64 and 65). In addition, among antitumor immune cells, CD8 + Only T cells were found to be significantly increased in CRC (Figs. 66 and 67). In addition, IHC analysis showed that CD8 + T and Granzyme B + The number of cells was found to increase (Figs. 68 and 69), and the antitumor effect of TB511 was only on CD8 in the CRC mouse model. + -Not only appeared in depleted cells (Figs. 70-72).

[0285]

[0286] Through this, we confirmed that tumor-infiltrating cells in the TME change significantly after TB511 treatment in both immunotherapy-responsive and non-responsive tumors, but the types of infiltrating cells differ depending on each tumor type.

[0287]

[0288] Example 10. Clinical feasibility assessment of TB511

[0289] 10-1. Analysis of the antitumor effect of TB511 through the immune system

[0290] To evaluate the clinical potential of TB511, 4-week-old SID mice (NOD-Prkdc) were used as immunodeficient mice. em1Beak IL2rg em1Break ) and irradiated with 1.5 Gy of gamma rays to human CD34 + hematopoietic stem cells (Lonza, Basel, Switzerland) 2Х10 5 A humanized mouse model was created by intravenous injection of cells / mouse. Eleven weeks after stem cell injection, peripheral blood was collected and flow cytometry was used to identify mature human leukocytes (human CD45 + As a result of confirming the engraftment of hCD45 cells, + The cell population comprised 37.32 ± 13.44% of male mice (n = 16) and 42.63 ± 10.41% of female mice (n = 15) 11 weeks after transplantation, meeting the criteria for a humanized mouse model with more than 25% human CD45 cells in the peripheral blood. Afterwards, the humanized mouse model was injected subcutaneously with PC3 (human prostate cancer cell line) and A549 (human lung cancer cell line), and the volume was measured every 3 days. TB511 was administered every 3 days starting on day 11 after tumor cell injection (Figs. 77 and 85), and tumor growth in the mice and changes in human immune cells infiltrating the TME were investigated using t-SNE analysis.

[0291] As a result, the antitumor effect of TB511 was completely lost in immunodeficient mice injected with PC3 tumor cells or A549 cells (Figs. 78 and 84), whereas CD34 +In transplanted mice, TB511 was shown to inhibit tumor growth (Figs. 79 and 85), confirming that an intact immune system is essential for the antitumor effect of TB511. In addition, analysis of human immune cells infiltrating the TME revealed that M2-TAM (CD11b + CD206 + / CD45 + The number of cells) was significantly reduced, and M1-TAM (CD11b + CD86 + / CD45 + The number of cells) did not change, but the M1 / M2 ratio appeared to have increased (Figs. 80 to 82). In addition, CD335 + NK and CD8 + Tumor-killer cells, including T cells, were found to significantly infiltrate the TME after TB511 treatment (Figs. 80 to 82).

[0292]

[0293] 10-2. Analysis of the effects of TB511 and immune checkpoint inhibitors alone or in combination.

[0294] To determine the effect of combined treatment with immune checkpoint inhibitors of TB511, humanized mice injected with A549 cells were administered TB511 alone, anti-PD-1 antibody (pembrolizumab) alone, or a combination of TB511 and anti-PD-1 antibody, and the antitumor effect was analyzed by measuring tumor volume and analyzing changes in tumor-infiltrating immune cell populations.

[0295] As a result of analyzing the antitumor effect, the antitumor effect of the TB511 monotherapy group and the anti-PD-1 antibody monotherapy group was found to be similar, and the antitumor effect of the group administered in combination was found to be significantly increased (Figure 85). In addition, as a result of analyzing the change in tumor-infiltrating immune cell population, the group administered in combination with TB511 and anti-PD-1 antibody showed a higher level of M1-TAMs (CD206+ CD11b + / CD45 + The number of cells (CD86 cells) was significantly increased, and M2-TAMs (CD86 + CD11b + / CD45 + The number of cells (cells) was significantly reduced (Figs. 86 to 88). In addition, Granzyme B-positive CD8 + T cells were found to significantly increase infiltrating the TME with co-administration of TB511 and anti-PD-1 antibody, and depleted CD8 + T cells (PD-1 + CD8 + / CD45 + The cell population was significantly reduced in the TB511 monotherapy group and the TB511 and anti-PD-1 antibody combination therapy group (Figures 89 to 91).

[0296]

[0297] 10-3. Analysis of the synergistic effect of combined administration of TB511 and immune checkpoint inhibitors.

[0298] To confirm the synergistic effect of the combination of TB511 and anti-PD-1 antibody (pembrolizumab), a hPD-L1 MC38 tumor-humanized PD-1 mouse model was generated by injecting human PD-L1-stabilizing mouse colon cancer MC38 cells (hPD-L1 MC38 cells) (Shanghai Model Organisms Center, Shanghai, China) subcutaneously into the dorsal skin of genetically modified C57BL / 6J mice (humanized PD-1 knock-in mice) expressing human full-length PD-1 protein (Figure 96). Mice were divided into groups administered with PBS, TB511, anti-PD-1 antibody (Selleckchem), or TB511 and anti-PD-1 antibody, and then PBS or TB511 (200 nmol / kg) was administered subcutaneously, and anti-PD-1 antibody (2.5 mg / kg) was administered intraperitoneally twice a week for 32 days, to confirm the synergistic effect of combined administration of TB511 and anti-PD-1 antibody (Figs. 94 to 99).

[0299]

[0300] Example 11. Analysis of the anticancer effect of combined administration of TB511 and chemotherapy (oxaliplatin) in a colon cancer animal model.

[0301] 11-1. Cell culture

[0302] Mouse colon cancer cells (CT-26) were cultured in RPMI1640 medium (Welgene, Gyeongsan, Korea) supplemented with 10% fetal bovine serum (FBS; Welgene, Gyeongsan, Korea), 100 U / ml penicillin, and 100 μg / ml streptomycin (Invitrogen, CA, USA). Cells were seeded every 3 days when 80% confluent was reached, and cultured at 37°C and 5% CO2.

[0303]

[0304] 11-2. Establishment of a colon cancer mouse model

[0305] To establish a mouse model of colon cancer, CT-26 cells were harvested and mixed with Matrigel at a 1:1 ratio. The mixed cells were injected subcutaneously into the right flank of mice at a concentration of 3 × 10^5 cells / mouse. When the tumor volume reached 50–100 mm³, the mice were divided into four groups: control, TB511, oxaliplatin (Oxp), and combination treatment. Mice in each group received subcutaneous injections of PBS or TB511 (200 nmol / kg) every 3 days, and a single dose of Oxp (1.5 mg / kg) was injected intraperitoneally. Tumor volumes were measured every 3 days using digital calipers. The formula for calculating tumor volume is V = (width × width × length) / 2. Animal experiments were approved by the Institutional Animal Care and Use Committee of Kyung Hee University (KHSAP(SE)-24-332). All mice were housed in a specific pathogen-free environment with free access to food and water under a 12-hour light / dark cycle. After analysis, all animals were euthanized using isoflurane and cervical dislocation. Tumor tissue was isolated and used for further analysis.

[0306]

[0307] 11-3. Flow cytometry

[0308] Tumor tissue was minced and digested in serum-free cell culture medium containing DNase I (1 U / mL) and collagenase D (1 mg / mL). The samples were incubated for 1 hour at 37°C with gentle agitation. The samples were filtered through a 100-μm nylon mesh sieve. Red blood cells were lysed with Pharmlyse buffer (BD Bioscience, CA, USA). Single cells were filtered through a 40-μm nylon mesh sieve and stained with the following antibodies. For mouse lymphocytes, anti-CD45-APCcy7 (clone 30-F11; BD Bioscience, #557659), anti-CD4-BB700 (clone RM4-5; BD Bioscience, #566407), anti-CD8-PE-cy7 (clone 53-6.7; BD Bioscience, #552877), anti-NKp46-BV711 (clone 29A1.4; BD Bioscience, #740822); For mouse macrophages, the following antibodies were used: anti-CD45-APCcy7 (clone 30-F11; BD Bioscience, #557659), anti-CD11b-BV510 (clone M1 / 70; BD Bioscience, #566117), anti-F4 / 80-PE (clone BM8; Biolegend, #123110), anti-CD206-APC (clone C068C2; Biolegend, #141708), anti-CD86-BV786 (clone GL1; BD Bioscience, #740900). Cells were detected on a FACS Lyric system (BD Bioscience) and analyzed using FlowJo software (BD Bioscience).

[0309]

[0310] 11-4. Statistical Analysis

[0311] All data are presented as means ± standard errors of the mean (SEMs). Statistical analyses were performed using Prism 10.1.2 software (GraphPad Software Inc., CA, USA). One-way ANOVA followed by Tukey's post hoc analysis or two-way ANOVA followed by Bonferroni's post hoc analysis for group comparisons were performed.

[0312]

[0313] 11-5. Analysis of the anticancer effects of combined administration of TB511 and oxaliplatin in a colon cancer mouse model.

[0314] According to Example 11-2, TB511 and oxaliplatin were administered alone or in combination to a colon cancer mouse model. Mice were injected intraperitoneally with a single dose of oxaliplatin on day 7, and TB511 was injected every 3 days (Fig. 100). Compared to the control group, the TB511 and oxaliplatin groups showed a significant decrease in tumor volume, and the combination group showed the highest anticancer efficacy compared to the other groups, and tumor growth was significantly suppressed compared to the control and TB511 groups (Figs. 101 to 105).

[0315]

[0316] 11-6. Analysis of changes in tumor weight and mouse body weight following combined administration of TB511 and oxaliplatin.

[0317] The weight changes of tumor tissue isolated from euthanized mice were measured following treatment with TB511 and oxaliplatin. Results showed that the combination treatment group exhibited significant reductions in tumor size and weight compared to the control group (Figures 106 and 108). Furthermore, no weight changes were observed in either group following administration of TB511 or oxaliplatin (Figure 109).

[0318]

[0319] 11-7. Reduction of M2-like Tumor-Associated Macrophages (TAMs) in the Tumor Microenvironment (TME) by Combination Therapy with TB511 and Oxaliplatin

[0320] We confirmed that TB511 selectively targets M2-like TAMs among macrophage subtypes in the TME. After single-cell tumor tissues were isolated, the distribution of macrophage subtypes in the TME was analyzed using flow cytometry. The results of flow cytometry showed that M1-like TAMs (CD45 + CD11b + CD86 in cells + F4 / 80 + The distribution of TAMs (CD45 cells) did not show significant changes in all groups. However, M2-like TAMs (CD45 + CD11b + CD206 in underwear + F4 / 80 + The distribution of TAMs (T1 / M2 cells) was significantly reduced in the TB511 group compared to the control group. In addition, M2-like TAMs were significantly reduced in the combination treatment group compared to the control group (Figs. 109 to 112). Furthermore, in the combination treatment group, it was confirmed that the decrease in M2-like TAMs in the TME increased the M1 / M2 ratio (Fig. 113). Through the above results, it was confirmed that the combination treatment of TB511 and chemotherapy removes M2-like TAMs in the TME, thereby inducing a change to an anti-tumor environment.

[0321]

[0322] 11-7. Analysis of induction of cytotoxic T cell infiltration into the TME by combined administration of TB511 and oxaliplatin.

[0323] We analyzed the changes in the distribution of lymphocytes in the TME due to the removal of TB511-induced M2-like TAMs. CD4 T cells (CD45 + CD3 + CD4+ cells), CD8 T cells (CD45 + CD3 + CD8 + cells) and NK cells (CD45 + CD3 + NKp46 + The distribution of lymphocytes, including CD4 T cells, was analyzed using flow cytometry. The distribution of CD4 T cells and NK cells did not show significant differences in any group. However, CD8 T cells significantly increased in the combination treatment group. These results confirmed that the decrease in M2-like TAMs following TB511 treatment increased the intratumoral infiltration of CD8 T cells, thereby demonstrating the activity of directly eliminating tumor cells.

[0324] In summary of the above examples, it was found that the removal of M2-like TAM by TB511 enhanced the anticancer efficacy of oxaliplatin, and that when TB511 and oxaliplatin were administered in combination, the tumor infiltration of T cells was increased compared to when each was administered alone, thereby promoting an antitumor immune environment, confirming the synergistic effect of combined administration of TB511 and oxaliplatin.

[0325]

[0326] Example 12. Analysis of the anticancer effect of combined administration of TB511 and chemotherapy (paclitaxel) in a triple-negative breast cancer animal model.

[0327] 12-1. Establishment of a triple-negative breast cancer mouse model

[0328] The following analyses were performed using female Balb / c (BALB / cAnNTac, Taconic Bioscience) mice (6–8 weeks old). Balb / c is a strain suitable for transplantation of the triple-negative breast cancer cell line 4T1 and was selected because it is widely used in immunology and oncology experiments. Mice were housed in an SPF environment at 22±1℃, 55±15% relative humidity, and under a 12-h light cycle (lights on at 07:00, lights off at 19:00). Up to five mice were housed in cages measuring 260 × 420 × 180 mm, and individual mice were marked on their tails with a permanent marker pen for individual identification. Food and water were provided ad libitum through solid food for laboratory animals and water bottles, respectively. This experiment was approved by the Animal Ethics Committee of Kyung Hee University (KHUAP(SE)-20-398) in accordance with the Animal Protection Act.

[0329]

[0330] 12-2. Tumor volume measurement

[0331] Female Balb / c mice (BALB / cAnNTac, Taconic Bioscience) were injected with triple-negative breast cancer cells, 4T1 (ATCC), at a density of 1×10 cells per fourth nipple. 4T1 cells were suspended in serum-free media and mixed with Matrigel (Corning) to promote tumor formation. A group treated with PBS served as a control, and 18 mice per group were administered drugs and analyzed. TB511 and paclitaxel were administered as a single dose or in combination at 3-day intervals, starting 5 days after tumor cell injection. TB511 was administered subcutaneously, and paclitaxel was administered intraperitoneally (Figure 118). Tumor size was measured using a digital caliper to calculate the volume.

[0332]

[0333] 12-3. Statistical methods

[0334] Significance analysis of the measurement results was performed using Graphpad Prism software (Version 5, CA, USA) and the mean values ​​were analyzed for variance. A P value less than 0.05 was considered statistically significant based on an unpaired t test. All experiments were performed blindly and independently repeated under identical conditions.

[0335]

[0336] 12-4. Analysis of the anticancer effect of combined administration of TB511 and chemotherapy (paclitaxel)

[0337] According to the above Example 12-2, the change in tumor size when TB511 or paclitaxel was administered was measured, and the anticancer effect of combined administration of TB511 and paclitaxel was confirmed through this. The analysis results are shown in Fig. 119. As can be seen in Fig. 119, the tumor size in the group administered combined administration of TB511 and paclitaxel was significantly smaller compared to the group administered TB511 and paclitaxel alone and the control group. Through the above results, it was confirmed that combined administration of TB511 and paclitaxel exhibited an enhanced anticancer effect.

[0338]

[0339] Example 13. Analysis of the anticancer effect of combined administration of TB511 and PADCEV (anti-Nectin-4 antibody antibody drug conjugate) in a humanized pancreatic cancer mouse model.

[0340] 13-1. Animal model setup

[0341] SID mice (NOD-Prkdcem1BeakIL2rgem1Break, 4 weeks old) were purchased from GemBioscience (Chungbuk, South Korea). Mice were irradiated with 1.5 Gy of γ-rays and then intravenously injected with human CD34+ hematopoietic stem cell 2X10 cells (Lonza, Basel, Switzerland). SID mice are suitable as a humanized mouse model capable of expressing humanized immune cells, and were selected because they are small in size, easy to handle, and immunodeficient, meaning they do not generate an immune response for transplantation of human-derived hHSC cells. Mice were 16 weeks old at the start of administration, and a total of 20 female humanized mice were used. Animals were housed in polycarbonate cages measuring W 200 X L 260 X H 130 (mm) using irradiated bedding, with a maximum of five animals per cage. Individuals were identified by tail tags, and cages were labeled with the study number and group information. Housing conditions included 100% HEPA-filtered air, at least 10 air changes per hour, a temperature of 20.2–23.8°C, a relative humidity of 41.9–55.4%, and a light intensity of 150–300 lux, with a 12-h day / night cycle. All animals were provided with standard irradiated pelleted laboratory chow (Purina Rodent Chow 38057) and water ad libitum. The analyses were approved by the Animal Ethics Committee of Kyung Hee University (KHUASP(SE)-20-308) and performed in compliance with the Animal Protection Act and related regulations.

[0342]

[0343] 13-2. Setting up a humanized mouse model

[0344] To establish a humanized mouse model, 4-week-old male immunodeficient mice (SID) were irradiated with 100 cGy for 1 minute, and human hematopoietic stem cells (hHSCs) were injected into the tail vein using a 30G insulin syringe within 1 hour. The expression of human immune cells was confirmed by flow cytometry at 10 and 16 weeks, and animals with hCD45+ cell expression of 25% or more were used in the experiment. Table 2 shows the immune cell expression ratios of the mice. The humanized mice used in the analysis were supplied by Lonza.

[0345] NohCD45+% in hCD45+ populationCD19 (B cell)CD3 (T cell)137.5940.8229.4891.8334.692.10.4443.790.52.2543.995.30.3642.193.41.3759.991.90.8834.593 .90.4948.695.411068.290.51.6114294.40.41229.192.80.51341.493.50.61440.3932.41544.293.31.3163 4.888.92.61746.491.52.6182989.32.61967.388.53.22033.489.33.82134.688.92.82241.9883.62335.987.74.62433.780.811.42534.888.92.62653.688.73.32740.881.87.82833.186.63.52934.390.42304187.42.9

[0346] In addition, to establish a humanized lung cancer mouse model, human lung cancer cell line (PANC1; ATCC) was prepared at a concentration of 2Х10 cells per mouse, mixed 1:1 with Matrigel (Corning), and 100 μL of the mixture was injected subcutaneously into the right dorsal region of the mouse using a 30G syringe.

[0347]

[0348] 13-3. Drug administration method

[0349] The dosage form of TB511 was prepared by the sponsor at a concentration of 5 mg / ml in D-PBS and diluted to 200 nmol / kg for administration. The dose of TB511 was set at 200 nmol / kg based on the results of a previous efficacy evaluation conducted in a lung cancer mouse model, and the dose of PADCEV (anti-Nectin-4 antibody drug conjugate) was set at 5 mg / kg with reference to external data. The mice were divided into four groups for the study: G1 (PBS administration group), G2 (anti-nectin-4 administration group, 5 mg / kg), G3 (TB511 administration group, 200 nmol / kg), and G4 (combination administration group, PADCEV 5 mg / kg + TB511 200 nmol / kg).

[0350] GroupGenderNo. of AnimalsDose levelG1F50G2F55 mg / kgG3F5200 nmolG4F55 mg / kg, 200 nmol / kg

[0351] TB511 was administered subcutaneously into the dorsal region of mice using an insulin syringe after disinfecting with a 70% alcohol swab. PADCEV was administered intraperitoneally using the same method. The adjuvant dose for both drugs was the same (100 μL), and the dosing interval was every three days.

[0352]

[0353] 13-4. Tumor volume measurement

[0354] Tumor volume was calculated using the formula V = (width (2) Х length) / 2. According to the guidelines, mice were sacrificed when tumor size reached a maximum diameter of 1–1.5 cm after inoculation.

[0355]

[0356] 13-5. Flow Cytometry Analysis

[0357] Brain, breast, colon, kidney, liver, lung, skin, and tumor tissues were cut into thin pieces using a MACS digester (Milteny Biotec, Auburn, CA, USA) and incubated in RPMI 1640 serum-free medium containing 1 U / mL DNase (Cincinnati, Indianapolis, IN, USA) and 1 mg / mL collagenase D (Roche) at 37°C for 30 min. The tissues were filtered through a 100 μm nylon mesh filter. Red blood cells in the filtered single cells were lysed with BD Pharm lyse buffer (BD Bioscience, CA, USA). The single cells were then stained with the following antibodies in BD Pharmingen Stain Buffer (BD Bioscience): anti-CD45-FITC, anti-CD11b-BV510, anti-CD18-PE, and anti-KIM127-BV786 (BD Bioscience) for human macrophages. Cells were detected using a FACS Lyric system (BD Bioscience) and analyzed using FlowJo software (BD Bioscience).

[0358]

[0359] 13-6. Immunohistochemistry (IHC)

[0360] For histological analysis, tumor tissues were fixed overnight in 10% neutral buffered formalin. The paraffin-embedded tumor tissues were then sectioned at 5 μm thickness. Slides were deparaffinized with xylene and dehydrated with ethanol and deionized water. For antigen retrieval, the slides were incubated in sodium citrate buffer (pH 6.0) for 15 minutes in a microwave oven. The slides were then treated with peroxidase blocking solution (Dako, Glostrup, Denmark) for 15 minutes and blocked with 5% bovine serum albumin. The slides were incubated overnight with primary antibodies, washed with TBS containing 0.1% Tween 20, incubated with an avidin-biotin complex kit (Vector Laboratories, Burlingame, CA, USA), and visualized with diaminobenzidine-HCL (Vector Laboratories). Nuclei were counterstained with hematoxylin. Slides were observed under a bright-field microscope (Nikon, Tokyo, Japan) and analyzed using ImageJ software (NIH). Antibodies used for IHC staining were anti-KI67 and anti-CD18 antibodies (1:200; Abcam, Cambridge, UK).

[0361]

[0362] 13-7. Immunofluorescence staining

[0363] After embedding in paraffin, tumor tissues were sectioned at 5 μm thickness. Slides were deparaffinized with xylene and dehydrated with ethanol and deionized water. For antigen retrieval, slides were incubated in sodium citrate buffer (pH 6.0) for 15 minutes in a microwave oven. The slides were then treated with peroxidase-blocking solution (Dako, Glostrup, Denmark) for 15 minutes and blocked with 5% bovine serum albumin. The slides were incubated overnight with primary antibodies and then washed with TBS containing 0.1% Tween 20. The slides were incubated overnight at 4°C with anti-vimentin, anti-E-cadherin, anti-actin, anti-CD163, anti-CD11b, anti-Kim127, and anti-CD8 antibodies (1:500; Abcam). Subsequently, the cells were stained with FITC-labeled TAMpep and APC-conjugated anti-rabbit IgG secondary antibody (1:500, Invitrogen) at 37°C for 1 h. To visualize nuclei, coverslips were mounted with Vectashield mounting medium (Vector Laboratories) containing 4',6-diamidino-2-phenylindole (DAPI). Images were captured using an LSM 800 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany).

[0364]

[0365] 13-8. Spatial Transcriptomics

[0366] Paraffin-embedded blocks were precisely sectioned into 5-μm-thick sections and mounted on Xenium slides. The sectioned slides were dried in a thermal cycler (C1000 96-well, Bio-Rad) at 42°C for 3 h. Deparaffinization and decrosslinking were then performed. After prime hybridization and RNase treatment, the sectioned slides were hybridized overnight (~24 h) at 50°C with the Xenium human 5k pan-tissue probe (10x Genomics). The slides were then washed, and ligation was performed at 42°C for 30 min. Amplification enhancement and amplification were immediately processed in a thermal cycler (C1000 96-well, Bio-Rad). The slides were washed again, and the cell division staining probe was applied overnight (~24 h) at 4°C. After staining enhancement and washing, autofluorescence suppression and nuclear staining were performed.

[0367] Afterwards, the cut slides were loaded onto the Xenium analyzer (XOA v3.0.2, 10x Genomics) to perform fluorescence signal detection. After running Xenium, the raw data were preprocessed with xeniumranger v3.0.0.

[0368]

[0369] 13-9. Statistical Analysis

[0370] All data are expressed as the mean ± standard deviation of three or four independent experiments. Comparisons were performed using the two-sample Mann-Whitney U-test and one- and two-way analysis of variance (ANOVA) (IBM SPSS Statistics version 21; IBM Inc., Chicago, IL, USA), and a P value < 0.05 was considered statistically significant.

[0371]

[0372] 13-10. Tumor suppression analysis of combined TB511 and PADCEV in a human pancreatic cancer mouse model.

[0373] To determine whether combined administration of TB511 and PADCEV (anti-nectin4 antibody) could inhibit tumor growth in a humanized pancreatic cancer mouse model, a tumor mouse model was established by subcutaneously injecting a human pancreatic cancer cell line (PANC1) into humanized mice, and the drug was administered to the mice twice a week. Tumor size was significantly reduced in the TB511 or PADCEV administration groups compared to the PBS group, and in particular, the combination administration group showed the most significant reduction (Figs. 120 and 121). In tumor tissues, the expression level of PCNA, a proliferation factor, was significantly reduced in the TB511, PADCEV, and combination groups compared to the PBS group (Figs. 122 and 123). In addition, the expression of E-cadherin, an epithelial cell marker, was significantly increased in the TB511, PADCEV, and combination groups compared to the PBS group, and the expression of vimentin, a mesenchymal cell marker, showed an opposite pattern to E-cadherin, and was significantly decreased in the TB511, PADCEV, and combination groups compared to the PBS group (Figs. 124 and 125). Through the above results, it was confirmed that when TB511 and PADCEV were administered together, they exhibited an activity of inhibiting tumor progression in a humanized pancreatic cancer mouse model compared to when each was administered separately.

[0374]

[0375] 13-11. Reduction of M2 Macrophages in Tumor Tissues Following Co-Administration of TB511 and PADCEV

[0376] To determine whether TB511 reduces M2 macrophages in the tumor microenvironment, tumor tissues were analyzed using immunohistochemical staining and flow cytometry. The results showed that the TB511 and combination treatment groups significantly reduced the number of cells expressing CD163, a marker of M2 macrophages, in tumor tissues compared to the PBS group, whereas no effect was observed in the PADCEV group (Figures 126 and 127). Notably, TB511 was shown to selectively bind to activated CD18 in M2 macrophages. CD18-positive cells in tumor tissues were significantly reduced in the TB511 and combination treatment groups (Figures 128 and 129). Furthermore, TB511 was shown to reduce M2 macrophages using the Kim127 antibody, which binds to activated CD18 (Figures 130 to 133). Through the above results, it was confirmed that TB511 selectively targets activated CD18 of M2 macrophages in tumor tissues and induces a decrease in these cells.

[0377]

[0378] 13-12. Increase in CD8 T cells in tumor tissues following combined administration of TB511 and PADCEV.

[0379] M2 macrophages in the tumor microenvironment have been reported to play an immunosuppressive role, inhibiting the influx of CD8 T cells (doi: 10.1186 / s12964-023-01424-6). To determine whether TB511, which targets M2 macrophages, increases the influx of CD8 T cells in the tumor microenvironment, tumor tissues were analyzed by immunofluorescence staining. The analysis results showed that CD8 T cells in tumor tissues significantly increased in the TB511 and combination treatment groups compared to the PBS group, while no significant change was observed in the PADCEV group (Figures 132 and 133). These results confirmed that TB511 promotes the influx of CD8 T cells by inducing a decrease in M2 macrophages. However, since PADCEV directly targets tumor cells by targeting nectin-4 expressed on tumor cells, it did not show any significant changes in immune cells such as macrophages and CD8 T cells in the tumor microenvironment.

[0380]

[0381] 13-13. Association of TB511 with activated CD18-expressing macrophages and CD8 T cells in normal tissues.

[0382] The association of TB511 with activated CD18-expressing macrophages and CD8 T cells in normal tissues was shown in Figure 20, where TB511 decreased activated CD18-expressing macrophages. To investigate the effects of TB511 on macrophages and CD8 T cells in normal tissues, single cells were obtained from spleen, liver, lung, and brain tissues, stained for activated CD18 using the Kim127 antibody, and analyzed by flow cytometry. The TB511, PADCEV, and combination treatment groups showed no effect on Kim127-positive macrophages and CD8 T cells compared to the PBS group (Figures 134-141). These results confirmed that TB511 can specifically target activated CD18-expressing M2 macrophages in tumor tissues.

[0383]

[0384] 13-14. Modulation of Immune Cells in the Tumor Microenvironment Following Co-Administration of TB511 and PADCEV

[0385] To investigate changes in immune cells in the tumor microenvironment of pancreatic cancer after combination therapy with TB511 and PADCEV, genetic analysis of tumor tissue was performed using spatial transcriptomics. Figures 142 to 145 show the cell distribution in the PBS, TB511, PADCEV, and combination treatment groups. In the PBS group, epithelial cells, endothelial cells, stromal cells, fibroblasts, and neural cells were evenly distributed around tumor cells. In contrast, in the TB511, PADCEV, and combination treatment groups, cell clusters were reduced to four or three, respectively (Figures 142 to 145).

[0386] The above cell populations were analyzed using UMAP. As a result of the analysis, the proportion of immune cells in the PBS, TB511, PADCEV, and combination treatment groups was 18%, 23%, 17%, and 26%, respectively. In other words, it can be confirmed that the TB511-treated groups showed a higher proportion of immune cells compared to the other groups (Figs. 146 to 153). As a result of analyzing the above immune cells, the proportion of epithelial cells, which are pancreatic cancer cells, decreased in the TB511, PADCEV, and combination treatment groups. In the TB511 and combination treatment groups, M1 macrophages increased, M2 macrophages decreased, and CD8 T cells and NK cells increased. Treg cells did not appear in any drug group (Figs. 154 and 155). These results confirmed that TB511 and PADCEV induced a reduction in tumor cells, and that TB511 specifically targeted M2 macrophages, inducing changes in immune cells within the microenvironment. However, PADCEV did not induce or alter immune cells because it directly targeted pancreatic cancer cells.

[0387]

[0388] 13-15. Role of TB511 in CD8 T cell activation within the tumor microenvironment

[0389] To confirm whether TB511 targets M2 macrophages and induces CD8 T cell activation, we analyzed the gene expression levels of exhausted markers PDCD1, CTLA4, FOXP3, and LAG3 in CD8 T cells, as well as the gene expression levels of activation markers GZMB and IFNG. CD8 T cells expressing exhausted T cell genes (brown cluster cells) are indicated by white arrows, and cells expressing activated T cell genes are indicated by red arrows. The analysis results showed that the number of activated T cells increased in the TB511 and combination treatment groups compared to the PBS and PADCEV groups (Figures 156 and 157). In addition, analysis of the expression levels of each gene showed that while PDCD1 (i.e., PD-1 gene) did not significantly change in any group, the exhausted marker genes CTLA4, FOXP3, and LAG3 were significantly decreased in the combination treatment group. , the expression of inflammatory cytokines such as Granzyme B and interferon gamma significantly increased in the TB511 or combination group. On the other hand, the PADCEV group showed a lower CD8 T cell activation induction effect compared to TB511 (Figs. 158 and 159). Through the above results, it was confirmed that TB511 induces CD8 T cell infiltration and activation by targeting and reducing M2 macrophages in pancreatic cancer tumor tissues, and PADCEV directly targets nectin-4 of tumor cells to reduce tumor growth, but does not contribute to the regulation of immune cells in the tumor microenvironment.

[0390] In summary of the above examples, it was found that when TB511 and PADCEV were administered together, tumor size and proliferation were reduced, the proportion of M1 macrophages, CD8 T cells, and NK cells were increased, and the proportion of M2 macrophages was reduced compared to when each was administered alone, confirming the existence of a synergistic effect due to the combined administration of TB511 and PADCEV.

[0391]

[0392] Through the results confirmed from the above humanized mouse model, the excellent efficacy of TB511 monotherapy and combination therapy with anticancer drugs was confirmed in various solid tumors.

Claims

1. A chimeric antigen receptor (CAR) comprising a peptide of sequence number 1 or sequence number 2 as an antigen binding domain.

2. A recombinant vector comprising a gene encoding the chimeric antigen receptor of claim 1.

3. A chimeric antigen receptor expressing cell transformed with the recombinant vector of paragraph 2.

4. In the third paragraph, the chimeric antigen receptor expressing cell is a chimeric antigen receptor expressing T (CAR-T) cell or a natural killer (CAR-NK) cell.

5. A T-cell engager comprising a peptide having sequence number 1 or sequence number 2.

6. A pharmaceutical composition for preventing or treating cancer, comprising a peptide of sequence number 1 or sequence number 2, a chimeric antigen receptor of claim 1, a chimeric antigen receptor expressing cell of claim 3, or a T cell engager of claim 5 as an active ingredient.

7. A pharmaceutical composition for preventing or treating cancer, wherein the cancer in claim 6 is a non-responsive or responsive cancer to an immunotherapy agent.

8. A pharmaceutical composition for preventing or treating cancer, wherein the cancer in paragraph 6 is a solid cancer.

9. A pharmaceutical composition for preventing or treating cancer, which is an immunotherapy agent according to claim 6.

10. In paragraph 6, A pharmaceutical composition for preventing or treating cancer, characterized in that the anticancer effect is enhanced when the composition is administered in combination with a chemotherapeutic anticancer agent or an antibody-drug conjugate (ADC).

11. In paragraph 10, A pharmaceutical composition for preventing or treating cancer, wherein the chemotherapeutic anticancer agent is at least one selected from the group consisting of Oxaliplatin, Pemetrexed, Cisplatin, Gemcitabine, Carboplatin, Fluorouracil (5-FU), Cyclophosphamide, Paclitaxel, Vincristine, Etoposide, and Doxorubicin.

12. In paragraph 10, A pharmaceutical composition for preventing or treating cancer, wherein the antibody-drug conjugate is PADCEV (anti-Nectin-4 antibody drug conjugate). 13.1) a peptide of sequence number 1 or sequence number 2, a chimeric antigen receptor of claim 1, a cell expressing a chimeric antigen receptor of claim 3, or a T cell engager of claim 5; and 2) A combination for the prevention or treatment of cancer, comprising an immunotherapy agent, a chemotherapy agent or an antibody-drug conjugate (ADC).

14. In claim 13, the immunotherapy agent is an immune checkpoint inhibitor, an immunosuppressive factor controlling drug, a cancer vaccine, an immunoadjuvant, an immune cell for cancer treatment, an immune cell activation cofactor, an antibody for cancer treatment, or a cytokine necessary for maintaining the activity of an immune cell for cancer treatment, a combination for preventing or treating cancer.

15. A combination for preventing or treating cancer, wherein the immune checkpoint inhibitor in claim 14 is an inhibitor of CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, BTLA, B7H3, B7H4, TIM3, KIR, TIGIT, CD47, VISTA or A2aR.

16. A combination for the prevention or treatment of cancer, wherein the combination is an anti-PD-1 antibody, an anti-PDL-1 antibody, an anti-CTLA4, or an antigen-binding fragment of the antibody that specifically binds to PD-1, PDL-1, or CTLA4, or a combination thereof, in claim 15.

17. A combination for the prevention or treatment of cancer, wherein the combination comprises at least one selected from the group consisting of Oxaliplatin, Pemetrexed, Cisplatin, Gemcitabine, Carboplatin, Fluorouracil (5-FU), Cyclophosphamide, Paclitaxel, Vincristine, Etoposide, and Doxorubicin.

18. A combination for preventing or treating cancer, wherein the antibody-drug conjugate in claim 13 is PADCEV (anti-Nectin-4 antibody drug conjugate).

19. A composition for diagnosing cancer, comprising a peptide of sequence number 1 or sequence number 2, a chimeric antigen receptor of claim 1, a chimeric antigen receptor-expressing cell of claim 3, or a T cell engager of claim 5 as an active ingredient.

20. A composition for diagnosing cancer, further comprising a label according to claim 19.

21. A composition for diagnosing cancer, wherein the label in clause 20 is a chromogenic enzyme, a radioisotope, a chromopore, a luminescent substance, a fluorescent substance, a probe or a tag.

22. A method for preventing or treating cancer, comprising administering to a subject the pharmaceutical composition of clause 6 or the combination of clause 13.

Images