Malic and glutaric acid based ionizable lipids
The introduction of ionizable or cationic lipids of Formula (I) addresses the challenges of nucleic acid delivery by enhancing stability, permeability, and targeting, resulting in improved pharmacokinetic properties and efficient protein expression in various cell types and tissues.
Patent Information
- Application Number
- PCT/IB2024/063068
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-22
- Filing Date
- 2024-12-20
- Publication Date
- 2025-06-26
AI Technical Summary
Current liposomal-based delivery systems for nucleic acids face challenges such as low in vivo stability, rapid degradation, and low cell permeability, necessitating improved ionizable or cationic lipids for enhanced pharmacokinetic properties and efficient delivery to various cell types and tissues.
The development of ionizable or cationic lipids, specifically those of Formula (I), which are designed to improve the delivery of nucleic acids by enhancing their stability, permeability, and targeting capabilities, while minimizing toxicity.
The use of these novel lipids in lipid nanoparticle formulations achieves enhanced expression of proteins encoded by cargo nucleic acid molecules, improved pharmacokinetic properties, and efficient delivery to a wide range of cell types and tissues, thereby overcoming the limitations of existing delivery systems.
Smart Images

Figure IB2024063068_26062025_PF_FP_ABST
Abstract
Description
[0001] Malic and Glutaric Acid Based Ionizable Lipids CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to European Patent Application No.23307350.1, filed December 22, 2023, the disclosure of which is incorporated herein by reference in its entirety. BACKGROUND Effective targeted delivery of biologically active substances such as nucleic acid molecules (e.g., mRNA) represents a continuing medical challenge. In particular, the delivery of nucleic acids to cells is made difficult by their low in vivo stability, propensity toward rapid degradation, and low cell permeability. Lipid-containing nanoparticle compositions have proven effective as transport vehicles into cells and / or intracellular compartments for biologically active substances such as small molecule drugs, proteins, and nucleic acids. Such compositions generally include one or more ionizable or cationic lipid, phospholipids including polyunsaturated lipids, cholesterol-based lipids, and / or lipids containing polyethylene glycol (PEGylated lipids). While liposomal-based vehicles that comprise an ionizable or cationic lipid have shown promising results with regards to encapsulation, stability, and site localization, there remains a great need for improvement of liposomal-based delivery systems. In particular, there remains a need for improved ionizable or cationic lipids that demonstrate improved pharmacokinetic properties and which are capable of delivering macromolecules, such as nucleic acids, to a wide variety of cell types and tissues with enhanced efficiency. Importantly, there also remains a particular need for novel ionizable and cationic lipids that are characterized as having reduced toxicity and are capable of efficiently delivering encapsulated nucleic acids and polynucleotides to cells, tissues, and organs by various routes of administration. SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Said .xml copy, created on December 19, 2024 is named 758925_SA9-394PC_SL, and is 7,409 bytes in size. SUMMARY The present disclosure provides, inter alia, a lipid of Formula (I): (I), or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3is or X1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: , , , , , , , , , , , and ; wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. The present disclosure further provides a lipid of Formula (I): (I), or a pharmaceutically acceptable salt thereof, wherein R1, R2, R3, X, and n are as defined herein. In one aspect, a lipid of Formula (I) is provided: (I), or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: , , , , , , , , and ; wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. In some embodiments, two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, and ; X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, or -OC(O)O-; and X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl. In some embodiments, two of R1, R2, and R3are independently selected from the group consisting of: In some embodiments, one of R1, R2, and R3is or ; X4is - C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. In some embodiments, one of R1, R2, and R3is ; X4is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. In some embodiments, R1and R2are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, or ; R3is or ; X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O- , -OC(O)-, or -OC(O)O-; X3independently for each occurrence is -C(5-24)alkyl or -C(5- 24)alkenyl; X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is - C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. In some embodiments, A is ; and RA1and RA2are each independently -C(1-6)alkyl that is optionally substituted with - OH; or RA1and RA2are taken together to form a 3- to 6-membered heteroaryl that is optionally substituted with one to three -C(1-3)alkyl groups. In some embodiments, A is -N(CH3)2. In some embodiments, is selected from the group consisting of: , , , and . In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of:
[0002] or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, RXis -H or -CH3. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, the lipid has a structure selected from the group consisting of:
[0003] or a pharmaceutically acceptable salt thereof. In some embodiments, the lipid has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In another aspect, the present disclosure provides a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises a lipid of the present disclosure (e.g., a lipid of Formula (I)). In some embodiments, the LNP comprises: (I) a lipid of the present disclosure; (II) a stealth lipid; (III) a structural lipid; and (IV) a helper lipid. In some embodiments, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid, a polyoxazoline polymer-conjugated lipid, or a polysarcosine-conjugated (pSar) lipid. In some embodiments, the stealth lipid is a PEGylated lipid selected from 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG), 1,2-dilauroyl-sn-glycero- 3-phosphoethanolamine-polyethylene glycol (DLPE-PEG), and 1,2-distearoyl-rac-glycero- polyethelene glycol (DSG-PEG). In some embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG- PEG2000). In some embodiments, the structural lipid is a sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the helper lipid is 1,2-dioleoyl-SN-glycero-3- phosphoethanolamine (DOPE); 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); 1,2- dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); 1,2-dielaidoyl-sn-glycero-3- phosphoethanolamine (DEPE); and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), or 1,2-dilauroyl-sn-glycero-3- phosphoethanolamine (DLPE). In some embodiments, the helper lipid is 1,2-dioleoyl-SN-glycero-3- phosphoethanolamine (DOPE). In some embodiments, the LNP comprises: the lipid of the present disclosure at a molar ratio between 35% and 45%, the stealth lipid at a molar ratio between 0.5% and 7%, the structural lipid at a molar ratio between 20% and 35%, and the helper lipid at a molar ratio of between 20% and 30%. In some embodiments, the LNP comprises: the lipid of any one of claims 1-23 at a molar ratio of about 40%, the stealth lipid at a molar ratio of about 1.5%, the structural lipid at a molar ratio of about 30%, and the helper lipid at a molar ratio of about 28.5%. In some embodiments, the LNP comprises: the lipid of any one of claims 1-23 at a molar ratio of about 40%, the stealth lipid at a molar ratio of about 5%, the structural lipid at a molar ratio of about 30%, and the helper lipid at a molar ratio of about 25%. In some embodiments, the composition comprising a lipid nanoparticle (LNP) further comprises a nucleic acid molecule, wherein the nucleic acid molecule is encapsulated in the LNP. In some embodiments, the LNP comprises 1-20, optionally 5-10 or 6-8, nucleic acid molecules. In some embodiments, the nucleic acid molecule is an mRNA molecule. In some embodiments, the mRNA molecule encodes an antigen, optionally a viral antigen or a bacterial antigen. In some embodiments, the LNP encapsulates two or more mRNA molecules, wherein each mRNA molecule encodes a different antigen, optionally wherein the different antigens are from the same pathogen or from different pathogens. In some embodiments, the composition comprises two or more LNPs, wherein each LNP encapsulates an mRNA encoding a different antigen, optionally wherein the different antigens are from the same pathogen or from different pathogens. In some embodiments, the composition is formulated for intranasal administration. In some embodiments, the composition comprises a phosphate-buffer saline. In some embodiments, the composition comprises trehalose, optionally at 10% (w / v) of the composition. In another aspect, the present disclosure provides a method of eliciting an immune response in a subject in need thereof, comprising administering to the subject, optionally mucosally, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of a composition of the present disclosure. In yet another aspect, the present disclosure provides a method of preventing an infection or reducing one or more symptoms of an infection in a subject in need thereof, comprising administering to the subject, optionally mucosally, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of a composition of the present disclosure. In some embodiments, the composition is administered intranasally. In some embodiments, the methods of the present disclosure comprise administering to the subject one or more doses of the composition, each dose comprising 1-250, optionally 2.5., 5, 15, 45, or 135, μg of mRNA. In some embodiments, the methods of the present disclosure comprise administering to the subject two doses of the composition with an interval of 2-6, optionally 4, weeks. In another aspect, the present disclosure provides the use of a composition of the present disclosure for the manufacture of a medicament for use in treating a subject in need thereof. In yet another aspect, the present disclosure provides a composition, as described herein, for use in treating a subject in need thereof. In still another aspect, the present disclosure provides a kit comprising a container comprising a single-use or multi-use dosage of a composition of the present disclosure, optionally wherein the container is a vial or a pre-filled nasal spray device. DETAILED DESCRIPTION The present disclosure provides ionizable or cationic lipids that may be incorporated into lipid nanoparticle (LNP) formulations for delivering cargo, such as a nucleic acid molecule (e.g., mRNA), to a target cell. LNPs comprising the ionizable or cationic lipids of the present disclosure exhibit enhanced expression of proteins encoded by cargo nucleic acid molecules. I. Definitions Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art. As used in the specification and in the claims, the term “comprising” can include the embodiments “consisting of” and “consisting essentially of.” The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that require the presence of the named ingredients / steps and permit the presence of other ingredients / steps. However, such description should be construed as also describing compositions or processes as “consisting of” and “consisting essentially of” the enumerated ingredients / steps, which allows the presence of only the named ingredients / steps and excludes other ingredients / steps. As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). As used herein, the term “delivery” encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and retained within the target tissue (also referred to as “local distribution” or “local delivery”), and situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into patient's circulation system (e.g., serum) and systematically distributed and taken up by other tissues (also referred to as “systemic distribution” or “systemic delivery). As used herein, “expression” of a nucleic acid sequence refers to translation of an mRNA into a polypeptide, assembly of multiple polypeptides (e.g., heavy chain or light chain of antibody) into an intact protein (e.g., antibody), and / or post-translational modification of a polypeptide or fully assembled protein (e.g., antibody). In this application, the terms “expression” and “production,” and grammatical equivalent, are used inter-changeably. As used herein, the term “half-life” is the time required for a quantity such as nucleic acid or protein concentration or activity to fall to half of its value as measured at the beginning of a time period. As used herein, the terms “improve,” “increase” or “reduce,” or grammatical equivalents, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control subject (or multiple control subject) in the absence of the treatment described herein. As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism. As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems). As used herein, the term "liposome" refers to any lamellar, multilamellar, or solid nanoparticle vesicle. Typically, a liposome as used herein can be formed by mixing one or more lipids or by mixing one or more lipids and polymer(s). In some embodiments, a liposome suitable for the present disclosure contains an ionizable or cationic lipid(s) and optionally non-cationic lipid(s), optionally cholesterol-based lipid(s), and / or optionally PEG- modified lipid(s). As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. mRNA as used herein may encompass both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5′ to 3′ direction unless otherwise indicated. In some embodiments, an mRNA is or comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5′-N- phosphoramidite linkages). As used herein, the term “nucleic acid,” in its broadest sense, refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single and / or double-stranded DNA and / or cDNA. The term “pharmaceutically acceptable” as used herein, refers to substances that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of this disclosure include those derived from suitable inorganic and organic acids and bases. As used herein, the term “subject” refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre- and post-natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient.” A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder. As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena. As used herein, the term “target tissues” refers to any tissue that is affected by a disease to be treated. In some embodiments, target tissues include those tissues that display disease-associated pathology, symptom, or feature. As used herein, the term “therapeutically effective amount” of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the symptom(s) of the disease, disorder, and / or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose. As used herein, the term “treatment” or “treating,” is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g., for diagnosis or ex vivo applications), who has a disorder or disease as described herein, a symptom thereof; or the potential to develop such disorder or disease, where the purpose of the application or administration is to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disorder or disease, or its symptoms. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. As used herein, the term “prevent” or “prevention” means no disorder or disease development if none had occurred, or no further disorder or disease development if there had already been development of the disorder or disease. Also considered is the ability of one to prevent some or all of the symptoms associated with the disorder or disease. Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers. Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, E. L. Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, S. H. Tables of Resolving Agents and Optical Resolutions p.268 (E. L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, Ind. 1972). The present disclosure additionally contemplates compounds as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers. When a range of values is listed, it is intended to encompass each value and sub-range within the range. For example “ C1-6alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1-6, C1-5, C1-4, C1-3, C1-2, C2-6, C2-5, C2-4, C2-3, C3-6, C3-5, C3-4, C4-6,C4-5, andC5-6alkyl. As used herein, the term “alkyl” refers to a straight or branched saturated hydrocarbon. For example, an alkyl group can have 1 to 30 carbon atoms (i.e., (C1-C30)alkyl), 1 to 20 carbon atoms (i.e., (C1-C20)alkyl), 1 to 12 carbon atoms (i.e., (C1-C12)alkyl), 1 to 6 carbon atoms (i.e., (C1-C6)alkyl), or 1 to 3 carbon atoms (i.e., (C1-C3)alkyl). Examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), 1- propyl (n-Pr, n-propyl, -CH2CH2CH3), isopropyl (i-Pr, i-propyl, -CH(CH3)2), 1-butyl (n-bu, n-butyl, -CH2CH2CH2CH3), 2-butyl (s-bu, s-butyl, -CH(CH3)CH2CH3), tert-butyl (t-bu, t- butyl, -CH(CH3)3), 1-pentyl (n-pentyl, -CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3) CH2CH2CH3), neopentyl (CH2C(CH3)3), 1-hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (- CH(CH3)CH2CH2CH2CH3), heptyl (-(CH2)6CH3), octyl (-(CH2)7CH3), 2,2,4-trimethylpentyl (-CH2C(CH3)2CH2CH(CH3)2), nonyl (-(CH2)8CH3), decyl (-(CH2)9CH3), undecyl (- (CH2)10CH3), and dodecyl (-(CH2)11CH3). When a bivalent variable is defined as “alkyl,” it is to be understood that such a group is a bivalent alkylene group. As used herein, the term “alkenyl” refers to a straight or branched saturated hydrocarbon having at least one site of carbon-carbon double bond unsaturation. For example, an alkenyl group can have 2 to 30 carbon atoms (i.e., (C2-C30)alkenyl), 2 to 20 carbon atoms (i.e., (C2-C20)alkenyl), 2 to 12 carbon atoms (i.e., (C2-C12)alkenyl) or 2 to 6 carbon atoms (i.e., (C2-C6)alkenyl), and the alkenyl group can contain 1, 2, 3, or 4 carbon- carbon double bonds. The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1-butenyl). Included within this term are the cis and trans isomers or mixtures of these isomers. Nonlimiting examples of alkenyl groups include prop- 2-enyl, but-2-enyl, but-3-enyl, 2-methylprop-2-enyl, hex-2-enyl, hex- 5-enyl, 2,3- dimethylbut-2-enyl, and the like. When a bivalent variable is defined as “alkenyl,” it is to be understood that such a group is a bivalent alkenylene group. As used herein, the term “alkynyl” refers to a straight or branched saturated hydrocarbon having at least one site of carbon-carbon triple bond unsaturation occurring at any stable point along the chain. For example, an alkynyl group can have 2 to 30 carbon atoms (i.e., (C2-C30)alkynyl), 2 to 20 carbon atoms (i.e., (C2-C20)alkynyl), 2 to 12 carbon atoms (i.e., (C2-C12)alkynyl) or 2 to 6 carbon atoms (i.e., (C2-C6)alkynyl), and the alkynyl group can contain 1, 2, 3, or 4 carbon-carbon triple bonds. The one or more carbon-carbon triple bonds can be internal or terminal. Optionally, the alkynyl group may include one or more double bonds (e.g., 1, 2, 3, or 4 double bonds). For purposes of the present disclosure, a hydrocarbon group having one or more triple bonds and one or more double bonds (e.g., an “ene-yne”) is categorized as an alkynyl moiety. Nonlimiting examples of an alkynyl groups include prop-2-ynyl, but-2-ynyl, but-3-ynyl, pent-2-ynyl, 3-methylpent-4-ynyl, hex-2-ynyl, hex-5-ynyl, etc. When a bivalent variable is defined as “alkynyl,” it is to be understood that such a group is a bivalent alkynylene group. The term “heterocycle” or “heterocyclyl” refers to a saturated or partially unsaturated ring system that has at least one atom other than carbon in the ring system, wherein the atom is selected from the group consisting of oxygen, nitrogen and sulfur. The heterocyclyl group may, for example, consist of a single ring or multiple rings (e.g., in the form of a spirocyclic or bicyclic ring system). Exemplary heterocycles include, but are not limited to oxetanyl, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, tetrahydropyranyl, tetrahydrofuranyl, and thiomorpholinyl. The term “heteroaryl” refers to a single aromatic ring that has at least one atom other than carbon in the ring, wherein the atom is selected from the group consisting of oxygen, nitrogen and sulfur. The term “heteroaryl” includes single aromatic rings of from 1 to 6 carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur. Exemplary heteroaryl ring systems include but are not limited to pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, pyrimidinyl, pyrazolyl, oxazolyl, oxadiazolyl, isoxazolyl, triazolyl, imidazolyl, tetrazolyl, thienyl, thiazolyl, isothiazolyl, thiadiazolyl, or furyl. The term “halogen” or “halo” refers to bromo (-Br), chloro (-Cl), fluoro (-F) or iodo (- I). As used herein, a “counteranion” is a negatively charged group associated with a positively charged quarternary amine in order to maintain electronic neutrality. Exemplary counteranions include halide ions (e.g., F—, Cl—, Br—, I—), NO3-, ClO4-, OH—, H2PO4-, HSO4-, sulfonate ions (e.g., methansulfonate, trifluoromethanesulfonate, p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate, naphthalene-2-sulfonate, naphthalene-1-sulfonic acid-5-sulfonate, ethan-1-sulfonic acid-2-sulfonate, and the like), and carboxylate ions (e.g., acetate, ethanoate, propanoate, benzoate, glycerate, lactate, tartrate, glycolate, and the like). Nitrogen atoms can be substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quarternary nitrogen atoms. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well- known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art. II. Ionizable / Cationic Lipids The present disclosure provides a lipid of Formula (I): (I), or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. In some embodiments, the present disclosure provides a lipid of Formula (I): (I), or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, or ; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)S-, -SC(O)-, or - OC(O)O-; X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl; X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: wherein * indicates the point of attachment to R3; RXis -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, or ; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, or -OC(O)O-; X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl; X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: wherein * indicates the point of attachment to R3; RXis -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from -C(6-24)alkyl, - C(6-24)alkenyl, , , and . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently -C(6-24)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently -C(6-24)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently -C(6-24)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently -C(6-24)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently -C(6-24)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently -C(6-24)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently -C(6-24)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently -C(6-24)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X1is -C(3-12)alkyl or -C(3-12)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X1is -C(3-12)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X1is -C(4-8)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -C(O)O-, -OC(O)-, -C(O)S-, -SC(O)-, or -OC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -C(O)O-, -OC(O)-, or -OC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -C(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -OC(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -C(O)NH-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -C(O)N(X3)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -NHC(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -N(X3)C(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -C(O)S-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -SC(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -OC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -OC(O)NH-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -NHC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X2is -NHC(O)NH-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is -C(5-24)alkyl or -C(5-24)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is -C(5-24)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is -C(5-20)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is -C(10-18)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is -C(5-24)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X3is -C(5-15)alkenyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas A1-A21: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas A1, A3, and A7-A18. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas A13, A14, and A15. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas A13 and A14: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1, A3, and A7-A18. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1-A21. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A13, A14, and A15. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A13 and A14. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1, A3, and A7-A18. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1-A21. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A13, A14, and A15. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A13 and A14. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1, A3, and A7-A18. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1-A21. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A13, A14, and A15. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A13 and A14. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas B1-58: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas B1-56. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas B1, B2, B5, B33-B53, B57, and B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas B33-B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, two of R1, R2, and R3are independently selected from the group consisting of formulas B36- B44. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1-B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1-B56. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1, B2, B5, B33- B53, B57, and B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B33-B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B36-B44. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1-B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1-B56. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1, B2, B5, B33- B53, B57, and B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B33-B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B36-B44. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1-B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1-B56. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1, B2, B5, B33- B53, B57, and B58. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B33-B51. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B36-B44. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, one of R1, R2, and R3is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, one of R1, R2, and R3is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is or . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is or . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is or . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -C(1-6)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -C(2-8)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -C(2-4)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -CH2CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is -CH2CH2CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X4is - CH2CH2CH2CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X5is -C(1-6)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X5is -C(2-8)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X5is -C(2-4)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X5is -CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X5is -CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X5is -CH2CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -C(O)O-, -OC(O)-, or -OC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -C(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -OC(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -C(O)NH-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -NHC(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -C(O)S-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -SC(O)-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -OC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -OC(O)NH-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -NHC(O)O-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X6is -NHC(O)NH-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X7is -C(1-6)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X7is -C(2-8)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X7is -C(2-4)alkyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X7is -CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X7is -CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X7is -CH2CH2CH2CH2-. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is an ionizable nitrogen-containing group. For example, A may be a group comprising a basic, ionizable nitrogen atom that can be converted to a charged group by protonation of the nitrogen with an acid. Nonlimiting examples of ionizable nitrogen- containing groups include NH2, guanidine, amidine, monoalkylamine, dialkylamine, 5- to 6- membered heterocycloalkyl, or 5- to 6-membered nitrogen-containing heteroaryl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is a cationic nitrogen-containing group, i.e., a group comprising a nitrogen atom having a positive charge. Nonlimiting examples of cationic nitrogen- containing groups include ammonium and 5- to 6-membered nitrogen-containing heteroaryl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof: A is ; and RA1and RA2are each independently -C(1-6)alkyl that is optionally substituted with - OH; or RA1and RA2are taken together to form a 3- to 6-membered heteroaryl that is optionally substituted with one to three -C(1-3)alkyl groups. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, RA1and RA2are each independently -C(1-4)alkyl that is optionally substituted with hydroxyl; or RA1and RA2are taken together to form a 5- to 6-membered heteroaryl that is optionally substituted with methyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof: A is ; and RA1and RA2are each independently -C(1-6)alkyl that is optionally substituted with - OH; or RA1and RA2are taken together to form a 3- to 6-membered heterocyclyl that is optionally substituted with one to three -C(1-3)alkyl groups. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, RA1and RA2are each independently -C(1-4)alkyl that is optionally substituted with hydroxyl; or RA1and RA2are taken together to form a 4- to 6-membered heterocyclyl that is optionally substituted with methyl. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is selected from the group consisting of: wherein RA3is -C(1-6)alkyl, and An- is a counteranion (e.g., a halide). In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is selected from the group consisting of:
[0004] wherein RA3is -C(1-6)alkyl, and An- is a counteranion (e.g., a halide). In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is selected from the group consisting of: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is selected from the group consisting of: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is selected from the group consisting of: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, A is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of Formulas C1-C12: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of Formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C3. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C5. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C6. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C7. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C8. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C9. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C11. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, has the structure of formula C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of Formulas D1-D48: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of Formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of formulas E1-E12:
[0005] In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of formulas E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of formulas E1 and E3: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the group consisting of formulas F1- F2: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas C1-C12 and E1- E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas C1-C10 and E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas E1-E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas E1 and E3. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1is selected from the group consisting of formulas F1 and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas C1-C12 and E1- E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas C1-C10 and E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas E1-E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas E1 and E3. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2is selected from the group consisting of formulas F1 and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas C1-C12 and E1- E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas C1-C10 and E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas E1-E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas E1 and E3. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R3is selected from the group consisting of formulas F1 and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is selected from the group consisting of: , In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is selected from the group consisting of: In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, X is . In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-a1), (I-a2), (I-a3), and (I-a4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-b1), (I-b2), (I-b3), and (I-b4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-b1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-b2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-b3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-b4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-c1), (I-c2), (I-c3), and (I-c4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-c1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-c2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-c3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-c4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-d1), (I-d2), (I-d3), and (I-d4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-d1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-d2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-d3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-d4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-e1), (I-e2), (I-e3), and (I-e4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-e1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-e2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-e3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-e4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-f1), (I-f2), (I-f3), and (I-f4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-f1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-f2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-f3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-f4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-g1), (I-g2), (I-g3), and (I-g4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-g1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-g2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-g3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-g4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-h1), (I-h2), (I-h3), and (I-h4), or a pharmaceutically acceptable salt thereof:
[0006] In some embodiments, the compound of Formula (I) has a structure according to Formula (I-h1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-h2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-h3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-h4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-i1), (I-i2), (I-i3), and (I-i4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-i1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-i2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-i3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-i4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-j1), (I-j2), (I-j3), and (I-j4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-j1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-j2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-j3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-j4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-k1), (I-k2), (I-k3), and (I-k4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-k1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-k2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-k3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-k4), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of Formulas (I-l1), (I-l2), (I-l3), and (I-l4), or a pharmaceutically acceptable salt thereof: In some embodiments, the compound of Formula (I) has a structure according to Formula (I-l1), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-l2), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-l3), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-l4), or a pharmaceutically acceptable salt thereof. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, RXis -H or -CH3.In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, RXis -H. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, RXis -CH3. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, n is 1 or 2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, n is 1. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a1), (I-b1), (I-c1), (I-d1), (I-e1), (I-f1), (I-g1), (I-h1), (I-i1), (I-j1), (I-k1), or (I-l1). In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a1), (I-b1), (I-c1), (I-d1), (I-e1), (I-f1), (I-g1), (I-h1), or (I-i1). In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, n is 2. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a2), (I-b2), (I-c2), (I-d2), (I-e2), (I-f2), (I-g2), (I-h2), (I-i2), (I-j2), (I-k2), or (I-l2). In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a2), (I-b2), (I-c2), (I-d2), (I-e2), (I-f2), (I-g2), (I-h2), or (I-i2). In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, n is 3. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a3), (I-b3), (I-c3), (I-d3), (I-e3), (I-f3), (I-g3), (I-h3), (I-i3), (I-j3), (I-k3), or (I-l3). In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a3), (I-b3), (I-c3), (I-d3), (I-e3), (I-f3), (I-g3), (I-h3), or (I-i3). In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, n is 4. In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a4), (I-b4), (I-c4), (I-d4), (I-e4), (I-f4), (I-g4), (I-h4), (I-i4), (I-j4), (I-k4), or (I-l4). In some embodiments, the compound of Formula (I) has a structure according to Formula (I-a4), (I-b4), (I-c4), (I-d4), (I-e4), (I-f4), (I-g4), (I-h4), or (I-i4). In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1-A21; and R3is selected from the group consisting of formulas C1-C12 and E1- E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1- A21; and R3is selected from the group consisting of formulas C1-C10 and E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1-A21; and R3is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1-A21; and R3is selected from the group consisting of formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A1, A3, and A7-A18; and R3is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas A13-A15; and R3has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1-B58; and R3is selected from the group consisting of formulas D1-D48, F1, and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1- B56; and R3is selected from the group consisting of formulas D1-D40, F1, and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R3is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R3is selected from the group consisting of formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R3is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B1, B2, B5, B33-B53, B57, and B58; and R3is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B33-B51; and R3is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B33-B51; and R3is selected from the group consisting of formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B36-B44; and R3is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R2are independently selected from the group consisting of formulas B36-B44; and R3is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1-A21; and R2is selected from the group consisting of formulas C1-C12 and E1- E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1- A21; and R2is selected from the group consisting of formulas C1-C10 and E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1-A21; and R2is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1-A21; and R2is selected from the group consisting of formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A1, A3, and A7-A18; and R2is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas A13-A15; and R2has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1-B58; and R2is selected from the group consisting of formulas D1-D48, F1, and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1- B56; and R2is selected from the group consisting of formulas D1-D40, F1, and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R2is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R2is selected from the group consisting of formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R2is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B1, B2, B5, B33-B53, B57, and B58; and R2is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B33-B51; and R2is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B33-B51; and R2is selected from the group consisting of formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B36-B44; and R2is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R1and R3are independently selected from the group consisting of formulas B36-B44; and R2is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1-A21; and R1is selected from the group consisting of formulas C1-C12 and E1- E12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1- A21; and R1is selected from the group consisting of formulas C1-C10 and E1-E10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1-A21; and R1is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1-A21; and R1is selected from the group consisting of formulas C1-C10. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A1, A3, and A7-A18; and R1is selected from the group consisting of formulas C1-C12. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas A13-A15; and R1has the structure of formula C1. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1-B58; and R1is selected from the group consisting of formulas D1-D48, F1, and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1- B56; and R1is selected from the group consisting of formulas D1-D40, F1, and F2. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R1is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R1is selected from the group consisting of formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1, B2, B3, B4, B5, B7, B10, B12, B15, B16, B18, B21, B24, B28, B31, B33, B36, B37, B40, B41, B43, B44, B46, B47, B48, B49, B50, and B51; and R1is selected from the group consisting of formulas D1-D4. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B1, B2, B5, B33-B53, B57, and B58; and R1is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B33-B51; and R1is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B33-B51; and R1is selected from the group consisting of formulas D1-D40. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B36-B44; and R1is selected from the group consisting of formulas D1-D48. In some embodiments of the compound of Formula (I), or a pharmaceutically acceptable salt thereof, R2and R3are independently selected from the group consisting of formulas B36-B44; and R1is selected from the group consisting of formulas D1-D4. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has a structure selected from the group consisting of:
[0007] or a pharmaceutically acceptable salt thereof. III. Ionizable / Cationic Lipid Synthesis The ionizable or cationic lipids of the present disclosure (e.g., compounds of Formula (I)) can be prepared according to methods known in the art. Nonlimiting and exemplary synthetic methods are disclosed herein. For example, Scheme A provides exemplary synthetic routes for preparing certain ionizable lipids of the present disclosure. Malic acid (1) can be esterified with methanol under acidic conditions to provide dimethyl malate (2), which can then be reacted with an alcohol (3) to provide intermediate (4). Intermediate (4) can be reacted with a carboxylic acid (5) in the presence of a coupling reagent, such as EDCI, to yield the ester product (8). Alternately, intermediate (4) can be reacted with a carbonate compound (6) to afford the carbonate product (9). Intermediate (4) can also be reacted with a carbamate compound (7), to afford the carbamate product (10).
[0008] Scheme A (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme B provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. N-Boc-(L)-aspartic acid (11) can be reacted with an alcohol (3) in the presence of a coupling reagent, such as EDCI, to provide intermediate (12), which can be deprotected with TFA to afford amine (13). Amine (13) can then be reacted with 4- nitrophenylchloroformate (14) to yield intermediate (15), which can be reacted with an alcohol (16) to afford the carbamate product (17). Scheme B (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme C provides exemplary synthetic routes for preparing certain ionizable lipids of the present disclosure. α-Ketoglutaric acid (18) can be reacted with alcohol (3) under acidic conditions to afford diester (19), which can be reduced with a reducing agent, such as NaBH4, to provide intermediate (20). Intermediate (20) can be reacted with a carboxylic acid (5) and a coupling reagent like EDCI to yield the ester product (22). Alternately, intermediate (20) can be reacted sequentially with 4-nitrophenylchloroformate (14) and an alcohol (16) to afford the carbonate product (23). Intermediate (20) can also be reacted sequentially with 4- nitrophenylchloroformate (14) and an amine (21) to afford the carbonate product (24). Scheme C (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme D provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. (tert-Butoxycarbonyl)-L-glutamic acid (25) can be reacted with an alcohol (3) in the presence of a coupling reagent, such as EDCI, to provide intermediate (26), which can be deprotected with TFA to afford amine (27). Amine (27) can be reacted with 4- nitrophenylchloroformate (14) to yield intermediate (28), which can then be reacted with an alcohol (16) to afford the carbamate product (29). Scheme D (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme E provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. Dimethyl malate (2) can be reacted with a benzyl protected diol such as compound (30) under acidic conditions to afford intermediate (31). Intermediate (31) can be protected with a hydroxyl protecting group, such as TBDPS, to afford intermediate (32) before deprotecting the benzyl groups (e.g., under hydrolytic conditions) to provide intermediate (33). Intermediate (33) can be oxidized to afford diacid (34), which can then be reacted with an alcohol (35) in the presence of a coupling reagent, such as EDCI, to provide intermediate (36). The hydroxyl group of intermediate (36) can be deprotected to provide intermediate (37), which can then be reacted with a carboxylic acid (5) to afford the product (38'). Alternately, intermediate (37) can be reacted with carbamate (5’) in the presence of a base, such as DIPEA, to afford the product (38’).
[0009] Scheme E (a is 1-7; R’ is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, - OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme F provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. (S)-2-(2,2-Dimethyl-5-oxo-1,3-dioxolan-4-yl)acetic acid (39) can be protected with a benzyl group to afford intermediate (40), the acetal moiety of which can then be cleaved under acidic conditions to provide intermediate (41). Intermediate (41) can be reacted with an alcohol (3) under acidic conditions to provide intermediate (42), the benzyl group of which can then be deprotected (e.g., under hydrolytic conditions) to afford intermediate (43). Intermediate (43) can be reacted sequentially with an alcohol (16) and a carboxylic acid (45) in the presence of a coupling reagent such as EDCI to provide the product (46). Scheme F (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and , wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme G provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. An alcohol (3) can be reacted with nitrophenylchloroformate (14) to yield intermediate (47), which can then be reacted with intermediate (44) to afford the carbamate product (48).
[0010] Scheme G (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme H provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. An alcohol (3) can be reacted with (S)-2-(2,2-dimethyl-5-oxo-1,3- dioxolan-4-yl)acetic acid (39) in the presence of a coupling reagent to provide intermediate (49), the acetal moiety of which can be cleaved under acidic conditions to afford intermediate (50). Intermediate (50) can then be reacted sequentially with an alcohol (16) and a carboxylic acid (45) in the presence of a coupling reagent such as EDCI to provide the product (52). Scheme H (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme I provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. An alcohol (3) can be reacted with nitrophenylchloroformate (14) to yield intermediate (47), which can then be reacted with intermediate (51) to afford the carbamate product (53).
[0011] Scheme I (a is 1-7; R is -C(6-24)alkyl, -C(6-24)alkenyl, -C(6-24)alkynyl, , and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) Scheme J provides an exemplary synthetic route for preparing certain ionizable lipids of the present disclosure. A diol (54) and 2-mercaptosuccinic acid (55) can be reacted in the presence of zinc chloride to provide intermediate (56). Intermediate (56) can then be reacted with dipyridyl disulfide to provide disulfide (57), which can then be reacted with an acyl chloride (58) to provide intermediate (59). Finally, intermediate (59) can be reacted with a thiol (60) to provide the disulfide product (61).
[0012] Scheme J (a is 1-7; R’ is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, - OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl) IV. Lipid Nanoparticles Compositions The present disclosure also provides a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises an ionizable or cationic lipid of the present disclosure (e.g., a lipid of Formula (I)). An ionizable or cationic lipid, such as those described herein, affords a positively charged environment at low pH and facilitates efficient encapsulation of a negatively charged drug substance (e.g., mRNA) in the LNP. In some embodiments, the LNP further comprises at least one of a structural lipid, a helper lipid, or a stealth lipid. In some embodiments, the LNP comprises an ionizable or cationic lipid of the present disclosure and a structural lipid. In some embodiments, the LNP comprises an ionizable or cationic lipid of the present disclosure and a helper lipid. In some embodiments, the LNP comprises an ionizable or cationic lipid of the present disclosure and a stealth lipid. In some embodiments, the LNP comprises an ionizable or cationic lipid of the present disclosure, a structural lipid, a helper lipid, and a stealth lipid. A. Structural Lipids A structural lipid component provides stability to the lipid bilayer structure within the lipid nanoparticle. In some embodiments, the LNP comprises one or more structural lipid. In some embodiments, the structural lipid is a cholesterol-based lipid. Suitable cholesterol-based lipids include, for example: DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), l,4- bis(3-N-oleylamino-propyl)piperazine (Gao et al., Biochem Biophys Res Comm. (1991) 179:280; Wolf et al., BioTechniques (1997) 23:139; U.S. Pat.5,744,335), imidazole cholesterol ester (“ICE”; WO2011 / 068810), sitosterol (22,23-dihydrostigmasterol), β- sitosterol, sitostanol, fucosterol, stigmasterol (stigmasta-5,22-dien-3-ol), ergosterol, desmosterol (3ß-hydroxy-5,24-cholestadiene), lanosterol (8,24-lanostadien-3b-ol), 7- dehydrocholesterol (Δ5,7-cholesterol), dihydrolanosterol (24,25-dihydrolanosterol), zymosterol (5α-cholesta-8,24-dien-3ß-ol), lathosterol (5α-cholest-7-en-3ß-ol), diosgenin ((3β,25R)-spirost-5-en-3-ol), campesterol (campest-5-en-3ß-ol), campestanol (5a-campestan- 3b-ol), 24-methylene cholesterol (5,24(28)-cholestadien-24-methylen-3ß-ol), cholesteryl margarate (cholest-5-en-3ß-yl heptadecanoate), cholesteryl oleate, cholesteryl stearate and other modified forms of cholesterol. In some embodiments, the structural lipid is cholesterol. B. Stealth Lipids A stealth lipid component provides control over particle size and stability of the nanoparticle. The addition of such components may prevent complex aggregation and provide a means for increasing circulation lifetime and increasing the delivery of a lipid- nucleic acid pharmaceutical composition to target tissues. In some embodiments, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid. These components may be selected to rapidly exchange out of the pharmaceutical composition in vivo (see, e.g., U.S. Pat.5,885,613). Contemplated PEGylated lipids include, but are not limited to, a polyethylene glycol (PEG) chain of up to 5 kDa in length covalently attached to a lipid with alkyl chain(s) of C6-C20(e.g., C8, C10, C12, C14, C16, or C18) length, such as a derivatized ceramide (e.g., N- octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)] (C8 PEG ceramide)). In some embodiments, the PEGylated lipid is 1,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol (DMG-PEG); 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-polyethylene glycol (DSPE- PEG); 1,2-dilauroyl-sn-glycero-3- phosphoethanolamine-polyethylene glycol (DLPE-PEG); or 1,2-distearoyl-rac-glycero- polyethelene glycol (DSG-PEG). In some embodiments, the PEG has a high molecular weight, e.g., 2000-2400 g / mol. In some embodiments, the PEG is PEG2000 (or PEG-2K). In some embodiments, the PEGylated lipid is DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, or C8 PEG2000. In some embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG- PEG2000). In some embodiments, the stealth lipid is a polyoxazoline polymer-conjugated lipid. Polyoxazoline polymer-conjugated lipids suitable for the LNP compositions of the present disclosure are described, for example, in WO2022 / 173667 and WO2023 / 031394. In some embodiments, the stealth lipid is a polysarcosine-conjugated (pSar) lipid. In some embodiment, the polysarcosine comprises 25-45 sarcosine units. In some embodiment, the polysarcosine comprises 25 sarcosine units. In some embodiment, the polysarcosine comprises 35 sarcosine units. In some embodiment, the polysarcosine comprises 45 sarcosine units. Nonlimiting examples of pSar lipids include N-tetradecyl-pSar25, N-hexadecyl- pSar25, N-octadecyl-pSar25, N-dodecyl-pSar25, 1,2-dimyristoyl-sn-glycero-3-succinyl-N- polysarcosine-25 (DMG-pSar25), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N- polysarcosine-25 (18:1 PE (DOPE) pSar25), N,N-ditetradecylamine-N- succinyl[methyl(polysarcosine)45], N,N-ditetradecylamine-N- succinyl[methyl(polysarcosine)35], and N,N-ditetradecyl-polysarcosine-25. Further examples of pSar lipids suitable for the LNP compositions of the present disclosure are described in WO2020 / 070040. C. Helper Lipids A helper lipid enhances the structural stability of the LNP and helps the LNP in endosomal escape. A helper lipid may improve uptake and release of an mRNA drug payload encapsulated in the LNP. In some embodiments, the helper lipid is a zwitterionic lipid. Without wishing to be bound by theory, the helper lipid can have fusogenic properties for enhancing uptake and release of the drug payload. Examples of helper lipids are 1,2-dioleoyl- SN-glycero-3-phosphoethanolamine (DOPE); 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); 1,2-dielaidoyl-sn-glycero-3- phosphoethanolamine (DEPE); and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), and 1,2-dilauroyl-sn-glycero-3- phosphoethanolamine (DLPE). Other exemplary helper lipids are dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l- carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), or a combination thereof. In particular embodiments, the helper lipid is 1,2-dioleoyl-SN-glycero-3- phosphoethanolamine (DOPE). D. Combinations of Lipid Components and Molar Ratios In some embodiments, the LNP comprises a lipid of Formula (I) and a structural lipid. In some embodiments, the LNP comprises a lipid of Formula (I) and a stealth lipid. In some embodiments, the LNP comprises a lipid of Formula (I) and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I), a structural lipid, a stealth lipid, and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a1), (I-b1), (I-c1), (I- d1), (I-e1), (I-f1), (I-g1), (I-h1), or (I-i1) and a structural lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a1), (I-b1), (I-c1), (I-d1), (I-e1), (I-f1), (I-g1), (I-h1), or (I-i1) and a stealth lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a1), (I-b1), (I-c1), (I-d1), (I-e1), (I-f1), (I-g1), (I-h1), or (I-i1) and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a1), (I-b1), (I-c1), (I-d1), (I-e1), (I- f1), (I-g1), (I-h1), or (I-i1); a structural lipid; a stealth lipid; and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a2), (I-b2), (I-c2), (I- d2), (I-e2), (I-f2), (I-g2), (I-h2), or (I-i2) and a structural lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a2), (I-b2), (I-c2), (I-d2), (I-e2), (I-f2), (I-g2), (I-h2), or (I-i2) and a stealth lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a2), (I-b2), (I-c2), (I-d2), (I-e2), (I-f2), (I-g2), (I-h2), or (I-i2) and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a2), (I-b2), (I-c2), (I-d2), (I-e2), (I- f2), (I-g2), (I-h2), or (I-i2); a structural lipid; a stealth lipid; and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a3), (I-b3), (I-c3), (I- d3), (I-e3), (I-f3), (I-g3), (I-h3), or (I-i3) and a structural lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a3), (I-b3), (I-c3), (I-d3), (I-e3), (I-f3), (I-g3), (I-h3), or (I-i3) and a stealth lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a3), (I-b3), (I-c3), (I-d3), (I-e3), (I-f3), (I-g3), (I-h3), or (I-i3) and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a3), (I-b3), (I-c3), (I-d3), (I-e3), (I- f3), (I-g3), (I-h3), or (I-i3); a structural lipid; a stealth lipid; and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a4), (I-b4), (I-c4), (I- d4), (I-e4), (I-f4), (I-g4), (I-h4), or (I-i4) and a structural lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a4), (I-b4), (I-c4), (I-d4), (I-e4), (I-f4), (I-g4), (I-h4), or (I-i4) and a stealth lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a4), (I-b4), (I-c4), (I-d4), (I-e4), (I-f4), (I-g4), (I-h4), or (I-i4) and a helper lipid. In some embodiments, the LNP comprises a lipid of Formula (I-a4), (I-b4), (I-c4), (I-d4), (I-e4), (I- f4), (I-g4), (I-h4), or (I-i4); a structural lipid; a stealth lipid; and a helper lipid. In some embodiments, the ionizable or cationic lipid may comprise a molar ratio from about 35% to about 45% of the total lipid present in the lipid nanoparticle. In some embodiments, the ionizable or cationic lipid may comprise a molar ratio of about 40% of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth (e.g., PEGylated) lipid may comprise a molar ratio from about 0.5% to about 7% of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth (e.g., PEGylated) lipid may comprise a molar ratio of about 1.5% of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth (e.g., PEGylated) lipid may comprise a molar ratio of about 5% of the total lipid present in the lipid nanoparticle. In some embodiments, the structural lipid may comprise a molar ratio from about 20% to about 35% of the total lipid present in the lipid nanoparticle. In some embodiments, the structural lipid may comprise a molar ratio of about 30% of the total lipid present in the lipid nanoparticle. In some embodiments, the helper lipid may comprise a molar ratio from about 20% to about 30% of the total lipid present in the lipid nanoparticle. In some embodiments, the helper lipid may comprise a molar ratio of about 25% of the total lipid present in the lipid nanoparticle. In some embodiments, the helper lipid may comprise a molar ratio of about 28.5% of the total lipid present in the lipid nanoparticle. In some embodiments, the LNP comprises the ionizable or cationic lipid at a molar ratio between 35% and 45%; the structural lipid at a molar ratio between 20% and 35%, the stealth lipid at a molar ratio between 0.5% and 7%, and the helper lipid at a molar ratio between 20% and 30%. In some embodiments, the LNP comprises the ionizable or cationic lipid at a molar ratio of about 40%; the structural lipid at a molar ratio of about 30%; the stealth lipid at a molar ratio of about 1.5%, and the helper lipid at a molar ratio of about 28.5%. In some embodiments, the LNP comprises the ionizable or cationic lipid at a molar ratio of about 40%; the structural lipid at a molar ratio of about 30%; the stealth lipid at a molar ratio of about 5%, and the helper lipid at a molar ratio of about 25%. To calculate the actual amount of each lipid to be put into an LNP formulation, the molar amount of the cationic or ionizable lipid is first determined based on a desired N / P ratio, where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA to be transported by the LNP. Next, the molar amount of each of the other lipids is calculated based on the molar amount of the cationic lipid and the molar ratio selected. These molar amounts are then converted to weights using the molecular weight of each lipid. E. Active Ingredients of the LNPs The active ingredient of the present LNP composition may be an mRNA that encodes a polypeptide of interest. In certain embodiments, the polypeptide is an antigen. In certain embodiments, the polypeptide is a therapeutic polypeptide. The therapeutic polypeptide may be an antibody (e.g., an antibody heavy chain or an antibody light chain. The therapeutic polypeptide may be an enzyme. The mRNA molecule encapsulated by the present disclosure LNPs may comprise at least one ribonucleic acid (RNA) comprising an ORF encoding a polypeptide of interest. In certain embodiments, the mRNA further comprises at least one 5’ UTR, 3’ UTR, a poly(A) tail, and / or a 5’ cap. i.5’ Cap An mRNA 5’ cap can provide resistance to nucleases found in most eukaryotic cells and promote translation efficiency. Several types of 5’ caps are known. A 7- methylguanosine cap (also referred to as “m7G” or “Cap-0”), comprises a guanosine that is linked through a 5’ – 5’ - triphosphate bond to the first transcribed nucleotide. A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5’ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5 ‘5 ‘5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5’)ppp, (5’(A,G(5’)ppp(5’)A, and G(5’)ppp(5’)G. Additional cap structures are described in U.S. Publication No. US 2016 / 0032356 and U.S. Publication No. US 2018 / 0125989, which are incorporated herein by reference. 5’-capping of polynucleotides may be completed concomitantly during the in vitro- transcription reaction using the following chemical RNA cap analogs to generate the 5’- guanosine cap structure according to manufacturer protocols: 3’-O-Me-m7G(5’)ppp(5’)G (the ARCA cap); G(5’)ppp(5’)A; G(5’)ppp(5’)G; m7G(5’)ppp(5’)A; m7G(5’)ppp(5’)G; m7G(5')ppp(5')(2'OMeA)pG; m7G(5')ppp(5')(2'OMeA)pU; m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies).5’-capping of modified RNA may be completed post-transcriptionally using a vaccinia virus capping enzyme to generate the Cap 0 structure: m7G(5’)ppp(5’)G. Cap 1 structure may be generated using both vaccinia virus capping enzyme and a 2’-O methyl-transferase to generate: m7G(5’)ppp(5’)G- 2’-O-methyl. Cap 2 structure may be generated from the Cap 1 structure followed by the 2’- O-methylation of the 5’-antepenultimate nucleotide using a 2’-O methyl-transferase. Cap 3 structure may be generated from the Cap 2 structure followed by the 2’-O-methylation of the 5’-preantepenultimate nucleotide using a 2’-O methyl-transferase. In certain embodiments, the mRNA of the disclosure comprises a 5’ cap selected from the group consisting of 3’-O-Me-m7G(5’)ppp(5’)G (the ARCA cap), G(5’)ppp(5’)A, G(5’)ppp(5’)G, m7G(5’)ppp(5’)A, m7G(5’)ppp(5’)G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeG)pG. In certain embodiments, the mRNA of the disclosure comprises a 5’ cap of: . ii. Untranslated Region (UTR) In some embodiments, the mRNA of the disclosure includes a 5’ and / or 3’ untranslated region (UTR). In mRNA, the 5’ UTR starts at the transcription start site and continues to the start codon but does not include the start codon. The 3’ UTR starts immediately following the stop codon and continues until the transcriptional termination signal. In some embodiments, the mRNA disclosed herein may comprise a 5’ UTR that includes one or more elements that affect an mRNA’s stability or translation. In some embodiments, a 5’ UTR may be about 10 to 5,000 nucleotides in length. In some embodiments, a 5’ UTR may be about 50 to 500 nucleotides in length. In some embodiments, the 5’ UTR is at least about 10 nucleotides in length, about 20 nucleotides in length, about 30 nucleotides in length, about 40 nucleotides in length, about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1,000 nucleotides in length, about 1,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length or about 5,000 nucleotides in length. In some embodiments, the mRNA disclosed herein may comprise a 3’ UTR comprising one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA’s stability of location in a cell, or one or more binding sites for miRNAs. In some embodiments, a 3’ UTR may be 50 to 5,000 nucleotides in length or longer. In some embodiments, a 3’ UTR may be 50 to 1,000 nucleotides in length or longer. In some embodiments, the 3’ UTR is at least about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1,000 nucleotides in length, about 1,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length, or about 5,000 nucleotides in length. In some embodiments, the mRNA disclosed herein may comprise a 5’ or 3’ UTR that is derived from a gene distinct from the one encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR). In certain embodiments, the 5’ and / or 3’ UTR sequences can be derived from mRNA which are stable (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the mRNA. For example, a 5’ UTR sequence may include a partial sequence of a CMV immediate-early 1 (IE1) gene, or a fragment thereof, to improve the nuclease resistance and / or improve the half-life of the mRNA. Also contemplated is the inclusion of a sequence encoding human growth hormone (hGH), or a fragment thereof, to the 3’ end or untranslated region of the mRNA. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the mRNA relative to their unmodified counterparts, and include, for example, modifications made to improve such mRNA resistance to in vivo nuclease digestion. Exemplary 5’ UTRs include a sequence derived from a CMV immediate-early 1 (IE1) gene (U.S. Publication Nos.2014 / 0206753 and 2015 / 0157565, each of which is incorporated herein by reference), or the sequence GGGAUCCUACC(SEQ ID NO:1) (U.S. Publication No.2016 / 0151409, incorporated herein by reference). In various embodiments, the 5’ UTR may be derived from the 5’ UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5’-terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by growth-associated translational regulation. However, TOP genes with a tissue specific translational regulation are also known. In certain embodiments, the 5’ UTR derived from the 5’ UTR of a TOP gene lacks the 5’ TOP motif (the oligopyrimidine tract) (e.g., U.S. Publication Nos.2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each of which is incorporated herein by reference). In certain embodiments, the 5’ UTR is derived from a ribosomal protein Large 32 (L32) gene (U.S. Publication No.2017 / 0029847, supra). In certain embodiments, the 5’ UTR is derived from the 5’ UTR of an hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (U.S. Publication No.2016 / 0166710, supra). In certain embodiments, the 5’ UTR is derived from the 5’ UTR of an ATP5A1 gene (U.S. Publication No.2016 / 0166710, supra). In some embodiments, an internal ribosome entry site (IRES) is used instead of a 5’ UTR. In some embodiments, the 5’UTR comprises a nucleic acid sequence reproduced below: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAA GACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGG AUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG(SEQ ID NO:2). In some embodiments, the 3’UTR comprises a nucleic acid sequence reproduced below: CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAA GUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC (SEQ ID NO:3). The 5’ UTR and 3’UTR are described in further detail in WO2012 / 075040, incorporated herein by reference. iii. Polyadenylated Tail As used herein, the terms “poly(A) sequence,” “poly(A) tail,” and “poly(A) region” refer to a sequence of adenosine nucleotides at the 3’ end of the mRNA molecule. The poly(A) tail may confer stability to the mRNA and protect it from exonuclease degradation. The poly(A) tail may enhance translation. In some embodiments, the poly(A) tail is essentially homopolymeric. For example, a poly(A) tail of 100 adenosine nucleotides may have essentially a length of 100 nucleotides. In certain embodiments, the poly(A) tail may be interrupted by at least one nucleotide different from an adenosine nucleotide (e.g., a nucleotide that is not an adenosine nucleotide). For example, a poly(A) tail of 100 adenosine nucleotides may have a length of more than 100 nucleotides (comprising 100 adenosine nucleotides and at least one nucleotide, or a stretch of nucleotides, that are different from an adenosine nucleotide). In certain embodiments, the poly(A) tail comprises the sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA(SEQ ID NO:4). The “poly(A) tail,” as used herein, typically relates to RNA. However, in the context of the disclosure, the term likewise relates to corresponding sequences in a DNA molecule (e.g., a “poly(T) sequence”). The poly(A) tail(SEQ ID NO:5) may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. The length of the poly(A) tail may be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides. In some embodiments where the nucleic acid is an RNA, the poly(A) (SEQ ID NO:5)tail of the nucleic acid is obtained from a DNA template during RNA in vitro transcription. In certain embodiments, the poly(A) tail is obtained in vitro by common methods of chemical synthesis without being transcribed from a DNA template. In various embodiments, poly(A) tails are generated by enzymatic polyadenylation of the RNA (after RNA in vitro transcription) using commercially available polyadenylation kits and corresponding protocols, or alternatively, by using immobilized poly(A)polymerases, e.g., using methods and means as described in WO2016 / 174271. The nucleic acid may comprise a poly(A) tail obtained by enzymatic polyadenylation, wherein the majority of nucleic acid molecules comprise about 100 (+ / -20) to about 500 (+ / - 50) or about 250 (+ / -20) adenosine nucleotides. In some embodiments, the nucleic acid may comprise a poly(A) tail derived from a template DNA and may additionally comprise at least one additional poly(A) tail generated by enzymatic polyadenylation, e.g., as described in WO2016 / 091391. In certain embodiments, the nucleic acid comprises at least one polyadenylation signal. In various embodiments, the nucleic acid may comprise at least one poly(C) sequence. The term ‘‘poly(C) (SEQ ID NO:6)sequence,” as used herein, is intended to be a sequence of cytosine nucleotides of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 30 cytosine nucleotides. iv. Chemical Modification The mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA may comprise at least one chemical modification. In some embodiments, the mRNA disclosed herein may contain one or more modifications that typically enhance RNA stability. Exemplary modifications can include backbone modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A) and guanine (G)) or pyrimidines (thymine (T), cytosine (C), and uracil (U)). In certain embodiments, the disclosed mRNA may be synthesized from modified nucleotide analogues or derivatives of purines and pyrimidines, such as, e.g., 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl- cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2- dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5- (carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5- carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxy acetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5’-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7- deazaguanosine, 5-methylcytosine, and inosine. In some embodiments, the disclosed mRNA may comprise at least one chemical modification including, but not limited to, pseudouridine, N1-methylpseudouridine, 2- thiouridine, 4’-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio- l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2’-O-methyl uridine. In some embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and a combination thereof. In some embodiments, the chemical modification comprises N1-methylpseudouridine. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the mRNA are chemically modified. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the ORF are chemically modified. The preparation of such analogues is described, e.g., in U.S. Pat. No.4,373,071, U.S. Pat. No.4,401,796, U.S. Pat. No.4,415,732, U.S. Pat. No.4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No.4,668,777, U.S. Pat. No.4,973,679, U.S. Pat. No.5,047,524, U.S. Pat. No.5,132,418, U.S. Pat. No.5,153,319, U.S. Pat. No.5,262,530, and U.S. Pat. No. 5,700,642. v. mRNA Synthesis The mRNAs disclosed herein may be synthesized according to any of a variety of methods. For example, mRNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Some methods for in vitro transcription are described, e.g., in Geall et al. (2013) Semin. Immunol.25(2): 152-159; Brunelle et al. (2013) Methods Enzymol.530:101-14. Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions may vary according to the specific application. The presence of these reagents is generally undesirable in a final mRNA product and these reagents can be considered impurities or contaminants which can be purified or removed to provide a clean and / or homogeneous mRNA that is suitable for therapeutic use. While mRNA provided from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA can be used according to the instant disclosure including wild-type mRNA produced from bacteria, fungi, plants, and / or animals. Where desired, the LNP or the LNP formulation may be multi-valent. In some embodiments, the LNP may carry mRNAs that encode more than one polypeptide (e.g., antigen), such as two, three, four, five, six, seven, eight, nine, ten, or more polypeptides. For example, the LNP may carry multiple mRNA molecules, each encoding a different polypeptide; or carry a polycistronic mRNA that can be translated into more than one polypeptide (e.g., each polypeptide-coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide such as a 2A peptide). An LNP carrying different mRNA molecules typically comprises (encapsulate) multiple copies of each mRNA molecule. For example, an LNP carrying or encapsulating two different mRNA molecules typically carries multiple copies of each of the two different mRNA molecules. In some embodiments, a single LNP formulation may comprise multiple kinds (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) of LNPs, each kind carrying a different mRNA. F. Buffer and Other Components To stabilize the nucleic acid and / or LNPs (e.g., to prolong the shelf-life of the vaccine product), to facilitate administration of the LNP pharmaceutical composition, and / or to enhance in vivo expression of the nucleic acid, the nucleic acid and / or LNP can be formulated in combination with one or more carriers, targeting ligands, stabilizing reagents (e.g., preservatives and antioxidants), and / or other pharmaceutically acceptable excipients. Examples of such excipients are parabens, thimerosal, thiomersal, chlorobutanol, bezalkonium chloride, and chelators (e.g., EDTA). The LNP compositions of the present disclosure can be provided as a frozen liquid form or a lyophilized form. A variety of cryoprotectants may be used, including, without limitations, sucrose, trehalose, glucose, mannitol, mannose, dextrose, and the like. The cryoprotectant may constitute 5-30% (w / v) of the LNP composition. In some embodiments, the LNP composition comprises trehalose, e.g., at 5-30% (e.g., 10%) (w / v). Once formulated with the cryoprotectant, the LNP compositions may be frozen (or lyophilized and cryopreserved) at -20oC to -80oC. The LNP compositions may be provided to a patient in an aqueous buffered solution – thawed if previously frozen, or if previously lyophilized, reconstituted in an aqueous buffered solution at bedside. The buffered solution may be isotonic and suitable for e.g., intramuscular or intradermal injection. In some embodiments, the buffered solution is a phosphate-buffered saline (PBS). G. Processes for Making the Present LNP Formulations The present LNPs can be prepared by various techniques presently known in the art. For example, multilamellar vesicles (MLV) may be prepared according to conventional techniques, such as by depositing a selected lipid on the inside wall of a suitable container or vessel by dissolving the lipid in an appropriate solvent, and then evaporating the solvent to leave a thin film on the inside of the vessel or by spray drying. An aqueous phase may then be added to the vessel with a vortexing motion that results in the formation of MLVs. Unilamellar vesicles (ULV) can then be formed by homogenization, sonication or extrusion of the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques. Various methods are described in US 2011 / 0244026, US 2016 / 0038432, US 2018 / 0153822, US 2018 / 0125989, and PCT / US2020 / 043223 (filed July 23, 2020) and can be used to practice the present disclosure. One exemplary process entails encapsulating mRNA by mixing it with a mixture of lipids, without first pre-forming the lipids into lipid nanoparticles, as described in US 2016 / 0038432. Another exemplary process entails encapsulating mRNA by mixing pre-formed LNPs with mRNA, as described in US 2018 / 0153822. In some embodiments, the process of preparing mRNA-loaded LNPs includes a step of heating one or more of the solutions to a temperature greater than ambient temperature, the one or more solutions being the solution comprising the pre-formed lipid nanoparticles, the solution comprising the mRNA and the mixed solution comprising the LNP-encapsulated mRNA. In some embodiments, the process includes the step of heating one or both of the mRNA solution and the pre-formed LNP solution, prior to the mixing step. In some embodiments, the process includes heating one or more of the solutions comprising the pre- formed LNPs, the solution comprising the mRNA and the solution comprising the LNP- encapsulated mRNA, during the mixing step. In some embodiments, the process includes the step of heating the LNP- encapsulated mRNA, after the mixing step. In some embodiments, the temperature to which one or more of the solutions is heated is or is greater than about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. In some embodiments, the temperature to which one or more of the solutions is heated ranges from about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60- 70°C. In some embodiments, the temperature is about 65°C. Various methods may be used to prepare an mRNA solution suitable for the present disclosure. In some embodiments, mRNA may be directly dissolved in a buffer solution described herein. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution prior to mixing with a lipid solution for encapsulation. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution immediately before mixing with a lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution may contain mRNA in water or a buffer at a concentration at or greater than about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml. In some embodiments, an mRNA stock solution is mixed with a buffer solution using a pump. Exemplary pumps include but are not limited to gear pumps, peristaltic pumps and centrifugal pumps. Typically, the buffer solution is mixed at a rate greater than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x greater than the rate of the mRNA stock solution. In some embodiments, a buffer solution is mixed at a flow rate ranging between about 100-6000 ml / minute (e.g., about 100-300 ml / minute, 300-600 ml / minute, 600-1200 ml / minute, 1200-2400 ml / minute, 2400-3600 ml / minute, 3600-4800 ml / minute, 4800-6000 ml / minute, or 60-420 ml / minute). In some embodiments, a buffer solution is mixed at a flow rate of, or greater than, about 60 ml / minute, 100 ml / minute, 140 ml / minute, 180 ml / minute, 220 ml / minute, 260 ml / minute, 300 ml / minute, 340 ml / minute, 380 ml / minute, 420 ml / minute, 480 ml / minute, 540 ml / minute, 600 ml / minute, 1200 ml / minute, 2400 ml / minute, 3600 ml / minute, 4800 ml / minute, or 6000 ml / minute. In some embodiments, an mRNA stock solution is mixed at a flow rate ranging between about 10-600 ml / minute (e.g., about 5-50 ml / minute, about 10-30 ml / minute, about 30-60 ml / minute, about 60-120 ml / minute, about 120-240 ml / minute, about 240-360 ml / minute, about 360-480 ml / minute, or about 480-600 ml / minute). In some embodiments, an mRNA stock solution is mixed at a flow rate of or greater than about 5 ml / minute, 10 ml / minute, 15 ml / minute, 20 ml / minute, 25 ml / minute, 30 ml / minute, 35 ml / minute, 40 ml / minute, 45 ml / minute, 50 ml / minute, 60 ml / minute, 80 ml / minute, 100 ml / minute, 200 ml / minute, 300 ml / minute, 400 ml / minute, 500 ml / minute, or 600 ml / minute. The process of incorporation of a desired mRNA into a lipid nanoparticle is referred to as “loading.” Exemplary methods are described in Lasic et al., FEBS Lett. (1992) 312:255-8. The LNP-incorporated nucleic acids may be completely or partially located in the interior space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or associated with the exterior surface of the lipid nanoparticle membrane. The incorporation of an mRNA into lipid nanoparticles is also referred to herein as “encapsulation” wherein the nucleic acid is entirely or substantially contained within the interior space of the lipid nanoparticle. Suitable LNPs may be made in various sizes. In some embodiments, decreased size of lipid nanoparticles is associated with more efficient delivery of an mRNA. Selection of an appropriate LNP size may take into consideration the site of the target cell or tissue and to some extent the application for which the lipid nanoparticle is being made. A variety of methods known in the art are available for sizing of a population of lipid nanoparticles. Preferred methods herein utilize Zetasizer Nano ZS (Malvern Panalytical) to measure LNP particle size. In one protocol, 10 μl of an LNP sample are mixed with 990 μl of 10% trehalose. This solution is loaded into a cuvette and then put into the Zetasizer machine. The z-average diameter (nm), or cumulants mean, is regarded as the average size for the LNPs in the sample. The Zetasizer machine can also be used to measure the polydispersity index (PDI) by using dynamic light scattering (DLS) and cumulant analysis of the autocorrelation function. Average LNP diameter may be reduced by sonication of formed LNP. Intermittent sonication cycles may be alternated with quasi-elastic light scattering (QELS) assessment to guide efficient lipid nanoparticle synthesis. In some embodiments, the majority of purified LNPs, i.e., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the LNPs, have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all (e.g., greater than 80 or 90%) of the purified lipid nanoparticles have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, the LNPs in the present composition have an average size of less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm. In some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the LNPs in the present composition have a size ranging from about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm), about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm), or about 50-70 nm (e.g., 55-65 nm) are particular suitable for pulmonary delivery via nebulization. In some embodiments, the dispersity, or measure of heterogeneity in size of molecules (PDI), of LNPs in a pharmaceutical composition provided by the present disclosure is less than about 0.5. In some embodiments, an LNP has a PDI of less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12, less than about 0.10, or less than about 0.08. The PDI may be measured by a Zetasizer machine as described above. In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified LNPs in a pharmaceutical composition provided herein encapsulate an mRNA within each individual particle. In some embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles in a pharmaceutical composition encapsulate an mRNA within each individual particle. In some embodiments, a lipid nanoparticle has an encapsulation efficiency of between 50% and 99%; or greater than about 60, 65, 70, 75, 80, 85, 90, 92, 95, 98, or 99%. Typically, lipid nanoparticles for use herein have an encapsulation efficiency of at least 90% (e.g., at least 91, 92, 93, 94, or 95%). In some embodiments, an LNP has a N / P ratio of between 1 and 10. In some embodiments, a lipid nanoparticle has a N / P ratio above 1, about 1, about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In further embodiments, a typical LNP herein has an N / P ratio of 4. In some embodiments, a pharmaceutical composition according to the present disclosure contains at least about 0.5 μg, 1 μg, 5 μg, 10 μg, 100 μg, 500 μg, or 1000 μg of encapsulated mRNA. In some embodiments, a pharmaceutical composition contains about 0.1 μg to 1000 μg, at least about 0.5 μg, at least about 0.8 μg, at least about 1 μg, at least about 5 μg, at least about 8 μg, at least about 10 μg, at least about 50 μg, at least about 100 μg, at least about 500 μg, or at least about 1000 μg of encapsulated mRNA. Packaging and Use of the mRNA-LNP The mRNA-LNP can be packaged for parenteral (e.g., intramuscular, intradermal, subcutaneous, or intravenous) administration, nasopharyngeal (e.g., intranasal) administration, or mucosal (e.g., intranasal, oral, rectal) administration. The compositions may be in the form of an extemporaneous formulation, where the LNP composition is lyophilized and reconstituted with a physiological buffer (e.g., PBS) just before use. The compositions also may be shipped and provided in the form of an aqueous solution or a frozen aqueous solution and can be directly administered to subjects without reconstitution (after thawing, if previously frozen). Accordingly, the present disclosure provides an article of manufacture, such as a kit, that provides the mRNA-LNP in a single container, or provides the mRNA-LNP in one container and a physiological buffer for reconstitution in another container. The container(s) may contain a single-use dosage or multi-use dosage. The containers may be pre-treated glass vials or ampules. The article of manufacture may include instructions for use as well. In some embodiments, the present disclosure provides methods of preventing or treating a disease or disorder by administering the composition of the disclosure to a subject in need thereof. In some embodiments, the subject is suffering from or susceptible to an infection. In some embodiments, the present disclosure provides methods of eliciting an immune response in a subject in need thereof, comprising administering to the subject a prophylactically effective amount of a composition described herein. In some embodiments, the present disclosure provides methods of preventing an infection or reducing one or more symptoms of an infection in a subject in need thereof, comprising administering to the subject a prophylactically effective amount of the composition. In some embodiments of the methods described herein, the composition is administered to the subject mucosally, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally. In some embodiments, the composition is administered mucosally. In some embodiments, the composition is administered intranasally. Intranasal administration includes administration via the nose, either with or without concomitant inhalation during administration. Such administration is typically through contact by the composition with the nasal mucosa, nasal turbinates or sinus cavity. The pharmaceutical compositions for administration may be applied in a single administration or in multiple administrations. For example, one dose can be placed in each nostril during administration. For example, bi-dose delivery can be used with the compositions according to the invention. Bi-dose devices contain two sub-doses of a single dose, one sub-dose for administration to each nostril. Generally, the two sub-doses are present in a single chamber and the construction of the device allows the efficient delivery of a single sub-dose at a time. Alternatively, a mono-dose device may be used for administering the compositions according to the invention. The composition can be given in one, two, three, four, or more doses, so that the subject is given a first dose (which can be a bi-dose or mono-dose, as described above), and then a second dose is administered within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,27, 28, 29, or 30 days, or 4 ,5, 6, 7, 8, 9, 10, 11, or 12 weeks, or 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more years apart. Exemplary devices for intranasal administration of the compositions according to the invention are spray devices. Suitable commercially available nasal spray devices include Accuspray™ (Becton Dickinson). Nebulizers produce a very fine spray (such as a mist) which can be easily inhaled and are also contemplated herein. Exemplary spray devices for intranasal use are devices for which the performance of the device is not dependent upon the pressure applied by the user. These devices are known as pressure threshold devices. Liquid is released from the nozzle only when a threshold pressure is applied. These devices make it easier to achieve a spray with a regular droplet size. Pressure threshold devices suitable for use with the present invention are known in the art. The invention provides in a further aspect a pharmaceutical kit comprising an intranasal administration device as described herein containing a formulation according to the invention. The invention is not necessarily limited to spray delivery of liquid formulations. Compositions according to the invention may be administered in other forms e.g. as a powder. In some embodiments of the methods described herein, the subject is administered one or more doses of the composition, wherein each dose comprises 1 ug – 25 mg of mRNA. In some embodiments, each dose comprises 2.5-135 μg of mRNA. In some embodiments, each dose comprises 250 ug – 13.5 mg of mRNA. In some embodiments, each dose comprises 2.5., 5, 15, 30, 45, 50, 135, 250, or 500 μg or 1, 1.5, 2.5, 3, 4, 5, 7.5 or 10 mg of mRNA. In some embodiments of the methods described herein, the subject is administered two doses of the composition. In some embodiments, the two doses of the composition are administered with an interval of 2-6 weeks. In some embodiments, the two doses of the composition are administered with an interval of 2, 3, 4, 5, or 6 weeks. In some embodiments, the two doses of the composition are administered with an interval of 4 weeks. The present disclosure also provides the use of a composition described herein for the manufacture of a medicament for use in any of the methods described herein. The present disclosure further provides a kit comprising a composition of the present disclosure. In some embodiments, the kit comprises a containing comprising a single-use or multi-use dosage of the composition. In some embodiments, the containing is a vial. In some embodiments, the container is a pre-filled nasal spray device. V. Particular Embodiments The present disclosure provides the following particular embodiments of the lipids, compositions, and uses disclosed herein: 1. A lipid of Formula (I): or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. 2. A lipid of Formula (I): (I), or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3is or ; X1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of: wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4. 3. The lipid of embodiment 1 or embodiment 2, or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, and ; X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)S-, -SC(O)-, or - OC(O)O-; and X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl. 4. The lipid of any one of embodiments 1-3, or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, and ; X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, or -OC(O)O-; and X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl. 5. The lipid of embodiment 1 or embodiment 2, or a pharmaceutically acceptable salt thereof, wherein two of R1, R2, and R3are independently selected from the group consisting of:
[0013] 6. The lipid of embodiment 1 or embodiment 2, or a pharmaceutically acceptable salt thereof, wherein two of R1, R2, and R3are independently selected from the group consisting of:
[0014] 7. The lipid of any one of embodiments 1-6, or a pharmaceutically acceptable salt thereof, wherein: one of R1, R2, and R3is X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. 8. The lipid of any one of embodiments 1-7, or a pharmaceutically acceptable salt thereof, wherein: one of R1, R2, and R3is ; X4is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. 9. The lipid of any one of embodiments 1-3, or a pharmaceutically acceptable salt thereof, wherein: R1and R2are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, or R3is X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)S-, -SC(O)-, or - OC(O)O-; X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl; X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. 10. The lipid of any one of embodiments 1-4, or a pharmaceutically acceptable salt thereof, wherein: R1and R2are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, or R3is or X1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, or -OC(O)O-; X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl; X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group. 11. The lipid of any one of embodiments 1-10, or a pharmaceutically acceptable salt thereof, wherein A is ; and RA1and RA2are each independently -C(1-6)alkyl that is optionally substituted with - OH; or RA1and RA2are taken together to form a 3- to 6-membered heteroaryl that is optionally substituted with one to three -C(1-3)alkyl groups. 12. The lipid of any one of embodiments 1-10, or a pharmaceutically acceptable salt thereof, wherein A is ; and RA1and RA2are each independently -C(1-6)alkyl that is optionally substituted with - OH; or RA1and RA2are taken together to form a 3- to 6-membered heterocyclyl that is optionally substituted with one to three -C(1-3)alkyl groups. 13. The lipid of any one of embodiments 1-10 or 12, or a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of: 14. The lipid of any one of embodiments 1-13, or a pharmaceutically acceptable salt thereof, wherein A is -N(CH3)2. 15. The lipid of any one of embodiments 1-10, 12, and 13, or a pharmaceutically acceptable salt thereof, wherein is selected from the group consisting of:
[0015] 16. The lipid of any one of embodiments 1-15, or a pharmaceutically acceptable salt thereof, wherein is selected from the group consisting of: 17. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 18. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 19. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 20. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of:
[0016] or a pharmaceutically acceptable salt thereof. 21. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 22. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 23. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 24. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 25. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 26. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 27. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 28. The lipid of any one of embodiments 1-16, having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 29. The lipid of any one of embodiments 1-16, 18, 20-22, and 26, or a pharmaceutically acceptable salt thereof, wherein RXis -H or -CH3. 30. The lipid of any one of embodiments 1-29, or a pharmaceutically acceptable salt thereof, wherein n is 1 or 2. 31. The lipid of any one of embodiments 1-30, or a pharmaceutically acceptable salt thereof, wherein n is 1. 32. The lipid of any one of embodiments 1-30, or a pharmaceutically acceptable salt thereof, wherein n is 2. 33. A lipid having a structure selected from the group consisting of:
[0017] or a pharmaceutically acceptable salt thereof. 34. A lipid having a structure selected from the group consisting of: or a pharmaceutically acceptable salt thereof. 35. A composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises the lipid of any one of embodiments 1-34. 36. The composition of embodiment 35, wherein the LNP comprises: (I) the lipid of any one of embodiments 1-34; (II) a stealth lipid; (III) a structural lipid; and (IV) a helper lipid. 37. The composition of embodiment 36, wherein the stealth lipid is a polyethylene glycol- conjugated (PEGylated) lipid, a polyoxazoline polymer-conjugated lipid, or a polysarcosine- conjugated (pSar) lipid. 38. The composition of embodiment 37, wherein the stealth lipid is a PEGylated lipid selected from 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2- distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG), 1,2- dilauroyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DLPE-PEG), and 1,2- distearoyl-rac-glycero-polyethelene glycol (DSG-PEG). 39. The composition of embodiment 38, wherein the PEGylated lipid is dimyristoyl- PEG2000 (DMG-PEG2000). 40. The composition of any one of embodiments 36-39, wherein the structural lipid is a sterol. 41. The composition of embodiment 40, wherein the sterol is cholesterol. 42. The composition of any one of embodiments 36-41, wherein the helper lipid is 1,2- dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE); 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC); 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); 1,2- dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE); and 1,2-dioleoyl-sn-glycero-3- phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero- 3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), or 1,2- dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE). 43. The composition of embodiment 42, wherein the helper lipid is 1,2-dioleoyl-SN- glycero-3-phosphoethanolamine (DOPE). 44. The composition of any one of embodiments 36-43, wherein the LNP comprises: the lipid of any one of claims 1-34 at a molar ratio between 35% and 45%, the stealth lipid at a molar ratio between 0.5% and 7%, the structural lipid at a molar ratio between 20% and 35%, and the helper lipid at a molar ratio of between 20% and 30%. 45. The composition of claim 44, wherein the LNP comprises: the lipid of any one of claims 1-23 at a molar ratio of about 40%, the stealth lipid at a molar ratio of about 1.5%, the structural lipid at a molar ratio of about 30%, and the helper lipid at a molar ratio of about 28.5%. 46. The composition of claim 44, wherein the LNP comprises: the lipid of any one of claims 1-23 at a molar ratio of about 40%, the stealth lipid at a molar ratio of about 5%, the structural lipid at a molar ratio of about 30%, and the helper lipid at a molar ratio of about 25%. 47. The composition of any one of embodiments 35-46, further comprising a nucleic acid molecule, wherein the nucleic acid molecule is encapsulated in the LNP. 48. The composition of embodiment 47, wherein the LNP comprises 1-20, optionally 5- 10 or 6-8, nucleic acid molecules. 49. The composition of embodiment 47 or embodiment 48, wherein the nucleic acid molecule is an mRNA molecule. 50. The composition of embodiment 49, wherein the mRNA molecule encodes an antigen, optionally a viral antigen or a bacterial antigen. 51. The composition of embodiment 49 or embodiment 50, wherein the LNP encapsulates two or more mRNA molecules, wherein each mRNA molecule encodes a different antigen, optionally wherein the different antigens are from the same pathogen or from different pathogens. 52. The composition of embodiment 49 or embodiment 50, wherein the composition comprises two or more LNPs, wherein each LNP encapsulates an mRNA encoding a different antigen, optionally wherein the different antigens are from the same pathogen or from different pathogens. 53. The composition of any one of embodiments 35-52, wherein the composition is formulated for intranasal administration. 54. The composition of any one of claims embodiments 35-53, wherein the composition comprises a phosphate-buffer saline. 55. The composition of any one of embodiments 35-54, wherein the composition comprises trehalose, optionally at 10% (w / v) of the composition. 56. A method of eliciting an immune response in a subject in need thereof, comprising administering to the subject, optionally mucosally, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of the composition of any one of embodiments 47-55. 57. A method of preventing an infection or reducing one or more symptoms of an infection in a subject in need thereof, comprising administering to the subject, optionally mucosally, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of the composition of any one of embodiments 47-55. 58. The method of embodiment 56 or embodiment 57, wherein the composition is administered intranasally. 59. The method of any one of embodiments 56-58, comprising administering to the subject one or more doses of the composition, each dose comprising 1-250, optionally 2.5., 5, 15, 45, or 135, μg of mRNA. 60. The method of any one of embodiments 56-59, comprising administering to the subject two doses of the composition with an interval of 2-6, optionally 4, weeks. 61. Use of the composition of any one of embodiments 47-55 for the manufacture of a medicament for use in treating a subject in need thereof, optionally in a method of any one of embodiments 56-60. 62. The composition of any one of embodiments 47-55 for use in treating a subject in need thereof, optionally in a method of any one of embodiments 56-60. 63. A kit comprising a container comprising a single-use or multi-use dosage of the composition of any one of embodiments 47-55, optionally wherein the container is a vial or a pre-filled nasal spray device. EXAMPLES The compounds and methods disclosed herein are further illustrated by the following examples, which should not be construed as further limiting. The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of organic synthesis, cell biology, cell culture, and molecular biology, which are within the skill of the art. The following examples further illustrate aspects of the present disclosure. However, they are in no way a limitation of the teachings of the present disclosure as set forth. HPLC Analytical Methods Method 1: HPLC: Agilent 1100 Column: Agela C18 column, 4.6 x 50 mm, 3 µm Column temperature: 60°C Flow Rate: 1.0 mL / min Detector: ELSD Eluents: A, acetonitrile with 0.1% TFA; B, water with 0.1% TFA. Gradient: Method 2: HPLC: Agilent 1100 Column: Agela C18 column, 4.6 x 50 mm, 3 µm Column temperature: 60°C Flow Rate: 0.5 mL / min Detector: ELSD Eluents: A, Isopropanol; B, water with 0.1% TFA. Gradient: Method 3: HPLC: Agilent 1100 Column: Agela C18 column, 4.6 x 50 mm, 3 µm Column temperature: 60°C Flow Rate: 0.5 mL / min Detector: ELSD Eluents: A, Isopropanol; B, water. Gradient: Example 1: Dioctadecyl (S)-2-((3-(dimethylamino)propanoyl)oxy)succinate Step 1: Synthesis of Dimethyl (S)-2-hydroxysuccinate (1) To a solution of L-Malic acid (6 g, 44.7 mmol) in 30 mL methanol, was added 4 M hydrogen chloride in dioxane (5 mL) and the mixture was stirred at room temperature for 17 h. The reaction was carefully basified by adding saturated sodium bicarbonate solution, and the solution was extracted with dichloromethane (3 x 100 mL). The combined organic extracts were washed with brine, dried (anhydrous sodium sulfate) and concentrated to give dimethyl L-malate as an oil (4.35 g, 60%). The crude dimethyl malate was used for the next step without further purification. Step 2: Synthesis of Dioctadecyl (S)-2-hydroxysuccinate (2) A mixture of dimethyl malate 1 (4.35 g, 26.8 mmol), octadecan-1-ol (14.51 g, 53.6 mmol), p-toluene sulfonic acid (800 mg, 4.6 mmol) in 650 mL toluene, was refluxed vigorously with Dean-stark apparatus. After 500 mL of solvent was distilled off, another 500- mL of toluene was added, and the distillation and removal of distillate was continued. This process was repeated one more time. The reaction mixture was cooled to room temperature and washed with saturated NaHCO3(100 mL), and the aqueous layer was extracted with ethyl acetate (150 mL x 3). The combined organic extracts were dried (anhydrous sodium sulfate) and concentrated, and the crude was purified by silica gel column chromatography using 5-25% ethyl acetate in hexane as eluent to give the desired product as thick oil (5.7 g, 33%). Step 3: Synthesis of Dioctadecyl (S)-2-((3-(dimethylamino)propanoyl)oxy)succinate (Example 1) A mixture of dioctadecyl (S)-2-hydroxysuccinate 2 (400 mg, 0.63 mmol), N,N- dimethylaminobutyric acid hydrochloride (128 mg, 0.76 mmol), EDC-HCl (192 mg, 1 mmol) and DMAP (122 mg, 1 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. The volatiles were removed under vacuum, and the residue was dissolved in hexanes (100 mL). The hexane solution was washed with acetonitrile (40 mL x 3), and then the hexane layer was dried over sodium sulfate, filtered, and concentrated to yield the desired product as white solid (401 mg, 85%).1H NMR (300 MHz, CDCl3) δ 5.48 (t, 1H), 4.14 (t, 2H), 4.11 (t, 2H), 2.87 (d, 2H), 2.68-2.52 (m, 4H), 2.23 (s, 6H), 1.62 (s, br., 4H), 1.25 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C45H87NO6 [M+H] = 738.2, Observed = 738.6. Example 2: Dioctadecyl (S)-2-((3-(dimethylamino)butanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 1.1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.13 (t, 2H), 4.09 (t, 2H), 2.86 (d, 2H), 2.42 (m, 2H), 2.29 (t, 2H), 2.26 (s, 6H), 1.80 (quint, 2H), 1.62 (s, br., 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H89NO6 [M+H] = 752.2, Observed = 752.6. Example 3: Dihexadecyl (S)-2-((3-(dimethylamino)propanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 1.1H NMR (300 MHz, CDCl3) δ 5.48 (t, 1H), 4.14 (t, 2H), 4.10 (t, 2H), 2.87 (d, 2H), 2.68-2.52 (m, 4H), 2.23 (s, 6H), 1.61 (s, br., 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C41H79NO6 [M+H] = 682.6, Observed = 682.5. Example 4: Dihexadecyl (S)-2-((3-(dimethylamino)butanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 1.1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.14 (t, 2H), 4.10 (t, 2H), 2.86 (d, 2H), 2.43 (m, 2H), 2.31 (t, 2H), 2.21 (s, 6H), 1.81 (quint, 2H), 1.62 (s, br., 4H), 1.24 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H81NO6 [M+H] = 696.6, Observed = 696.6. Example 5: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) (S)-2-((3- (dimethylamino)propanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 1.1H NMR (300 MHz, CDCl3) δ 5.48 (t, 1H), 5.35 (m, 8H), 4.14 (t, 2H), 4.09 (t, 2H), 2.87 (d, 2H), 2.77 (t, 4H), 2.67-2.52 (m, 4H), 2.23 (s, 6H), 2.03 (m, 8H), 1.61 (s, br., 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C45H79NO6 [M+H] = 730.6, Observed = 730.5. Example 6: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) (S)-2-((3- (dimethylamino)butanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 1.1H NMR (300 MHz, CDCl3) δ 5.48 (t, 1H), 5.34 (m, 8H), 4.13 (t, 2H), 4.09 (t, 2H), 2.86 (d, 2H), 2.76 (t, 4H), 2.42 (m, 2H), 2.28 (t, 2H), 2.20 (s, 6H), 2.04 (m, 8H), 1.81 (quint, 2H), 1.62 (s, br., 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C46H81NO6 [M+H] = 744.6, Observed = 744.6. Example 7: Bis(7-(nonanoyloxy)heptyl) (S)-2-((3-(dimethylamino)propanoyl)oxy)succinate Step 1: Synthesis of 7-hydroxyheptyl nonanoate (3) A mixture of 1,7-heptanediol (10.6 g, 80 mmol), nonanoic acid (3.12 g, 20 mmol), EDCI-HCl (4.22 g, 22 mmol) and DMAP (2.7 g, 22 mmol) in 60 mL dichloromethane was stirred at room temperature for 17 h. The dichloromethane was removed on rotavapor, the residue was diluted with ethyl acetate (200 mL), and the solution was washed with aqueous saturated ammonium chloride, followed by brine and dried over sodium sulfate and concentrated to give an oil. The crude product was purified by column chromatography using 15-10% ethyl acetate in hexanes to yield the desired product as colorless oil (4.5 g, 82%). Step 2: Bis(7-(nonanoyloxy)heptyl) (S)-2-hydroxysuccinate (4) A mixture of dimethyl malate 1 (648 mg, 4 mmol), 7-hydroxyheptyl nonanoate 3 (2.16 g, 8 mmol) and p-toluenesulfonic acid (200 mg) in 200 mL toluene was heated to reflux vigorously with Dean-stark apparatus. After 150 mL toluene was distilled, more toluene was added. This process was repeated one more time. The reaction mixture was cooled to room temperature and washed with saturated NaHCO3 solution, and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over sodium sulfate and concentrated to give a viscous oil. The crude product was purified by silica gel column chromatography using 0-10 % ethyl acetate in hexane as eluent to give the desired product as colorless oil (260 mg, 10.1 %) Step 3: Synthesis of bis(7-(nonanoyloxy)heptyl) (S)-2-((3- (dimethylamino)propanoyl)oxy)succinate (Example 7) A mixture of bis(7-(nonanoyloxy)heptyl) (S)-2-hydroxysuccinate 4(130 mg, 0.2 mmol), N,N-dimethylaminobutyric acid hydrochloride (35 mg, 0.3 mmol), EDC-HCl (65 mg, 0.3 mmol) and DMAP (40 mg, 0.3 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. The volatiles were removed under vacuum, and the residue was dissolved in EtOAc. The solution was washed with water, and the organic layer was dried over sodium sulfate, filtered, and concentrated, and the crude was purified by silica gel column chromatography using 0-10% methanol in dichloromethane to yield the desired product as colorless oil (120 mg, 81%).1H NMR (300 MHz, CDCl3) δ 5.45 (t, 1H), 4.11 (t, 2H), 4.06 (t, 2H), 4.01 (t, 4H), 2.84 (d, 2H), 2.65-2.49 (m, 4H), 2.25 (t, 4H), 2.20 (s, 6H), 1.60 (m, 12H), 1.31-1.20 (m, 32H), 0.84 (t, 6H). APCI-MS analysis: Calculated C41H75NO10 [M+H] = 742.5, Observed = 742.5. Example 8: Bis(7-(nonanoyloxy)heptyl) (S)-2-((3-(dimethylamino)butanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 7.1H NMR (300 MHz, CDCl3) δ 5.44 (t, 1H), 4.12 (t, 2H), 4.09 (t, 2H), 4.02 (t, 4H), 2.84 (d, 2H), 2.42 (m, 2H), 2.29-2.24 (m, 6H), 2.19 (s, 6H), 1.78 (quint, 2H), 1.60 (m, 12H), 1.32- 1.25 (m, 32H), 0.85 (t, 6H). APCI-MS analysis: Calculated C42H77NO10 [M+H] = 756.5, Observed = 756.5. Example 9: Dioctadecyl (S)-2-(((2-(dimethylamino)ethoxy)carbonyl)oxy)succinate To a solution of N,N-dimethyl ethanol (356 mg, 4 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (804 mg, 4 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of dioctadecyl (S)-2-hydroxysuccinate 2 (350 mg, 0.55 mmol) in 3 mL dichloromethane was added, then triethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for another 15 h. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 50% ethyl acetate in hexanes, followed by ethyl acetate and acetone in ethyl acetate to give desired product (133 mg, 32%).1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.26 (t, 2H), 4.15 (dt, 2H), 4.09 (t, 2H), 2.89 (d, 2H), 2.61 (dd, 2H), 2.28 (s, 6H), 1.64-1.57 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C45H87NO7 [M+H] = 754.6, Observed = 754.6. Example 10: Dioctadecyl (S)-2-(((3-(dimethylamino)propoxy)carbonyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.23 (t, 2H), 4.16 (dt, 2H), 4.10 (t, 2H), 2.89 (d, 2H), 2.35 (t, 2H), 2.21 (s, 6H), 1.84 (quint, 2H), 1.64-1.57 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H89NO7 [M+H] = 768.7, Observed = 768.6. Example 11: Dihexadecyl (S)-2-(((2-(dimethylamino)ethoxy)carbonyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.25 (t, 2H), 4.15 (dt, 2H), 4.09 (t, 2H), 2.89 (d, 2H), 2.61 (dd, 2H), 2.28 (s, 6H), 1.64-1.57 (m, 4H), 1.24 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C41H79NO7 [M+H] = 698.5, Observed = 698.5. Example 12: Dihexadecyl (S)-2-(((3-(dimethylamino)propoxy)carbonyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.25 (t, 2H), 4.16 (dt, 2H), 4.10 (t, 2H), 2.90 (d, 2H), 2.54 (s, br., 2H), 2.36 (s, 6H), 1.94 (quint, 2H), 1.66-1.59 (m, 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H81NO7 [M+H] = 712.6, Observed = 712.5. Example 13: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) (S)-2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)-succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.42-5.25 (m, 9H), 4.24 (t, 2H), 4.15 (dt, 2H), 4.09 (t, 2H), 2.88 (d, 2H), 2.75 (t, 4H), 2.61 (dd, 2H), 2.26 (s, 6H), 2.06-2.00 (m, 8H), 1.64-1.57 (m, 4H), 1.28 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C45H79NO7 [M+H] = 746.6, Observed = 746.5. Example 14: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) (S)-2-(((3- (dimethylamino)propoxy)carbonyl)oxy)-succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.42-5.25 (m, 9H), 4.20 (t, 2H), 4.15 (dt, 2H), 4.09 (t, 2H), 2.88 (d, 2H), 2.75 (t, 4H), 2.33 (t, 2H), 2.20 (s, 6H), 2.06-2.00 (m, 8H), 1.85 (quint, 2H), 1.64-1.57 (m, 4H), 1.28 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H81NO7 [M+H] = 760.6, Observed = 760.5. Example 15: Bis(7-(nonanoyloxy)heptyl) (S)-2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.36 (t, 1H), 4.24 (t, 2H), 4.15 (t, 2H), 4.08 (t, 2H), 4.03 (t, 4H), 2.87 (d, 2H), 2.59 (dd, 2H), 2.26 (s, 6H), 2.26 (t, 4H), 1.59 (m, 12H), 1.38-1.17 (m, 32H), 0.85 (t, 6H). APCI-MS analysis: Calculated C41H75NO11 [M+H] = 758.5, Observed = 758.5. Example 16: Bis(7-(nonanoyloxy)heptyl) (S)-2-(((3- (dimethylamino)propoxy)carbonyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 9.1H NMR (300 MHz, CDCl3) δ 5.35 (t, 1H), 4.23 (dt, 2H), 4.14 (t, 2H), 4.08 (t, 2H), 4.02 (t, 4H), 2.87 (d, 2H), 2.33 (t, 2H), 2.26 (t, 4H), 2.19 (s, 6H), 1.82 (quint, 2H), 1.64-1.57 (m, 12H), 1.38-1.17 (m, 32H), 0.85 (t, 6H). APCI-MS analysis: Calculated C42H77NO11 [M+H] = 772.5, Observed = 772.5. Example 17: Dioctadecyl (S)-2-(((2-(dimethylamino)ethyl)(methyl)carbamoyl)oxy)succinate To a solution of N1,N1,N2-trimethylethane-1,2-diamine (408 mg, 4 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (804 mg, 4 mmol), and the resulting mixture was stirred at room temperature for 2 h. TLC showed complete reaction. A solution of dioctadecyl (S)-2-hydroxysuccinate 2 (320 mg, 0.5 mmol) in 3 mL dichloromethane, then 1 mL triethylamine was added, and the reaction was stirred at room temperature for 15 h. After concentrating under reduced pressure, the residue was dissolved in hexanes and washed with acetonitrile several times until the acetonitrile layer becomes colorless. The hexane layer was concentrated, and the crude was purified by column chromatography using 50% ethyl acetate in hexanes, followed by ethyl acetate and 50% acetone in ethyl acetate to give desired product (240 mg, 63 %).1H NMR (300 MHz, CDCl3) δ 5.43-5.37 (m, 1H), 4.13 (t, 2H), 4.11 (t, 2H), 3.45-3.24 (m, 2H), 2.94 (s, 3H), 2.86 (d, 2H), 2.48-2.40 (m, 2H), 2.25 (d, 6H), 1.66-1.53 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H90N2O6 [M+H] = 767.7, Observed = 767.6. Example 18: Dioctadecyl (S)-2-(((3- (dimethylamino)propyl)(methyl)carbamoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 17.1H NMR (300 MHz, CDCl3) δ 5.42-5.35 (m, 1H), 4.11 (t, 2H), 4.09 (t, 2H), 3.27 (t, 2H), 2.90 (s, 3H), 2.84 (d, 2H), 2.21 (t, 2H), 2.18 (s, 6H), 1.68 (quint, 2H), 1.61-1.54 (m, 4H), 1.23 (m, 60H), 0.85 (t, 6H). APCI-MS analysis: Calculated C47H92N2O6 [M+H] = 781.7, Observed = 781.6. Example 19: Dihexadecyl (S)-2-(((2-(dimethylamino)ethyl)(methyl)carbamoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 17.1H NMR (300 MHz, CDCl3) δ 5.42-5.35 (m, 1H), 4.14 (t, 2H), 4.09 (t, 2H), 3.45-3.24 (m, 2H), 2.94 (s, 3H), 2.86 (d, 2H), 2.48-2.40 (m, 2H), 2.24 (d, 6H), 1.68-1.53 (m, 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H82N2O6 [M+H] = 711.6, Observed = 711.5. Example 20: Dihexadecyl (S)-2-(((3- (dimethylamino)propyl)(methyl)carbamoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 17.1H NMR (300 MHz, CDCl3) δ 5.42-5.35 (m, 1H), 2.18-4.08 (m, 4H), 3.29 (t, 2H), 2.92 (s, 3H), 2.86 (d, 2H), 2.26 (t, 2H), 2.21 (s, 6H), 1.65-1.57 (m, 6H), 1.25 (m, 52H), 0.85 (t, 6H). APCI-MS analysis: Calculated C43H84N2O6 [M+H] = 725.6, Observed = 725.5. Example 21: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) (S)-2-(((2- (dimethylamino)ethyl)(methyl)carbamoyl)-oxy)succinate The titular compound was prepared in a manner analogous to Example 17.1H NMR (300 MHz, CDCl3) δ 5.44-5.28 (m, 9H), 4.14 (t, 2H), 4.09 (t, 2H), 3.45-3.24 (m, 2H), 2.94 (s, 3H), 2.86 (d, 2H), 2.76 (t, 4H), 2.48-2.40 (m, 2H), 2.24 (d, 6H), 2.10-1.97 (m, 8H), 1.68-1.53 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C46H82N2O6 [M+H] = 759.6, Observed = 759.6. Example 22: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) (S)-2-(((3- (dimethylamino)propyl)(methyl)-carbamoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 17.1H NMR (300 MHz, CDCl3) δ 5.44-5.28 (m, 9H), 4.13 (t, 2H), 4.09 (t, 2H), 3.29 (t, 2H), 2.92 (s, 3H), 2.86 (d, 2H), 2.76 (t, 4H), 2.24 (t, 2H), 2.21 (d, 6H), 2.10-1.96 (m, 8H), 1.70 (quint, 2H), 1.60 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C47H84N2O6 [M+H] = 773.6, Observed = 773.6. Example 23: Dioctadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-aspartate Step 1: Synthesis of Dioctadecyl (tert-butoxycarbonyl)-L-aspartate (5) A mixture of N-Boc-(L)-aspartic acid (2.33g, 10 mmol), octadecan-1-ol (5.4 g, 20 mmol), EDCI-HCl (4.8 g, 25 mmol) and DMAP (3.05 g, 25 mmol) in a mixture of 25 mL dichloromethane and 20 mL DMF was stirred at room temperature for 17 h. The reaction mixture was diluted with saturated ammonium chloride solution (100 mL) and extracted with dichloromethane (100 mL x 3). The combined organic layers were washed with brine, dried (sodium sulfate) and concentrated, and the crude was purified by column chromatography using 10-35% ethyl acetate in hexanes to get the desired product as white solid (5.2 g, 71%). Step 2: Synthesis of Dioctadecyl L-aspartate (6) To a solution of dioctadecyl (tert-butoxycarbonyl)-L-aspartate 5 (1.2 g, 1.63 mmol) in 10 mL dichloromethane, was added 3 mL trifluoroacetic acid, and the mixture was stirred at room temperature for 6 h. The volatiles were concentrated under vacuum, and the residue was dissolved in dichloromethane, and washed with saturated sodium bicarbonate solution. The organic layer was dried over sodium sulfate and concentrated to give the desired product (1.0 g, 99%), which was used without further purification. Step 3: Synthesis of Dioctadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-aspartate (Example 23) To a solution of 2-(dimethylamino)ethan-1-ol (267 mg, 3 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (603 mg, 3 mmol), and the resulting mixture was stirred at room temperature for 3 h. A solution of dioctadecyl L-aspartate 6 (400 mg, 0.61 mmol) in 3 mL dichloromethane was added, then 1 mL triethylamine was added, and the reaction was stirred at room temperature for 15 h. After concentration under vacuum, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer becomes colorless. The hexane layer was concentrated to give the desired product (327 mg, 69%).1H NMR (300 MHz, CDCl3) δ 5.75 (d, 1H), 4.62-4.54 (m, 1H), 4.17 (t, 2H), 4.13 (t, 2H), 4.05 (t, 2H), 3.02 (dd, 1H), 2.81 (dd, 1H), 2.56 (t, 2H), 2.28 (s, 6H), 1.66-1.53 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H90N2O6 [M+H] = 767.7, Observed = 767.6. Example 24: Dioctadecyl ((3-(dimethylamino)propoxy)carbonyl)-L-aspartate The titular compound was prepared in a manner analogous to Example 23.1H NMR (300 MHz, CDCl3) δ 5.66 (d, 1H), 4.59 (m, 1H), 4.20-4.03 (m, 6H), 3.02 (dd, 1H), 2.82 (dd, 1H), 2.36 (t, 2H), 2.24 (s, 6H), 1.88-1.77 (m, 2H), 1.67-1.53 (m, 4H), 1.25 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H90N2O6 [M+H] = 767.7, Observed = 767.6. Example 25: Dihexadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-aspartate The titular compound was prepared in a manner analogous to Example 23.1H NMR (300 MHz, CDCl3) δ 5.75 (d, 1H), 4.62-4.54 (m, 1H), 4.15 (t, 2H), 4.13 (t, 2H), 4.06 (t, 2H), 3.02 (dd, 1H), 2.81 (dd, 1H), 2.55 (t, 2H), 2.28 (s, 6H), 1.66-1.55 (m, 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C41H80N2O6 [M+H] = 697.6, Observed = 697.5. Example 26: Dihexadecyl ((3-(dimethylamino)propoxy)carbonyl)-L-aspartate The titular compound was prepared in a manner analogous to Example 23.1H NMR (300 MHz, CDCl3) δ 5.65 (d, 1H), 4.62-4.53 (m, 1H), 4.18-4.04 (m, 6H), 3.02 (dd, 1H), 2.82 (dd, 1H), 2.33 (t, 2H), 2.22 (s, 6H), 1.79 (quint, 2H), 1.67-1.56 (m, 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H82N2O6 [M+H] = 711.6, Observed = 711.5. Example 27: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) ((2-(dimethylamino)ethoxy)carbonyl)-L- aspartate The titular compound was prepared in a manner analogous to Example 23.1H NMR (300 MHz, CDCl3) δ 5.76 (d, 1H), 5.45-5.25 (m, 8H), 4.62-4.54 (m, 1H), 4.17 (t, 2H), 4.12 (t, 2H), 4.05 (t, 2H), 3.02 (dd, 1H), 2.81 (dd, 1H), 2.76 (t, 4H), 2.57 (t, 2H), 2.28 (s, 6H), 2.08-1.96 (m, 8H), 1.66-1.52 (m, 4H), 1.29 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C45H80N2O6 [M+H] = 745.6, Observed = 745.6. Example 28: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) ((3-(dimethylamino)propoxy)carbonyl)- L-aspartate The titular compound was prepared in a manner analogous to Example 23.1H NMR (300 MHz, CDCl3) δ 5.65 (d, 1H), 5.45-5.25 (m, 8H), 4.62-4.54 (m, 1H), 4.19-4.04 (m, 6H), 3.02 (dd, 1H), 2.81 (dd, 1H), 2.76 (t, 4H), 2.35 (t, 2H), 2.23 (s, 6H), 2.08-1.96 (m, 8H), 1.78 (quint, 2H), 1.66-1.52 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C46H82N2O6 [M+H] = 759.6, Observed = 759.6. Example 29: Dioctadecyl 2-((3-(dimethylamino)propanoyl)oxy)pentanedioate Step 1: Synthesis of Dioctadecyl 2-oxopentanedioate (7) A mixture of α-ketoglutaric acid (3.0 g, 20.5 mmol), 1-octadecanol (11.0 g, 41 mmol) and p-toluenesulfonic acid monohydrate (0.5 g) in 80 mL toluene was heated to reflux for 5 hours. The reaction mixture was concentrated under vacuum, and the residue was crystallized in acetonitrile to give dioctadecyl 2-oxopentanedioate was obtained as brown solid (14.0 g, quant.) Step 2: Synthesis of Dioctadecyl 2-hydroxypentanedioate (8) To a solution of dioctadecyl 2-oxopentanedioate 7 (14 g, 20.5 mmol) in 100 mL THF, was added sodium borohydride (1.2 g, 32.2 mmol), and the reaction mixture was stirred at room temperature for 2 hours. After cooled to 0 °C, saturated ammonium chloride solution was added slowly, and the resulting mixture was extracted with ethyl acetate. The combined organic layer was washed with brine and dried over sodium sulfate. After concentration, the crude was purified by flash column chromatography eluted with hexane / ethyl acetate to get dioctadecyl 2-hydroxypentanedioate as white solid (2.0 g, 15%). The byproducts include 1- octadecanol and octadecyl 5-oxotetrahydrofuran-2-carboxylate. Step 3: Synthesis of Dioctadecyl 2-((3-(dimethylamino)propanoyl)oxy)pentanedioate (Example 29) A mixture of dioctadecyl 2-hydroxypentanedioate 8 (100 mg, 0.15 mmol), 2,2- dimethylaminopropanoic acid (27 mg, 0.23 mmol), EDCI (57.5 mg, 0.3 mmol) and 4- dimethylaminopyridine (37 mg, 0.3 mmol) in 10 mL dichloromethane was stirred at room temperature overnight. The reaction mixture was concentrated, and the residue was partitioned between hexane and acetonitrile. After separation, the hexane layer was washed with acetonitrile, and then concentrated to afford dioctadecyl 2-((3- (dimethylamino)propanoyl)oxy)pentanedioate as pale yellow wax (100 mg, 91%).1H NMR (300 MHz, CDCl3) δ 5.05 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 2.68-2.53 (m, 4H), 2.43 (m, 2H), 2.24 (s, 6H), 2.21-2.08 (m, 2H), 1.68-1.55 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H89NO6 [M+H] = 752.7, Observed = 752.6. Example 30: Dioctadecyl 2-((4-(dimethylamino)butanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29.1H NMR (300 MHz, CDCl3) δ 5.02 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 2.42 (m, 4H), 2.29 (t, 2H), 2.21 (s, 6H), 2.21-2.08 (m, 2H), 1.81 (quint, 2H), 1.66-1.56 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C47H91NO6 [M+H] = 766.7, Observed = 766.6. Example 31: Dihexadecyl 2-((3-(dimethylamino)propanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29.1H NMR (300 MHz, CDCl3) δ 5.07 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 2.68-2.53 (m, 4H), 2.43 (m, 2H), 2.24 (s, 6H), 2.22-2.08 (m, 2H), 1.66-1.55 (m, 4H), 1.24 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H81NO6 [M+H] = 696.6, Observed = 695.9. Example 32: Dihexadecyl 2-((4-(dimethylamino)butanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29.1H NMR (300 MHz, CDCl3) δ 5.02 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 2.43 (m, 4H), 2.34 (t, 2H), 2.25 (s, 6H), 2.23-2.09 (m, 2H), 1.85 (quint, 2H), 1.68-1.56 (m, 4H), 1.24 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C43H83NO6 [M+H] = 710.6, Observed = 709.8. Example 33: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) 2-((3- (dimethylamino)propanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29.1H NMR (300 MHz, CDCl3) δ 5.42-5.27 (m, 8H), 5.07 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 2.76 (t, 2H), 2.67-2.55 (m, 4H), 2.44 (m, 2H), 2.24 (s, 6H), 2.22-2.08 (m, 2H), 2.07-2.01 (m, 8H), 1.66-1.55 (m, 6H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C46H81NO6 [M+H] = 744.6, Observed = 743.7. Example 34: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) 2-((4- (dimethylamino)butanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29.1H NMR (300 MHz, CDCl3) δ 5.42-5.27 (m, 8H), 5.02 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 2.76 (t, 4H), 2.46-2.40 (m, 4H), 2.30 (t, 2H), 2.22 (s, 6H), 2.20-2.09 (m, 2H), 2.08-2.01 (m, 8H), 1.81 (quint, 2H), 1.66-1.55 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C47H83NO6 [M+H] = 758.6, Observed = 757.7. Example 35: Bis(7-(nonanoyloxy)heptyl) 2-((3- (dimethylamino)propanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29 and was obtained by column purification chromatography eluted with hexane / acetone.1H NMR (300 MHz, CDCl3) δ 5.05 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 4.04 (t, 4H), 2.67- 2.53 (m, 4H), 2.44 (m, 2H), 2.28 (t, 4H), 2.24 (s, 6H), 2.22-2.08 (m, 2H), 1.66-1.53 (m, 12H), 1.38-1.18 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H77NO10 [M+H] = 756.5, Observed = 756.5. Example 36: Bis(7-(nonanoyloxy)heptyl) 2-((4-(dimethylamino)butanoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 29 and was obtained by column purification chromatography eluted with hexane / acetone.1H NMR (300 MHz, CDCl3) δ 5.01 (dd, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 4.04 (t, 4H), 2.49- 2.42 (m, 4H), 2.28 (t, 6H), 2.21 (s, 6H), 2.20-2.07 (m, 2H), 1.80 (quint, 2H), 1.68-1.55 (m, 12H), 1.36-1.19 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C43H79NO10 [M+H] = 770.6, Observed = 770.5. Example 37: Dioctadecyl 2-(((2-(dimethylamino)ethoxy)carbonyl)oxy)pentanedioate To a solution of dioctadecyl 2-hydroxypentanedioate 8 (150 mg, 0.23 mmol) and pyridine (75 μL, 0.92 mmol) in 10 mL dichloromethane, was added p-nitrophenyl chloroformate (138 mg, 0.69 mmol), and the resulting mixture was stirred for 2 hours. After TLC showed the complete reaction, 2-dimethylaminoethanol (73 mg, 0.92 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was concentrated, and the residue was partitioned between hexane and acetonitrile. The hexane layer was concentrated, and the crude was purified by column chromatography eluted with dichloromethane / acetone to afford dioctadecyl 2-(((2-(dimethylamino)ethoxy)carbonyl)oxy)pentanedioate as pale yellow wax (141 mg, 80%).1H NMR (300 MHz, CDCl3) δ 4.94 (dd, 1H), 4.23 (dt, 2H), 4.13 (t, 2H), 4.04 (t, 2H), 2.68- 2.53 (m, 2H), 2.48-2.41 (m, 2H), 2.28 (s, 6H), 2.21-2.04 (m, 2H), 1.68-1.53 (m, 4H), 1.24 (m, 60H), 0.86 (t, 6H). APCI-MS analysis: Calculated C46H89NO7 [M+H] = 768.6, Observed = 768.6. Example 38: Dioctadecyl 2-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 4.94 (dd, 1H), 4.20 (t, 2H), 4.12 (t, 2H), 4.05 (t, 2H), 2.48- 2.41 (m, 2H), 2.35 (t, 2H), 2.21 (s, 6H), 2.21-2.09 (m, 2H), 1.84 (quint, 2H), 1.66-1.56 (m, 4H), 1.24 (m, 60H), 0.86 (t, 6H). APCI-MS analysis: Calculated C47H91NO7 [M+H] = 782.7, Observed = 782.6. Example 39: Dihexadecyl 2-(((2-(dimethylamino)ethoxy)carbonyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 4.95 (dd, 1H), 4.25 (dt, 2H), 4.15 (t, 2H), 4.06 (t, 2H), 2.68- 2.52 (m, 2H), 2.50-2.44 (m, 2H), 2.28 (s, 6H), 2.25-2.10 (m, 2H), 1.68-1.54 (m, 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H81NO7 [M+H] = 712.6, Observed = 712.5. Example 40: Dihexadecyl 2-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 4.95 (dd, 1H), 4.21 (t, 2H), 4.15 (t, 2H), 4.06 (t, 2H), 2.50- 2.42 (m, 2H), 2.36 (t, 2H), 2.22 (s, 6H), 2.21-2.10 (m, 2H), 1.85 (quint, 2H), 1.66-1.56 (m, 4H), 1.25 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C43H83NO7 [M+H] = 726.7, Observed = 726.5. Example 41: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)-pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 5.44-5.27 (m, 8H), 4.95 (dd, 1H), 4.25 (dt, 2H), 4.15 (t, 2H), 4.06 (t, 2H), 2.76 (t, 4H), 2.68-2.55 (m, 2H), 2.51-2.43 (m, 2H), 2.28 (s, 6H), 2.25-2.12 (m, 2H), 2.14-2.01 (m, 8H), 1.66-1.55 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C46H81NO7 [M+H] = 760.6, Observed = 759.6. Example 42: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) 2-(((3- (dimethylamino)propoxy)carbonyl)oxy)-pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 5.43-5.27 (m, 8H), 4.95 (dd, 1H), 4.21 (dt, 2H), 4.15 (t, 2H), 4.06 (t, 2H), 2.76 (t, 4H), 2.51-2.42 (m, 2H), 2.39-2.34 (m, 2H), 2.22 (s, 6H), 2.20-2.12 (m, 2H), 2.07-2.01 (m, 8H), 1.85 (quint, 2H), 1.66-1.55 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C47H83NO7 [M+H] = 774.6, Observed = 773.7. Example 43: Bis(7-(nonanoyloxy)heptyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 4.94 (dd, 1H), 4.27-4.21 (m, 2H), 4.14 (t, 2H), 4.07-4.01 (m, 6H), 2.68-2.56 (m, 2H), 2.50-2.42 (m, 2H), 2.27 (s, 6H), 2.27 (t, 4H), 2.24-2.04 (m, 2H), 1.66-1.53 (m, 12H), 1.38-1.18 (m, 32H), 0.86 (t, 6H). APCI-MS analysis: Calculated C42H77NO11 [M+H] = 772.5, Observed = 772.5. Example 44: Bis(7-(nonanoyloxy)heptyl) 2-(((3- (dimethylamino)propoxy)carbonyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 37.1H NMR (300 MHz, CDCl3) δ 4.96 (dd, 1H), 4.27-4.21 (m, 2H), 4.15 (t, 2H), 4.08-4.02 (m, 8H), 2.50-2.42 (m, 2H), 2.39-2.33 (m, 2H), 2.28 (t, 4H), 2.22 (s, 6H), 2.20-2.08 (m, 2H), 1.85 (quint, 2H), 1.66-1.53 (m, 12H), 1.38-1.18 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C43H79NO11 [M+H] = 786.5, Observed = 785.5. Example 45: Dioctadecyl 2-(((2-(dimethylamino)ethyl)(methyl)carbamoyl)oxy)- pentanedioate To a solution of dioctadecyl 2-hydroxypentanedioate 8 (150 mg, 0.23 mmol) and pyridine (75 μL, 0.92 mmol) in 10 mL dichloromethane, was added p-nitrophenyl chloroformate (138 mg, 0.69 mmol), and the resulting mixture was stirred for 2 hours. After TLC showed the complete reaction, N1,N1,N2-trimethylethane-1,2-diamine (94 mg, 0.92 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was concentrated, and the residue was partitioned between hexane and acetonitrile. The hexane layer was concentrated, and the crude was purified by column chromatography eluted with dichloromethane / acetone to afford dioctadecyl 2-(((2-(dimethylamino)ethyl)(methyl)carbamoyl)oxy)-pentanedioate as pale yellow wax (142 mg, 79%).1H NMR (300 MHz, CDCl3) δ 5.03-4.93 (m, 1H), 4.12 (dt, 2H), 4.05 (t, 2H), 3.50-3.25 (m, 2H), 2.95 (d, 3H), 2.52-2.39 (m, 4H), 2.25 (s, 6H), 2.21-2.08 (m, 2H), 1.68-1.53 (m, 4H), 1.24 (m, 60H), 0.86 (t, 6H). APCI-MS analysis: Calculated C47H92N2O6 [M+H] = 781.7, Observed = 781.6. Example 46: Dioctadecyl 2-(((3- (dimethylamino)propyl)(methyl)carbamoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 45.1H NMR (300 MHz, CDCl3) δ 5.03-4.93 (m, 1H), 4.11 (dt, 2H), 4.04 (t, 2H), 3.35-3.25 (m, 2H), 2.91 (d, 3H), 2.44-2.37 (m, 2H), 2.29-2.23 (m, 2H), 2.20 (s, 6H), 2.19-2.08 (m, 2H), 1.76-1.53 (m, 6H), 1.23 (m, 60H), 0.85 (t, 6H). APCI-MS analysis: Calculated C48H94N2O6 [M+H] = 795.7, Observed = 795.6. Example 47: Dihexadecyl 2-(((2- (dimethylamino)ethyl)(methyl)carbamoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 45.1H NMR (300 MHz, CDCl3) δ 5.03-4.93 (m, 1H), 4.11 (dt, 2H), 4.04 (t, 2H), 3.50-3.25 (m, 2H), 2.94 (d, 3H), 2.52-2.39 (m, 4H), 2.25 (s, 6H), 2.21-2.06 (m, 2H), 1.68-1.53 (m, 4H), 1.23 (m, 52H), 0.85 (t, 6H). APCI-MS analysis: Calculated C43H84N2O6 [M+H] = 725.6, Observed = 725.5. Example 48: Dihexadecyl 2-(((3- (dimethylamino)propyl)(methyl)carbamoyl)oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 45.1H NMR (300 MHz, CDCl3) δ 5.03-4.93 (m, 1H), 4.11 (dt, 2H), 4.05 (t, 2H), 3.38-3.25 (m, 2H), 2.93 (d, 3H), 2.48-2.39 (m, 2H), 2.24 (s, 6H), 2.35-2.13 (m, 4H), 1.74 (quint, 2H), 1.66- 1.53 (m, 4H), 1.24 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C44H86N2O6 [M+H] = 739.6, Observed = 739.6. Example 49: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) 2-(((2- (dimethylamino)ethyl)(methyl)carbamoyl)oxy)-pentanedioate The titular compound was prepared in a manner analogous to Example 45. 1H NMR (300 MHz, CDCl3) δ 5.44-5.27 (m, 8H), 5.03-4.95 (m, 1H), 4.12 (t, 2H), 4.06 (t, 2H), 3.53-3.24 (m, 2H), 2.96 (d, 3H), 2.76 (t, 4H), 2.52-2.41 (m, 4H), 2.26 (s, 6H), 2.24-2.12 (m, 2H), 2.09-2.01 (m, 8H), 1.66-1.55 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C47H84N2O6 [M+H] = 773.6, Observed = 772.7. Example 50: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) 2-(((3- (dimethylamino)propyl)(methyl)carbamoyl)-oxy)pentanedioate The titular compound was prepared in a manner analogous to Example 45. 1H NMR (300 MHz, CDCl3) δ 5.43-5.27 (m, 8H), 5.01-4.94 (m, 1H), 4.12 (dt, 2H), 4.05 (t, 2H), 3.38-3.27 (m, 2H), 2.93 (d, 3H), 2.76 (t, 4H), 2.47-2.41 (m, 2H), 2.32-2.22 (m, 2H), 2.21 (s, 6H), 2.20-2.12 (m, 2H), 2.07-2.01 (m, 8H), 1.75 (quint, 2H), 1.66-1.55 (m, 4H), 1.29 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C48H86N2O6 [M+H] = 787.6, Observed = 786.7. Example 51: Dioctadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-glutamate Step 1: Synthesis of Dioctadecyl (tert-butoxycarbonyl)-L-glutamate (9) A solution of (tert-butoxycarbonyl)-L-glutamic acid (2.0 g, 8 mmol), 1-octadecanol (5.41 g, 20 mmol), EDCI (4.6 g, 24 mmol) and 4-dimethylaminopyridine (1.0 g, 8 mmol) in 80 mL dichloromethane was stirred at room temperature overnight. After concentration, the residue was partition between hexane and acetonitrile, and the hexane layer was washed by acetonitrile. After concentration, dioctadecyl (tert-butoxycarbonyl)-L-glutamate was obtained as white wax (4.4 g, 73%). Step 2: Synthesis of Dioctadecyl L-glutamate trifluoroacetate (10) To a solution of dioctadecyl (tert-butoxycarbonyl)-L-glutamate 9 (4.0 g, 5.3 mmol) in 10 mL dichloromethane, was added 9 mL trifluoroacetic acid slowly, and the reaction mixture was stirred at room temperature for 3 hours. MS showed complete reaction. After concentration, the residue was coevaporated with heptane three times, and the crude was used for the next step without further purification. Step 3: Synthesis of Dioctadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-glutamate (Example 51) To a solution of dioctadecyl L-glutamate trifluoroacetate 10 (500 mg, 0.65 mmol) and pyridine (0.21 mL, 2.6 mmol) in 10 mL dichloromethane, was added p-nitrophenyl chloroformate (393 mg, 2 mmol), and the resulting mixture was stirred for 2 hours. After TLC showed the complete reaction, 2-dimethylaminoethanol (231 mg, 2.6 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was concentrated, and the residue was partitioned between hexane and acetonitrile. The hexane layer was concentrated, and the crude was purified by column chromatography eluted with dichloromethane / acetone to afford dioctadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-glutamate as pale yellow wax (50 mg, 10%). 1H NMR (300 MHz, CDCl3) δ 5.42 (d, 1H), 4.42-4.32 (m, 1H), 4.15 (t, 2H), 4.12 (t, 2H), 4.07 (t, 2H), 2.54 (t, 2H), 2.38 (dd, 2H), 2.27 (s, 6H), 2.26-2.13 (m, 1H), 2.05-1.88 (m, 1H), 1.68-1.53 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C46H90N2O6 [M+H] = 767.7, Observed = 767.6. Example 52: Dioctadecyl ((3-(dimethylamino)propoxy)carbonyl)-L-glutamate The titular compound was prepared in a manner analogous to Example 51. 1H NMR (300 MHz, CDCl3) δ 5.33 (d, 1H), 4.42-4.32 (m, 1H), 4.16-4.02 (m, 6H), 2.38 (t, 2H), 2.26 (s, 6H), 2.26-2.13 (m, 1H), 2.05-1.88 (m, 3H), 1.80 (quint, 2H), 1.68-1.55 (m, 4H), 1.24 (m, 60H), 0.87 (t, 6H). APCI-MS analysis: Calculated C47H92N2O6 [M+H] = 781.7, Observed = 781.6. Example 53: Dihexadecyl ((2-(dimethylamino)ethoxy)carbonyl)-L-glutamate The titular compound was prepared in a manner analogous to Example 51. 1H NMR (300 MHz, CDCl3) δ 5.42 (d, 1H), 4.42-4.32 (m, 1H), 4.15 (t, 2H), 4.12 (t, 2H), 4.07 (t, 2H), 2.54 (t, 2H), 2.38 (dd, 2H), 2.27 (s, 6H), 2.26-2.13 (m, 1H), 2.05-1.88 (m, 1H), 1.68-1.53 (m, 4H), 1.24 (m, 52H), 0.86 (t, 6H). APCI-MS analysis: Calculated C42H82N2O6 [M+H] = 711.6, Observed = 711.5. Example 54: Dihexadecyl ((3-(dimethylamino)propoxy)carbonyl)-L-glutamate The titular compound was prepared in a manner analogous to Example 51. 1H NMR (300 MHz, CDCl3) δ 5.37 (m, 1H), 4.43-4.34 (m, 1H), 4.10 (t, 2H), 4.04 (t, 2H), 3.28-3.17 (m, 2H), 2.46-2.28 (m, 2H), 2.22 (s, 6H), 2.18-2.09 (m, 1H), 2.01-1.84 (m, 3H), 1.68-1.55 (m, 6H), 1.24 (m, 52H), 0.87 (t, 6H). APCI-MS analysis: Calculated C48H84N2O6 [M+H] = 725.6, Observed = 725.0. Example 55: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) ((2-(dimethylamino)ethoxy)carbonyl)-L- glutamate The titular compound was prepared in a manner analogous to Example 51. 1H NMR (300 MHz, CDCl3) δ 5.45-5.27 (m, 9H), 4.42-4.32 (m, 1H), 4.15 (t, 2H), 4.12 (t, 2H), 4.04 (t, 2H), 2.76 (t, 4H), 2.54 (t, 2H), 2.38 (dd, 2H), 2.27 (s, 6H), 2.26-2.13 (m, 1H), 2.07-1.88 (m, 9H), 1.68-1.53 (m, 4H), 1.24 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C46H82N2O6 [M+H] = 759.6, Observed = 759.6. Example 56: Di((9Z,12Z)-octadeca-9,12-dien-1-yl) ((3-(dimethylamino)propoxy)carbonyl)- L-glutamate The titular compound was prepared in a manner analogous to Example 51. 1H NMR (300 MHz, CDCl3) δ 5.43-5.25 (m, 9H), 4.42-4.32 (m, 1H), 4.14-4.02 (m, 6H), 2.76 (t, 4H), 2.46-2.30 (m, 4H), 2.22 (s, 6H), 2.20-2.13 (m, 1H), 2.07-1.90 (m, 9H), 1.78 (quint, 2H), 1.68-1.53 (m, 4H), 1.24 (m, 32H), 0.88 (t, 6H). APCI-MS analysis: Calculated C47H84N2O6 [M+H] = 773.6, Observed = 773.6. Example 57: Bis(7-(nonanoyloxy)heptyl) ((2-(dimethylamino)ethoxy)carbonyl)-L-glutamate The titular compound was prepared in a manner analogous to Example 51.1H NMR (300 MHz, CDCl3) δ 5.43 (d, 1H), 4.40-4.32 (m, 1H), 4.18-4.08 (m, 2H), 4.04 (t, 8H), 2.56 (t, 2H), 2.38 (dd, 2H), 2.28 (s, 6H), 2.28 (t, 4H), 2.25-2.13 (m, 1H), 2.02-1.88 (m, 1H), 1.68-1.50 (m, 12H), 1.38-1.18 (m, 32H), 0.86 (t, 6H). APCI-MS analysis: Calculated C42H78N2O10 [M+H] = 771.6, Observed = 771.5. Example 58: Bis(5-(octanoyloxy)pentyl) 2-((3-(dimethylamino)propanoyl)oxy)-succinate Step 1: Synthesis of Dimethyl 2-hydroxysuccinate (11) To a solution of racemic malic acid (10 g, 74.6 mmol) in 100 mL methanol, was added a solution of hydrogen chloride (4 M in dioxane, 6 mL, 24 mmol), and the mixture was stirred at room temperature for 17 h. The reaction was carefully basified by adding saturated sodium bicarbonate solution, and the solution was extracted with dichloromethane (3 x 100 mL). The combined organic extracts were washed with brine, dried over sodium sulfate, and concentrated to give dimethyl malate as colorless oil (10.0 g, 83%). The crude was used for the next step without further purification. Step 2: Synthesis of 5-Hydroxypentyl octanoate (12) A mixture of 1,5-pentanediol (15.7 mL, 0.15 mole), octanoic acid (7.92 mL, 50 mmol), EDCI-HCl (9.58 g, 50 mmol) and DMAP (1.52 g, 12.5 mmol) in 100 mL dichloromethane was stirred at room temperature for 17 h. The dichloromethane was removed, the residue was diluted with 200 mL ethyl acetate, and the solution was washed with aqueous saturated ammonium chloride. After dried over sodium sulfate and concentrated, the crude was purified by column chromatography using 15-10% ethyl acetate in hexane to yield the desired product as colorless oil (10.79 g, 85%). Step 3: Synthesis of Bis(5-(octanoyloxy)pentyl) 2-hydroxysuccinate (13) A mixture of dimethyl malate 11(2.43 g, 15 mmol), 5-hydroxypentyl octanoate 12 (6.94 g, 30 mmol) and p-toluenesulfonic acid monohydrate (200 mg) in 200 mL toluene was heated to reflux vigorously with Dean-stark apparatus. After 150 mL toluene was distilled, more toluene was added. This process was repeated one more time. The reaction mixture was cooled to room temperature and washed with saturated sodium bicarbonate solution, and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over sodium sulfate and concentrated to give the crude which was purified by column chromatography eluted with 0-10 % ethyl acetate in hexane to give the desired product as colorless oil (1.0 g, 12%). Step 4: Synthesis of Bis(5-(octanoyloxy)pentyl) 2-((3-(dimethylamino)propanoyl)oxy)- succinate (Example 58) A mixture of bis(5-(octanoyloxy)pentyl) 2-hydroxysuccinate 13 (265 mg, 0.47 mmol), 3-(dimethylamino)propanoic acid hydrochloride (88 mg, 0.57 mmol), EDC-HCl (109 mg, 0.57 mmol) and DMAP (70 mg, 0.57 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. The volatiles were removed under vacuum, and the residue was dissolved in EtOAc. The solution was washed with water, and the organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 0-10% methanol in dichloromethane to yield the desired product as colorless oil (170 mg, 55%).1H NMR (300 MHz, CDCl3) δ 5.47 (t, 1H), 4.15 (t, 2H), 4.10 (t, 2H), 4.05 (m, 4H), 2.87 (d, 2H), 2.66-2.52 (m, 4H), 2.28 (t, 4H), 2.22 (s, 6H), 1.72-1.55 (m, 12H), 1.46-1.36 (m, 4H), 1.27 (m, 16H), 0.87 (t, 6H). APCI-MS analysis: Calculated C35H63NO10 [M+H] = 658.4, Observed = 658.4. Example 59: Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-((3-(dimethylamino)propanoyl)- oxy)succinate Step 1: Synthesis of 5-Hydroxypentyl 2-hexyldecanoate (14) A mixture of 1,5-pentanediol (12.6 mL, 0.12 mole), 2-hexyldecanoic acid (11.7 mL, 40 mmol), EDCI-HCl (7.66 g, 40 mmol) and DMAP (0.97 g, 8 mmol) in 80 mL dichloromethane was stirred at room temperature for 17 h. The solvent was removed, the residue was diluted with 200 mL ethyl acetate, and the solution was washed with aqueous saturated ammonium chloride. After dried over sodium sulfate and concentrated, the crude was purified by column chromatography using 15-10% ethyl acetate in hexane to yield the desired product as colorless oil (10.0 g, 75%). Step 2: Synthesis of Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-hydroxysuccinate (15) A mixture of dimethyl malate 11 (2.11 g, 13 mmol), 5-hydroxypentyl 2- hexyldecanoate 14 (8.89 g, 26 mmol) and p-toluenesulfonic acid monohydrate (200 mg) in 200 mL toluene was heated to reflux vigorously with Dean-stark apparatus. After 150 mL toluene was distilled, more toluene was added. This process was repeated one more time. The reaction mixture was cooled to room temperature and washed with saturated sodium bicarbonate solution, and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over sodium sulfate and concentrated to give the crude which was purified by column chromatography using 0-10 % ethyl acetate in hexane as eluent to give the desired product as colorless oil (5.0 g, 50%). Step 3: Synthesis of Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-((3-(dimethylamino)propanoyl)- oxy)succinate (Example 59) A mixture of bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-hydroxysuccinate 15 (265 mg, 0.34 mmol), 3-(dimethylamino)propanoic acid hydrochloride (88 mg, 0.57 mmol), EDC-HCl (109 mg, 0.57 mmol), DMAP (70 mg, 0.57 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. After concentration, the residue was dissolved in EtOAc and washed with water. The organic layer was dried over sodium sulfate and concentrated, and the crude was purified by column chromatography using 0-10% methanol in dichloromethane to yield the desired product as colorless oil (240 mg, 71%).1H NMR (300 MHz, CDCl3) δ 5.47 (t, 1H), 4.15 (t, 2H), 4.11 (t, 2H), 4.06 (m, 4H), 2.87 (d, 2H), 2.73-2.54 (m, 4H), 2.35-2.27 (m, 8H), 1.72-1.50 (m, 14H), 1.42 (m, 6H), 1.24 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C51H95NO10 [M+H] = 882.7, Observed = 882.6. Example 60: Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-((4- (dimethylamino)butanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 59.1H NMR (300 MHz, CDCl3) δ 5.45 (t, 1H), 4.15 (t, 2H), 4.11 (t, 2H), 4.06 (m, 4H), 2.86 (d, 2H), 2.42 (m, 2H), 2.35-2.25 (m, 4H), 2.20 (s, 6H), 1.79 (m, 2H), 1.69-1.50 (m, 14H), 1.35- 1.48 (m, 6H), 1.24 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C52H97NO10 [M+H] = 896.7, Observed = 896.6. Example 61: Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((3-(dimethylamino)- propanoyl)oxy)succinate Step 1: Synthesis of Pentadecan-7-ol (16) At 0 °C, to a solution of octylmagnesium bromide (2 M in ether, 52.5 mL, 0.105 mole) in 100 mL ether, was slowly added a solution of heptaldehyde (12.6 mL, 90 mmol) in 40 mL ether, and the mixture was warmed up to room temperature and stirred overnight. The reaction was quenched by saturated ammonium chloride and extracted with ether, the combined organic layers were dried over sodium sulfate. After concentration, the crude was recrystallized in acetonitrile to afford the desired product as white wax (10.0 g, 50%). Step 2: Synthesis of Bis(6-(benzyloxy)hexyl) 2-hydroxysuccinate (17) A mixture of dimethyl malate 11 (2.1 g, 13 mmol), 6-benzyoxyhexanol (5.4 g, 26 mmol) and p-toluenesulfonic acid monohydrate (300 mg) in 200 mL toluene was refluxed vigorously with Dean-stark apparatus. After 150 mL solvent was distilled off, more toluene was added and refluxed. This process was repeated one more time. After cooled to room temperature, the mixture was diluted with saturated sodium bicarbonate, and the resulting mixture was extracted with ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give oil which was purified by column chromatography using 0-20% ethyl acetate in hexane to give the desired product as colorless oil (2.7 g, 41%). Step 3: Synthesis of Bis(6-(benzyloxy)hexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate (18) A mixture of bis(6-(benzyloxy)hexyl) 2-hydroxysuccinate 17 (1.4 g, 2.72 mmol), tert- butyldiphenylsilyl chloride (825 mg, 3 mmol) and imidazole (340 mg, 5 mmol) in 12 mL DMF was stirred room temperature for 17 h. The reaction mixture was partitioned with ethyl acetate and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 5-20% ethyl acetate in hexane to give the desired product (1.65 g, 83%). Step 4: Synthesis of Bis(6-hydroxyhexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate (19) A mixture of bis(6-(benzyloxy)hexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate 18 (1.6 g, 2,12 mmol) and 5% palladium on carbon (500 mg) in 100 mL ethyl acetate was subjected to hydrogenolysis for 15 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to obtain the desired product (800 mg, 66%) along with partially deprotected intermediate (400 mg, 30%). Step 5: Synthesis of 6,6'-((2-((tert-Butyldiphenylsilyl)oxy)succinyl)bis(oxy))dihexanoic acid (20) To a solution of bis(6-hydroxyhexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate 19 (700 mg, 1.22 mmol) in 15 mL acetone, was added Jones reagent until the orange color persisted, and the resulting mixture was stirred for 30 min. The excess Jones reagent was consumed by adding few drops of 2-propanol, then the blue solution was diluted with water (100 mL) and extracted with ethyl acetate (3 x 70 mL). The combined organic layers were washed with brine, dried and concentrated to give the desired product (700 mg, 95%), which was used for the next step without further purification. Step 6: Synthesis of Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((tert-butyldiphenylsilyl)oxy)- succinate (21) A mixture of 6,6'-((2-((tert-butyldiphenylsilyl)oxy)succinyl)bis(oxy))dihexanoic acid 20 (800 mg, 1.33 mmol), 7-pentadecanol (914 mg, 4 mmol), EDCI-HCl (768 mg, 4 mmol) and DMAP (488 mg, 4 mmol) in 10 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 2- 10% ethyl acetate in hexane to give the desired product (900 mg, 66%). Step 7: Synthesis of Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-hydroxysuccinate (22) To a solution of bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((tert- butyldiphenylsilyl)oxy)-succinate 21 (500 mg, 0.49 mmol) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 1.5 mL), and the mixture was stirred at room temperature for 4 h. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 10-30% ethyl acetate in hexane to yield the desired product (280 mg, 73%). Step 8: Synthesis of Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((3-(dimethylamino)- propanoyl)oxy)succinate (Example 61) A mixture of bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-hydroxysuccinate 22 (125 mg, 0.16 mmol), 3-(dimethylamino)propanoic acid hydrochloride (76 mg, 0.49 mmol), EDC- HCl (95 mg, 0.49 mmol) and DMAP (60 mg, 0.49 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. The volatiles were removed under vacuum, and the residue was dissolved in EtOAc. The solution was washed with water, and the organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 0-10% methanol in dichloromethane to yield the desired product as colorless oil (140 mg, 98%).1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.84 (quint., 2H), 4.13 (t, 2H), 4.09 (t, 2H), 2.86 (d, 2H), 2.68-2.52 (m, 4H), 2.27 (t, 4H), 2.22 (s, 6H), 1.68-1.57 (m, 8H), 1.53-1.30 (m, 12H), 1.24 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C51H95NO10 [M+H] = 882.7, Observed = 882.6. Example 62: Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((3-(dimethylamino)- butanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 61.1H NMR (300 MHz, CDCl3) δ 5.44 (t, 1H), 4.85 (quint., 2H), 4.13 (t, 2H), 4.09 (t, 2H), 2.85 (d, 2H), 2.42 (m, 2H), 2.28 (t, 6H), 2.20 (s, 6H), 1.79 (quint., 2H), 1.68-1.57 (m, 8H), 1.53- 1.30 (m, 12H), 1.24 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C52H97NO10 [M+H] = 896.7, Observed = 896.6. Example 63: Bis(6-((2-butylnonyl)oxy)-6-oxohexyl) 2-hydroxysuccinate Step 1: Synthesis of 2-Butylnonanoic acid (23) To a solution of nonanoic acid (17.7 mL, 0.114 mole) in 200 mL THF at 0 °C, was added NaH (60%, 5.0 g, 0.125 mole) portionwise, followed by adding a solution of LDA (2 M in THF / heptane / ethylbenzene, 62.5 mL, 0.125 mole) dropwise, and the mixture was stirred at room temperature for 30 min. After addition of n-butyl iodide (15.5 mL, 0.137 mole), the resulting mixture was heated to 45 °C overnight. The suspension was cooled to room temperature and quenched with 1 N HCl to pH 2, the organic layer was separated and dried over sodium sulfate. After concentration, the crude was purified by flash column chromatography eluted with 0-20% EtOAc in hexane to give impure product (20 g), and the impurity is nonanoic acid. The impure product was used for the next step without further purification. Step 2: Synthesis of 2-Butylnonan-1-ol (24) To a solution of impure 2-butylnonanoic acid 23 (1.0 g, 4.7 mmol) in 30 mL ether, was added a solution of LiAlH4 (2 M in THF, 23.5 mL, 47 mmol) dropwise, and the resulting mixture was stirred at room temperature overnight. After quenched by EtOAc, the solution was washed with water, and the organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by flash column chromatography eluted with 0-40% EtOAc in hexane to give the desired product as colorless oil (600 mg, 64%). Step 3: Synthesis of Bis(6-((2-butylnonyl)oxy)-6-oxohexyl) 2-((tert- butyldiphenylsilyl)oxy)succinate (25) A mixture of 6,6'-((2-((tert-butyldiphenylsilyl)oxy)succinyl)bis(oxy))dihexanoic acid 20 (300 mg, 0.5 mmol), 2-butylnonan-1-ol 24 (300 mg, 1.5 mmol), EDCI-HCl (143 mg, 0.75 mmol) and DMAP (91 mg, 0.75 mmol) in 10 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 2-10% ethyl acetate in hexane to give the impure product (200 mg), which was used for the next step without further purification. Step 4: Synthesis of Bis(6-((2-butylnonyl)oxy)-6-oxohexyl) 2-hydroxysuccinate (26) To a solution of bis(6-((2-butylnonyl)oxy)-6-oxohexyl) 2-((tert- butyldiphenylsilyl)oxy)succinate 25 (200 mg, impure) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 1.5 mL), and the mixture was stirred at room temperature for 4 h. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 10-30% ethyl acetate in hexane to yield the desired product as oil (73 mg, 20% in two steps). Step 5: Synthesis of Bis(6-((2-butylnonyl)oxy)-6-oxohexyl) 2-hydroxysuccinate (Example 63) A mixture of bis(6-((2-butylnonyl)oxy)-6-oxohexyl) 2-hydroxysuccinate 26 (73 mg, 0.10 mmol), 3-(dimethylamino)propanoic acid hydrochloride (76 mg, 0.49 mmol), EDC-HCl (95 mg, 0.49 mmol) and DMAP (60 mg, 0.49 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. The volatiles were removed under vacuum, and the residue was partitioned in EtOAc and water, and the organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 0-10% methanol in dichloromethane to yield the desired product as colorless oil (63 mg, 76%). 1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.84 (quint., 2H), 4.13 (t, 2H), 4.09 (t, 2H), 2.86 (d, 2H), 2.68-2.52 (m, 4H), 2.27 (t, 4H), 2.22 (s, 6H), 1.68-1.57 (m, 8H), 1.53-1.30 (m, 12H), 1.24 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C47H87NO10 [M+H] = 826.6, Observed = 826.6. Example 64: 4-(2-(Dimethylamino)ethyl) 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2-((6-((2- hexyldecanoyl)oxy)hexanoyl)oxy)succinate Step 1: Synthesis of Benzyl (S)-2-(2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)acetate (27) Compound 27 was prepared according the procedure described in CN111039919A. To a solution of (S)-2-(2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)acetic acid (12 g, 69 mmol) and triethylamine (28.9 mL, 0.207 mole) in 200 mL acetone, was added benzyl bromide (24.6 mL, 0.207 mole) slowly, and then the resulting mixture was heated to reflux for 6 h. After cooled to room temperature, the suspension was filtered and washed with acetone, and the filtrate was concentrated. The residue was dissolved in EtOAc and washed with water, the organic layer was dried over sodium sulfate and concentrated. The residue was triturated with 25 mL ether to get the desired product as white solid (18.5 g, quant.). Step 2: Synthesis of (S)-4-(Benzyloxy)-2-hydroxy-4-oxobutanoic acid (28) Compound 28 was prepared according the procedure described in CN111039919A. A solution of benzyl (S)-2-(2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)acetate 27 (6.5 g, 24.6 mmol) in 30 mL THF, 30 mL acetic acid and 30 mL water was heated to 40 °C overnight. The solvent was evaporated, and the residue was coevaporated with toluene three times to give the desired product as pale yellow oil (6.0 g, quant.). Step 3: Synthesis of 4-Benzyl 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2-hydroxysuccinate (29) A solution of 4-hydroxybutyl 2-hexyldecanoate (800 mg, 2.35 mmol), (S)-4- (benzyloxy)-2-hydroxy-4-oxobutanoic acid 28 (800 mg, 3.57 mmol) and p-toluenesulfonic acid monohydrate (80 mg) in 60 mL toluene was heated to reflux overnight. The solvent was evaporated, and the residue was purified by column chromatography eluting with 0-20% EtOAc in hexane to give the desired product as pale yellow oil (650 mg, 47%). Step 4: Synthesis of (3S)-4-(4-((2-Hexyldecanoyl)oxy)butoxy)-3-hydroxy-4-oxobutanoic acid (30) A mixture of 4-benzyl 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2-hydroxysuccinate 29 (155 mg, 0.29 mmol) and palladium on carbon (5%, 200 mg) in 15 mL hexane was subjected to hydrogenolysis for 30 h. After filtration and concentration, the crude was purified by column chromatography eluted with 10-100% ethyl acetate in hexane to give the desired acid as colorless oil (116 mg, 90%). Step 5: Synthesis of 4-(2-(Dimethylamino)ethyl) 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2- hydroxysuccinate (31) A solution of (3S)-4-(4-((2-hexyldecanoyl)oxy)butoxy)-3-hydroxy-4-oxobutanoic acid 30 (130 mg, 0.29 mmol), 2-(dimethylamino)ethan-1-ol (260 mg, 2.9 mmol), EDCI-HCl (192 mg, 1 mmol) and DMAP (122 mg, 1 mmol) in 7 mL dichloromethane was stirred at room temperature for 18 h. The reaction mixture was diluted with 100 mL dichloromethane, washed with saturated ammonium chloride solution (50 mL x 3), and followed by brine. The organic layer was dried over sodium sulfate and concentrated to give the crude product which was carried to the next step without further purification. Step 6: Synthesis of 4-(2-(Dimethylamino)ethyl) 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2-((6- ((2-hexyldecanoyl)oxy)hexanoyl)oxy)succinate (Example 64) A solution of 4-(2-(dimethylamino)ethyl) 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2- hydroxysuccinate 31 (150 mg, 0.29 mmol), 6-((2-hexyldecanoyl)oxy)hexanoic acid (507 mg, 1.32 mmol), EDCI-HCl (253 mg, 1.32 mmol) and DMAP (122 mg, 1 mmol) in 8 mL dichloromethane was stirred at room temperature for 18 h. After the solvent was removed under vacuum, the residue was dissolved in ethyl acetate (80 mL), which was washed with saturated aqueous ammonium chloride (40 mL x 2), followed by brine. The organic layer was dried over sodium sulfate and concentrated, and the crude was purified by column chromatography eluting with 20-100% ethyl acetate in hexane to give the desired product as colorless oil (154 mg, 61%).1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.23-4.16 (m, 4H), 4.09-4.01 (m, 4H), 2.90 (d, 2H), 2.55 (t, 2H), 2.38 (dt, 2H), 2.34-2.27 (m, 2H), 2.26 (s, 6H), 1.74-1.50 (m, 12H), 1.47- 1.36 (m, 6H), 1.24 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C50H93NO10 [M+H] = 868.6, Observed = 868.0. Example 65: 4-(2-(Dimethylamino)propyl) 1-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2-((6-((2- hexyldecanoyl)oxy)hexanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 64.1H NMR (300 MHz, CDCl3) δ 5.44 (t, 1H), 4.21-4.14 (m, 4H), 4.09-3.99 (m, 4H), 2.86 (d, 2H), 2.42-2.24 (m, 6H), 2.20 (s, 6H), 1.83-1.36 (m, 20H), 1.23 (m, 40H), 0.86 (t, 12H). APCI-MS analysis: Calculated C51H95NO10 [M+H] = 882.7, Observed = 882.0. Example 66: 4-(2-(Dimethylamino)ethyl) 1-(5-((2-hexyldecanoyl)oxy)-pentyl) 2-((7-((2- hexyldecanoyl)oxy)heptanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 64.1H NMR (300 MHz, CDCl3) δ 5.45 (t, 1H), 4.20 (t, 2H), 4.15 (t, 2H), 4.05 (m, 4H), 2.90 (d, 2H), 2.55 (t, 2H), 2.40-2.29 (m, 4H), 2.27 (s, 6H), 1.73-1.51 (m, 10H), 1.48-1.33 (m, 4H), 1.24 (m, 48H), 0.87 (t, 12H). APCI-MS analysis: Calculated C52H97NO10 [M+H] = 896.7, Observed = 896.9. Example 67: 4-(3-(Dimethylamino)propyl) 1-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((7- ((2-hexyldecanoyl)oxy)heptanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 64.1H NMR (300 MHz, CDCl3) δ 5.45 (t, 1H), 4.20-4.13 (m, 4H), 4.08-4.02 (m, 4H), 2.86 (d, 2H), 2.42-2.28 (m, 6H), 2.24 (s, 6H), 1.82 (quint, 2H), 1.73-1.51 (m, 10H), 1.48-1.30 (m, 4H), 1.24 (m, 48H), 0.87 (t, 12H). APCI-MS analysis: Calculated C53H99NO10 [M+H] = 910.7, Observed = 910.8. Example 68: 4-(2-(Dimethylamino)ethyl) 1-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((((5- ((2-hexyldecanoyl)oxy)pentyl)oxy)carbonyl)oxy)succinate Step 1: Synthesis of 5-Hydroxypentyl 2-hexyldecanoate (32) A mixture of 1,5-pentanediol (10.4 g, 0.10 mole), 2-hexyldecanoic acid (7.92 mL, 50 mmol), EDCI-HCl (9.58 g, 50 mmol) and DMAP (1.52 g, 12.5 mmol) in 100 mL dichloromethane was stirred at room temperature for 16 h. The mixture was diluted with 100 mL water, the organic layer was separated and washed by brine. After dried over sodium sulfate, the solvent was removed under vacuum, and the residue was purified by column chromatography using 0-10% ethyl acetate in hexane to yield the desired product as colorless oil (13.9 g, 81%). Step 2: Synthesis of 4-(2-(Dimethylamino)ethyl) 1-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- ((((5-((2-hexyldecanoyl)oxy)pentyl)oxy)carbonyl)oxy)succinate (Example 68) To a mixture of 5-hydroxypentyl 2-hexyldecanoate 32 (684 mg, 2.0 mmol) and pyridine (1.5 mL) in 6 mL dichloromethane, was added p-nitrophenyl chloroformate (404 mg, 2.0 mmol), and the resulting mixture was stirred at room temperature for 12 h. Then a solution of 4-(2-(dimethylamino)ethyl) 1-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- hydroxysuccinate (150 mg, 0.28 mmol) in 4 mL dichloromethane was added and followed by triethylamine (150 µL, 1 mmol), and the mixture was stirred at room temperature for 18 h. After evaporation, the residue was dissolved in hexane, and the solution was washed with 2% Na2CO3 solution several times until no p-nitrophenol present. After concentration, the crude was purified by column chromatography using 20% -100% ethyl acetate in hexane to give the desired product as colorless oil (60 mg, 24%). Example 69: 4-(3-(Dimethylamino)propyl) 1-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((((5- ((2-hexyldecanoyl)oxy)pentyl)oxy)carbonyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 68.1H NMR (300 MHz, CDCl3) δ 5.36 (t, 1H), 4.23-4.12 (m, 6H), 4.05 (t, 4H), 2.89 (d, 2H), 2.54 (t, 2H), 2.37-2.26 (m, 4H), 2.21 (s, 6H), 1.79 (quint, 2H), 1.75-1.50 (m, 6H), 1.48-1.33 (m, 4H), 1.24 (m, 48H), 0.86 (t, 12H). APCI-MS analysis: Calculated C52H97NO11 [M+H] = 912.3, Observed = 912.0. Example 70: 1-(2-(Dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((7-((2- hexyldecanoyl)oxy)heptanoyl)oxy)succinate Step 1: 7-Hydroxyheptyl 2-hexyldecanoate (33) A mixture of 1,7-heptanediol (4.6 g, 35 mmol), 2-hexyldecanoic acid (4.5 g, 17.5 mmol), EDCI-HCl (4.0 g, 21 mmol) and DMAP (427 mg, 3.5 mmol) in 50 mL dichloromethane was stirred at room temperature for 16 h. The mixture was diluted with 50 mL water, the organic layer was separated and washed by brine. After dried over sodium sulfate, the solvent was removed under vacuum, and the residue was purified by column chromatography using 0-10% ethyl acetate in hexane to yield the desired product as colorless oil (5.0 g, 77%). Step 2: 7-((2-Hexyldecanoyl)oxy)heptanoic acid (34) To a solution of 7-hydroxyheptyl 2-hexyldecanoate 33 (4.9 g, 13.2 mmol) in 50 mL acetone, was added Jones reagent until the orange color persisted and the resulting mixture was stirred for 1 h. The excess Jones reagent was consumed by adding few drops of 2- propanol. Then the blue solution was diluted with water (100 mL) and extracted with ethyl acetate (3 x 100 mL). The combined organic layers were washed with brine, dried and concentrated to give the desired product (5.0 g, 98%), which was used for the next step without further purification. Step 3: Synthesis of 5-(2-((S)-2,2-Dimethyl-5-oxo-1,3-dioxolan-4-yl)acetoxy)pentyl 2- hexyldecanoate (35) A mixture of (S)-2-(2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)acetic acid (174 mg, 1 mmol), 5-hydroxypentyl 2-hexyldecanoate 32 (342 mg, 1 mmol), triethylamine (0.5 mL), EDCI-HCl (192 mg, 1 mmol) and DMAP (122 mg, 1 mmol) in 8 mL dichloromethane was stirred at room temperature for 17 h. The solvent was removed under vacuum, the residue was dissolved in ethyl acetate (80 mL), and then the solution was washed with saturated ammonium chloride solution (25 mL x 2), followed by brine (25 mL x 2). After dried over sodium sulfate and concentration, the crude was purified by column chromatography using 5- 30% ethyl acetate in hexane to give the desired ester as pale yellow oil (433 mg, 87%). Step 4: Synthesis of (2S)-4-((5-((2-Hexyldecanoyl)oxy)pentyl)oxy)-2-hydroxy-4-oxobutanoic acid (36) A solution of 5-(2-((S)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)acetoxy)pentyl 2- hexyldecanoate 35 (433 mg, 0.87 mmol) in a mixture of acetic acid (5 mL), water (5 mL) and THF (5 mL) was heated at 40-50 °C for 18 h. The volatiles were removed, and the residue was coevaporated with toluene three times to get the crude product as brown oil (400 mg, quant.), which was carried over to the next step without further purification. Step 5: Synthesis of 1-(2-(Dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- hydroxysuccinate (37) A mixture of (2S)-4-((5-((2-hexyldecanoyl)oxy)pentyl)oxy)-2-hydroxy-4-oxobutanoic acid 36 (200 mg, 0.44 mmol), 2-(dimethylamino)ethan-1-ol (390 mg, 4.4 mmol), EDCI-HCl (192 mg, 1 mmol) and DMAP (122 mg, 1 mmol) in 7 mL dichloromethane was stirred at room temperature for 18 h. The reaction mixture was diluted with dichloromethane (100 mL) and washed with saturated ammonium chloride solution (50 mL x 3), followed by brine (50 mL x 1). The organic layer was dried over sodium sulfate and concentrated to get the desired product as brown oil (250 mg) which was used for the next step without further purification. Step 6: Synthesis of 1-(2-(Dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- ((7-((2-hexyldecanoyl)oxy)heptanoyl)oxy)succinate (Example 70) A mixture of 1-(2-(dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- hydroxysuccinate 37 (250 mg, 0.44 mmol), 7-((2-hexyldecanoyl)oxy)heptanoic acid 34 (507 mg, 1.32 mmol), EDCI-HCl (253 mg, 1.32 mmol) and DMAP (122 mg, 1 mmol) in 8 mL dichloromethane was stirred at room temperature for 18 h. After concentration, the residue was dissolved in ethyl acetate (80 mL), washed with saturated ammonium chloride solution (40 mL x 2), and followed by brine. The organic layer was dried over sodium sulfate and concentrated, and the crude was purified by column chromatography using 20-100% ethyl acetate in hexane to get the desired product as colorless oil (65 mg, 17%).1H NMR (300 MHz, CDCl3) δ 5.45 (t, 1H), 4.24 (t, 2H), 4.09 (t, 2H), 4.05 (m, 4H), 2.86 (d, 2H), 2.54 (t, 2H), 2.40-2.26 (m, 4H), 2.24 (s, 6H), 1.70-1.48 (m, 10H), 1.46-1.30 (m, 4H), 1.23 (m, 48H), 0.85 (t, 12H). APCI-MS analysis: Calculated C52H97NO10 [M+H] = 896.3, Observed = 896.7. Example 71: 1-(3-(Dimethylamino)propyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((7- ((2-hexyldecanoyl)oxy)heptanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 70.1H NMR (300 MHz, CDCl3) δ 5.45 (t, 1H), 4.20 (t, 2H), 4.10 (t, 2H), 4.06 (m, 4H), 2.86 (d, 2H), 2.54 (t, 2H), 2.42-2.24 (m, 6H), 2.21 (s, 6H), 1.79 (quint, 2H), 1.70-1.48 (m, 8H), 1.46- 1.32 (m, 4H), 1.24 (m, 48H), 0.86 (t, 12H). APCI-MS analysis: Calculated C53H99NO10 [M+H] = 910.3, Observed = 910.6. Example 72: 1-(2-(Dimethylamino)ethyl) 4-(4-((2-hexyldecanoyl)oxy)butyl) (2S)-2-((6-((2- hexyldecanoyl)oxy)hexanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 70.1H NMR (300 MHz, CDCl3) δ 5.47 (t, 1H), 4.25 (t, 2H), 4.17-4.03 (m, 6H), 2.88 (d, 2H), 2.56 (t, 2H), 2.42-2.26 (m, 4H), 2.25 (s, 6H), 1.75-1.50 (m, 10H), 1.48-1.35 (m, 4H), 1.24 (m, 44H), 0.86 (t, 12H). APCI-MS analysis: Calculated C50H93NO10 [M+H] = 868.3, Observed = 868.0. Example 73: 1-(18-hexyl-2-methyl-6,9,16-trioxo-5,10,17-trioxa-2-azahexacosan-7-yl) 8- (pentadecan-7-yl) octanedioate The titular compound was prepared in a manner analogous to Example 70.1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.85 (m, 2H), 4.25 (t, 2H), 4.09 (t, 2H), 2.86 (d, 2H), 2.56 (t, 2H), 2.42-2.26 (m, 6H), 2.24 (s, 6H), 1.76-1.55 (m, 10H), 1.55-1.43 (m, 4H), 1.24 (m, 48H), 0.86 (t, 12H). APCI-MS analysis: Calculated C52H97NO10 [M+H] = 896.3, Observed = 896.0. Example 74: 1-(2-(Dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy) pentyl) 2-((6-((2- hexyldecanoyl)oxy)hexanoyl)oxy)succinate The titular compound was prepared in a manner analogous to Example 70.1H NMR (300 MHz, CDCl3) δ 5.46 (t, 1H), 4.25 (t, 2H), 4.10 (t, 2H), 4.05 (m, 4H), 2.87 (d, 2H), 2.55 (t, 2H), 2.43-2.26 (m, 4H), 2.25 (s, 6H), 1.74-1.48 (m, 8H), 1.46-1.34 (m, 4H), 1.24 (m, 48H), 0.86 (t, 12H). APCI-MS analysis: Calculated C51H95NO10 [M+H] = 882.3, Observed = 882.6. Example 75: 1-(2-(Dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((((5- ((2-hexyldecanoyl)oxy)pentyl)oxy)carbonyl)oxy)succinate To a mixture of 5-hydroxypentyl 2-hexyldecanoate 32 (513 mg, 1.5 mmol) and pyridine (1 mL) in 6 mL dichloromethane, was added p-nitrophenyl chloroformate (303 mg, 1.5 mmol), and the resulting mixture was stirred at room temperature for 12 h. Then a solution of 1-(2-(dimethylamino)ethyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- hydroxysuccinate 37 (150 mg, 0.28 mmol) in 4 mL dichloromethane was added and followed by triethylamine (150 µL, 1 mmol), and the mixture was stirred at room temperature for 18 h. After evaporation, the residue was dissolved in hexane, and the solution was washed with 2% Na2CO3solution several times until no p-nitrophenol was present. The solvent was evaporated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to give the desired product as colorless oil (84 mg, 35%).1H NMR (300 MHz, CDCl3) δ 5.40-5.36 (m, 1H), 4.29-4.25 (m, 2H), 4.19-4.03 (m, 8H), 2.91-2.88 (m, 2H), 2.56 (t, 2H), 2.32-2.25 (m, 8H), 1.73-1.37 (m, 20H), 1.23 (m, 40H), 0.85 (t, 12H). APCI-MS analysis: Calculated C51H95NO11 [M+H] = 898.7, Observed = 898.6. Example 76: 1-(3-(Dimethylamino)propyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2-((((5- ((2-hexyldecanoyl)oxy)pentyl)oxy)carbonyl)oxy)succinate Step 1: Synthesis of 1-(3-(Dimethylamino)propyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- hydroxysuccinate (38) A mixture of (2S)-4-((5-((2-hexyldecanoyl)oxy)pentyl)oxy)-2-hydroxy-4-oxobutanoic acid 36 (800 mg, 0.44 mmol), 3-(dimethylamino)propan-1-ol (453 mg, 4.4 mmol), EDCI-HCl (192 mg, 1 mmol) and DMAP (122 mg, 1 mmol) in 7 mL dichloromethane was stirred at room temperature for 18 h. The reaction mixture was diluted with dichloromethane (100 mL) and washed with saturated ammonium chloride solution (50 mL x 3), followed by brine (50 mL x 1). The organic layer was dried over sodium sulfate and concentrated to get the desired product as brown oil (260 mg) which was used for the next step without further purification. Step 2: Synthesis of 1-(3-(dimethylamino)propyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- ((((5-((2-hexyldecanoyl)oxy)pentyl)oxy)carbonyl)oxy)succinate (Example 76) To a mixture of 5-hydroxypentyl 2-hexyldecanoate 32 (513 mg, 1.5 mmol) and pyridine (1 mL) in 6 mL dichloromethane, was added p-nitrophenyl chloroformate (303 mg, 1.5 mmol), and the resulting mixture was stirred at room temperature for 12 h. Then a solution of 1-(2-(dimethylamino)propyl) 4-(5-((2-hexyldecanoyl)oxy)pentyl) (2S)-2- hydroxysuccinate 38 (150 mg, 0.28 mmol) in 4 mL dichloromethane was added and followed by triethylamine (50 µL, 0.33 mmol), and the mixture was stirred at room temperature for 18 h. After evaporation, the residue was dissolved in hexane, and the solution was washed with 2% Na2CO3solution several times until no p-nitrophenol was present. The solvent was evaporated, and the crude was purified by column chromatography using 0 -100% ethyl acetate in hexane and then 0-30% acetone in ethyl acetate to give the desired product as colorless oil (47 mg, 14%).1H NMR (300 MHz, CDCl3) δ 5.32-5.41 (1H), 4.10-4.03 (m, 10H), 2.90 (m, 2H), 2.31-2.28 (m, 4H), 2.20 (s, 6H), 1.73-1.87 (m, 2H), 1.66-1.39 (m, 20H), 1.23 (m, 40H), 0.85 (t, 12H). APCI-MS analysis: Calculated C52H97NO11 [M+H] = 912.7, Observed = 912.0. Example 77: Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of Bis(8-(benzyloxy)octyl) 2-hydroxysuccinate (39) A mixture of dimethyl malate (4.05 g, 25 mmol), 8-benzoxyoctanol (11.8 g, 50 mmol) and p-toluenesulfonic acid monohydrate (600 mg) in 200 mL toluene was refluxed vigorously with Dean-stark apparatus. After 150 mL solvent was distilled off, more toluene was added and refluxed. This process was repeated one more time. After cooling to room temperature, the mixture was diluted with saturated sodium bicarbonate, and the resulting mixture was extracted with ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated, and the crude was purified by column chromatography using 0-20% ethyl acetate in hexane to give the desired product as colorless oil (5.7 g, 40%). Step 2: Synthesis of Bis(8-(benzyloxy)octyl) 2-((tert-butyldiphenylsilyl)oxy)succinate (40) A mixture of bis(8-(benzyloxy)octyl) 2-hydroxysuccinate 39 (5.0 g, 8.77 mmol), tert- butyldiphenylsilyl chloride (2.65 g, 9.65 mmol) and imidazole (657 mg, 9.65 mmol) in 50 mL DMF was stirred at room temperature for 17 h. The reaction mixture was partitioned with ethyl acetate and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 0-20% ethyl acetate in hexane to give the desired product as clear oil (6.4 g, quant.). Step 3: Synthesis of Bis(8-hydroxyoctyl) 2-((tert-butyldiphenylsilyl)oxy)succinate (41) A mixture of bis(8-(benzyloxy)octyl) 2-((tert-butyldiphenylsilyl)oxy)succinate 40 (6.4 g, 8.77 mmol) and 5% palladium on carbon (1 g) in 100 mL ethyl acetate was subjected to hydrogenolysis for 15 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to obtain the desired product (800 mg) along with a mixture of partially deprotected intermediate and starting material (4 g), which was further hydrogenated with 800 mg 20% palladium hydroxide on carbon in a Parr apparatus (40 psi) for 16 h. After workup and column purification, 3.2 g pure product was obtained (total: 4.0 g, 72%). Step 4: Synthesis of 8,8'-((2-((tert-Butyldiphenylsilyl)oxy)succinyl)bis(oxy))dioctanoic acid (42) To a solution of bis(8-hydroxyoctyl) 2-((tert-butyldiphenylsilyl)oxy)succinate 41 (800 mg, 1.37 mmol) in 20 mL acetone, was added Jones reagent until the orange color persisted, and the resulting mixture was stirred for 90 min. The excess Jones reagent was consumed by adding few drops of 2-propanol, then the blue solution was diluted with water (100 mL) and extracted with ethyl acetate (3 x 70 mL). The combined organic layers were washed with brine, dried and concentrated to give the desired product (800 mg, 95%), which was used for the next step without further purification. Step 5: Synthesis of Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-((tert- butyldiphenylsilyl)oxy)succinate (43) A mixture of 8,8'-((2-((tert-butyldiphenylsilyl)oxy)succinyl)bis(oxy))dioctanoic acid 42 (400 mg, 0.61 mmol), 7-pentadecanol (310 mg, 1.28 mmol), EDCI-HCl (384 mg, 2 mmol) and DMAP (244 mg, 2 mmol) in 10 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0- 10% ethyl acetate in hexane to give the desired product (590 mg, 90%). Step 6: Synthesis of Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-hydroxysuccinate (44) To a solution of bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-((tert- butyldiphenylsilyl)oxy)succinate 43 (590 mg, 0.55 mmol) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 1.5 mL), and the mixture was stirred at room temperature overnight. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 0-30% ethyl acetate in hexane to yield the desired product (440 mg, 95%). Step 7: Synthesis of Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 77) To a solution of 2,2-dimethylaminoethanol (534 mg, 6 mmol) in a mixture of 3mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (603 mg, 6 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-hydroxysuccinate 44 (440 mg, 0.53 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for another 15 h. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product (178 mg, 35%).1H NMR (300 MHz, CDCl3) δ 5.36 (t, 1H), 4.86 (quint, 2H), 4.25 (t, 2H), 4.15 (t, 2H), 4.09 (t, 2H), 2.89-2.87 (m, 2H), 2.60 (m, 2H), 2.29-2.25 (m, 10H), 1.65-1.49 (m, 18H), 1.28 (m, 50H), 0.87 (t, 12H). APCI-MS analysis: Calculated C55H103NO11 [M+H] = 954.7, Observed = 954.7. Example 78: Bis(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of Bis(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl) 2-((tert- butyldiphenylsilyl)oxy)succinate (45) A mixture of 8,8'-((2-((tert-butyldiphenylsilyl)oxy)succinyl)bis(oxy))dioctanoic acid 42 (400 mg, 0.61 mmol), (Z)-non-2-en-1-ol (182 mg, 1.28 mmol), EDCI-HCl (384 mg, 2 mmol) and DMAP (244 mg, 2 mmol) in 10 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (410 mg, 74%). Step 2: Synthesis of Bis(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl) 2-hydroxysuccinate (46) To a solution of bis(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl) 2-((tert- butyldiphenylsilyl)oxy)succinate 45 (410 mg, 0.45 mmol) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 0.5 mL), and the mixture was stirred at room temperature for 20 h. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 0-30% ethyl acetate in hexane to yield the desired product (270 mg, 89%). Step 3: Synthesis of Bis(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 78) To a solution of 2-(dimethylamino)ethan-1-ol (534 mg, 6 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (1.20 g, 6 mmol), and the reaction mixture was stirred at room temperature for 1 h. TLC showed complete reaction. A solution of bis(8-(((Z)-non-2-en-1-yl)oxy)-8-oxooctyl) 2- hydroxysuccinate 46 (270 mg, 0.4 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (0.52 mL, 3 mmol) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product as colorless oil (183 mg, 58%).1H NMR (300 MHz, CDCl3) δ 5.68-5.47 (m, 4H), 5.37 (t, 1H), 4.61 (d, 4H), 4.25 (t, 2H), 4.16 (t, 2H), 4.09 (t, 2H), 2.90-2.87 (m, 2H), 2.63-2.58 (m, 2H), 2.32-2.23 (m, 10H), 2.09 (q, 4H), 1.61 (m, 6H), 1.32-1.25 (m, 30H), 0.87 (t, 6H). APCI-MS analysis: Calculated C43H75NO11 [M+H] = 782.5, Observed = 782.5. Example 79: Bis(7-((8-methylnonanoyl)oxy)heptyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of 7-(Benzyloxy)heptan-1-ol (47) To a solution of 1,7-heptanediol (10 g, 75.7mmol) in 60 mL DMF, was added NaH (3.33 g, 83 mmol) at 0°C. After stirring for 30 min, a solution of benzylbromide (20.2 g, 91 mmol) in 30 mL DMF was added dropwise, and then reaction mixture was stirred at room temperature overnight. Water was added to quench the reaction, the mixture was extracted with EtOAc (2 x 200 mL). The combined organic layer was washed with water and brine, and then dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography using 0-60% ethyl acetate in hexane to give the desired product (9.4 g, 59%). Step 2: Synthesis of 7-(Benzyloxy)heptyl 8-methylnonanoate (48) A mixture of 7-(benzyloxy)heptan-1-ol 47 (9.4 g, 42.3 mmol), 8-methylnonanoic acid (7.28 g, 42.3 mmol), EDCI-HCl (11.4 g, 59.3 mmol) and DMAP (1.03 g, 8.4 mmol) in 100 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between dichloromethane and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (14.47 g, 91%). Step 3: Synthesis of 7-Hydroxyheptyl 8-methylnonanoate (49) A mixture of 7-(benzyloxy)heptyl 8-methylnonanoate 48 (13.8 g, 48.2 mmol) and 20% palladium hydroxide on carbon (1.5 g) in 100 mL ethyl acetate was subjected to hydrogenolysis in a Parr apparatus (40 psi) for 16 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to obtain the desired product (10.5 g, quant.). Step 4: Synthesis of Bis(7-((8-methylnonanoyl)oxy)heptyl) 2-hydroxysuccinate (50) A mixture of dimethyl malate (991 mg, 6.11 mmol), 7-hydroxyheptyl 8- methylnonanoate 49 (3.5 g, 12.3 mmol) and p-toluenesulfonic acid monohydrate (600 mg) in 200 mL toluene was refluxed vigorously with Dean-stark apparatus. After 150 mL solvent was distilled off, more toluene was added and refluxed. This process was repeated one more time. After cooled to room temperature, the mixture was diluted with saturated sodium bicarbonate, and the resulting mixture was extracted with ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give oil which was purified by column chromatography using 0-20% ethyl acetate in hexane to give the desired product as colorless oil (190 mg, 4.6%). The major product is heptane-1,7-diyl bis(8- methylnonanoate). Step 5: Synthesis of Bis(7-((8-methylnonanoyl)oxy)heptyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 79) To a solution of 2-(dimethylamino)ethan-1-ol (534 mg, 6 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (1.20 g, 6 mmol), and the reaction mixture was stirred at room temperature for 1 h. TLC showed complete reaction. A solution of bis(7-((8-methylnonanoyl)oxy)heptyl) 2-hydroxysuccinate 50 (190 mg, 0.28 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (0.52 mL, 3 mmol) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product as colorless oil (98 mg, 43%). 1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.25 (t, 2H), 4.16 (t, 2H), 4.09 (t, 2H), 4.04 (t, 4H), 2.90-2.88 (m, 2H), 2.63-2.58 (m, 2H), 2.31-2.26 (m, 10H), 1.66-1.58 (m, 12H), 1.55- 1.46 (m, 2H), 1.33-1.10 (m, 28H), 0.86 (d, 12H). APCI-MS analysis: Calculated C43H79NO11 [M+H] = 786.5, Observed = 786.5. Example 80: Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of 2-Propylnonanoic acid (51) To a solution of nonanoic acid (10.5 mL, 60 mmol) in 100 mL THF at 0°C, was added NaH (60%, 2.4 g, 60 mmol) in portions, followed by adding a solution of LDA (2 M in THF / heptane / ethylbenzene, 60 mL, 0.12 mole) dropwise, and the mixture was stirred at room temperature for 30 min. After addition of n-propyl iodide (11.22 g, 66 mmol), the resulting mixture was heated to 45°C overnight. The suspension was cooled to room temperature and quenched with 1 N HCl to pH 2, the organic layer was separated and dried over sodium sulfate. After concentration, the crude was purified by flash column chromatography eluted with 0-20% EtOAc in hexane to give impure product (10 g), and the impurity is nonanoic acid. The impure product was used for the next step without further purification. Step 2: Synthesis of 2-propylnonan-1-ol (52) To a solution of impure 2-propylnonanoic acid 51 (5.5 g, 30 mmol) in 30 mL ether, was added a solution of LiAlH4(2 M in THF, 15 mL, 30 mmol) dropwise, and the resulting mixture was stirred at room temperature overnight. After quenched by EtOAc, the solution was washed with water, and the organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by flash column chromatography eluted with 0-40% EtOAc in hexane to give the desired product as colorless oil (3.5 g, 69%). Step 3: Synthesis of Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-((tert- butyldiphenylsilyl)oxy)succinate (53) A mixture of 8,8'-((2-((tert-butyldiphenylsilyl)oxy)succinyl)bis(oxy))dioctanoic acid 42 (700 mg, 1.06 mmol), 2-propylnonan-1-ol 52 (510 mg, 2.74 mmol), EDCI-HCl (576 mg, 3 mmol) and DMAP (366 mg, 3 mmol) in 12 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. After concentration, the crude (900 mg) was used for the next step without purification. Step 4: Synthesis of Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-hydroxysuccinate (54) To a solution of crude bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-((tert- butyldiphenylsilyl)oxy)succinate 53 (900 mg) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 1.5 mL), and the mixture was stirred at room temperature overnight. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 0-30% ethyl acetate in hexane to yield the desired product (460 mg, 57%). Step 5: Synthesis of Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 80) To a solution of 2-(dimethylamino)ethan-1-ol (534 mg, 6 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (1.20 g, 6 mmol), and the reaction mixture was stirred at room temperature for 1 h. TLC showed complete reaction. A solution of bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-hydroxysuccinate 54 (350 mg, 0.46 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (0.52 mL, 3 mmol) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product (220 mg, 54%).1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.25 (t, 2H), 4.15 (t, 2H), 4.09 (t, 2H), 3.96 (d, 4H), 2.89-2.87 (m, 2H), 2.63-2.57 (m, 2H), 2.31-2.27 (m, 10H), 1.63-1.59 (m, 10H), 1.32- 1.25 (m, 44H), 0.90-0.85 (m, 12H). APCI-MS analysis: Calculated C49H91NO11 [M+H] = 870.6, Observed = 870.6. Example 81: Bis(6-(decanoyloxy)hexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of Bis(6-(decanoyloxy)hexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate (55) A mixture of bis(6-hydroxyhexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate 19 (370 mg, 0.65 mmol), decanoic acid (223 mg, 1.3 mmol), EDCI-HCl (288 mg, 1.5 mmol) and DMAP (183 mg, 1.5 mmol) in 8 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0- 10% ethyl acetate in hexane to give the desired product (550 mg, 88%). Step 2: Synthesis of Bis(6-(decanoyloxy)hexyl) 2-hydroxysuccinate (56) To a solution of bis(6-(decanoyloxy)hexyl) 2-((tert-butyldiphenylsilyl)oxy)succinate 55 (550 mg, 0.54 mmol) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 1 mL), and the mixture was stirred at room temperature for 16 h. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 10-30% ethyl acetate in hexane to yield the desired product (330 mg, 95%). Step 3: Synthesis of Bis(6-(decanoyloxy)hexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 81) To a solution of 2-(dimethylamino)ethan-1-ol (534 mg, 6 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (1.20 g, 6 mmol), and the reaction mixture was stirred at room temperature for 1 h. TLC showed complete reaction. A solution of bis(6-(decanoyloxy)hexyl) 2-hydroxysuccinate 56 (350 mg, 0.46 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (0.52 mL, 3 mmol) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product (110 mg, 28%).1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.26 (t, 2H), 4.17 (t, 2H), 4.12 (t, 2H), 4.05 (t, 4H), 2.89 (m, 2H), 2.63-2.58 (m, 2H), 2.31-2.26 (m, 10H), 1.63-1.61 (m, 12H), 1.37-1.26 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C41H75NO11 [M+H] = 758.5, Observed = 758.0. Example 82: Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((5- (dimethylamino)pentanoyl)oxy)succinate A mixture of bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-hydroxysuccinate 22 (120 mg, 0.15 mmol), 5-(dimethylamino)pentanoic acid hydrochloride (54 mg, 0.3 mmol), EDC- HCl (95 mg, 0.49 mmol) and DMAP (60 mg, 0.49 mmol) in 10 mL dichloromethane was stirred at room temperature for 17 h. The volatiles were removed under vacuum, and the residue was dissolved in EtOAc. The solution was washed with water, and the organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 0-10% methanol in dichloromethane to yield the desired product as colorless oil (196 mg, 71%). 1H NMR (300 MHz, CDCl3) δ 5.43 (t, 1H), 4.84 (quint, 2H), 4.15-4.06 (m, 4H), 2.84 (d, 2H), 2.42-2.15 (m, 12H), 1.67-1.47 (m, 18H), 1.41-1.23 (m, 48H), 0.90-0.83 (m, 12H). APCI-MS analysis: Calculated C53H99NO10 [M+H] = 910.7, Observed = 910.0. Example 83: Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-(((3- (dimethylamino)propoxy)carbonyl)oxy)succinate To a solution of 3-(dimethylamino)propan-1-ol (267 mg, 3 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (603 mg, 3 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-hydroxysuccinate 22 (300 mg, 0.29 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for another 15 h. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product (118 mg, 42%). 1H NMR (300 MHz, CDCl3) δ 5.36 (t, 1H), 4.85 (quint, 2H), 4.25-4.05 (m, 6H), 2.89 (d, 2H), 2.38-2.18 (m, 12H), 1.90-1.80 (m, 2H), 1.69-1.42 (m, 20H), 1.29 (m, 40H), 0.95-0.84 (m, 12H). APCI-MS analysis: Calculated C52H97NO11 [M+H] = 912.7, Observed = 912.1. Example 84: Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate To a solution of 2-(dimethylamino)ethan-1-ol (267 mg, 3 mmol) in a mixture of 1 mL pyridine and 8 mL dichloromethane, was added 4-nitrophenylchloroformate (603 mg, 3 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-hydroxysuccinate 22 (140 mg, 0.18 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for another 15 h. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes, followed by 0-30% acetone in ethyl acetate to give desired product (40 mg, 24%).1H NMR (300 MHz, CDCl3) δ 5.36 (m, 1H), 4.86 (t, 2H), 4.26 (t, 2H), 4.17 (t, 2H), 4.10 (t, 2H), 2.89 (m, 2H), 2.61 (m, 2H), 2.31-2.26 (m, 12H), 1.70-1.49 (m, 18H), 1.42-1.25 (m, 40H), 0.87 (t, 12H). APCI-MS analysis: Calculated C51H95NO11 [M+H] = 898.7, Observed = 898.0. Example 85: Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate To a solution of 2-(dimethylamino)ethan-1-ol (445 mg, 5 mmol) in a mixture of 3 mL pyridine and 10 mL dichloromethane, was added 4-nitrophenylchloroformate (1.0 g, 5 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-hydroxysuccinate 15 (500 mg, 0.66 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes to give desired product (360 mg, 61%).1H NMR (300 MHz, CDCl3) δ 5.36 (t, 1H), 4.24 (t, 2H), 4.17 (t, 2H), 4.10 (t, 2H), 4.05 (t, 4H), 2.88 (d, 2H), 2.59 (m, 2H), 2.32-2.24 (m, 8H), 1.70-1.53 (m, 12H), 1.44-1.34 (m, 6H), 1.23 (m, 42H), 0.85 (t, 12H). APCI-MS analysis: Calculated C51H95NO11 [M+H] = 898.7, Observed = 898.0. Example 86: Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-((tert- butyldiphenylsilyl)oxy)succinate (57) A mixture of 6,6'-((2-((tert-butyldiphenylsilyl)oxy)succinyl)bis(oxy))dihexanoic acid 20 (400 mg, 0.67 mmol), (Z)-non-2-en-1-ol (238 mg, 1.67 mmol), EDCI-HCl (321 mg, 1.67 mmol) and DMAP (204 mg, 1.67 mmol) in 10 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in dichloromethane to give the desired product (500 mg, 88%). Step 2: Synthesis of Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-hydroxysuccinate (58) To a solution of bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-((tert- butyldiphenylsilyl)oxy)succinate 57 (500 mg, 0.49 mmol) in 10 mL THF, was added pyridine (2 mL) followed by HF-pyridine complex (70%, 1.5 mL), and the mixture was stirred at room temperature overnight. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 0-40% ethyl acetate in hexane to yield the desired product (300 mg, 82%). Step 3: Synthesis of Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 86) To a solution of 2-(dimethylamino)ethan-1-ol (445 mg, 5 mmol) in a mixture of 3 mL pyridine and 10 mL dichloromethane, was added 4-nitrophenylchloroformate (1.0 g, 5 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2- hydroxysuccinate 58 (500 mg, 0.66 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4- nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes to give desired product (165 mg, 46%).1H NMR (300 MHz, CDCl3) δ 5.68-5.46 (m, 4H), 5.36 (t, 1H), 4.61 (d, 4H), 4.25 (t, 2H), 4.16 (t, 2H), 4.10 (t, 2H), 2.88 (d, 2H), 2.63-2.57 (m, 2H), 2.34-2.27 (m, 10H), 2.09 (m, 4H), 1.75-1.59 (m, 8H), 1.42-1.25 (m, 20H), 0.87 (t, 6H). APCI-MS analysis: Calculated C39H67NO11 [M+H] = 726.4, Observed = 725.9. Example 87: Bis(7-((2-hexyldecanoyl)oxy)heptyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of Bis(7-((2-hexyldecanoyl)oxy)heptyl) 2-hydroxysuccinate (59) A mixture of dimethyl malate (870 mg, 6 mmol), 7-hydroxyheptyl 2-hexyldecanoate 33 (4.4 g, 12 mmol) and p-toluenesulfonic acid monohydrate (300 mg) in 200 mL toluene was refluxed vigorously with Dean-stark apparatus overnight. After cooled to room temperature, the mixture was diluted with saturated sodium bicarbonate, and the resulting mixture was extracted with ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give oil which was purified by column chromatography using 0-20% ethyl acetate in hexane to give the desired product as colorless oil (3.0 g, 60%). Step 2: Synthesis of Bis(7-((2-hexyldecanoyl)oxy)heptyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 87) To a solution of 2-(dimethylamino)ethan-1-ol (445 mg, 5 mmol) in a mixture of 3 mL pyridine and 10 mL dichloromethane, was added 4-nitrophenylchloroformate (1.0 g, 5 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(7-((2-hexyldecanoyl)oxy)heptyl) 2-hydroxysuccinate 59 (500 mg, 0.66 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (1 mL) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes to give desired product (310 mg, 54%).1H NMR (300 MHz, CDCl3) δ 5.36 (t, 1H), 4.24 (t, 2H), 4.15 (t, 2H), 4.08 (t, 2H), 4.04 (t, 4H), 2.88 (d, 2H), 2.60 (m, 2H), 2.32-2.22 (m, 8H), 1.63-1.46 (m, 12H), 1.46-1.23 (m, 56H), 0.85 (t, 12H). APCI-MS analysis: Calculated C55H103NO11 [M+H] = 954.7, Observed = 954.0. Example 88: Bis(5-(decanoyloxy)pentyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate Step 1: Synthesis of 5-Hydroxypentyl decanoate (60) A mixture of 1,5-pentanediol (10 g, 0.10 mole), decanoic acid (5.67 g, 33 mmol), EDCI-HCl (8.85 g, 46.2 mmol) and DMAP (805 mg, 6.6 mmol) in 100 mL dichloromethane was stirred at room temperature for 17 h. The dichloromethane was removed, the residue was diluted with 200 mL ethyl acetate, and the solution was washed with aqueous saturated ammonium chloride. After dried over sodium sulfate and concentrated, the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to yield the desired product as colorless oil (13.9 g, 88%). Step 2: Synthesis of Bis(5-(decanoyloxy)pentyl) 2-hydroxysuccinate (61) A mixture of dimethyl malate (1.22 g, 7.5 mmol), 5-hydroxypentyl decanoate 60(4.0 g, 15 mmol) and p-toluenesulfonic acid monohydrate (250 mg) in 150 mL toluene was heated to reflux vigorously with Dean-stark apparatus overnight. The reaction mixture was cooled to room temperature and washed with saturated sodium bicarbonate solution, and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over sodium sulfate and concentrated to give the crude which was purified by column chromatography eluted with 0-10% ethyl acetate in dichloromethane to give the desired product as colorless oil (350 mg, 8%). Step 3: Synthesis of Bis(5-(decanoyloxy)pentyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)succinate (Example 88) To a solution of 2-(dimethylamino)ethan-1-ol (445 mg, 5 mmol) in a mixture of 3 mL pyridine and 10 mL dichloromethane, was added 4-nitrophenylchloroformate (1.0 g, 5 mmol), and the reaction mixture was stirred at room temperature for 3 h. TLC showed complete reaction. A solution of bis(5-(decanoyloxy)pentyl) 2-hydroxysuccinate 61 (500 mg, 0.66 mmol) in 3 mL dichloromethane was added, then diisopropylethylamine (0.52 mL) was added, and the resulting mixture was stirred at room temperature for two days. After concentration, the residue was dissolved in hexanes, and the solution was washed by acetonitrile several times until the acetonitrile layer contains no 4-nitrophenol. The hexane layer was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexanes to give desired product (180 mg, 46%).1H NMR (300 MHz, CDCl3) δ 5.37 (t, 1H), 4.25 (t, 2H), 4.18 (t, 2H), 4.11 (t, 2H), 4.05 (td, 4H), 2.89 (d, 2H), 2.60 (m, 2H), 2.31-2.26 (m, 10H), 1.71-1.58 (m, 12H), 1.45-1.35 (m, 4H), 1.30 (m, 24H), 0.87 (t, 6H). APCI-MS analysis: Calculated C39H71NO11 [M+H] = 730.5, Observed = 730.5 Example 89: Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-((3- (dimethylamino)propyl)disulfaneyl)succinate Step 1: Synthesis of Bis(5-hydroxypentyl) 2-mercaptosuccinate (62) To a mixture of 2-mercaptosuccinic acid (1.10 g, 7.3 mmol) in 5 mL 1,5-pentanediol, was added 100 mg zinc chloride, and then the mixture was heated to 150°C for 5 h. After cooled to room temperature, 100 mL dichloromethane was added to dissolve the mixture. The solution was washed with water and brine. After dried over sodium sulfate, the solvent was removed under vacuum to give crude product (2.1 g), which was used for the next step without purification. Step 2: Synthesis of Bis(5-hydroxypentyl) 2-(pyridin-2-yldisulfaneyl)succinate (63) A solution of bis(5-hydroxypentyl) 2-mercaptosuccinate 62 (2.1 g, 6.52 mmol) and dipyridyl disulfide (2.86 g, 13 mmol) in 50 mL dichloromethane was purged with nitrogen three times, and then the mixture was stirred at room temperature overnight. After concentration, the crude was purified by column chromatography eluted with 0-80% ethyl acetate in hexanes to give the desired product (2.15 g, 77%). Step 3: Synthesis of Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-(pyridin-2-yldisulfaneyl)succinate (64) A solution of 2-hexyldecanoic acid (1.54 g, 6 mmol) in 20 mL dichloromethane was cooled to 0°C, then oxalyl chloride (1.1 mL, 12 mmol) and 5 drops of DMF were added, and the mixture was stirred at room temperature for 2 h. After concentration, the crude was dissolved in 20 mL dichloromethane and 3 mL pyridine, then bis(5-hydroxypentyl) 2- (pyridin-2-yldisulfaneyl)succinate 63 (900 mg, 2.1 mmol) was added dropwise at 0°C. The reaction mixture was stirred at room temperature overnight. TLC showed complete reaction. The mixture was partitioned between dichloromethane and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0- 100% ethyl acetate in hexanes to give the desired product (817 mg, 45%). Step 4: Synthesis of Bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-((3- (dimethylamino)propyl)disulfaneyl)succinate (Example 89) A solution of bis(5-((2-hexyldecanoyl)oxy)pentyl) 2-(pyridin-2- yldisulfaneyl)succinate 64 (350 mg, 0.38 mmol) and 3-(dimethylamino)propane-1-thiol hydrochloride (156 mg, 1 mmol) in a mixture of 2 mL methanol and 10 mL dichloromethane was purged with nitrogen three times, and then stirred at room temperature for 5 h. MS showed complete reaction. After concentration, the residue was dissolved in dichloromethane, and the solution was washed by saturated sodium bicarbonate solution. The combined organic layer was dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography using 0-100% ethyl acetate in dichloromethane to give desired product as pale yellow oil (200 mg, 57%).1H NMR (300 MHz, CDCl3) δ 4.16-4.04 (m, 8H), 3.78-3.75 (m, 1H), 3.11 (dd, 1H), 2.83- 2.71 (m, 3H), 2.34-2.27 (m, 4H), 2.21 (s, 6H), 1.80 (m, 2H), 1.72-1.51 (m, 12H), 1.48-1.34 (m, 8H), 1.24 (m, 40H), 0.91-0.81 (m, 12H). APCI-MS analysis: Calculated C51H97NO8S2 [M+H] = 916.6, Observed = 916.6. Example 90: Bis(6-(nonyloxy)-6-oxohexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate Step 1: Synthesis of 6-(Benzyloxy)hexanoic acid (65) To a solution of 6-(benzyloxy)hexan-1-ol (9.7 g, 46.5 mmol) in 60 mL acetone, was added Jones reagent until the orange color persisted, and the resulting mixture was stirred for 90 min. The excess Jones reagent was consumed by adding few drops of 2-propanol, then the blue solution was diluted with water (100 mL) and extracted with ethyl acetate (3 x 100 mL). The combined organic layers were washed with brine, dried and concentrated to give the desired product (9.0 g), which was used for the next step without further purification. Step 2: Synthesis of Nonyl 6-(benzyloxy)hexanoate (66) A mixture of 6-(benzyloxy)hexanoic acid 65 (9.0 g, 40.5 mmol), nonan-1-ol (7.3 g, 42 mmol), EDCI-HCl (9.6 g, 50 mmol) and DMAP (1.22 g, 10 mmol) in 200 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (11.2 g, 79%). Step 3: Synthesis of Nonyl 6-hydroxyhexanoate (67) A mixture of nonyl 6-(benzyloxy)hexanoate 66 (11.2 g, 32.2 mmol) and 5% palladium on carbon (1 g) in 100 mL ethyl acetate was subjected to hydrogenolysis for 15 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to afford the desired product (8.1 g, 97%). Step 4: Synthesis of Bis(6-(nonyloxy)-6-oxohexyl) 2-oxopentanedioate (68) A mixture of α-ketoglutaric acid (514 mg, 3.5 mmol), nonyl 6-hydroxyhexanoate 67 (2.0 g, 7.74 mmol) and p-toluenesulfonic acid monohydrate (100 mg) in 80 mL toluene was heated to reflux for 30 min. The reaction mixture was concentrated under vacuum, and the crude was purified by column chromatography with 0-20% ethyl acetate in hexanes to give the desired product (400 mg, 18%) Step 5: Synthesis of Bis(6-(nonyloxy)-6-oxohexyl) 2-hydroxypentanedioate (69) To a solution of bis(6-(nonyloxy)-6-oxohexyl) 2-oxopentanedioate 68 (600 mg, 0.95 mmol) in 20 mL THF, was added sodium borohydride (53 mg, 1.4 mmol), and the reaction mixture was stirred at room temperature for 2 h. After cooled to 0°C, saturated ammonium chloride solution was added slowly, and the resulting mixture was extracted with ethyl acetate. The combined organic layer was washed with brine and dried over sodium sulfate. After concentration, the crude (600 mg) was used for the next step without purification. Step 6: Synthesis of Bis(6-(nonyloxy)-6-oxohexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate (Example 90) To a solution of bis(6-(nonyloxy)-6-oxohexyl) 2-hydroxypentanedioate 69 (600 mg, 0.95 mmol) in 3 mL pyridine and 10 mL dichloromethane, was added p-nitrophenyl chloroformate (382 mg, 1.9 mmol), and the resulting mixture was stirred for 2 h. After TLC showed the complete reaction, 2-dimethylaminoethanol (253 mg, 2.85 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was washed by saturated sodium bicarbonate solution, and the combined organic layer was dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography eluted with 0-10% methanol in dichloromethane to afford the desired product as clear oil (250 mg, 35%).1H NMR (300 MHz, CDCl3) δ 4.89-5.02 (1H), 4.28-4.21 (m, 2H), 4.16 (t, 2H), 4.09-4.03 (m, 6H), 2.66-2.54 (m, 2H), 2.42-2.52 (m, 2H), 2.33-2.23 (m, 12H), 1.74-1.52 (m, 12H), 1.42- 1.26 (m, 28H), 0.89-0.85 (m, 6H). APCI-MS analysis: Calculated C40H73NO11 [M+H] = 744.5, Observed = 744.5. Example 91: Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate Step 1: Synthesis of 6-((tert-Butyldiphenylsilyl)oxy)hexan-1-ol (70) A mixture of hexane-1,6-diol (8.8 g, 75 mmol), tert-butyldiphenylsilyl chloride (22.7 g, 82.5 mmol) and imidazole (6.1 g, 90 mmol) in 20 mL DMF and 50 mL dichloromethane was stirred at room temperature for 17 h. The reaction mixture was partitioned with ethyl acetate and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography using 0-25% ethyl acetate in hexane to give the desired product (13 g, 48%). Step 2: Synthesis of 6-((tert-Butyldiphenylsilyl)oxy)hexanoic acid (71) To a solution of 6-((tert-butyldiphenylsilyl)oxy)hexan-1-ol 70 (9.5 g, 26.6 mmol) in 150 mL acetone, was added Jones reagent until the orange color persisted, and the resulting mixture was stirred for 30 min. The excess Jones reagent was consumed by adding few drops of 2-propanol, then the blue solution was diluted with water (100 mL) and extracted with ethyl acetate (3 x 100 mL). The combined organic layers were washed with brine, dried and concentrated to give the desired product (8.9 g, 90%), which was used for the next step without further purification. Step 3: Synthesis of (Z)-Non-2-en-1-yl 6-((tert-butyldiphenylsilyl)oxy)hexanoate (72) A mixture of 6-((tert-butyldiphenylsilyl)oxy)hexanoic acid 71 (8.9 g, 24 mmol), (Z)- non-2-en-1-ol (3.0 g, 21.6 mmol), EDCI-HCl (8.3 g, 43.2 mmol) and DMAP (658 mg, 5.4 mmol) in 150 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was triturated with hexanes three times, and the solvent was removed under vacuum, then the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (10.2 g, 99%). Step 4: Synthesis of (Z)-Non-2-en-1-yl 6-hydroxyhexanoate (73) To a solution of (Z)-non-2-en-1-yl 6-((tert-butyldiphenylsilyl)oxy)hexanoate 72 (10.1 g, 20.4 mmol) in 80 mL THF, was added pyridine (8 mL) followed by HF-pyridine complex (70%, 5 mL), and the mixture was stirred at room temperature for 20 h. The reaction was quenched by adding saturated sodium bicarbonate to pH 7, and then extracted with ethyl acetate (3 x 60 mL). The combined organic layers were dried and concentrated, and the crude was purified by column chromatography using 0-30% ethyl acetate in hexane to yield the desired product (4.7 g, 90%). Step 5: Synthesis of Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-oxopentanedioate (74) A mixture of α-ketoglutaric acid (700 mg, 4.8 mmol), (Z)-non-2-en-1-yl 6-hydroxyhexanoate 73 (2.7 g, 10.5 mmol) and p-toluenesulfonic acid monohydrate (100 mg) in 80 mL toluene was heated to reflux for 2 h. The reaction mixture was concentrated under vacuum, and the crude was purified by column chromatography with 0-20% ethyl acetate in hexanes to give the desired product (300 mg, 10%) Step 6: Synthesis of Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-hydroxypentanedioate (75) To a solution of bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-oxopentanedioate 74 (500 mg, 0.8 mmol) in 20 mL THF, was added sodium borohydride (46 mg, 1.2 mmol), and the reaction mixture was stirred at room temperature for 2 h. After cooled to 0°C, saturated ammonium chloride solution was added slowly, and the resulting mixture was extracted with ethyl acetate. The combined organic layer was washed with brine and dried over sodium sulfate. After concentration, the crude (500 mg) was used for the next step without purification. Step 7: Synthesis of Bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate (Example 91) To a solution of bis(6-(((Z)-non-2-en-1-yl)oxy)-6-oxohexyl) 2-hydroxypentanedioate 75 (500 mg, 0.8 mmol) in 3 mL pyridine and 10 mL dichloromethane, was added p- nitrophenyl chloroformate (322 mg, 1.6 mmol), and the resulting mixture was stirred for 2 h. After TLC showed the complete reaction, 2-dimethylaminoethanol (213 mg, 2.4 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was washed by saturated sodium bicarbonate solution, and the combined organic layer was dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography eluted with 0- 10% methanol in dichloromethane to afford the desired product as clear oil (200 mg, 33%).1H NMR (300 MHz, CDCl3) δ 5.68-5.49 (m, 4H), 4.96-4.92 (m, 1H), 4.61 (d, 4H), 4.27-4.21 (m, 2H), 4.19-4.12 (m, 2H), 4.09-4.03 (m, 2H), 2.63-2.55 (m, 2H), 2.49-2.42 (m, 2H), 2.34- 2.16 (m, 12H), 2.17-2.05 (m, 4H), 1.70-1.59 (m, 8H), 1.42-1.25 (m, 20H), 0.87 (t, 6H). APCI-MS analysis: Calculated C40H69NO11 [M+H] = 740.5, Observed = 740.4. Example 92: Bis(6-(decanoyloxy)hexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate Step 1: Synthesis of Bis(6-(decanoyloxy)hexyl) 2-oxopentanedioate (76) A mixture of α-ketoglutaric acid (536 mg, 3.7 mmol), 6-hydroxyhexyl decanoate (2.0 g, 7.3 mmol) and p-toluenesulfonic acid monohydrate (10 mg) in 80 mL toluene was heated to reflux for 2 h. The reaction mixture was concentrated under vacuum, and the crude was purified by column chromatography with 0-20% ethyl acetate in hexanes to give the desired product (1.3 g, 53%) Step 2: Synthesis of Bis(6-(decanoyloxy)hexyl) 2-hydroxypentanedioate (77) To a solution of bis(6-(decanoyloxy)hexyl) 2-oxopentanedioate 76 (1.3 g, 2 mmol) in 20 mL THF, was added sodium borohydride (115 mg, 3 mmol), and the reaction mixture was stirred at room temperature for 1 h. TLC showed complete reaction. After diluted with 100 mL dichloromethane, the solution was washed by water and brine. The combined organic layer was dried over sodium sulfate. After concentration, the crude was purified by column chromatography with 0-10% methanol in dichloromethane to afford the desired product as clear oil (800 mg, 60%). Step 3: Synthesis of Bis(6-(decanoyloxy)hexyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate (Example 92) To a solution of bis(6-(decanoyloxy)hexyl) 2-hydroxypentanedioate 77 (400 mg, 0.61 mmol) in 2 mL pyridine and 10 mL dichloromethane, was added p-nitrophenyl chloroformate (367 mg, 1.83 mmol), and the resulting mixture was stirred for 3 h. After TLC showed the complete reaction, 2-dimethylaminoethanol (213 mg, 2.44 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was washed by saturated sodium bicarbonate solution, and the combined organic layer was dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography eluted with 0-10% methanol in dichloromethane to afford the desired product as clear oil (130 mg, 27%).1H NMR (300 MHz, CDCl3) δ 4.95 (dd, 1H), 4.27-4.21 (m, 2H), 4.19-4.12 (m, 2H), 4.10- 4.02 (m, 6H), 2.65-2.57 (m, 2H), 2.50-2.44 (m, 2H), 2.31-2.12 (m, 12H), 1.72-1.54 (m, 12H), 1.43-1.25 (m, 32H), 0.87 (t, 6H). APCI-MS analysis: Calculated C42H77NO11 [M+H] = 772.5, Observed = 772.5. Example 93: Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)-pentanedioate Step 1: Synthesis of 8-(Benzyloxy)octanoic acid (78) To a solution of 8-(benzyloxy)octan-1-ol (4.8 g, 20.3 mmol) in 60 mL acetone, was added Jones reagent until the orange color persisted, and the resulting mixture was stirred for 90 min. The excess Jones reagent was consumed by adding few drops of 2-propanol, then the blue solution was diluted with water (100 mL) and extracted with ethyl acetate (3 x 100 mL). The combined organic layers were washed with brine, dried and concentrated to give the desired product (4.8 g, quant.), which was used for the next step without further purification. Step 2: Synthesis of 2-Propyloctyl 8-(benzyloxy)octanoate (79) A mixture of 8-(benzyloxy)octanoic acid 78 (3.2 g, 12.8 mmol), 2-propylnonan-1-ol 52 (3.0 g, 16.1 mmol), EDCI-HCl (4.9 g, 25.6 mmol) and DMAP (1.56 g, 12.8 mmol) in 20 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (4.3 g, 80%). Step 3: Synthesis of 2-Propyloctyl 8-hydroxyoctanoate (80) A mixture of 2-propyloctyl 8-(benzyloxy)octanoate 79 (4.3 g, 10.3 mmol) and 20% palladium hydroxide on carbon (0.2 g) in 60 mL ethyl acetate was subjected to hydrogenolysis for 15 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to afford the desired product (3.6 g, quant.). Step 4: Synthesis of Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-oxopentanedioate (81) A mixture of α-ketoglutaric acid (398 mg, 2.7 mmol), 2-propyloctyl 8- hydroxyoctanoate 80 (2.0 g, 6 mmol) and p-toluenesulfonic acid monohydrate (100 mg) in 80 mL toluene was heated to reflux for 30 min. The reaction mixture was concentrated under vacuum, and the crude was purified by column chromatography with 0-20% ethyl acetate in hexanes to give the desired product (800 mg, 38%) Step 5: Synthesis of Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-hydroxypentanedioate (82) To a solution of bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-oxopentanedioate 81 (800 mg, 1.04 mmol) in 20 mL THF, was added sodium borohydride (63.5 mg, 1.67 mmol), and the reaction mixture was stirred at room temperature for 2 h. After cooled to 0°C, saturated ammonium chloride solution was added slowly, and the resulting mixture was extracted with ethyl acetate. The combined organic layer was washed with brine and dried over sodium sulfate. After concentration, the crude (700 mg) was used for the next step without purification. Step 6: Synthesis of Bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)-pentanedioate (Example 93) To a solution of bis(8-oxo-8-((2-propylnonyl)oxy)octyl) 2-hydroxypentanedioate 82 (700 mg, 0.91 mmol) in 3 mL pyridine and 10 mL dichloromethane, was added p-nitrophenyl chloroformate (366 mg, 1.82 mmol), and the resulting mixture was stirred for 2 h. After TLC showed the complete reaction, 2-dimethylaminoethanol (243 mg, 2.73 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was washed by saturated sodium bicarbonate solution, and the combined organic layer was dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography eluted with 0-10% methanol in dichloromethane to afford the desired product as clear oil (325 mg, 40%).1H NMR (300 MHz, CDCl3) δ 4.94 (dd, 1H), 4.27-4.19 (m, 2H), 4.17-4.11 (m, 2H), 4.08- 4.03 (m, 2H), 3.96 (d, 4H), 2.66-2.53 (m, 2H), 2.49-2.43 (m, 2H), 2.33-2.14 (m, 10H), 1.62 (m, 8H), 1.43-1.25 (m, 48H), 0.91-0.85 (m, 12H). APCI-MS analysis: Calculated C50H93NO11 [M+H] = 884.6, Observed = 884.7. Example 94: Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate Step 1: Synthesis of Pentadecan-7-yl 8-(benzyloxy)octanoate (83) A mixture of 8-(benzyloxy)octanoic acid 78 (1.6 g, 6.4 mmol), pentadecan-7-ol 16 (1.8 g, 8 mmol), EDCI-HCl (1.9 g, 10 mmol) and DMAP (1.2 g, 14 mmol) in 20 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (2.3 g, 78%). Step 2: Synthesis of Pentadecan-7-yl 8-hydroxyoctanoate (84) A mixture of pentadecan-7-yl 8-(benzyloxy)octanoate 83 (2.3 g, 5 mmol) and 5% palladium on carbon (0.6 g) in 50 mL ethyl acetate was subjected to hydrogenolysis for 15 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to afford the desired product (1.9 g, quant.). Step 3: Synthesis of bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-oxopentanedioate (85) A mixture of α-ketoglutaric acid (350 mg, 2.4 mmol), pentadecan-7-yl 8- hydroxyoctanoate 84 (1.9 g, 5.1 mmol) and p-toluenesulfonic acid monohydrate (100 mg) in 80 mL toluene was heated to reflux for 30 min. The reaction mixture was concentrated under vacuum, and the crude was purified by column chromatography with 0-20% ethyl acetate in hexanes to give the desired product (1.2 g, 38%) Step 4: Synthesis of Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-hydroxypentanedioate (86) To a solution of bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-oxopentanedioate 85 (1.2 g, 1.4 mmol) in 40 mL THF, was added sodium borohydride (80 mg, 2.1 mmol), and the reaction mixture was stirred at room temperature for 2 h. After cooled to 0°C, saturated ammonium chloride solution was added slowly, and the resulting mixture was extracted with ethyl acetate. The combined organic layer was washed with brine and dried over sodium sulfate. After concentration, the crude (800 mg) was used for the next step without purification. Step 5: Synthesis of Bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-(((2- (dimethylamino)ethoxy)carbonyl)oxy)pentanedioate (Example 94) To a solution of bis(8-oxo-8-(pentadecan-7-yloxy)octyl) 2-hydroxypentanedioate 86 (800 mg, 0.9 mmol) in 3 mL pyridine and 10 mL dichloromethane, was added p-nitrophenyl chloroformate (377 mg, 1.87 mmol), and the resulting mixture was stirred for 2 h. After TLC showed the complete reaction, 2-dimethylaminoethanol (240 mg, 2.7 mmol) was added, and the reaction mixture was stirred at room temperature overnight. MS showed the formation of desired product. The reaction mixture was washed by saturated sodium bicarbonate solution, and the combined organic layer was dried over sodium sulfate. After filtration and concentration, the crude was purified by column chromatography eluted with 0-10% methanol in dichloromethane to afford the desired product as clear oil (275 mg, 31%).1H NMR (300 MHz, CDCl3) δ 4.94 (dd, 1H), 4.86 (quint, 2H), 4.24 (m, 2H), 4.14 (t, 2H), 4.05 (t, 2H), 2.64-2.58 (m, 2H), 2.49-2.43 (m, 2H), 2.30-2.11 (m, 12H), 1.63-1.49 (m, 12H), 1.39-1.17 (m, 56H), 0.89-0.81 (m, 12H). APCI-MS analysis: Calculated C56H105NO11 [M+H] = 968.7, Observed = 968.7. Example 95: Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-((3- (dimethylamino)propanoyl)oxy)pentanedioate Step 1: Synthesis of Pentadecan-7-yl 6-(benzyloxy)hexanoate (87) A mixture of 6-(benzyloxy)hexanoic acid 65 (8.4 g, 37.8 mmol), pentadecan-7-ol 16 (12.9 g, 56.7 mmol), EDCI-HCl (10.88 g, 56.7 mmol) and DMAP (1.22 g, 10 mmol) in 200 mL dichloromethane was stirred at room temperature for 16 h. After concentration, the crude was partitioned between EtOAc and saturated ammonium chloride solution, and the combined organic layer was dried over sodium sulfate. The solvent was removed under vacuum, and the crude was purified by column chromatography using 0-10% ethyl acetate in hexane to give the desired product (12.5 g, 76%). Step 2: Synthesis of Pentadecan-7-yl 6-hydroxyhexanoate (88) A mixture of pentadecan-7-yl 6-(benzyloxy)hexanoate 87 (12.5 g, 36.5 mmol) and 5% palladium on carbon (1.2 g) in 100 mL ethyl acetate was subjected to hydrogenolysis for 15 h. After filtration, the filtrate was concentrated, and the crude was purified by column chromatography using 0-100% ethyl acetate in hexane to afford the desired product (10.3 g, quant.). Step 3: Synthesis of Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-oxopentanedioate (89) A mixture of α-ketoglutaric acid (1.74 g, 11.9 mmol), pentadecan-7-yl 6- hydroxyhexanoate 88 (10.3 g, 29.8 mmol) and p-toluenesulfonic acid monohydrate (500 mg) in 150 mL toluene was heated to reflux overnight. The reaction mixture was concentrated under vacuum, and the crude was purified by column chromatography with 0-20% ethyl acetate in hexanes to give the desired product (2.3 g, 24%) Step 4: Synthesis of Bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-hydroxypentanedioate (90) To a solution of bis(6-oxo-6-(pentadecan-7-yloxy)hexyl) 2-oxopentanedioate 89 (250 mg, 0.31 mmol) in 40 mL THF, was added sodium borohydride (18 mg, 0.47 mmol), and the reaction mixture was stirred at room temperature for 2 h. After cooled to 0°C, saturated ammonium chloride solution was added slowly, and the resulting mixture was extracted with ethyl acetate. The comb...
Claims
CLAIMS 1. A lipid of Formula (I):or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl, , , and , wherein the -C(6-24)alkyl, - C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3isX1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-; X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of:wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4.
2. A lipid of Formula (I):or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, - C(6-24)alkynyl and wherein the -C(6-24)alkyl, -C(6-24)alkenyl, and -C(6-24)alkynyl are each optionally substituted with one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; one of R1, R2, and R3isX1independently for each occurrence is -C(3-12)alkyl, -C(3-12)alkenyl, or -C(3-12)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, -C(O)NH-, -C(O)N(X3)-, -NHC(O)-, -N(X3)C(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, or - NHC(O)NH-;X3independently for each occurrence is -C(5-24)alkyl, -C(5-24)alkenyl, or -C(5-24)alkynyl, each of which is optionally substituted by one to six groups independently selected from halo, -OC(1-6)alkyl, -OC(2-6)alkenyl, -SC(1-6)alkyl, -SC(2-6)alkenyl, and -C(O)OC(1-6)alkyl; X4is -C(1-8)alkyl; X5is -C(1-8)alkyl; X6is -C(O)O-, -OC(O)-, -C(O)NH-, -NHC(O)-, -C(O)S-, -SC(O)-, -OC(O)O-, - OC(O)NH-, -NHC(O)O-, or -NHC(O)NH-; X7is -C(1-8)alkyl; A is an ionizable or cationic nitrogen-containing group; X is selected from the group consisting of:wherein * indicates the point of attachment to R3; RXindependently for each occurrence is -H or -C(1-3)alkyl; and n is 1, 2, 3, or 4.
3. The lipid of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein: two of R1, R2, and R3are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, andX1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, or -OC(O)O-; and X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl.
4. The lipid of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein two of R1, R2, and R3are independently selected from the group consisting of:
5. The lipid of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein two of R1, R2, and R3are independently selected from the group consisting of:
6. The lipid of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein: R1and R2are independently selected from -C(6-24)alkyl, -C(6-24)alkenyl, or; R3isX1independently for each occurrence is -C(3-12)alkyl or -C(3-12)alkenyl; X2independently for each occurrence is -C(O)O-, -OC(O)-, or -OC(O)O-; X3independently for each occurrence is -C(5-24)alkyl or -C(5-24)alkenyl. X4is -C(1-6)alkyl; X5is -C(1-6)alkyl; X6is -C(O)O-, -OC(O)-, or -OC(O)O-; X7is -C(1-6)alkyl; and A is an ionizable or cationic nitrogen-containing group.
7. The lipid of any one of claims 1-6, or a pharmaceutically acceptable salt thereof, wherein A is ; and RA1and RA2are each independently -C(1-6)alkyl that is optionally substituted with - OH; or RA1and RA2are taken together to form a 3- to 6-membered heterocyclyl that is optionally substituted with one to three -C(1-3)alkyl groups.
8. The lipid of any one of claims 1-7, or a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of:
9. The lipid of any one of claims 1-8, or a pharmaceutically acceptable salt thereof, wherein is selected from the group consisting of:
10. The lipid of any one of claims 1-9, having a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof.
11. The lipid of any one of claims 1-9, having a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof.
12. The lipid of any one of claims 1-9, having a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof.
13. The lipid of any one of claims 1-12, or a pharmaceutically acceptable salt thereof, wherein n is 1 or 2.
14. A lipid having a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof.
15. A lipid having a structure selected from the group consisting of:or a pharmaceutically acceptable salt thereof.
16. A composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises: (I) the lipid of any one of claims 1-15; (II) a stealth lipid; (III) a structural lipid; and (IV) a helper lipid.
17. The composition of claim 16, wherein: the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid, a polyoxazoline polymer-conjugated lipid, or a polysarcosine-conjugated (pSar) lipid, optionally wherein the stealth lipid is a PEGylated lipid selected from 1,2-dimyristoyl-rac- glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-polyethylene glycol (DSPE-PEG), 1,2-dilauroyl-sn-glycero-3- phosphoethanolamine-polyethylene glycol (DLPE-PEG), and 1,2-distearoyl-rac-glycero- polyethelene glycol (DSG-PEG); the structural lipid is a sterol, optionally wherein the sterol is cholesterol; and the helper lipid is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE); 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC); 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE); and 1,2-dioleoyl-sn- glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), or 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE).
18. The composition of claim 16 or claim 17, further comprising a nucleic acid molecule, wherein the nucleic acid molecule is encapsulated in the LNP, and wherein the nucleic acid molecule is an mRNA molecule.
19. The composition of claim 18, wherein the mRNA molecule encodes an antigen, optionally a viral antigen or a bacterial antigen.
20. The composition of claim 18 or claim 19 for use in eliciting an immune response in a subject in need thereof.
21. The composition of claim 18 or claim 19 for use in preventing an infection or reducing one or more symptoms of an infection in a subject in need thereof.
Citation Information
Patent Citations
L-malic acid dimer impurity and preparation method thereof
CN111039919A
Delivery of mRNA for the augmentation of proteins and enzymes in human genetic diseases
US20110244026A1
Lipid nanoparticle compositions and methods for mRNA delivery
US20140206753A1
Pulmonary delivery of mRNA to non-lung target cells
US20150157565A1
Quantitative assessment for cap efficiency of messenger RNA
US20160032356A1
Cited By
Ionizable lipid compound as well as preparation method and application thereof
CN121449524A
Novel lipid compounds and methods of their use
WO2026136246A1