Transgenic plant having improved photosynthesis efficiency and method for producing same

By introducing the carbonic anhydrase β2 gene from Bienertia sinuspersici into other plants, the transgenic plants achieve improved photosynthetic efficiency, leading to enhanced growth and productivity.

WO2025135436A1PCT designated stage expired Publication Date: 2025-06-26REPUBLIC OF KOREA (MANAGEMENT RURAL DEV ADMINISTRATION) +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/015861
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-16
Filing Date
2024-10-18
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current plants have limitations in photosynthetic efficiency, particularly in low CO2 environments, which affects their growth and productivity.

Method used

Introduction of the carbonic anhydrase β2 gene (BsCAβ2) from Bienertia sinuspersici into other plants using a recombinant vector, leading to overexpression of this gene in transgenic plants.

Benefits of technology

The transgenic plants exhibit enhanced photosynthetic efficiency, rapid growth, increased leaf size and number, and earlier flowering, thereby improving crop yields and resilience.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024015861_26062025_PF_FP_ABST
    Figure KR2024015861_26062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to: a transgenic plant having improved photosynthesis efficiency due to the introduction of a carbonic anhydrase β2 gene isolated from Bienertia sinuspersici; and a method for producing same. A plant that overexpresses the carbonic anhydrase β2 gene can be produced by using a recombinant vector comprising a gene encoding the carbonic anhydrase β2 protein derived from Bienertia sinuspersici. The plant thus produced exhibits a rapid increase during growth and development compared to an existing plant, and thus has characteristics such as increased leaf size, an increased number of leaves, and an earlier flowering period.
Need to check novelty before this filing date? Find Prior Art

Description

Transgenic plant with enhanced photosynthetic efficiency and method for producing the same

[0001] The present invention relates to a transgenic plant with enhanced photosynthetic efficiency by introducing a carbonicanhydrase β2 gene isolated from Bienertiasinuspersici, and a method for producing the same.

[0002] Bienertia is a unique photosynthetic plant native to the Gulf Coast. Its chromosome consists of nine pairs (Gene & Genomics, 2020, Figure 1) and its genome size is estimated to be 3.8 Gb. Young leaves (1–2 mm) contain C3 chloroplasts. Intermediated leaves (1–5 mm) begin to develop peripheral C4 chloroplasts in addition to the central C3 chloroplasts. In mature leaves, C3 chloroplasts are positioned centrally, while C4 chloroplasts are positioned peripherally (Figure 2). Due to these characteristics, Bienertia is classified as a single-cell C4 (SCC4) plant. These plants have the characteristic of localizing Rubisco, which allows for both photosynthesis and photorespiration, only in the center of the cells, thereby suppressing photorespiration and enhancing photosynthetic efficiency.

[0003] Most plants have C3 chloroplasts, but C4 plants photosynthesize in the mesophyll cells and adjacent bundle-sheath cells, and the first fixed organic matter is the four-carbon sugar malate or oxaloacetate. Representative plants such as corn and sugarcane that grow in hot, dry regions with low CO2 concentrations are C4 plants. Bienertia is a halophyte plant that grows in colonies in the arid region of the Gulf of South Iran and is highly salt-tolerant.

[0004] Carbonic anhydrase (CA) is generally classified into three gene families structurally: αCA, βCA, and γCA (Moroney et al., 2001). Plants have a diverse number of CA genes, and CA is expressed in chloroplasts, mitochondria, cytoplasmic tissues, and various subtissues. Among them, βCA is responsible for HCO3 production in the cytoplasmic mesophyll cells of C4 plants. - It is mainly involved in the production of HCO3 in terms of high-efficiency photosynthesis. - Spatial separation of CO2 production and CO2 assimilation is necessary. Bienia plants possess two β-type CA isoforms, BsCAβ1 and BsCAβ2. Furthermore, these genes exhibit increased expression during leaf development and are located in distinct locations, such as the cytoplasm and the cell membrane.

[0005] Accordingly, it was predicted that the β-type CA gene is involved in improving the photosynthetic efficiency of Bienergia, and this was introduced into other plants to produce transgenic plants with improved photosynthetic efficiency.

[0006] [Prior patent literature]

[0007] [Patent Document]

[0008] 1. Republic of Korea Patent No. 10-2540389 (announced on June 2, 2023)

[0009] 2. Republic of Korea Patent No. 10-1326412 (announced on November 11, 2013)

[0010] The purpose of the present invention is to provide a transgenic plant with enhanced photosynthetic efficiency and a method for producing the same by introducing carbonic anhydrase, which is expected to be involved in enhancing the photosynthetic efficiency of Bienertia, into another plant.

[0011] In addition, another object of the present invention is to provide a method for improving photosynthetic efficiency by introducing carbonic anhydrase derived from Bienertia into other plants.

[0012] To achieve the above purpose, the present invention provides a transgenic plant with enhanced photosynthetic efficiency, transformed with a recombinant vector containing a carbonic anhydrase β2 gene derived from Bienergia of SEQ ID NO: 1.

[0013] In addition, the present invention provides a method for producing a transgenic plant with enhanced photosynthetic efficiency, comprising the steps of transforming a plant cell with a recombinant vector containing a carbonic anhydrase β2 gene derived from Bienergia of SEQ ID NO: 1; and the step of overexpressing the BsCAβ2 gene in the transformed plant cell.

[0014] In addition, the present invention provides a method for improving photosynthetic efficiency of a transformed plant, comprising the steps of transforming a plant cell with a recombinant vector containing a carbonic anhydrase β2 gene derived from Bienergia of SEQ ID NO: 1; and the step of overexpressing the BsCAβ2 gene in the transformed plant cell.

[0015] In addition, the present invention provides a composition for increasing photosynthetic efficiency of a plant, which contains as an active ingredient a recombinant vector including a carbonic anhydrase β2 gene derived from Bienergia of sequence number 1.

[0016] A plant overexpressing the carbonic anhydrase β2 gene can be produced using a recombinant vector containing a gene encoding the carbonic anhydrase β2 protein derived from the Bienentia plant, and the plant produced in this way exhibits rapid growth and development compared to existing plants, resulting in larger leaves, an increased number of leaves, and an earlier flowering time. Therefore, by introducing the gene into forage crops such as soybeans and corn, it can be utilized to prepare for future food shortages.

[0017] Figure 1 shows the results of genome karyotype analysis of Bienertia.

[0018] Figure 2 shows the chloroplast development process according to leaf size of Bienertia.

[0019] Figure 3 is a comparative phylogenetic diagram of carbonic anhydrase genes. A compares the α-type CA protein sequence, and B compares the β-type CA protein sequence.

[0020] Figure 4 shows the pBIBBsCAβ2 binary vector map.

[0021] Figure 5 is a photograph showing the growth phase of T1 seeds of cabbage transformants into which the Bienergia BsCAβ2 gene has been introduced (NC: non-transformed control).

[0022] Figure 6 is a photograph showing the germination rate of four lines of BsCAβ2 gene overexpressing cabbage, lines 2, 4, 6, and 8, compared to the control group (indicated in the order of lines 2, 4, 6, and 8 from the top) (NC: non-transformed control group).

[0023] Figure 7 is a photograph comparing the growth and development of lines 2 and 8 of BsCAβ2 gene overexpressing plants on day 16 in a greenhouse (NC: non-transformed control).

[0024] Figure 8 is a photograph comparing the growth and development of BsCAβ2 gene overexpressing plants on day 24 in a greenhouse (cont: non-transformed control group).

[0025] Figure 9 is a photograph comparing the growth and development of BsCAβ2 gene overexpressing plants (rice) on day 176 in a greenhouse (cont: non-transformed control group).

[0026] Figure 10 is a photograph showing the growth superiority of eight lines of BsCAβ2 gene overexpressing soybeans (lines 6, 8, 9, 11, 12, 15, 18, and 20) compared to the control group (left: Williams soybean, non-transformed control).

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

[0028]

[0029] The present invention relates to a transgenic plant with enhanced photosynthetic efficiency, transformed with a recombinant vector comprising a carbonic anhydrase β2 gene derived from Bienertia (also referred to herein as “BsCAβ2 gene”).

[0030] The BsCAβ2 gene used in the present invention is one of the isoforms of carbonic anhydrase β-type isolated from Bienertiasinuspersici, and the present inventors have revealed that this gene is a growth promoting gene.

[0031] The above-mentioned bienergia-derived carbonic anhydrase β2 gene (BsCAβ2 gene) may preferably be composed of the base sequence of the following sequence number 1, but is not limited thereto:

[0032] Sequence number 1: Bienertiasinuspersici beta-carbonic anhydrase 2 mRNA, complete CDs

[0033] ATTGTTGTGATTGGACACAGCTGCTGTGGAGGAATAAAGGGGCTCATGTCTATCCCTGATGATGGGAGCACCGCTACTGATTTCATAGAAGATTGGGTTAAGATCTGCAATCCTGCAAGGAACAAGGTGAAAGCAGAACTAAAGAGC GCAGATTTCGCAGTCCAAATGCGAGAATTGCGAGAAGGAAGCTGTGAATGTATCACTTGGGAACTTGTTGACATACCCATTTGTAAGAGAAGCAGTGATGAAGAATACTCTGGCTCTAAAAGGTGCCCATTACGATTTTGTCAAGGGAT GTTTTGAGCTGTGGAATCTCGAATTCACTTTTTCACCTTCTATTGGAGCATAAATCCATAAAGAAACATATATTATACATATGACATCAAATCATAATGTATCTTTTTGCAAATTTCTGTCCAGTTTTTTTGAGGTTTCCTTTGCTTT TCTAAGTACTTTGTATAATCTATGCATCAACAATGTCGCTATAATAAGATCATTATCCTTTATTTTTTCTCTCAATTGTGGTCGTAAGCTATGTTCAATTCAGCTAATTTAATTTTATTTGATCTTGTATAACCGGCGGTTGAGTAAAT

[0034] Additionally, homologs of the above base sequence are included within the scope of the present invention. Specifically, the gene may include a base sequence having a sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95% with the base sequence of SEQ ID NO: 1.

[0035] "Homology" refers to the degree of similarity with a wild-type base sequence or amino acid sequence, and includes the base sequence of the present invention and sequences having an identical sequence of at least the above percentage. This comparison of homology can be performed visually or using readily available comparison programs. Commercially available computer programs can calculate the homology between two or more sequences as a percentage (%), and the homology (%) can be calculated for adjacent sequences.

[0036] The term "recombinant" refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell can express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. A recombinant cell can also express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means. In the present invention, the BsCAβ2 gene sequence can be inserted into a recombinant vector.

[0037] "Recombinant expression vector" refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid or vector can be used as long as it can replicate and be stabilized in a host. Important characteristics of the expression vector include an origin of replication, a promoter, a marker gene, and translation control elements.

[0038] An expression vector comprising the BsCAβ2 gene sequence of the present invention and appropriate transcription / translation control signals can be constructed by methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to an appropriate promoter within the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site as a translation initiation site and a transcription terminator.

[0039] The expression vector of the present invention will preferably include one or more selectable markers. These markers are typically nucleic acid sequences with properties that can be selected chemically, and include any gene that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin; antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol; and the aadA gene.

[0040] In the recombinant vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS, histone promoter, or Clp promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental states or cell differentiation. A constitutive promoter may be preferred in the present invention because selection of transformants can be performed by various tissues at various stages. Therefore, a constitutive promoter does not limit the possibility of selection.

[0041] In the recombinant vector of the present invention, conventional terminators can be used, and examples thereof include, but are not limited to, nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, terminator of the Octopine gene of Agrobacterium tumefaciens, and rrnB1 / B2 terminator of Escherichia coli. Regarding the necessity of terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.

[0042] When transforming a eukaryotic cell with the vector of the present invention, yeast (Saccharomycecerevisiae), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN, and MDCK cell lines), and plant cells can be used as host cells. Preferably, the host cell is a plant cell.

[0043] "Transformation" means a genetic change in the characteristics of an organism or cell by DNA, which is a genetic material provided from the outside, and transformation with the recombinant vector of the present invention can be performed by a transformation technique known to those skilled in the art. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion, microinjection, liposome-mediated method, in planta transformation, vacuum infiltration method, floral meristem dipping method, or Agrobacterium sp. mediated method can be used, but is not limited thereto.

[0044] In the present invention, "plant" means a plant or a plant cell. The plant includes a whole plant, a part of a plant, callus, plant tissue, plant cell, and plant seed. The plant includes all dicotyledonous plants such as Arabidopsis thaliana, eggplant, tobacco, pepper, tomato, burdock, crown daisy, lettuce, bellflower root, spinach, thailand cabbage, sweet potato, celery, carrot, water parsley, parsley, cabbage, cabbage, rapeseed, bok choy, mustard, mustard greens, kale, broccoli, kohlrabi, mustard radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, bean, kidney bean, and pea; and all monocotyledonous plants such as corn and rice; preferably cabbage, bean, or rice, but not limited thereto.

[0045] The present invention relates to a method for producing a transgenic plant with enhanced photosynthetic efficiency, comprising the steps of transforming a plant cell with a recombinant vector containing a carbonic anhydrase β2 gene (BsCAβ2 gene) derived from Bienergia; and the step of overexpressing the BsCAβ2 gene in the transformed plant cell.

[0046] The above-mentioned bienergia-derived carbonic anhydrase β2 gene (BsCAβ2 gene) may preferably be composed of the base sequence of sequence number 1, but is not limited thereto.

[0047] The method of the present invention may include a step of regenerating a transgenic plant from the transformed plant cell. Any method known in the art may be used to regenerate a transgenic plant from the transgenic plant cell.

[0048] Transformed plant cells must be regenerated into whole plants. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vols. 1-5, 1983-1989 Momillan, NY).

[0049] In addition, the present invention provides a method for improving photosynthetic efficiency of a plant, comprising the steps of transforming a plant cell with a recombinant vector containing a carbonic anhydrase β2 gene (BsCAβ2 gene) derived from Bienergia; and the step of overexpressing the BsCAβ2 gene in the transformed plant cell.

[0050] The above-mentioned bienergia-derived carbonic anhydrase β2 gene (BsCAβ2 gene) may preferably be composed of the base sequence of sequence number 1, but is not limited thereto.

[0051] In addition, the present invention provides a composition for increasing photosynthetic efficiency of a plant, which contains as an active ingredient a recombinant vector including a carbonic anhydrase β2 gene derived from Bienergia of SEQ ID NO: 1. The composition contains as an active ingredient a recombinant vector including a BsCAβ2 gene consisting of a base sequence of SEQ ID NO: 1, and can increase photosynthetic efficiency by overexpressing the gene in a plant, thereby showing a rapid increase in all plant growth processes, such as an increase in leaf size through sufficient vegetative growth, an increase in the number of leaves, and an advancement of flowering time, compared to a conventional plant that has not been transformed.

[0052] The present inventors drew a phylogenetic tree of the BsCAβ2 gene in the desert-growing Biennia plant, which has two chromosomes per cell, and confirmed that it is in the correct position in the genome classification.

[0053] In addition, the BsCAβ2 gene, which is predicted to be involved in improving the photosynthetic efficiency of Bienergia, was overexpressed in cabbage and the growth efficiency in transgenic cabbage plants was analyzed. Compared to the prediction, the T1 and T2 generations showed a rapid increase in all plant growth processes, such as leaf size, number of leaves, and advancement of flowering time through sufficient vegetative growth, which revealed that the BsCAβ2 gene is a growth promoting gene. This suggests that the BsCAβ2 gene can be utilized as a gene to prepare for future food shortages by being introduced into soybeans, corn, etc.

[0054] In addition, the growth efficiency of transgenic rice plants overexpressing the BsCAβ2 gene was analyzed. Compared to the control, Samkwang, tillering was significantly increased, and it was confirmed that rice flower differentiation occurred after sufficient somatic cell growth.

[0055] In addition, the growth efficiency of transgenic rice plants overexpressing the BsCAβ2 gene in soybeans was analyzed. In the T1 generation, leaf size and number of leaves were increased compared to Williams soybeans used as a control.

[0056] Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings so that those skilled in the art can easily implement the present invention. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

[0057]

[0058] [Example 1] Isolation and sequence confirmation of the Bienergia BsCAs gene

[0059] The mRNA sequences of BsCAα1, BsCAα2, BsCAβ1, and BsCAβ2 genes as CA genes of Bienertia were determined and registered in GenBank (MK674489 to MK674492, respectively). A comparative phylogenetic tree was constructed for the α-type CA and β-type CA protein sequences of Bienertia with those of monocots and dicotyledons. Monocots are indicated by yellow circles, and dicotyledons by green triangles. The phylogenetic tree was constructed using pairwise deletion and the Poisson correlation method with a bootstrap of 50% or more at 1,000 iterations. The α-type CA and β-type CA protein sequences of Bienertia were classified into the dicotyledonous plant group, such as spinach and tobacco, which are in similar evolutionary positions (see Fig. 3).

[0060]

[0061] [Example 2] Production of transgenic cabbage containing the Bienergia BsCAβ2 gene

[0062] 2-1. Construction of a recombinant vector for overexpression of the BsCAβ2 gene in cabbage

[0063] The bienergia BsCAβ2 expression gene (SEQ ID NO: 1), which is predicted to exhibit photosynthetic patterns similar to those of C4 plants, was recombined into the pBIB binary vector using the Gateway cloning method (Wimmer et al., 2019). The vector map produced in this way is shown in Figure 4.

[0064] Referring to Fig. 4, the produced vector uses the CaMV35S promoter and includes hygromycin and kanamycin resistance genes as antibiotic selection markers.

[0065]

[0066] 2-2. Cabbage transformation with the BsCAβ2 gene

[0067] Cabbage transformation was performed as follows. Sterilized cabbage seeds (washed 70% EtOH for 1 minute, 2% bleach for 20 minutes, and 5 times with sterile water) were placed on sterile filter paper in a clean bench to remove moisture, and then planted on MS medium. After 3 days of dark culture and 3 days of light culture, the hypocotyls were cut to a size of 0.5 to 1 cm, and then planted on pre-culture medium (Pre-culture medium: basic MS medium + 1 mgL -1 NAA + 4 mgL -1 BA + 2 mgL -1 AgNO3 + 3% sucrose + 0.9% plant agar) were cultured. The pre-cultured hypocotyl tissue was co-cultured with Agrobacterium tumefaciens GV3101 to infect the transformed BsCAβ2 gene in the dark at 25℃. The co-cultured hypocotyl tissue was cultured on selection medium (basic MS medium + 1 mgL -1 NAA + 4 mgL -1 BA + 15 mgL -1 Hygromycin + 100 mgL -1 Carbenicillin + 250 mgL -1(Sefotaxime + 3% sucrose + 0.9% plant agar). Once callus was formed, the cells were transferred to the same selection medium and subcultured at 2-3 week intervals until shoots were formed. The redifferentiated shoots were induced to form roots in the rooting medium. The rooted plants were acclimatized and cultivated in a greenhouse. After growing vigorously for 2-3 weeks, they were cold-treated at 4℃ for 40 days to induce bolting and flowering. The transformants whose flowering was induced by vernalization were subjected to brain pollination to harvest seeds and advance the next generation.

[0068]

[0069] 2-3. T1 generation growth phase of cabbage and rapeseed transgenic plants expressing the BsCAβ2 gene

[0070] Cabbage transformant progeny T1 seeds were grown on hygromycin selection medium (MS basal medium + 30 mgL -1 Green, healthy T1 plants were grown in a greenhouse after being treated with hygromycin. After growing for 2 to 3 weeks, they were subjected to low-temperature treatment at 4℃ for 40 days to induce flowering, and seeds were collected by brain pollination.

[0071] When the growth phase of the cabbage T1 plants was compared with that of non-transformant cabbage, it was found that all growth phases, including the number of leaves, leaf size, and flowering time, were significantly improved (see Fig. 5).

[0072]

[0073] 2-4. Analysis of the insertion location of the BsCAβ2 overexpression gene into the cabbage genome

[0074] Cabbage lines 2, 4, 6, and 8 were created with the BsCAβ2 overexpressing gene. The gDNA of these lines was isolated, and short-range sequencing was performed according to the NGS analysis method. Sequence reads were 151 bp each in a paired-end manner, and libraries were constructed using the TruSeq Nano DNA Kit, Illumina, and sequencing was performed using the Illumina system. The analysis was performed at the level of 100X coverage of the cabbage genome. Adapters were trimmed, and the Q30 sequence was secured at an average level of 96.24%. The genome was assembled and mapped based on the Branch Reference V3.0 sequence, and the insertion site of the BsCAβ2 gene in the cabbage genome was analyzed. The analysis results are shown in Table 1 (Analysis of insertion sites in the cabbage genome).

[0075]

[0076] QueryChrQuery_startQuery_endChr_startChr-endE-valueTypeGene_IDFamily #2A04202624751,683,4371,683,8820Gene betweenBra014600Upstream 1.767 kbFamily #4A0475123691,705,3891,703,7710Gene betweenBra014604Upstream 12.828 kbFamily #6A09154520022,441,7422,442,1960IntronBra036152Family #8A021527166614,299,15014,299,0119.00E-735'Upstream-1000Bra008278Upstream 0.207kb

[0077]

[0078] As shown in Table 1 above, each line had insertions in different genetic regions, with lines 2 and 4 having insertions in nearly adjacent regions. No lines had insertions within the CDS region of a gene, and insertions were found between genes or in introns and the 5'-region of the gene.

[0079]

[0080] [Example 3] Growth efficiency test of transgenic cabbage containing the Bienergia BsCAβ2 gene

[0081] 3-1. Selection and breeding of T2 homo lines of cabbage and rapeseed transgenic plants expressing the BsCAβ2 gene.

[0082] From the T2 seeds received from the T1 generation of the four lines of the cabbage BsCAβ2 gene overexpression transformants obtained in Example 2 above, four lines and ten homo lines showing resistance on the hygromycin selection medium were selected. The results of the BsCAβ2 overexpression gene cabbage T2 hygromycin resistance analysis and selection are shown in Table 2 below (BsCAβ2 overexpression gene cabbage T2 hygromycin resistance analysis).

[0083]

[0084]

[0085] 3-2. Sowing of seeds, greenhouse cultivation, and growth analysis of cabbage homogeneous lines

[0086] Ten homo strains of BsCAβ2 gene overexpressing cabbage were sown in petri dishes. Four days after sowing, increased growth of the overexpressing transgenic plants was confirmed in the development of cotyledons (Fig. 6).

[0087] After 16 days of growth in a greenhouse, comparative growth photographs of BsCAβ2 gene overexpressing cabbage lines 2 and 6 are shown in Figure 7. The lengths of the red bars indicated in the photographs are equal. Compared to the control group, the transformants according to the present invention showed at least 1.8 times larger leaf size and increased leaf number development.

[0088] Additionally, the growth of five selected, fast-growing strains among the homo strains was captured by drone on the 24th day of greenhouse growth, and is shown in Figure 8. The red bars in the photographs are of equal length. Compared to the control group, it can be confirmed that the size and number of leaves in the transformants according to the present invention have significantly increased.

[0089]

[0090] [Example 4] Production of transgenic rice containing the Bienergia BsCAβ2 gene

[0091] 4-1. Construction of a recombinant vector for overexpression of the BsCAβ2 gene in rice

[0092] The BsCAβ2 expression gene (SEQ ID NO: 1) was recombined into the pBIB binary vector using the Gateway cloning method (Wimmer et al., 2019). The vector map produced in this way is shown in Figure 4.

[0093] 4-2. Transformation of rice with the BsCAβ2 gene

[0094] Rice transformation was performed as follows. Sterilized rice seeds (washed 70% EtOH for 1 minute, 2% bleach for 20 minutes, and 5 times with sterilized water) were placed on sterile filter paper in a clean bench to remove moisture, and then planted on MS medium. After 3 days of dark culture and 3 days of light culture, the hypocotyls were cut to a size of 0.5 to 1 cm, and then planted on pre-culture medium (Pre-culture medium: basic MS medium + 1 mgL -1 NAA + 4 mgL -1 BA + 2 mgL -1 AgNO3 + 3% sucrose + 0.9% plant agar) were cultured. The pre-cultured hypocotyl tissue was co-cultured with Agrobacterium tumefaciens GV3101 to infect the transformed BsCAβ2 gene in the dark at 25℃. The co-cultured hypocotyl tissue was cultured on selection medium (basic MS medium + 1 mgL -1 NAA + 4 mgL -1 BA + 15 mgL -1 Hygromycin + 100 mgL -1 Carbenicillin + 250 mgL -1(Sefotaxime + 3% sucrose + 0.9% plant agar). Once callus was formed, the cells were transferred to the same selection medium and subcultured at 2-3 week intervals until shoots were formed. The redifferentiated shoots were induced to form roots in the rooting medium. The rooted plants were acclimatized and cultivated in a greenhouse. After growing vigorously for 2-3 weeks, they were cold-treated at 4℃ for 40 days to induce bolting and flowering. The transformants whose flowering was induced by vernalization were subjected to brain pollination to harvest seeds and advance the next generation.

[0095]

[0096] 4-3. BsCAβ2 gene expression in rice plants in a greenhouse and growth phase analysis

[0097] BsCAβ2 gene overexpressing rice seeds were sown in petri dishes.

[0098] Growth on the 176th day in the greenhouse is shown in Fig. 9. Compared to the control group, Samkwang, it can be confirmed that tillering was greatly increased in the rice transformant according to the present invention, and rice flower differentiation occurred after sufficient trichome growth.

[0099]

[0100] [Example 5] Production of transgenic soybeans containing the Bienergia BsCAβ2 gene

[0101] 5-1. Construction of a recombinant vector for overexpression of the BsCAβ2 gene in soybeans

[0102] The BsCAβ2 expression gene (SEQ ID NO: 1) was recombined into the pBIB binary vector using the Gateway cloning method (Wimmer et al., 2019). The vector map produced in this way is shown in Figure 4.

[0103]

[0104] 5-2. Soybean transformation with the BsCAβ2 gene

[0105] Soybean transformation was performed as follows. Sterilized soybean seeds (washed 70% EtOH for 1 minute, 2% bleach for 20 minutes, and 5 times with sterile water) were placed on sterile filter paper in a clean bench to remove moisture, and then planted on MS medium. After 3 days of dark culture and 3 days of light culture, the hypocotyls were cut to a size of 0.5 to 1 cm, and then planted on pre-culture medium (Pre-culture medium: basic MS medium + 1 mgL -1 NAA + 4 mgL -1 BA + 2 mgL -1 AgNO3 + 3% sucrose + 0.9% plant agar) were cultured. The pre-cultured hypocotyl tissue was co-cultured with Agrobacterium tumefaciens GV3101 to infect the transformed BsCAβ2 gene in the dark at 25℃. The co-cultured hypocotyl tissue was cultured on selection medium (basic MS medium + 1 mgL -1 NAA + 4 mgL -1 BA + 15 mgL -1 Hygromycin + 100 mgL -1 Carbenicillin + 250 mgL -1 (Sefotaxime + 3% sucrose + 0.9% plant agar). Once callus was formed, the cells were transferred to the same selection medium and subcultured at 2-3 week intervals until shoots were formed. The redifferentiated shoots were induced to form roots in the rooting medium. The rooted plants were acclimatized and cultivated in a greenhouse. After growing vigorously for 2-3 weeks, they were cold-treated at 4℃ for 40 days to induce bolting and flowering. The transformants whose flowering was induced by vernalization were subjected to brain pollination to harvest seeds and advance the next generation.

[0106]

[0107] 5-3. T1 generation growth phase of soybean transformants expressing the BsCAβ2 overexpression gene

[0108] Soybean transformant progeny T1 seeds were grown on hygromycin selection medium (MS basal medium + 30 mgL -1Green, healthy T1 plants were grown in a greenhouse after being treated with hygromycin. After growing for 2 to 3 weeks, they were subjected to low-temperature treatment at 4℃ for 40 days to induce flowering, and seeds were collected by brain pollination.

[0109] When the growth of soybean T1 plants was compared with that of non-transgenic soybeans (Williams soybeans), it was confirmed that the number of leaves and leaf size increased (Fig. 10).

[0110] By introducing the gene according to the present invention into feed crops such as soybeans and corn, it can be utilized to prepare for future food shortages.

Claims

1. A transgenic plant with enhanced photosynthetic efficiency, transformed with a recombinant vector containing the carbonic anhydrase β2 gene (BsCAβ2 gene) derived from Bienertiasinus persici having sequence number 1.

2. In the first paragraph, the plant is a transformed plant with enhanced photosynthetic efficiency, which is a plant selected from the group consisting of Arabidopsis, eggplant, tobacco, pepper, tomato, burdock, crown daisy, lettuce, bellflower root, spinach, tangle, sweet potato, celery, carrot, water parsley, parsley, cabbage, Chinese cabbage, rapeseed, bok choy, mustard, mustard greens, kale, broccoli, kohlrabi, mustard radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, soybean, corn and rice.

3. In the second paragraph, the plant is a cabbage, a transformed plant with enhanced photosynthetic efficiency.

4. A step of transforming a plant cell with a recombinant vector containing a carbonic anhydrase β2 gene (BsCAβ2 gene) derived from Bienertia of sequence number 1; and A step of overexpressing the BsCAβ2 gene in the transformed plant cell A method for producing a transgenic plant having enhanced photosynthetic efficiency, comprising:

5. A method for producing a transgenic plant with enhanced photosynthetic efficiency, wherein the method further comprises a step of re-differentiating a transgenic plant from a transformed plant cell.

6. A step of transforming a plant cell with a recombinant vector containing a carbonic anhydrase β2 gene (BsCAβ2 gene) derived from Bienertia of sequence number 1; and A step of overexpressing the BsCAβ2 gene in the transformed plant cell A method for improving photosynthetic efficiency of a transgenic plant, comprising:

7. A composition for increasing photosynthetic efficiency of a plant, comprising a recombinant vector including a carbonic anhydrase β2 gene (BsCAβ2 gene) derived from Bienergia having sequence number 1 as an active ingredient.

Citation Information

Patent Citations

  • The method for enhancement of photosynthesis and biomass of plant by plastid transformation of malate dehydrogenase

    KR100813150B1

  • Transgenic plants for controlling photosynthetic efficiency in the light and cold stress, and control method thereof

    KR101660231B1

  • Method for increasing both phothosynthetic rate and tolerance to drought and salt stresses in plants

    KR101752324B1

  • Air sterilization mask using UVC radiation

    KR1020220031165A

  • Method for providing desktop service and managing server using the same

    KR1020240003882A