Pharmaceutical composition for prevention or treatment of aging comprising as active ingredient engineered virus-like particles comprising oct4, sox2, and klf4 proteins

Engineered virus-like particles (eVLPs) delivering Oct4, Sox2, and Klf4 proteins provide a safe and effective method for transient overexpression, addressing the challenges of long-term expression and cancer risks in treating aging and neurodegenerative diseases.

WO2025135671A1PCT designated stage expired Publication Date: 2025-06-26RES & BUSINESS FOUND SUNGKYUNKWAN UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/020199
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-20
Filing Date
2024-12-10
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current methods for delivering Yamanaka factors, such as Oct4, Sox2, and Klf4, for treating aging and neurodegenerative diseases face challenges including long-term expression risks, cancer concerns, and difficulties in transient overexpression in vivo.

Method used

Development of engineered virus-like particles (eVLPs) that deliver Oct4, Sox2, and Klf4 proteins as active ingredients, allowing for transient overexpression without integrating DNA into the genome, thereby minimizing side effects.

Benefits of technology

The eVLPs effectively induce temporary overexpression of Oct4 and Sox2, demonstrating potential as safe and effective preventive or therapeutic agents for aging and neurodegenerative diseases with reduced risk of cancer and other side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024020199_26062025_PF_FP_ABST
    Figure KR2024020199_26062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of aging, comprising, as an active ingredient, engineered virus-like particles (eVLPs) comprising Oct4, Sox2, and Klf4 proteins. When the eVLPs comprising Oct4, Sox2, and Klf4 proteins, of the present invention, are used, the transient overexpression of Oct4 and Sox2 can be effectively induced, which enables safe induction of overexpression compared to conventional doxycycline-inducible expression methods. Therefore, the eVLPs can be effectively used for the prevention or treatment of aging.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for preventing or treating aging comprising engineered virus-like particles comprising OCT4, SOX2, and KLF4 proteins as active ingredients

[0001] The present invention was made under the support of the Ministry of Health and Welfare of the Republic of Korea under the research number HR22C1363040023, the research management specialized organization of the said project is the Korea Health Industry Development Institute, the research project name is "Research-oriented hospital promotion", the research project name is "Development of next-generation gene therapy source technology and establishment of efficacy evaluation system", the main organization is Sungkyunkwan University Industry-Academic Cooperation Foundation, and the research period is 2023.01.01-2023.12.31.

[0002] The present invention was made under the support of the Ministry of Health and Welfare of the Republic of Korea under the research project number HI22C1588000223, the research management specialized organization of the project is the Korea Health Industry Development Institute, the research project name is "Establishment of Regenerative Medicine Clinical Research Base", the research project name is "Development of AAV Vector Production and Mini Gene Scissors System for AAV", the main organization is Sungkyunkwan University Industry-Academic Cooperation Foundation, and the research period is 2023.01.01-2023.12.31.

[0003] The present invention was made under the support of the Ministry of Science and ICT of the Republic of Korea under the research project number 2020R1A2C2101714, and the research management specialized organization of the project is the Korea Health Industry Development Institute, the research project name is "Individual Basic Research (Ministry of Science and ICT)", the research project name is "Development of a Drug Resistance Mutation Specific Correction System Using Prime Editor", the main organization is the Sungkyunkwan University Industry-Academic Cooperation Foundation, and the research period is 2023.03.01-2024.02.29.

[0004] The present invention was made under the support of the Ministry of Science and ICT of the Republic of Korea under the research project number 21A0202L1, and the research management specialized institution of the project is the Inter-Ministry Regenerative Medicine Technology Development Project (Foundation), the research project name is "Inter-Ministry Regenerative Medicine Technology Development Project", the research project name is "Development of in vivo reprogramming and target cell conversion induction technology for the treatment of neurodegenerative diseases", the main institution is the Yonsei University Industry-Academic Cooperation Foundation, and the research period is 2023.01.01-2023.12.31.

[0005] This patent application claims priority to Republic of Korea Patent Application No. 10-2023-0187720, filed with the Korean Intellectual Property Office on December 20, 2023, the disclosure of which is incorporated herein by reference.

[0006] The present invention relates to a pharmaceutical composition for preventing or treating aging, comprising an engineered virus-like particle comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0007]

[0008] In 2007, Professor Yamanaka of Japan successfully created induced pluripotent stem cells (iPSCs) with pluripotency and self-renewal capacity by introducing Oct4, Sox2, Klf4, and c-myc transcription genes into mouse somatic cells. These four genes are also known as Yamanaka factors, and Professor Yamanaka's research team suggested that introducing these factors into somatic cells could induce pluripotency and reverse cellular aging.

[0009] However, another study reported that long-term expression of Yamanaka factors can lead to cancer. Therefore, studies related to Yamanaka factors and aging have been conducted by inducing transient overexpression of Yamanaka factors using a doxycycline-inducible expression system. However, doxycycline is a type of antibiotic, and continuous and repeated administration is required to improve aging-related phenotypes. Furthermore, overdose can cause serious side effects. Furthermore, Yamanaka factors are difficult to integrate into human cells. This makes their application in humans challenging.

[0010] Therefore, in order to practically apply the improvement of aging-related phenotypes through transient expression of Yamanaka factors, it is necessary to establish a safe system that can induce transient overexpression of Oct4, Sox2, and Klf4 in vivo, excluding c-Myc, which is a cause of cancer development.

[0011] Currently, the primary method for delivering gene editing tools, such as base editors, into the body is through delivery using adeno-associated viruses (AAV) or viral DNA vectors. In this process, the cargo is delivered to target cells in DNA form, integrated into genomic DNA or remains as an episome within the target cell's nucleus, and then expressed as a protein through the target cell's expression system.

[0012] Although the above method effectively delivers cargo into target cells, it is difficult to use for human therapeutic purposes because the viral DNA is integrated into the genomic DNA or the foreign DNA remains in the nucleus of the cell and the cargo is expressed for a long time. In addition, it is unknown what effect the cargo will have when expressed for a long time, and there is a possibility that it may cause cancer.

[0013] Engineered Virus-Like Particles (eVLPs), recently developed by David Liu and his team based on existing VLPs, can deliver cargo into the body in the form of proteins, rather than DNA or RNA. Proteins delivered into target cells function temporarily upon delivery and disappear within a few days due to intracellular proteolysis, avoiding the side effects associated with AAV or viral DNA vectors.

[0014]

[0015] The present inventors have conducted extensive research efforts to develop a pharmaceutical composition for the prevention or treatment of aging or neurodegenerative diseases. As a result, we have developed an engineered virus-like particle (eVLP) that effectively induces transient overexpression of Oct4, Sox2, and Klf4 proteins. The present inventors have confirmed that eVLPs containing Oct4, Sox2, and Klf4 proteins can induce overexpression of Oct4 and Sox2 in cells. Furthermore, we have confirmed that the overexpression of Oct4 and Sox2 is temporarily induced and then returns to normal levels. By elucidating that the composition can be used as a preventive or therapeutic agent for aging or neurodegenerative diseases with minimal side effects, we have completed the present invention.

[0016] Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating aging, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0017] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neurodegenerative diseases, which comprises an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0018] Another object of the present invention is to provide a host cell comprising a polynucleotide.

[0019] Another object of the present invention is to provide a method for producing an engineered virus-like particle (eVLP).

[0020]

[0021] The present invention provides the following inventions 1 to 14.

[0022] 1. A pharmaceutical composition for preventing or treating aging, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0023] 2. A pharmaceutical composition for preventing or treating a neurodegenerative disease, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0024] 3. A pharmaceutical composition according to 1 or 2, characterized in that the eVLP comprises the following components:

[0025] (i) vesicular stomatitis virus (VSV) envelope glycoprotein (VSV-G) bound to the eVLP envelope;

[0026] (ii) gag-pol protein forming the membrane structure of eVLP; and

[0027] (iii) gag-Oct4, gag-Sox2, and gag-Klf4 proteins located on the inner side of the eVLP membrane.

[0028] 4. In 2 or 3, the neurodegenerative disease is at least one selected from the group consisting of Alzheimer's disease, Alzheimer's dementia, vascular dementia, Lewy body dementia, frontotemporal dementia, corticobasal degeneration, Parkinson's disease, multiple system atrophy, Huntington's chorea, progressive supranuclear palsy, amyotrophic lateral sclerosis, primary lateral sclerosis, spinal muscular atrophy, brain inflammation, and neuronal cell death, or A pharmaceutical composition for therapeutic purposes.

[0029] 5. A host cell comprising the following polynucleotide.

[0030] (i) a polynucleotide expressing VSV-G protein;

[0031] (ii) a polynucleotide expressing a gag-pol protein;

[0032] (iii) a polynucleotide expressing gag-Oct4 protein;

[0033] (iv) a polynucleotide expressing the gag-Sox2 protein; and

[0034] (v) A polynucleotide expressing the gag-Klf4 protein.

[0035] 6. A host cell in which the polynucleotides of (i) to (v) are contained within a vector.

[0036] 7. A host cell in 5, wherein the polynucleotides (i) to (v) are contained in one or more vectors.

[0037] 8. In 4, the host cell is a human embryonic kidney (HEK) 293 cell or HEK293 T cell.

[0038] 9. A method for manufacturing an engineered virus-like particle (eVLP), comprising the following steps:

[0039] (i) a step of preparing a vector expressing VSV-G protein, Gag-pol protein, Oct4 protein, Sox2 protein, and Klf4 protein;

[0040] (ii) a step of transforming the above vector into a host cell;

[0041] (iii) a step of obtaining a medium supernatant in which the transformed host cell is cultured; and

[0042] (iv) A step of separating eVLPs from the above medium supernatant.

[0043] 10. A manufacturing method according to 9, wherein the vector is one or more.

[0044] 11. A manufacturing method further comprising a step of isolating, optionally purifying or concentrating eVLPs in 9.

[0045] 12. A method for treating a disease, comprising administering any one of the pharmaceutical compositions 1 to 4 to a subject in need of prevention or treatment.

[0046] 13. A method for treating a disease according to claim 12, wherein the disease is an aging or neurodegenerative disease.

[0047] 14. A method for treating a disease according to claim 13, wherein the neurodegenerative disease is at least one selected from the group consisting of Alzheimer's disease, Alzheimer's dementia, vascular dementia, Lewy body dementia, frontotemporal dementia, corticobasal degeneration, Parkinson's disease, multiple system atrophy, Huntington's chorea, progressive supranuclear palsy, amyotrophic lateral sclerosis, primary laterial sclerosis, spinal muscular atrophy, brain inflammation, and neuronal cell death.

[0048]

[0049] The present inventors have conducted extensive research efforts to develop a pharmaceutical composition for the prevention or treatment of aging or neurodegenerative diseases. As a result, we have developed an engineered virus-like particle (eVLP) that effectively induces transient overexpression of Oct4, Sox2, and Klf4 proteins. The present inventors have confirmed that eVLPs containing Oct4, Sox2, and Klf4 proteins can induce overexpression of Oct4 and Sox2 in cells. Furthermore, we have confirmed that the overexpression of Oct4 and Sox2 is temporarily induced and then returns to normal levels. By elucidating that the composition can be used as a preventive or therapeutic agent for aging or neurodegenerative diseases with minimal side effects, we have completed the present invention.

[0050] According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating aging, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0051] In the present invention, "virus-like particle" refers to a non-infectious viral subunit that may or may not carry viral proteins. For example, the virus-like particle may completely lack a DNA or RNA genome.

[0052] The virus-like particles of the present invention can be produced by methods widely known in the art. For example, the virus-like particles of the present invention can be produced by transforming a given host cell with a recombinant DNA molecule encoding a structural protein and a surface antigen protein, followed by culturing the cell. The proteins expressed within the cell can then be assembled on the cell surface and then released into the culture supernatant.

[0053] The above virus-like particles self-assemble into a form similar to an actual virus through binding between the structural proteins of the virus. However, during the assembly process, the viral genes may not be incorporated into the virus-like particles. Virus-like particles with the above characteristics have a form very similar to an actual virus, and thus can exhibit high immunogenicity when injected into the body. In addition, since they do not contain viral genes, they can act as safe antigens that cannot proliferate in the body.

[0054] In the present invention, "engineered virus-like particles (eVLPs)" are virus-like particles recently developed by David Liu's research team based on existing VLPs, and refer to carriers capable of delivering cargo into the body in the form of proteins rather than DNA or RNA. Proteins delivered into target cells function temporarily upon delivery and then disappear within a few days due to intracellular protein degradation, thereby avoiding the side effects of AAV or viral DNA carriers.

[0055] In the present invention, the "Yamanaka factor" refers to a factor that induces pluripotency (Takahashi et al., Cell. 2006 Aug 25;126(4):663-76) and reverses the DNA methylation clock of aging (Horvath, Genome Biol. 2013), and refers to four genes, namely Oct4, Sox2, Klf4, and c-Myc, or proteins derived therefrom.

[0056] In the present invention, "Oct4 (octamer-binding transcription factor 4)", which may also be referred to as octamer-binding transcription factor 4, OCT3, OCT3 / 4, POU5F1, or POU class 5 homeobox 1, is a transcription factor involved in embryonic development and cell fate determination. Similar to other OCT transcription factors, OCT4 is characterized by a bipartite DNA binding domain referred to as the POU domain. The OCT4 transcription factor, homolog, or variant thereof used herein may be derived from any species, including humans. Gene expression of Oct4 induces phenotypic differentiation of stem cell differentiation during mammalian embryonic development and functions to maintain pluripotency throughout embryonic development.

[0057] In the present invention, "Sox2 (SRY (sex determining region Y)-box 2)" is a member of the SRY-related HMG-box (SOX) family of transcription factors. SOX2 has been implicated in promoting embryonic development. Members of the SOX (SRY-related HMG-box) family of transcription factors are characterized by a high mobility group 5 (HMG)-box DNA sequence. This HMG box is a DNA binding domain that is highly conserved across eukaryotic species. The SOX2 transcription factor, a homologue or variant thereof used herein may be derived from any species, including humans. The Sox2 is a transcription factor essential for maintaining the self-renewal or pluripotency of undifferentiated embryonic stem cells, and activates the transcription of important pluripotency factors in mammalian development.

[0058] In the present invention, "Klf4 (Kruppel-like factor 4)", also referred to as EZF or GKLF, is a zinc-finger transcription factor. KLF4 has been implicated in the regulation of differentiation and proliferation and can interact with coactivators, including members of the p300-CBP coactivator family. The KLF4 transcription factor, a homolog (e.g., a functional homolog), or a variant thereof used herein may be derived from any species, including humans. The Klf4 plays a role in the regulation of proliferation, differentiation, apoptosis, and somatic cell reprogramming.

[0059] In the present invention, "c-Myc" or "Myc" refers to a nuclear phosphoprotein associated with cell cycle progression. c-Myc can form a heterodimer with the transcription factor MAX, and the heterodimer can bind to the E box sequence on a nucleic acid (e.g., an engineered nucleic acid) to regulate the transcription of a target gene. Because c-Myc is a well-known proto-oncogene, it carries a high risk if activated along with genomic integration.

[0060] Therefore, to reduce this risk, we sought to engineer virus-like particles containing the remaining three transcription factors (Oct4, Sox2, and Klf4).

[0061] In the present invention, “comprising as an active ingredient” means including an amount sufficient to achieve the efficacy or activity of the engineered virus-like particle.

[0062] In the present invention, "aging" refers to the natural process of being born, growing, and growing old over time. As time passes, we age, which leads to the development of diseases and a gradual increase in the risk of death, ultimately making continued life impossible. While the aging process is not necessarily associated with geriatric diseases, the incidence of disease increases with the degree of aging. While the precise biological mechanisms of the aging process remain unknown, it has been confirmed that aging is a multifactorial phenomenon involving internal and external factors within the organism.

[0063] In the present invention, “prevention” means any act of suppressing the onset of the disease or promoting its progression by administering a pharmaceutical composition according to the present invention.

[0064] In the present invention, “treatment” includes suppression of occurrence or recurrence of the disease, alleviation of symptoms, reduction of any direct or indirect pathological consequences of the disease, reduction of the rate of disease progression, improvement, alleviation, or improved prognosis of the disease state, etc., by administration of the pharmaceutical composition according to the present invention.

[0065] In the present invention, the term "pharmaceutical composition" refers to a composition administered for a specific purpose, and for the purposes of the present invention, means administered to prevent or treat aging or at least one symptom thereof. The pharmaceutical composition comprises an eVLP containing a pharmaceutically effective amount of Oct4, Sox2, and Klf4 proteins.

[0066] The pharmaceutical composition of the invention may be formulated as a powder, granule, tablet, coated tablet, pill, sugar tablet, capsule, liquid, suspension, gel, syrup, slurry, suppository, enema, emulsion, paste, ointment, cream, lotion, powder, spray or suspension.

[0067] The pharmaceutical composition of the present invention may further comprise a suitable carrier, excipient or diluent commonly used in the manufacture of pharmaceutical compositions. Examples thereof include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, mannitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate or mineral oil.

[0068] In addition to the above ingredients, the pharmaceutical composition of the present invention may further include excipients, stabilizers, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers, vehicles, excipients, stabilizers, or diluents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0069] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount.

[0070] In the present invention, "pharmaceutically effective amount" means an amount sufficient to achieve preventive, alleviative, or therapeutic efficacy for aging or at least one symptom thereof. The effective dosage level may be determined based on factors including the type and severity of the patient's disease, drug activity and drug sensitivity, administration time, administration route and excretion rate, treatment duration, concurrent medications, and other factors well known in the medical field. The amount of the composition used may vary depending on the patient's age and weight, but an amount sufficient to achieve a blood concentration of eVLP useful for the treatment of aging may be administered once or several times daily.

[0071] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the method can be performed. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0072] The dosage of the above composition may be increased or decreased depending on the route of administration, severity of the disease, body weight, age, etc. Therefore, the above dosage does not limit the scope of the present invention in any way.

[0073] The pharmaceutical composition of the present invention can be administered to a subject via various routes. All modes of administration are conceivable, including intracerebral administration, oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, intrathecal injection, sublingual administration, buccal mucosa administration, rectal insertion, vaginal insertion, otic administration, nasal administration, inhalation, oral or nasal spraying, dermal administration, and transdermal administration.

[0074] The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents. It can be administered sequentially or simultaneously with conventional therapeutic agents, or in single or multiple doses. Taking all of the above factors into account, it is important to administer an amount that achieves maximum efficacy with minimal side effects. This can be readily determined by those skilled in the art.

[0075] In one embodiment of the present invention, the eVLP comprises (i) a vesicular stomatitis virus (VSV) envelope glycoprotein (VSV-G) bound to the eVLP envelope; (ii) a Gag-pol protein forming the membrane structure of the eVLP; and (iii) Gag-Oct4, Gag-Sox2, and Gag-Klf4 proteins located on the inner side of the eVLP membrane.

[0076] In one embodiment of the present invention, the Oct4, Sox2, and Klf4 proteins may be represented by amino acid sequences of SEQ ID NOs: 16 to 18, respectively.

[0077] In one embodiment of the present invention, the VSV-G, Gag-pol protein, Gag-Oct4, Gag-Sox2, and Gag-Klf4 proteins may be represented by amino acid sequences of SEQ ID NOs: 19 to 23, respectively.

[0078] In the present invention, "vesicular stomatitis virus (VSV) envelope glycoprotein (VSV-G)" exists in a form bound to the outer coat of eVLP, and helps eVLP fuse with the cell membrane to facilitate the delivery of Oct4, Sox2, and Klf4.

[0079] In the present invention, "Gag-pol protein" means a fused form of Gag protein and pol protein, where Gag protein is a protein that forms the internal structure of a virus, and pol protein performs the role of reverse transcription that reversely transcribes RNA of a retrovirus introduced into a target cell through infection into DNA.

[0080] In the present invention, "Gag-Oct4, Gag-Sox2, and Gag-Klf4 proteins" means a protein in which Oct4, Sox2, and Klf4 proteins are fused to Gag, which forms the membrane structure of an eVLP, and the structure of an eVLP is naturally formed by Gag, and at this time, the Oct4, Sox2, and Klf4 proteins are packaged inside the eVLP membrane.

[0081]

[0082] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating a neurodegenerative disease, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0083] In the present invention, “neurodegenerative disease” means a disease that causes various symptoms as degenerative changes in the structure or function of the central nervous system or peripheral nervous system appear, and includes brain nerve diseases that cause impairment of cognitive function, learning or memory, or are accompanied by neuroinflammation.

[0084] In one embodiment of the present invention, the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Alzheimer's dementia, vascular dementia, Lewy body dementia, frontotemporal dementia, corticobasal degeneration, Parkinson's disease, multiple system atrophy, Huntington's chorea, progressive supranuclear palsy, amyotrophic lateral sclerosis, primary lateral sclerosis, spinal muscular atrophy, brain inflammation, and neuronal cell death, but is not limited thereto.

[0085] In one aspect of the present invention, the present invention provides a method for treating a disease, comprising administering to a subject in need of treatment an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins or a pharmaceutical composition comprising the same.

[0086] The above diseases are aging or neurodegenerative diseases.

[0087] Since the above disease treatment method includes a step of administering to a subject an engineered virus-like particle (eVLP) containing Oct4, Sox2, and Klf4 proteins or a pharmaceutical composition containing the same, description of any overlapping content with the above pharmaceutical composition is omitted.

[0088] According to another aspect of the present invention, the present invention provides a host cell comprising the following polynucleotides: (i) a polynucleotide expressing a VSV-G protein; (ii) a polynucleotide expressing a Gag-pol protein; (iii) a polynucleotide expressing a Gag-Oct4 protein; (iv) a polynucleotide expressing a Gag-Sox2 protein; and (v) a polynucleotide expressing a Gag-Klf4 protein.

[0089] In the present invention, "nucleic acid", "polynucleotide", "nucleotide sequence", "nucleic acid (e.g., engineered nucleic acid) molecule", "nucleic acid (e.g., engineered nucleic acid) sequence", and "oligonucleotide" mean a series of nucleotide bases (also referred to as "nucleotides") in DNA and RNA, and any chain of two or more nucleotides. The term "nucleic acid" or "nucleic acid (e.g., engineered nucleic acid) sequence", "nucleic acid (e.g., engineered nucleic acid) molecule", "nucleic acid (e.g., engineered nucleic acid) fragment" or "polynucleotide" can be used interchangeably with "gene", "mRNA encoded by a gene" and "cDNA".

[0090] In one embodiment of the present invention, the polynucleotides (i) to (v) are contained in a vector.

[0091] In the present invention, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide can be inserted. If the vector allows for the expression of a protein encoded by the polynucleotide inserted therein, the vector is referred to as an expression vector. The vector can be introduced into a host cell by transformation, transduction, or transfection, and the vector can have the transferred genetic material elements expressed in the host cell. Vectors are well known to those skilled in the art.

[0092] The above vector is a means for expressing a target gene in a host cell, and includes a plasmid vector, a bacteriophage vector, a phagemid vector, a cosmid vector, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), adenovirus vectors; a retrovirus vector, and a lentivirus vector.

[0093] In one embodiment of the present invention, the polynucleotides (i) to (v) are contained in one or more vectors.

[0094] According to one embodiment of the present invention, in the vector of the present invention, the polynucleotide is operatively linked to a promoter.

[0095] In the present invention, the expression "operatively linked" means that a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein or RNA are functionally linked. That is, the expression means that a nucleic acid sequence encoding a protein or RNA is linked in a manner that enables gene expression by the expression control sequence. For example, a promoter and a nucleic acid sequence encoding a protein or RNA must be operably linked to affect the expression of the encoding nucleic acid sequence. The operative linkage with a recombinant vector can be produced using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation uses enzymes generally known in the art.

[0096] The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.

[0097] Meanwhile, the vector capable of expressing the above polynucleotide can be either a vector system in which the polynucleotides are simultaneously expressed from a single vector or a system in which the polynucleotides are each expressed from separate vectors. In the latter case, the two vectors can be introduced into the host cell through co-transformation and targeted transformation.

[0098] Any host cell capable of stably and continuously cloning and expressing the vector of the present invention can be used as a host cell known in the art, and for example, suitable eukaryotic host cells for the vector include, but are not limited to, human embryonic kidney 293 (HEK-293) cells, HEK293 T, monkey kidney cells 7 (COS7: monkey kidney cells), NSO cells, SP2 / 0, Chinese hamster ovary (CHO: Chinese hamster ovary) cells, W138, baby hamster kidney (BHK: baby hamster kidney) cells, MDCK, myeloma cell lines, HuT 78 cells, and cells.

[0099] In one embodiment of the present invention, the host cell may be a human embryonic kidney (HEK) 293 cell or a HEK293 T cell.

[0100] In the present invention, the injection of exogenous nucleotides, which are not originally contained in the cell, into the cell is called transfection, and the phenomenon in which the genetic characteristics of the cell are changed thereby is called transformation. The process in which the exogenous nucleotides are injected into the cell through a plasmid, virus, or virus-derived vector is called transduction. Preferably, the transduction of the present invention means that the exogenous nucleotides are injected into the host cell through a virus-derived vector and expressed, but is not limited thereto.

[0101] In the present invention, “transformation,” “transfection,” and “transduction” are used with similar meanings to refer to the process of introducing exogenous nucleotides into a cell to give it genetic characteristics different from the normal type, or such a process.

[0102] A “transformed”, “transduced” or “transfected” cell is a cell that has been transformed, transduced or transfected with an exogenous nucleic acid, including the cell and progeny cells resulting from its passage.

[0103] The expression vector according to the present invention can be introduced into cells by methods known in the art, including but not limited to transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, dextran-mediated transfection (DEAE), polybrene-mediated transfection, electroporation, gene gun, and any known method for introducing nucleic acids into cells.

[0104] According to another aspect of the present invention, the present invention provides a method for producing an engineered virus-like particle (eVLP).

[0105] The above manufacturing method comprises the following steps:

[0106] (i) a step of preparing a vector expressing VSV-G protein, Gag-pol protein, Gag-Oct4 protein, Gag-Sox2 protein, and Gag-Klf4 protein;

[0107] (ii) a step of transforming the above vector into a host cell;

[0108] (iii) a step of obtaining a medium supernatant in which the transformed host cell is cultured; and

[0109] (iv) A step of separating eVLPs from the above medium supernatant.

[0110]

[0111] In one embodiment of the present invention, in order to produce a vector expressing Gag-pol protein, Gag-Oct4 protein, Gag-Sox2 protein, and Gag-Klf4 protein in step (i), polymerase chain reaction (PCR) is performed on the Gag-pol, Gag-Oct4, Gag-Sox2, and Gag-Klf4 genes. After the PCR, the generated PCR product is purified, treated with the restriction enzyme DpnI, and cloning is performed. After that, competent E. coli is used for transformation, and the plasmid vector can be extracted by prepping.

[0112] In one embodiment of the present invention, the vector is one or more. The vector capable of expressing the polynucleotide may be a vector system in which polynucleotides are simultaneously expressed from a single vector, or a system in which each polynucleotide is expressed from a separate vector.

[0113] In one embodiment of the present invention, the host cell used in step (ii) may be, but is not limited to, human embryonic kidney (HEK) 293 cells or HEK293 T cells.

[0114] In one embodiment of the present invention, eVLPs packaging Gag-Oct4, Gag-Sox2, and Gag-Klf4 are self-assembled in the transformed host cell in step (iii) and released outside the cell, and the released eVLPs float in the medium.

[0115] In one embodiment of the present invention, a centrifugation method may be used to separate eVLPs in step (iv).

[0116] In one embodiment of the present invention, the method further comprises the step of isolating, and optionally purifying or concentrating, the eVLP.

[0117] According to an embodiment of the present invention, it was confirmed that the composition of the present invention can effectively induce an increase in the expression of Oct4 and Sox2.

[0118] According to an embodiment of the present invention, the expression levels of Oct4 and Sox2 following treatment with the composition of the present invention increased to a maximum on the second day and then rapidly decreased, which proved that the composition of the present invention is suitable for inducing transient overexpression of Oct4 and Sox2.

[0119]

[0120] The features and advantages of the present invention are summarized as follows:

[0121] (a) The present invention provides a pharmaceutical composition for preventing or treating aging, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0122] (b) The present invention provides a pharmaceutical composition for preventing or treating a neurodegenerative disease, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

[0123] (c) The present invention provides a host cell comprising a polynucleotide.

[0124] (d) The present invention provides a method for producing an engineered virus-like particle (eVLP).

[0125] (e) When using an engineered virus-like particle (eVLP) comprising the Oct4, Sox2, and Klf4 proteins of the present invention, transient overexpression of Oct4 and Sox2 can be effectively induced, and overexpression can be safely induced compared to the existing doxycycline-induced expression method, so that it can be usefully used for the prevention or treatment of aging.

[0126]

[0127] Figure 1 shows the results of analysis of the mRNA expression levels of Oct4 and Sox2 in Neuro2a cells after treatment with eVLP-Oct4 and eVLP-Sox2.

[0128] Figure 2 shows the change in mRNA expression levels of Oct4 and Sox2 over time in Neuro2a cells after treatment with eVLP-Oct4 and eVLP-Sox2.

[0129] Figure 3 shows the results of analysis of the mRNA expression levels of Oct4 and Sox2 in Neuro2a cells after eVLP-OKS (Oct4, Klf4, Sox2) treatment.

[0130] Figure 4 shows the results of comparing gene expression on days 1 to 4 after eVLP treatment compared to gene expression on day 0.

[0131] Figures 5 and 6 show the results of GSEA analysis using RNA sequencing of eVLP-Oct4 and eVLP-Sox2 treated samples.

[0132] Figures 7 to 10 show changes in gene expression from day 0 to day 4 of genes in biological pathways whose expression increases after eVLP-Oct4 and eVLP-Sox2 treatment.

[0133] Figure 11 shows changes in Oct4 gene expression following eVLP injection into the ventricle.

[0134] Figure 12 shows changes in Oct4 gene expression following eVLP injection in the organ.

[0135] Figure 13 shows the results of tumor expression observation following eVLP injection in brain tissue.

[0136] Figure 14 shows the results of motor function evaluation (a), body weight (b), and brain weight measurement (c) after eVLP injection.

[0137]

[0138] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0139]

[0140] Example

[0141]

[0142] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0143]

[0144] Example 1: Production of Gag-Oct4, Gag-Sox2, and Gag-Klf4

[0145] The present inventors produced Gag-Oct4, Gag-Sox2, and Gag-Klf4 pDNA (plasmid DNA) to deliver Oct4, Sox2, and Klf4 to target cells using eVLPs.

[0146] First, the Oct4 and Sox genes were amplified through Q5 PCR using the primers listed in Table 1 and the template pDNA listed in Table 2.

[0147] The conditions of the mixture for PCR reaction are shown in Table 3, and the PCR cycling conditions are shown in Table 4.

[0148]

[0149] Primer name sequence (5' → 3') Sequence number pCMV-MMLVGag_FTGAGATCTTTTTCCCTCTGCC1 pCMV-MMLVGag_RCTTATCGTCATCGTCTTTGTAATCTC2 Oct4_For_Gag_FtctggagattacaaagacgatgacgataagGCTGGACACCTGGCTTCAGA3 Oct4_For_Gag_RataatttttggcagagggaaaaagatctcaGTTTGAATGCATGGGAGAGCCC4 Sox2_For_Gag_FtctggagattacaaagacgatgacgataagTATAACATGATGGAGACGGAGCTGAAGCC5 Sox2_For_Gag_RataatttttggcagagggaaaaagatctcaCATGTGCGACAGGGGCAGTG6

[0150]

[0151] template pDNApCMV-MMLVGag-3xNES-Cas9VB211011-1363tcn_AAV4-Nestin-HA-Oct4VB211011-1364vxg_AAV4-Nestin-FLAG-Sox2

[0152] Component50 μl ReactionQ5 High-Fidelity 2X Master Mix25 μl10 μM Forward Primer2.5 μl10 μM Reverse Primer2.5 μltemplate DNAvariable (to 10ng)Nuclease-Free Waterto 50 μl

[0153] Cycle countDenaturationAnnealingExtensionHold198℃, 30s---2~3198℃, 10sGag - 54℃, 15minOct4 - 54℃, 15sSox2 - 54℃, 15sGag - 72℃, 3.5minOct4 - 72℃, 30sSox2 - 72℃, 30s-32--72℃, 2min-33---12℃, hold

[0154]

[0155] For Klf4, the DNA sequence for Gibson assembly was designed as shown in Table 5 and gblock was ordered.

[0156]

[0157] Klf4 SEQ ID CTCCAGGGTTTCACCCACATCCCGGGCCCAACTACCCGCCGTTCTTGCCTGATCAGATGCAGAGTCAAGTTCCTTCCCTCCATTATCAGGAGCTGATGCCGCCAGGCTCTTGTTTGCCTGAGGAACCTAAGCCCAAGAGAGGGCGCCGGAGTTGGCCTCGGAAACGCACTGCCACACATACCTGTGATTACGCAGGCTGCGGCAAGACGT ACACTAAGAGTAGTAGTCACCTCAAAGCTCACCTGCGCACCCACACAGGAGAAAAGCCCTACCATTGCGATTGGGACGGGTGCGGCTGGAAATTTGCCCGGAGTGACGAGTTGACTCGCCACTACAGAAAACACACGGGACATCGGCCGTTCCAGTGCCAGAAGTGCGATAGAGCATTTTCCAGATCCGACCACCTCGCCCTGCACATGAAGCGACACTTT7

[0158] To confirm successful PCR amplification, 5 μL of the PCR product was loaded onto a 1% gel and electrophoresed. The PCR product was then purified using a PCR purification kit according to the manufacturer's instructions, and its concentration was measured.

[0159] Afterwards, for cloning, the restriction enzyme DpnI was treated under the conditions shown in Table 6.

[0160]

[0161] Components Volume DNA <5000 ng DpnI2 μl Cutsmart buffer 10 μl Deionized H2Oto 88 μl

[0162] After treatment, the reaction was incubated at 37°C for 1 hour, and the concentration was measured after purification using a PCR Product Purification Kit. Next, cloning of Gag-Oct4, Gag-Sox2, and Gag-Klf4 was performed using an Assembly Cloning Kit.

[0163]

[0164] ComponentVolumeTotal Amount of Fragments0.02-0.5 pmolsGibson Assembly Master Mix (2X)10 μlDeionized H2Oto 20 μl

[0165] After adding the amount shown in Table 7 and reacting at 50°C for 1 hour, 10 μL of the mixture and 100 μL of competent E. coli were placed in one tube to proceed with transformation.

[0166] Next, the transformed E. coli was midi-prepped to extract Gag-Oct4, Gag-Sox2, and Gag-Klf4 plasmid DNA.

[0167]

[0168] Example 2. Production of Engineered Virus-Like Particles

[0169] The present inventors sought to prepare eVLPs for delivering Oct4, Sox2, and Klf4.

[0170] First, Gesicle producer 293T cells were seeded at 1×10 in a 150 mm dish. 7The cells were inoculated at a concentration of 10 cells / dish. Then, the amount shown in Table 8 was added to the inoculated cells and cultured overnight.

[0171]

[0172] -Component volume VLP-Oct4 treatment group VSV-G pDNA 1600 ng Gag-pol pDNA 13200 ng Gag-Oct4 pDNA 4400 nge VLP-Sox2 treatment group VSV-G pDNA 1600 ng Gag-pol pDNA 13200 ng Gag-Sox2 pDNA 4400 nge VLP-OKS (Oct4, Sox2, Klf4) treatment group VSV-G pDNA 1600 ng Gag-pol pDNA 13200 ng Gag-Oct4 pDNA 1467 ng Gag-Sox2 pDNA 1467 ng Gag-Klf4 pDNA 1467 ng

[0173] Next, the medium was replaced and cultured in a 37℃ CO2 incubator for 48 hours. After culture, only the supernatant was separated and transferred to a new tube, and centrifuged at 500 rcf for 5 minutes to precipitate cell debris, and only the supernatant was transferred to a new tube. For concentration, a virus concentration solution (1 / 4 the amount of the supernatant) was added, and the tube was placed on a rotator and mixed overnight at 4℃. Next, eVLPs were precipitated by centrifugation at 1500 rcf for 30 minutes, and the supernatant was removed. The precipitated eVLPs were diluted with the virus concentration reagent and stored at -80℃.

[0174]

[0175] Example 3: Preparation of eVLP-Oct4 and eVLP-Sox2 transduced cells

[0176] The present inventors attempted to transduce cells with eVLPs containing Oct4, Sox2, and Klf4 proteins.

[0177] Specifically, first, 1.5×10 Neuro2a was added to a 24-well plate. 5 Cells were inoculated at a concentration of 10 cells / well and cultured overnight in a 37°C CO2 incubator. After incubation, eVLP-Oct4 and eVLP-Sox2 were treated individually in each well at 1, 2, 4, 8, and 16 μL, respectively, and cultured in a 37°C CO2 incubator for 48 hours.

[0178] After incubation, 1 mL of medium was added and cultured overnight in a 37°C CO2 incubator. Upon completion of incubation, the supernatant was removed, and 200 μL of trypsin was treated to the eVLP-transduced Neuro2a cells, and the cells were detached by sufficient pipetting. The detached cells were transferred to an e-tube, centrifuged at 12,000 rpm for 5 minutes to sediment the cells, and the supernatant was completely removed.

[0179]

[0180] Example 4. RNA extraction from eVLP-transduced cells

[0181] The inventors of the present invention used the RNeasy Mini Kit to extract RNA from eVLP-transduced Neuro2a cells.

[0182] First, a master mix was prepared by mixing 40 μL of 1 M dithiothreitol (DTT) per 1 mL of Buffer RLT, and 350 μL of the master mix was added to the tube containing the precipitated cells and pipetted to lyse the cells. Next, 350 μL of 70% ethanol was added and vortexed. The entire sample (700 μL) was collected by pipetting, transferred to an RNeasy Mini spin column, and centrifuged at 8000 g for 15 seconds to precipitate. After replacing it with a new tube, 700 μL of Buffer RW1 was added, and centrifuged at 8000 g for 15 seconds. After centrifugation, the column was replaced with a new tube, 500 μL of Buffer RPE was added, and centrifuged at 8000 g for 15 seconds. After replacing with a new tube, 500 μL of Buffer RPE was added to the column for washing and centrifuged at 8000 g for 2 minutes. Finally, the collection tube was discarded, an e-tube was inserted under the column, 50 μL of RNase-free water was added, and the column was centrifuged at 8000 g for 1 minute to elute the RNA. The RNA concentration was measured and stored at -20°C.

[0183]

[0184] Example 5: Confirmation of induction of Oct4 and Sox2 gene expression through eVLP-mediated delivery

[0185] To evaluate whether eVLP-mediated delivery of Oct4 and Sox2 effectively induces increased expression of Oct4 and Sox2, the inventors attempted to determine the mRNA expression levels of Oct4 and Sox2 in RNA from eVLP-Oct4 and eVLP-Sox2 transduced Neuro2a cells.

[0186] First, TOPscript TMcDNA was synthesized from RNA samples using a cDNA Synthesis Kit under the conditions shown in Tables 9 and 10.

[0187]

[0188] Component50 μl ReactionTOPscript Reverse Transcriptase2 μlRT buffer1 μldNTP2 μlOligo dT1 μlRNase inhibitor0.5 μlRNA samplex μl(1100ng)Deionized H2Oup to 20 μl

[0189] Cycle countAnnealingExtensionHold154℃, 1 hr--2-95℃, 5 min-3--12℃, hold

[0190]

[0191] qPCR was performed from the synthesized cDNA using the KAPA SYBR® FAST qPCR Master Mix (2X) Kit under the conditions shown in Tables 12 and 13. At this time, qPCR was performed on cDNA synthesized from the sample treated with eVLP-Oct4 using Oct4 primer and GAPDH primer, and qPCR was performed on cDNA synthesized from the sample treated with eVLP-Sox2 using Sox2 primer and GAPDH.

[0192]

[0193] Primer name sequence (5'→3')SEQ ID NO:Oct4_FAACGGCAGCTACAGCATGATGC8Oct4_RCGAGCTGGTCATGGAGTTGTAC9Sox_FCAGCAGATCACTCACATCGCCA10Sox_RGCCTCATACTCTTCTC GTTGGG11Klf4_FGTGCCCCGACTAACCGTTG12Klf4_RGTCGTTGAACTCCTCGGTCT13GAPDH_FGTTGTCTCCTGCGACTTCA14GAPDH_RGGTGGTCCAGGGTTTCTTA15

[0194] Component50 μl ReactionKAPA SYBR FAST qPCR Master Mix (2X)Universal210 μl10 μM Forward Primer1 μl10 μM Reverse Primer1 μlsynthesized cDNA1 μlDeionized H2Oup to 20 μl

[0195]

[0196] Cycle numberDenaturationAnnealing&ExtensionMelting&DetectionEnd195℃, 30 s---2~5195℃, 10 s60℃, 10 s--52-65℃, 5 s95℃, 5 s-53---End

[0197] The mRNA expression of Oct4 and Sox2 was analyzed using the obtained Ct information, and the results are shown in Fig. 1.

[0198] As shown in Fig. 1, the expression level analysis results confirmed that the mRNA expression levels of Oct4 and Sox2 in samples treated with eVLP-Oct4 and eVLP-Sox2 significantly increased compared to the untreated group, and in samples treated with 16 μL of eVLP, Sox2 mRNA increased significantly by 32119 times and Oct4 mRNA increased significantly by 1012 times.

[0199]

[0200] Example 5: Confirmation of the persistence of overexpression of Oct4 and Sox2 genes induced by eVLP-mediated delivery.

[0201] To confirm the persistence of the effect of inducing overexpression of Oct4 and Sox2 following eVLP-mediated delivery of Oct4 and Sox2, the present inventors conducted a time-line check experiment.

[0202] First, 1.5×10 Neuro2a were seeded in a 24-well plate. 5Cells were inoculated at a concentration of 10 cells / well and cultured overnight in a 37°C CO2 incubator. After culture, eVLP-Oct4 and eVLP-Sox2 were transduced into 5 wells at a volume of 8 μL / well, and samples were collected daily for a total of 5 days. At this time, the eVLP treatment volume was fixed at 8 μL, the lowest volume where an increase in expression was clearly observed, and the experiment was conducted using the RNA extraction and qPCR methods described in Example 4, and the results are shown in Fig. 2.

[0203] As shown in Fig. 2, eVLP-mediated Oct4 and Sox2 delivery showed a maximum increase in the mRNA expression levels of Oct4 and Sox2 on the second day after treatment, and a rapid decrease in the mRNA expression levels from the third day onwards.

[0204] These results suggest that eVLP-mediated delivery of Oct4 and Sox2 is suitable for inducing transient overexpression of Oct4 and Sox2.

[0205]

[0206] Example 6: Confirmation of gene expression induction by eVLP delivery containing Oct4, Sox2, and Klf4 simultaneously.

[0207] To evaluate whether eVLP-mediated simultaneous delivery of Oct4, Sox2, and Klf4 effectively induces overexpression of Oct4 and Sox2, the present inventors sought to determine the mRNA expression levels of Oct and Sox2 after treatment with eVLPs containing Oct4, Sox2, and Klf4 simultaneously.

[0208] First, 1.5×10 Neuro2a were seeded in a 24-well plate. 5Cells were seeded at a concentration of 10 cells / well and cultured overnight in a 37°C CO2 incubator. After incubation, Neuro2a cells were treated with 1, 2, 4, 8, and 16 μL of eVLP-OKS, respectively. qPCR was then performed to confirm changes in the mRNA expression levels of Oct4 and Sox2 after eVLP treatment, and the results are shown in Figure 3.

[0209] As shown in Fig. 3, the mRNA expression analysis results showed that when 16 μL of eVLP-OKS was treated, Oct4 increased 1993-fold and Sox2 increased 3173-fold compared to the control group.

[0210] From these results, it is believed that the simultaneous delivery method can also effectively induce transient overexpression of Oct4 and Sox2 and will be useful for improving aging-related phenotypes.

[0211] In conclusion, the present invention is a novel transient overexpression induction system that effectively induces transient overexpression of Oct4 and Sox2, inducing overexpression more safely than the existing Dox-inducible expression system, and is highly likely to be useful in improving aging-related phenotypes.

[0212]

[0213] Example 7: Measurement of gene expression levels through RNA sequencing

[0214] We aimed to confirm the regulation of gene expression following eVLP-mediated co-delivery of Oct4, Sox2, and Klf4 using RNA sequencing data.

[0215] After removing exp = 0 from day 0 to day 4, fc was calculated by adding 5e-07 to all exp, and GSEA was performed based on the FC ranking of day 4 compared to day 0 (total n = 25,720), and the results are shown in Figures 4 to 10.

[0216] Figure 4 shows the results of comparing gene expression on days 1 to 4 after eVLP treatment with gene expression on day 0, with gene expression on day 0 set as the x-axis and expression on days 1 to 4 after treatment set as the y-axis.

[0217] As shown in Fig. 4, gene expression was significantly increased on days 1 to 3, and the two points indicated on the y-axis corresponded to Oct4 and Sox2, showing results corresponding to the qPCR results.

[0218]

[0219] Figures 5 and 6 show the results of GSEA analysis using RNA sequencing of eVLP-Oct4 and eVLP-Sox2 treated samples.

[0220] As a result of GSEA analysis, the degree of gene expression abundance was in the order of yellow < orange < red, and it was confirmed that the biological pathways rich in genes with increased expression were mainly synaptic transmission or regulation pathways related to neural function and sensory perception pathways that recognize various external stimuli.

[0221] Given that Neuro2a cells are derived from the nervous system, increased expression of genes within this pathway suggests improved cell function and aging.

[0222]

[0223] Figures 7 to 10 show changes in gene expression of biological pathways related to the nervous system, senses, and aging, and genes within the biological pathways from day 0 to day 4 after eVLP-Oct4 and eVLP-Sox2 treatment.

[0224] As shown in Figures 7 to 10, it was confirmed that eVLP-Oct4 and eVLP-Sox2-mediated Oct4 and Sox2 overexpression significantly increased the expression of genes in biological pathways related to the nervous system, senses, and aging.

[0225]

[0226] Example 8: Confirmation of changes following eVLP injection in a Huntington's disease mouse model

[0227] The present inventors sought to confirm the therapeutic effect of eVLP (eVLP-Oct4+Sox2, eVLP- Oct4+Sox2+Klf4) in a Huntington's disease mouse model.

[0228] The Huntington's disease mouse model was purchased and bred using B6CBA-Tg(HDexon1)62Gpb / 1J (Jackson, USA).

[0229]

[0230] 8-1. Confirmation of short-term expression of Oct4 in the brain after eVLP injection

[0231] After injecting eVLPs containing Oct4, Sox2 and eVLPs containing Oct4, Sox2, and Klf4 simultaneously into the ventricle of a Huntington's disease model, short-term expression of Oct4 in the brain was confirmed 2 days later, and the results are shown in Fig. 11.

[0232] As shown in Fig. 11, it was confirmed that the expression level of Oct4 was significantly increased in the subventricular zone (SVZ) of mice injected with eVLPs containing Oct4 and Sox2 and eVLPs containing Oct4, Sox2, and Klf4 simultaneously, compared to the control group.

[0233]

[0234] 8-2. Confirmation of short-term expression of Oct4 in organs after eVLP injection

[0235] After injecting eVLPs containing Oct4, Sox2, and Klf4 simultaneously into the ventricle of a Huntington's disease model, short-term expression of Oct4 in the organ was confirmed 2 days later, and the results are shown in Fig. 12.

[0236] As shown in Fig. 12, when eVLPs containing Oct4, Sox2, and Klf4 were injected simultaneously, the expression of Oct4 increased in the kidney compared to the control group, but no change in the expression level of Oct4 was observed in other organs (heart, liver, kidney, lung, and spleen).

[0237]

[0238] 8-3. Confirmation of tumor occurrence after eVLP injection

[0239] After injecting eVLPs containing Oct4 and Sox2 simultaneously into a Huntington's disease model, 12-week-old mice were sacrificed to determine whether tumors occurred in the brain tissue.

[0240] Brain tissue was stained with hematoxylin & eosin (H&E), and the pathological results of the brain tissue stained with hematoxylin and eosin are shown in Figure 13.

[0241] As shown in Figure 13, when eVLPs containing Oct4 and Sox2 were injected simultaneously, no tumor development was observed compared to the control group.

[0242] These results indicate that eVLPs containing Oct4 and Sox2 simultaneously effectively induce transient overexpression of Oct4 and Sox2, which are then degraded, preventing tumorigenesis.

[0243]

[0244] 8-4. Motor function assessment and body weight and brain weight measurement after eVLP injection

[0245] After injecting eVLPs containing Oct4 and Sox2 simultaneously into the ventricle of a Huntington's disease model, motor function was evaluated and body weight and brain weight were measured, and the results are shown in Figures 14a to 14c.

[0246] As shown in Figures 14a to 14c, mice injected with eVLPs containing both Oct4 and Sox2 exhibited improved motor skills, while no significant changes in body weight were observed. Furthermore, brain weight measurements revealed that when injected with eVLPs containing both Oct4 and Sox2, brain weight increased compared to the control group.

[0247]

[0248] These results suggest that eVLPs containing both Oct4 and Sox2 effectively induce transient overexpression of Oct4 in a Huntington's disease mouse model and improve motor ability without side effects, suggesting that they may be used as a therapeutic agent for neurodegenerative diseases, including Huntington's disease.

Claims

1. A pharmaceutical composition for preventing or treating aging, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient, wherein the eVLP comprises the following components: (i) vesicular stomatitis virus (VSV) envelope glycoprotein (VSV-G) bound to the eVLP envelope; (ii) gag-pol protein forming the membrane structure of eVLP; and (iii) gag-Oct4, gag-Sox2, and gag-Klf4 proteins located on the inner side of the eVLP membrane.

2. A pharmaceutical composition for preventing or treating a neurodegenerative disease, comprising an engineered virus-like particle (eVLP) comprising Oct4, Sox2, and Klf4 proteins as an active ingredient.

3. In the second paragraph, the neurodegenerative disease is at least one selected from the group consisting of Alzheimer's disease, Alzheimer's dementia, vascular dementia, Lewy body dementia, frontotemporal dementia, corticobasal degeneration, Parkinson's disease, multiple system atrophy, Huntington's chorea, progressive supranuclear palsy, amyotrophic lateral sclerosis, primary lateral sclerosis, spinal muscular atrophy, brain inflammation, and neuronal cell death, a pharmaceutical composition for preventing or treating a neurodegenerative disease. Composition.

4. A host cell comprising the following polynucleotide. (i) a polynucleotide expressing VSV-G protein; (ii) a polynucleotide expressing a gag-pol protein; (iii) a polynucleotide expressing gag-Oct4 protein; (iv) a polynucleotide expressing gag-Sox2 protein; and (v) A polynucleotide expressing gag-Klf4 protein.

5. A host cell according to claim 4, wherein the polynucleotides (i) to (v) are contained within a vector.

6. A host cell according to claim 4, wherein the polynucleotides (i) to (v) are contained in one or more vectors.

7. In the fourth paragraph, the host cell is a host cell that is a human embryonic kidney (HEK) 293 cell or a HEK293 T cell.

8. A method for manufacturing an engineered virus-like particle (eVLP), comprising the following steps: (i) a step of producing a vector expressing VSV-G protein, Gag-pol protein, Oct4 protein, Sox2 protein, and Klf4 protein; (ii) a step of transforming the vector into a host cell; (iii) a step of obtaining a medium supernatant in which the transformed host cell is cultured; and (iv) A step of isolating eVLPs from the above medium supernatant.

9. A manufacturing method according to claim 8, wherein the vector is one or more.

10. A manufacturing method according to claim 8, further comprising a step of isolating and optionally purifying or concentrating eVLPs.

Citation Information

Patent Citations

  • How to specify medicine bags and customer information

    KR1020240147337A

  • Methods and compositions for protein delivery

    US10577397B2

  • Virus-like particles and use thereof

    US20210269790A1

  • Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells

    US20220259617A1