Composition comprising rice lactic acid fermented product for improving intestinal health
The use of a fermented rice lactic acid product, derived from Lactobacillus plantarum fermentation, addresses the limitations of current IBS and IBD treatments by improving intestinal health, enhancing flora balance, and reducing inflammation, thereby effectively managing symptoms.
Patent Information
- Application Number
- PCT/KR2024/020681
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-20
- Filing Date
- 2024-12-19
- Publication Date
- 2025-06-26
AI Technical Summary
Current treatments for irritable bowel syndrome (IBS) and inflammatory bowel diseases (IBD) often come with side effects and fail to address the underlying intestinal health issues, particularly in managing symptoms like constipation and diarrhea without exacerbating them.
A composition containing fermented rice lactic acid product, prepared using Lactobacillus plantarum, which improves intestinal health by enhancing intestinal flora and reducing colitis symptoms.
The fermented rice lactic acid product effectively improves intestinal health by promoting beneficial bacteria, reducing inflammation, and alleviating symptoms of IBS and IBD, as demonstrated in animal models with DSS-induced colitis and stress exposure.
Smart Images

Figure KR2024020681_26062025_PF_FP_ABST
Abstract
Description
Composition for improving intestinal health containing fermented rice lactic acid
[0001] The present invention relates to a composition for improving intestinal health including fermented rice lactic acid product, and more specifically, to the use of fermented rice lactic acid product prepared by fermenting a rice extract using Lactobacillus plantarum for improving intestinal health, such as improving intestinal flora or improving colitis.
[0002]
[0003] Intestinal disorders such as irritable bowel syndrome and inflammatory bowel disease are chronic conditions characterized by recurring unpleasant digestive symptoms like abdominal bloating and indigestion, as well as bowel disturbances like diarrhea and bloody stool. While the precise pathogenesis remains unknown, recent studies suggest that they are triggered by excessive intestinal permeability caused by factors such as stress and infection.
[0004] Novartis of Switzerland developed Zelmac (tegaserod hydrogen maleate) as a treatment for irritable bowel syndrome, but its sales were banned because it caused side effects such as ischemic cardiovascular disease (myocardial infarction, stroke, angina pectoris), and since then, no drug has been developed that can treat both constipation and diarrhea, which are the main symptoms of irritable bowel syndrome, without side effects. As a temporary measure, laxatives (antidiarrheal drugs) are prescribed when diarrhea occurs, and laxatives (purgatives) are prescribed when constipation occurs, but there is a problem that symptoms worsen if these agents are overused. In particular, laxatives are known to cause side effects such as exhaustion, weakness, and dependence, and laxatives are known to cause side effects such as constipation.
[0005] Since the main cause of irritable bowel syndrome is a weak intestine or stress, it is expected that simply treating symptoms such as constipation or diarrhea will not have a fundamental effect, and that relieving stress will be necessary to achieve a fundamental effect. In order to develop a treatment that can achieve this effect, active research is being conducted to obtain effective ingredients from natural products with no or few side effects.
[0006]
[0007] Meanwhile, the inventors of the present invention have previously conducted research on rice lactic acid fermentation using Lactobacillus plantarum, and have confirmed that rice lactic acid fermentation using Lactobacillus plantarum JSA22, developed by the inventors, has various excellent functional properties. However, the effects of the rice lactic acid fermentation on improving intestinal health, including irritable bowel syndrome, have not yet been studied.
[0008]
[0009] The present inventors completed the present invention by confirming that a composition containing fermented rice lactic acid as an active ingredient can improve intestinal health.
[0010]
[0011] One object of the present invention is to provide a food composition for improving intestinal health, which comprises a fermented rice lactic acid product as an effective ingredient.
[0012] Another object of the present invention is to provide a feed composition for improving intestinal health, which comprises fermented rice lactic acid as an effective ingredient.
[0013]
[0014] The fermented rice lactic acid product of the present invention has excellent intestinal health improvement properties such as improvement of intestinal flora and / or improvement of colitis, and can be usefully utilized as a composition for improving intestinal health.
[0015]
[0016] Figure 1 is a diagram showing the changes in the microbial community in the large intestine (NS: untreated, Milk: fermented milk, SG: fermented Samkwang rice lactic acid, JH: fermented Jo Eun black rice lactic acid).
[0017] Figure 2 is a diagram showing the change in SCFA, a representative metabolite in the large intestine.
[0018] Figure 3 is a diagram illustrating the experimental design of the DDS-induced colitis model.
[0019] Figure 4 is a diagram showing the effect on disease activity of DDS-induced colitis (Con: normal control group, C-only: DDS-induced + normal drinking water administration group, DSS-UFR: DDS-induced + non-fermented rice raw material administration group, DDS-FR: DDS-induced + rice lactic acid fermentation administration group).
[0020] Figure 5 is a diagram showing the bloody stool condition of DDS-induced colitis mice.
[0021] Figure 6 is a diagram measuring the difference in colon length in mice with DDS-induced colitis.
[0022] Figure 7 is a diagram confirming the difference in the expression of proinflammatory cytokines IL-6 and TNF-α mRNA in the mucosa of the distal colon of mice with DSS-induced colitis.
[0023] Figure 8 is a diagram confirming the difference in the pattern of mucosal thickening in the colon of mice with DSS-induced colitis.
[0024] Figure 9 is a diagram illustrating the design of the water avoidance stress-DSS-induced colitis experiment.
[0025] Figure 10 is a photograph showing a water avoidance stress experiment scene.
[0026] Figure 11 is a diagram showing the effect on disease activity of a water avoidance stress-DSS-induced colitis model (Sham: normal control group, WAS+DSS+Tap: water avoidance stress + DSS-induced + normal drinking water administration group, WAS+DSS+FR: water avoidance stress + DSS-induced + fermented rice lactic acid administration group).
[0027] Figure 12 is a diagram showing the difference in fecal discharge in a water avoidance stress-DSS induced colitis model.
[0028] Figure 13 is a diagram showing the difference in the expression of proinflammatory cytokine IL-6 mRNA in the distal colonic mucosa of water avoidance stress-DSS-induced colitis model mice.
[0029] Figure 14 is a diagram showing the difference in the expression of tight junction protein Occludin mRNA in the distal colonic mucosa of water avoidance stress-DSS induced colitis model mice.
[0030] Figure 15 is a diagram showing the difference in expression of tight junction proteins ZO-1 and Occludin in the distal colonic mucosa of a colitis model.
[0031] Figure 16 is a diagram showing the difference in expression of mucus protein MUC2 mRNA in the distal colonic mucosa of water avoidance stress-DSS-induced colitis model mice.
[0032]
[0033] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.
[0034] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Furthermore, such equivalents are intended to be encompassed by the present invention.
[0035]
[0036] One aspect of the present invention provides a food composition for improving intestinal health, comprising a fermented rice lactic acid product as an effective ingredient.
[0037] In the present invention, while exploring various uses of rice lactic acid fermentation product manufactured by fermenting rice extract using Lactobacillus plantarum, the inventors of the present invention confirmed that the rice lactic acid fermentation product developed by the present inventors is effective in improving intestinal health, such as improving intestinal microflora or colitis, and the present invention seeks to provide such uses.
[0038]
[0039] The rice lactic acid fermentation product, which is an effective ingredient of the present invention, may be a product obtained by fermenting a rice extract with Lactobacillus plantarum.
[0040] The term "rice" in the present invention refers to white rice refined by milling rice. For the purpose of the present invention, the rice may be rice from which the germ and bran layer have been completely removed through milling. The varieties of the rice are not particularly limited, but may include, but are not limited to, Samkwang, Hangaru, Hiami, Cheongpum, Ilpum, Dodam, Goami 2, Goami 4, Hongjinju, Jeokjinju, Joeun Black Rice, Suwon 542, and Miryang 317, and specifically, may be Samkwang or Joeun Black Rice.
[0041] The term "lactic acid fermentation product" of the present invention refers to a general term for a substance fermented using lactic acid bacteria (lactic acid bacteria), and may be used interchangeably with "lactic acid bacteria fermentation product" in the present invention. In addition, for the purpose of the present invention, the lactic acid fermentation product may not contain dairy products. The dairy products collectively refer to foods made by processing milk from livestock, and include milk, butter, cheese, condensed milk, powdered milk, etc., and in the present invention, a lactic acid fermentation product of rice can be produced without dairy products containing milk.
[0042]
[0043] In the present invention, the rice extract for producing the rice lactic acid fermentation product is a general term for products extracted from rice, and includes the rice itself, an extract obtained by extracting rice, a diluted or concentrated extract, a dried product obtained by drying the extract, a conditioned or purified product of the extract, or a mixture thereof, and all extracts in the form of extracts that can be formed using the extract. Specifically, it may be a mixture of (i) rice paste prepared by mixing rice and water, and (ii) rice germ oil prepared by mixing rice germ and water.
[0044] The above rice paste may be prepared by mixing rice and water, and specifically, may be prepared by mixing 5 to 35% (w / w) of rice and 65 to 95% (w / w) of water, more specifically, 15 to 35% (w / w) of rice and 65 to 85% (w / w) of water, and most specifically, 20 to 30% (w / w) of rice and 70 to 80% (w / w) of water, but is not limited thereto. The above rice paste may mean a mixture of rice and water that has been ground.
[0045] The above rice germ oil may be manufactured by mixing rice germ and water, and specifically, may be manufactured by mixing 5 to 15% (w / w) of rice germ and 85 to 95% (w / w) of water, and more specifically, may be manufactured by mixing 8 to 12% (w / w) of rice germ and 88 to 92% (w / w) of water, but is not limited thereto. The above rice germ oil may mean a mixture of rice germ and water that is ground or a mixture that is ground and filtered.
[0046] The above rice paste and rice germ oil are manufactured and mixed to maximize the quality characteristics and sensory characteristics of the rice lactic acid fermentation product and to a degree that does not inhibit fermentation by lactic acid bacteria, thereby manufacturing a rice extract. Afterwards, a rice lactic acid fermentation product can be manufactured through fermentation by lactic acid bacteria. Specifically, the rice paste and rice germ oil can be manufactured by mixing equal amounts by volume, but is not limited thereto.
[0047] In the production of the rice extract of the present invention, processes such as sugar addition, sterilization, and homogenization may be added so as not to cause limitations in subsequent fermentation, but are not limited thereto.
[0048] The above-mentioned manufactured rice extract can be fermented using a microorganism of the genus Lactobacillus, specifically Lactobacillus plantarum, to produce the rice lactic acid fermentation product of the present invention.
[0049] The above Lactobacillus plantarum can be inoculated into the rice extract at 0.05 to 0.15% (v / v), specifically 0.07 to 0.13% (v / v), most specifically 0.1% (v / v), but is not limited thereto as long as fermentation can be performed.
[0050] In the present invention, the Lactobacillus plantarum may be Lactobacillus plantarum JSA22, i.e., Lactobacillus plantarum having the accession number KACC91973P, described in Korean Patent Publication No. 10-1634270, which is a prior patent of the present inventor. The strain is a lactic acid bacterium isolated and selected from traditional soybean paste, and is characterized by excellent antibacterial activity, artificial digestive fluid survival rate, and adhesiveness.
[0051]
[0052] The fermented rice lactic acid product of the present invention is characterized by showing an excellent effect in improving intestinal health.
[0053] In the present invention, "intestinal health" refers to the general maintenance of proper intestinal function, while "improved intestinal health" refers to the general maintenance of beneficial or proper intestinal function and the reduction of related diseases and symptoms. Specifically, this may refer to improved intestinal microflora or colitis, but is not limited thereto.
[0054] The above improvement of intestinal microflora has the same meaning as improvement of intestinal microflora or maintenance of intestinal microflora balance, and may mean promoting the growth of beneficial intestinal bacteria included in the intestinal microflora and inhibiting the growth of harmful intestinal bacteria. In addition, the beneficial intestinal bacteria may include microorganisms of the genus Lactobacillus or microorganisms of the genus Bifidobacterium, and in one embodiment of the present invention, it was confirmed that the effect of improving intestinal microflora can be achieved by confirming that the population of microorganisms of the genus Lactobacillus or microorganisms of the genus Bifidobacterium increases according to the treatment of the fermented rice lactic acid product of the present invention.
[0055] Colitis, as mentioned above, is a condition in which inflammation occurs in the large intestine. Inflammation can occur due to various causes, and depending on the cause, it can be broadly classified into infectious enteritis and non-infectious enteritis. Representative examples of non-infectious colitis include, but are not limited to, inflammatory bowel diseases such as ulcerative colitis and Crohn's disease, which fall under the category of macroscopic colitis, and irritable bowel syndrome, which falls under the category of microscopic colitis.
[0056] Inflammatory bowel disease is a disease that causes chronic diarrhea, abdominal pain, bloody stool, and weight loss, and mucosal ulcers are observed in colonoscopy, and relapse is common. In one embodiment of the present invention, the colitis-improving effect of the rice lactic acid fermentation product of the present invention was confirmed through a DSS-induced inflammatory bowel disease model.
[0057] In addition, irritable bowel syndrome is a functional chronic intestinal disease that occurs when intestinal dysfunction occurs without other diseases or anatomical abnormalities, and is accompanied by chronic abdominal pain or abdominal discomfort, defecation disorders, etc., although there are no abnormal findings in colonoscopy. It is assumed that the mechanism is stress, intestinal movement disorder, intestinal mucosal immunity disorder, intestinal microbiota imbalance, brain-gut axis disorder, etc. In one embodiment of the present invention, based on the pathophysiology of such irritable bowel syndrome, the effect of the fermented rice lactic acid product of the present invention on improving irritable bowel syndrome was confirmed through a mouse model exposed to stress along with DSS induction.
[0058]
[0059] The term "food" of the present invention includes all foods in the conventional sense, such as snacks, confectionery, bread, pizza, ramen, other noodles, rice, instant rice, dairy products including ice cream, health foods, etc., and is not limited thereto, as long as the fermented rice lactic acid product may be included.
[0060] When using the composition of the present invention as a health functional food additive, the fermented rice lactic acid product can be added directly or combined with other foods or food ingredients, and can be used appropriately according to conventional methods. The amount of active ingredients mixed can be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment). Since the composition of the present invention has no stability issues, there are no significant restrictions on the amount mixed.
[0061] Since the food composition of the present invention can be consumed on a daily basis, it can be expected to have an effect of improving intestinal health, and thus can be very usefully used for health promotion purposes.
[0062] The above term, "health functional food", is the same as food for special health use (FoSHU), and refers to a food with high medical and healthcare effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition. Here, "function" means regulating nutrients for the structure and function of the human body or obtaining a useful effect for health purposes such as physiological action. The health functional food of the present invention can be manufactured by a method commonly used in the art, and can be manufactured by adding raw materials and ingredients commonly added in the art during the manufacturing process. In addition, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur with long-term administration of drugs because it uses food as a raw material, and is highly portable, so the health functional food of the present invention can be consumed as a supplement to enhance the effect of improving intestinal health.
[0063] The above health functional foods refer to foods that have a more active health maintenance or promotion effect than regular foods, while health supplement foods refer to foods intended for health supplementation. In some cases, the terms health functional foods, health foods, and health supplements are used interchangeably.
[0064] Specifically, the health functional food means a food product manufactured by adding the composition of the present invention to food materials such as beverages, teas, spices, gums, and confectionery, or by manufacturing it in the form of encapsulation, powder, suspension, etc., and means that when consumed, it brings about a specific health effect, but unlike general drugs, it has the advantage of not having side effects that may occur with long-term use of drugs by using food as a raw material.
[0065] The above food composition may additionally include a physiologically acceptable carrier. The type of the carrier is not particularly limited, and any carrier commonly used in the art may be used.
[0066] In addition, the food composition may include additional ingredients commonly used in food compositions to improve odor, taste, appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and amino acids such as lysine, tryptophan, cysteine, and valine.
[0067] In addition, the food composition may include food additives that are acceptable in terms of food science, such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), sterilizers (bleaching powder and high-purity bleaching powder, sodium hypochlorite, etc.), antioxidants (butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), etc.), colorants (tar colorants, etc.), colorants (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, D-potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (glucose fillers), film-forming agents, gum-forming agents, foam suppressants, solvents, and improvers. The above additives can be selected according to the type of food and used in an appropriate amount.
[0068] As an example, the food composition of the present invention can be used as a health beverage composition, and in this case, it can contain various flavoring agents or natural carbohydrates as additional ingredients like a regular beverage. The above-mentioned natural carbohydrates can be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; sugar alcohols such as xylitol, sorbitol, and erythritol. The sweetener can be a natural sweetener such as thaumatin and stevia extract; a synthetic sweetener such as saccharin and aspartame, etc. The proportion of the natural carbohydrate can be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 mL of the health beverage composition of the present invention.
[0069] In addition to the above, the health beverage composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. Furthermore, the composition may contain fruit pulp for the production of natural fruit juice, fruit juice beverages, or vegetable beverages. These ingredients may be used independently or in combination.
[0070] The proportion of these additives is not particularly important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition of the present invention.
[0071]
[0072] Another aspect of the present invention for achieving the above object provides a feed composition for improving intestinal health, comprising a fermented rice lactic acid product as an effective ingredient.
[0073] The above terms, rice lactic acid fermentation, and improvement of intestinal health are as described above.
[0074] The term "feed" in the present invention means any natural or artificial diet, meal, etc. or ingredients of said meal for eating, ingesting, and digesting by an animal or suitable therefor.
[0075] The type of the above feed is not particularly limited, and feed commonly used in the relevant technical field can be used. Non-limiting examples of the above feed include plant feed such as grains, roots, food processing by-products, algae, fiber, pharmaceutical by-products, oils, starches, meal, or grain by-products; and animal feed such as proteins, inorganic substances, oils, mineral substances, oils, single-cell proteins, zooplankton, or food. These may be used alone or in combination of two or more.
[0076] The amount of the rice lactic acid fermentation product of the present invention included in the feed composition of the present invention may vary depending on the purpose and conditions of use of the feed, and for example, may be included in an amount of 0.01 to 100 wt%, more specifically, 1 to 80 wt%, based on the total weight of the livestock feed composition.
[0077]
[0078] The present invention is described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present invention and are therefore not intended to limit the scope of the present invention. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present invention or similar fields.
[0079]
[0080] Example 1: Preparation of fermented rice lactic acid product
[0081]
[0082] A lactic acid fermentation product containing rice and rice germ was prepared in the following manner.
[0083] First, refined rice was ground using a test grinder, and then rice flour passed through a 50-mesh sieve was used. The rice flour and water were mixed in a weight ratio of 1:9 to 3:7, and ground to produce rice paste.
[0084] Additionally, rice germ oil was prepared by mixing rice germ and water in a weight ratio of 1:10, grinding the mixture, and then filtering it through cheese cloth.
[0085] Afterwards, the above rice paste and rice germ oil were mixed in equal volume ratios to prepare a mixture of rice paste and rice germ oil, and 3% (w / v) of sugar was added to the mixture, followed by sterilization (gelatinization, autoclaving, 100°C, 60 minutes). After cooling to room temperature and going through a homogenization process, lactic acid bacteria were inoculated at a certain concentration (0.1% (v / v), OD (600 nm)), and fermented at 30°C for 40 hours to prepare a rice lactic acid fermented product containing rice and rice germ.
[0086] The rice used was Samkwang or Jo-eun black rice, and the lactic acid bacteria used was Lactobacillus plantarum JSA22. The lactic acid bacteria strain was used after being subcultured twice in MRS broth.
[0087] As a control group, regular fermented milk or unfermented, non-fermented rice raw material was used.
[0088]
[0089] Example 2: Confirmation of the effect of improving intestinal microflora
[0090]
[0091] 2-1: In vitro human-mimetic fermentation
[0092]
[0093] First, to simulate in vitro digestion, the digestion reaction of rice lactic acid fermentation was performed under the same reaction temperature, substrate / enzyme concentration, time, and pH as human digestion conditions (see Minekus et al. 2014).
[0094] Specifically, for the stomach, it was reacted with the sample at a ratio of 50:50 (v / v) under Simulated Gastric Fluid (SGF, pH 3.0) conditions. The gastric enzyme Porcine pepsin was added at a final concentration of 2000 U mL. -1 The mixture was mixed with CaCl2 to a final concentration of 0.075 mM, the pH was adjusted to 3.0 with 1 M HCL, and the enzyme was inactivated after 2 hours of reaction at 37°C.
[0095] For the small intestine, the reaction was performed at a 50:50 (v / v) ratio with the sample under Simulated Intestinal Fluid (SIF, pH 7.0) conditions. The small intestine enzyme pancreatin was added at a final concentration of 100 U mL. -1 and CaCl2 was mixed to a final concentration of 0.3 mM. The pH was adjusted to 7.0 with 1 M NaOH, and after 2 hours of reaction at 37°C, the enzyme was inactivated.
[0096] For BBMV, the reaction was performed at a 50:50 (v / v) ratio with the sample under Simulated Intestinal Fluid (SIF, pH 7.0) conditions. BBMV aminopeptidase (10% of the final volume) was mixed, and CaCl2 was mixed at a final concentration of 0.3 mM. The pH was adjusted to 7.0 with 1 M NaOH, and the enzyme was inactivated after 2 hours of reaction at 37°C.
[0097]
[0098] Subsequently, a field simulation fermentation was performed. Specifically, human feces were used as an inoculum at a 1% inoculum, and dietary fiber samples obtained from digestion experiments were simultaneously added. To create anaerobic conditions, N2 (15 ml / min) was continuously supplied to the fermenter. The medium used in the fermentation was Basal Growth Medium (BGM), and the conditions were as follows: pH 6.8, 37°C, 24 h.
[0099]
[0100] Material capacity (g)Peptone water5Tryptone5Yeast extract4.5NaCl4.5KCl4.5Pectin2Mucin4Casein sodium salt3Arabinogalactan2NaHCO31.5MgSO4·H2O0.69Guar1L-cysteine HCl·H2O0.8KH2PO40.5K2HPO40.5Bile salt0.4CaCl20.08FeSO4·7H2O0.005Tween 801
[0101] By culturing for 24 hours in an in vitro gut model batch type, the changes in the colonic microbial community and metabolite were analyzed.
[0102]
[0103] 2-2: Measurement of changes in the colonic microbial community
[0104]
[0105] To quantitatively measure the changes in the colonic microbial community, real-time quantitative PCR (CFX96 Touch TM The experiment was conducted under the following conditions using real-time PCR (Bio-Rad).
[0106]
[0107] CompositionVolume (μL)DNA template52x SYBR mix2x Greenstar qPCR master mix10Primer-F0.5Primer-R0.5DW3.5Dye0.5Total20
[0108] The 16S rRNA primer sequences used for microbial identification using real-time PCR are as follows.
[0109]
[0110] Target genus or groupPrimer sequence (5'→3')Total bacteriaMost bacteriaF: TCCTACGGGAGGCAGCAGTR: GGACTACCAGGGTATCTAATCCTGTTBif164 forBifidobacteriumspp. (BIF)MostBifidobacteriumspp.F: GGGTGGTAATGCCGGATGR: TAAGCCATGGACTTTCACACCLab158 forLactobacillus / Enterococcus(LAB)MostLactobacillus,LeuconostocandWeissellaspp.;Lactococcus lactisF: AGCAGTAGGGAATCTTCCAR: CACCGCTACACATGGAGBac 303 forBacteroides-Prevotellagroup (BAC)MostBacteroides sensu strictoandPrevotellaspp.F: GAAGGTCCCCCACATTGR: CAATCGGAGTTCTTCGTGErec 482 forEubacteriumrectale-Clostridium coccoidesgroup (EREC)Most members ofClostridium clusterXIVa;Syntrophococcus sucromutansF: CGGTACCTGACTAAGAAGCR: AGTTTYATTCTTGCGAACG
[0111] As a result of measuring the changes in the colonic microbial community for each group of untreated (NS), regular milk fermentation (Milk), Samkwang rice lactic acid fermentation (SG), and Joeun black rice lactic acid fermentation (JH), as shown in Fig. 1, the Lactobacillus (LAB) group and the Bifidobacterium (BIF) group were relatively increased in both Samkwang rice lactic acid fermentation (SG) and Joeun black rice lactic acid fermentation (JH) compared to the regular milk fermentation. In particular, microorganisms in the genus Bifidobacterium are known as probiotic strains that produce acetic acid, and have been reported to be effective in improving irritable bowel syndrome symptoms, preventing acute enteritis, and reducing atopic dermatitis symptoms. Therefore, it was found that the rice lactic acid fermentation of the present invention can improve intestinal microbial flora and thereby improve intestinal health.
[0112]
[0113] 2-3: Metabolite analysis according to metabolism in the large intestine
[0114]
[0115] Organic acids produced in an in vitro gut model were quantitatively analyzed using HPLC (1260 infinity, Agilent, USA). The analysis conditions were as follows.
[0116]
[0117] ItemConditionInstrumentAgilent, 1260 infinityDetectorUV (Agilent, Korea) at 215 nmColumnAminex HPX-87HInjection volume(Dependable on substrate)20 ㎕Mobile phase(Dependable on substrate)0.008NH2SO4Flow rate(Dependable on substrate)0.6㎖ / min
[0118] As a result of analyzing short chain fatty acids (SCFAs), which are representative metabolites of intestinal microorganisms, the production of acetic acid and butyric acid was observed when Samkwang and Joeun black rice lactic acid fermentation products were added, as shown in Figure 2. In particular, the production of butyric acid showed the greatest tendency to increase in the Samkwang sample at 24 hours. The production of butyric acid has been reported to regulate IBD and colonic inflammatory responses by downregulating inflammatory mediators in the colon and maintaining E. coli at a low concentration (Pamela, 2013), and to be effective in obesity by promoting the growth of beneficial bacteria in the colon and reducing the levels of monosaccharides and disaccharides. Therefore, it was found that the rice lactic acid fermentation product of the present invention is effective in improving intestinal health.
[0119]
[0120] Example 3: Confirmation of the effects of fermented rice lactic acid product on improving intestinal function and inflammation response in mice with DSS-induced colitis and stress exposure - Therapeutic experimental design
[0121]
[0122] 3-1: Materials and Methods
[0123] Twenty-four 11-week-old male C57BL / 6 mice were purchased and used in the experiment after a one-week adaptation period. They were randomly assigned to four groups: Con group (normal control, n=6), C-only group (normal drinking water + DSS, n=6), DSS-UFR (unfermented rice raw material + DSS, n=6), and DSS-FR (rice lactic acid fermentation + DSS, n=6) so that the average body weight of each group was similar. For 5 days before the start of the experiment, the normal group consumed normal drinking water, and the other groups, excluding the normal group, consumed normal drinking water mixed with 2% dextran sulfate sodium (DSS). After 5 days of DSS administration, all groups consumed normal drinking water, and at the same time, the DSS-UFR group and the DSS-FR group consumed unfermented rice raw material and rice lactic acid fermentation, respectively. The Samkwang rice variety was used. All experimental animals were sacrificed on the 11th day after the start of the experiment.
[0124] Figure 3 illustrates the experimental design of the DDS-induced colitis model. To induce DSS enteritis, the normal group was supplied with normal drinking water, and the remaining groups were supplied with 2% DSS mixed with normal drinking water. From the 6th day of the experiment, normal drinking water, unfermented rice raw material, and fermented rice lactic acid were supplied instead of DSS administration. An autopsy was performed on the 11th day of the experiment.
[0125] During the experimental period, to evaluate the clinical symptoms of DSS colitis, the disease activity index (DAI) was measured at the same time every day by assigning a score from 0 to 4 based on the degree of weight loss, diarrhea, and presence of bloody stool.
[0126] After the experiment, the length of the large intestine from the cecum to the anus was measured in the sacrificed animals. The entire contents of the large intestine were removed, and some samples were fixed in 4% paraformaldehyde (PFA) for use as pathological tissue samples. The remaining samples were frozen at -80°C for molecular biological analysis.
[0127]
[0128] 3-2: Disease activity measurement results
[0129] First, as shown in Fig. 4, the disease activity measured daily to evaluate the symptoms of DSS-induced colitis in the fermented rice lactic acid product was significantly lower in the fermented rice lactic acid product administration group than in the group administered with regular drinking water, and there was no difference between the group administered with regular drinking water and the group administered with non-fermented rice raw materials.
[0130]
[0131] Next, the presence or absence of blood in the stool, which is included in the disease activity index, was visually observed and a subjective score was recorded. In order to confirm this using an objective index, a portion of the feces was collected from each group and the luminol reaction was observed. As a result, as shown in Fig. 5, the luminol reaction increased with DSS administration, and the strongest luminol reaction was observed on the last day of DSS administration. The luminol reaction decreased after DSS was discontinued, and among the model groups in which colitis was induced by DSS administration, the group administered fermented rice lactic acid and the group administered non-fermented rice raw materials were significantly reduced compared to the group administered normal drinking water. The group administered fermented rice lactic acid tended to be lower than the group administered non-fermented rice raw materials.
[0132]
[0133] 3-3: Colon length analysis results
[0134] After sacrificing the animals, macroscopic colon length analysis revealed that, compared to the normal control group, the group administered regular drinking water showed a significant decrease in the length of the excised colon. However, as shown in Figure 6, the groups administered fermented rice lactic acid and the groups administered non-fermented rice raw materials showed no difference from the normal control group, confirming that the inflammatory response was relatively mild.
[0135]
[0136] 3-4: Confirmation of anti-inflammatory effect
[0137] To confirm the anti-inflammatory effect of fermented rice lactic acid product confirmed by symptom score and macroscopic intestinal length, we examined the mRNA expression of IL-6, a proinflammatory cytokine, using RT-qPCR. Compared to the normal control group, the group administered regular drinking water among the models induced by DSS administration showed a significant increase in the mRNA expression of IL-6, and the group administered non-fermented rice raw material also showed an increasing trend. In contrast, as shown in Figure 7, the group administered fermented rice lactic acid product showed a significant decrease in the expression of IL-6 compared to the group administered regular drinking water. In addition, the expression of TNF-α mRNA tended to increase in the groups administered regular drinking water or non-fermented rice raw material in the colitis-induced model, but tended to decrease in the fermented rice lactic acid product group. These results confirmed the anti-inflammatory effect of fermented rice lactic acid product, consistent with the results of symptom score and macroscopic intestinal length.
[0138]
[0139] 3-5: Confirmation of the pattern of thickening of the colonic mucosa
[0140] H&E staining was performed to observe inflammatory or structural changes in colon tissue. As shown in Figure 8, among the groups in which colitis was induced with DSS and only regular drinking water was supplied, mucosal thickening was observed. Comparatively, the groups administered fermented rice lactic acid and fermented rice raw materials showed less severe mucosal thickening.
[0141]
[0142] Example 4: Confirmation of the effects of fermented rice lactic acid product on improving intestinal function and inflammation response in mice with DSS-induced colitis and stress exposure - preventive experimental design
[0143]
[0144] 4-1: Materials and Methods
[0145] Eighteen 9-week-old male C57BL / 6 mice were purchased and used in the experiment after a one-week adaptation period. They were randomly assigned to three groups: the Sham group (normal control group, n=6), the WAS+DSS+Tap group (Tap water+WAS+DSS, n=6), and the WAS+DSS+FR group (fermented rice lactic acid solution+WAS+DSS, n=6) so that the average body weight of each group was similar. To confirm the effect of preventing irritable bowel syndrome symptoms, the WAS+DSS+Tap group was administered only regular drinking water, and the WAS+DSS+FR group was administered fermented rice lactic acid solution for the first 14 days. On the 15th and 16th days of the experiment, the mice were exposed to water avoidance stress for 1 hour every day for 2 days, and from the 15th day of the experiment, 2% DSS was mixed with regular drinking water and provided for 5 days. The normal control group was exposed to sham water avoidance stress and then provided with regular drinking water without DSS administration. Disease activity was measured during the DSS administration period, and an autopsy was performed on the 20th day of the experiment (Fig. 9).
[0146] For the water avoidance stress (WAS) experiment, a small island (5 cm x 5 cm x 5 cm) was placed in the center of a standard plastic cage (40 cm long x 25 cm wide x 18 cm high). From the 12th day of the experiment, all groups of mice were allowed to acclimate to the same cage for 1 hour each time under water-free conditions for 3 days. After 3 days of adaptation, the stress group (WAS+DSS group) was stressed for 2 days by allowing the mice to stay in the cage filled with 25℃ water up to 1 cm below the center of the island for 1 hour, while the Sham group was allowed to stay in a container without water. Compared to the Sham group in the container without water, the mice in the container with water felt anxious and stressed, climbing onto the island to avoid the water, which led to immediate defecation. The number of fecal lumps excreted during the 1-hour water avoidance stress experiment was measured, and the number of feces excreted per hour was measured at the same time during the post-water avoidance stress period (Fig. 10).
[0147]
[0148] 4-2: Disease activity measurement results
[0149] First, as shown in Figure 11, the disease activity measurement results showed that the water avoidance stress-DSS-induced colitis group had higher symptom scores than the normal control group. In the group exposed to water avoidance stress and simultaneously induced DSS colitis, the symptom scores tended to be lower in the latter half of the experiment when administered fermented rice lactic acid compared to the group administered regular drinking water. This suggests that fermented rice lactic acid may alleviate intestinal symptoms in mice simultaneously exposed to psychological stress and DSS.
[0150]
[0151] 4-3: Results of checking the amount of waste discharged
[0152] To investigate the improving effect of fermented rice lactic acid on irritable bowel syndrome during the water avoidance stress exposure period and subsequent DSS administration period, the stool output of all subjects was measured. As shown in Figure 12, the water avoidance stress-DSS-induced colitis group showed a tendency for increased stool output compared to the normal control group. Among the water avoidance stress-DSS-induced colitis groups, the number of stools excreted tended to be lower when fermented rice lactic acid was administered compared to when regular drinking water was supplied.
[0153]
[0154] 4-4: Confirmation of anti-inflammatory effect
[0155] To confirm the relationship between the observed effects of fermented rice lactic acid on disease activity and the development of inflammation, we measured IL-6, a proinflammatory cytokine, in the distal colonic mucosa using RT-qPCR. As a result, as shown in Figure 13, IL-6 tended to increase in the water avoidance stress-DSS-induced colitis group when only regular drinking water was administered compared to the normal control group. However, when fermented rice lactic acid was administered, it tended to be lower than when only regular drinking water was administered.
[0156]
[0157] 4-5: Results of tight junction protein expression measurement
[0158] To investigate the mechanism underlying the observed effects of fermented rice lactic acid on disease activity, we examined differences in the mRNA expression of the tight junction protein Occludin using RT-qPCR. As shown in Figure 14, Occludin mRNA expression tended to increase in the water avoidance stress-DSS-induced colitis group compared to the normal control group. The fermented rice lactic acid administration group showed a lower expression compared to the regular drinking water administration group, similar to the normal control group.
[0159] Furthermore, as shown in Figure 15, the tight junction proteins ZO-1 and Occludin were increased in the water avoidance stress-DSS-induced colitis group compared to the normal control group when examined by Western blot. The fermented rice lactic acid product-administered group showed a lower tendency than the regular drinking water-administered group, similar to the normal control group.
[0160]
[0161] 4-6: Results of mRNA expression measurement of the mucus protein Mucin2
[0162] To confirm the mechanism of the effect of fermented rice lactic acid on disease activity, we measured the mRNA expression of Mucin2 (MUC2), a mucin protein secreted from the intestinal mucosa, using RT-qPCR. As a result, as shown in Fig. 16, compared to the normal control group, in the water avoidance stress-DSS-induced colitis group, when only regular drinking water was administered, the mRNA expression of MUC2 tended to increase. In contrast, when fermented rice lactic acid was administered, the expression was significantly lower than when only regular drinking water was administered, showing a value similar to that of the normal control group.
[0163]
[0164] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
[0165]
[0166] 서열목록서열번호명칭서열(5'→3')1Primer-FTCCTACGGGAGGCAGCAGT2Primer-RGGACTACCAGGGTATCTAATCCTGTT3Primer-FGGGTGGTAATGCCGGATG4Primer-RTAAGCCATGGACTTTCACACC5Primer-FAGCAGTAGGGAATCTTCCA6Primer-RCACCGCTACACATGGAG7Primer-FGAAGGTCCCCCACATTG8Primer-RCAATCGGAGTTCTTCGTG9Primer-FCGGTACCTGACTAAGAAGC10Primer-RAGTTTYATTCTTGCGAACG
Claims
1. A food composition for improving intestinal health, comprising fermented rice lactic acid as an effective ingredient.
2. A food composition according to claim 1, wherein the improvement in intestinal health is improvement in intestinal microflora or improvement in colitis.
3. A food composition in the second paragraph, wherein the improvement in the intestinal microbial flora is an increase in the population of microorganisms of the genus Lactobacillus or the genus Bifidobacterium.
4. A food composition according to claim 2, wherein the colitis is ulcerative colitis, Crohn's disease or irritable bowel syndrome.
5. A food composition in claim 1, wherein the rice lactic acid fermentation product is obtained by fermenting a rice extract with Lactobacillus plantarum.
6. A food composition in claim 5, wherein the rice extract is a mixture of rice paste prepared by mixing rice and water, and rice germ oil prepared by mixing rice germ and water.
7. A food composition according to claim 1, wherein the fermented rice lactic acid product is made using Samkwang or Jo-eun black rice varieties.
8. A food composition according to claim 1, characterized in that the fermented rice lactic acid product does not contain dairy products.
9. A feed composition for improving intestinal health, containing fermented rice lactic acid as an effective ingredient.
Citation Information
Patent Citations
Processed Meat and Manufacturing Method Thereof
KR1020210157977A
System for compressing and cooling hydrogen having a high efficiency
KR102248672B1
Moving Robot
KR102585861B1