Cosmetic composition comprising sturgeon mucus hydrolysate

Abstract

The present invention relates to a cosmetic composition comprising a sturgeon mucus hydrolysate. Particularly, the present invention relates to a cosmetic composition for skin improvement, the composition comprising: a sturgeon mucus hydrolysate having a low molecular weight due to hydrolysis; or a low molecular weight fraction thereof.

Description

Cosmetic composition comprising sturgeon mucus hydrolyzate

[0001] The present invention relates to a cosmetic composition comprising sturgeon mucus hydrolysate. In particular, the present invention relates to a cosmetic composition for improving skin comprising sturgeon mucus hydrolysate reduced to a low molecular weight through hydrolysis or a low molecular weight fraction thereof.

[0002] The sturgeon is a saltwater fish belonging to the bony fish class of the order Sturgeonidae. It is currently regulated by the Convention on International Trade in Endangered Species of Wild Fauna and Flora, and is farmed worldwide as a means of protecting sturgeon. The sturgeon is a fish belonging to the family Acipenseridae, and unlike common sharks (Elasmobranchs), it is composed of more than 70% cartilage, which is a characteristic of bony fish. The bones, cartilage, and fins of the sturgeon contain large amounts of chondroitin sulfate, collagen, and organic potassium, which are known to be useful for strengthening the bones of children and women and for osteoporosis in the elderly. In addition, sturgeon roe (caviar) is rich in protein and vitamins, is excellent for preventing aging, has excellent skin affinity, has excellent absorption, and contains various nutrients and moisturizing ingredients, such as essential fatty acids such as Omega 3, which have anti-aging properties.

[0003] Meanwhile, sturgeon's skin surface cells secrete a mucus, which reduces friction with water, enhancing swimming ability, and is known to have biological defense functions, such as preventing bacterial infection. It also protects the epidermis against physicochemical changes in the water. This epidermal mucus secretion increases rapidly when the environment deteriorates or life is threatened. It is also produced in large quantities as a byproduct during the male-female separation process of sturgeon farming, but is often discarded, raising a need for ways to utilize it.

[0004] The present invention was conceived to solve the above-described problem, and aims to provide a cosmetic composition containing a hydrolyzate of sturgeon mucus as an active ingredient.

[0005] In addition, the present invention aims to provide a cosmetic composition comprising a low molecular weight fraction of sturgeon mucus hydrolyzate as an active ingredient.

[0006] In addition, the present invention aims to provide a method for producing a hydrolyzed sturgeon mucus.

[0007] In addition, the present invention aims to provide a hydrolyzed sturgeon mucus.

[0008] In addition, the present invention aims to provide a method for producing a low molecular weight fraction of sturgeon mucus hydrolysate.

[0009] In addition, the present invention aims to provide a low molecular weight fraction of sturgeon mucus hydrolysate.

[0010] The technical problems of the present invention are not limited to the technical problems mentioned above, and other technical problems not mentioned will be clearly understood by those skilled in the art from the description below.

[0011] In order to solve the above problem, the present invention provides a cosmetic composition comprising a hydrolyzate of sturgeon mucus as an active ingredient.

[0012] In addition, the present invention provides a cosmetic composition comprising a low molecular weight fraction of sturgeon mucus hydrolyzate as an active ingredient.

[0013] In addition, the present invention provides a method for producing a hydrolyzed sturgeon mucus.

[0014] In addition, the present invention provides a hydrolyzed sturgeon mucus.

[0015] In addition, the present invention provides a method for producing a low molecular weight fraction of sturgeon mucus hydrolysate.

[0016] In addition, the present invention provides a low molecular weight fraction of sturgeon mucus hydrolysate.

[0017] According to the present invention as described above, the composition of the present invention is a novel material using a hydrolyzed product of low molecular weight epidermal mucus, a by-product produced from sturgeon, and therefore has an environmentally friendly and economical effect.

[0018] Additionally, by hydrolyzing sturgeon mucus and reducing its molecular weight, it has the effect of improving skin moisturizing functionality and skin permeability.

[0019] In addition, the low molecular weight fraction of the sturgeon mucus hydrolyzate of the present invention has a significantly improved skin moisturizing function.

[0020] In addition, by hydrolyzing the sturgeon mucus and reducing its molecular weight, the formulation stability is improved, enabling long-term storage.

[0021] The effects of the present invention are not limited to those mentioned above, and also include other effects that are not explicitly mentioned, although they can be clearly understood by those skilled in the art from the description throughout the specification.

[0022] Figure 1 is a diagram showing the analysis of sturgeon mucus and hydrolyzate of sturgeon mucus using GPC.

[0023] Figure 2 is a diagram showing the colorimetric determination of reducing sugars in sturgeon mucus (Orininal) and hydrolyzate of sturgeon mucus (Hydrolysis).

[0024] Figure 3 is a diagram showing the expression levels of skin moisturizing-related genes analyzed by qRT-PCR according to treatment with sturgeon mucus (original), sturgeon mucus hydrolysate (enzyme), low-molecular fraction of sturgeon mucus hydrolysate (enzyme_low), and high-molecular fraction of sturgeon mucus hydrolysate (enzyme_high).

[0025] Figure 4 is a diagram showing the skin permeability of sturgeon mucus (original solution) and sturgeon mucus hydrolyzate (enzyme) confirmed by Franz Diffusion Cell analysis.

[0026] Figure 5 is a diagram comparing the long-term storage properties and solubility of sturgeon mucus concentrate and sturgeon mucus hydrolyzate.

[0027] Figure 6 is a diagram comparing the long-term storage stability and solubility of sturgeon mucus concentrate, high molecular weight fraction of sturgeon mucus hydrolysate, and low molecular weight fraction of sturgeon mucus hydrolysate.

[0028] Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the attached drawings. The advantages and features of the present invention, and methods for achieving them, will become clear with reference to the embodiments described in detail below together with the attached drawings. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms. These embodiments are provided only to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined only by the scope of the claims. Like reference numerals refer to like elements throughout the specification.

[0029] Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used in a sense commonly understood by those of ordinary skill in the art to which the present invention pertains. Furthermore, terms defined in commonly used dictionaries are not to be interpreted ideally or excessively unless explicitly and specifically defined otherwise. The terminology used herein is for the purpose of describing embodiments and is not intended to limit the present invention. In this specification, singular forms also include plural forms, unless specifically stated otherwise.

[0030] The terms "comprises" and / or "comprising" as used in the specification do not exclude the presence or addition of one or more other components, steps, operations and / or elements.

[0031] The term "cosmetically effective amount" as used herein means an amount sufficient to achieve the efficacy of the composition of the present invention described above.

[0032] The term "expression" herein generally refers to the cellular process by which a biologically active polypeptide is generated from a DNA sequence and exhibits biological activity in a cell. In this context, gene expression encompasses not only transcription and translation processes, but also post-transcriptional and post-translational processes that can affect the biological activity of a gene or gene product. These processes include, but are not limited to, RNA synthesis, processing, and transport, as well as polypeptide synthesis, transport, and post-translational modification of polypeptides.

[0033] The term "hydrolysate" as used herein means a product comprising hydrolyzed sugars, hydrolyzed proteins, peptides, amino acids and / or other compounds derived from proteins, hydrolyzed fats, fatty acids and / or glycerol, or hydrolyzed glycoproteins, obtainable by enzymatic hydrolysis.

[0034]

[0035] In one aspect, the present invention relates to a cosmetic composition comprising a hydrolyzate of sturgeon mucus as an active ingredient.

[0036] In one embodiment, the sturgeon can be a beluga sturgeon (Huso huso), a Kaluga sturgeon (Huso dauricus), a Siberian sturgeon (Acipenser baerii), a Russian sturgeon (Acipenser gueldenstaedti), a sterlet sturgeon (Acipenser ruthenus), a white sturgeon (Acipenser transmontanus), an Amur sturgeon (Acipenser schrenckii), a Chinese sturgeon (Acipenser sinensis), a spatula sturgeon (Polyodon spathula), or a hybrid thereof.

[0037] In one embodiment, the hydrolyzate of sturgeon mucus of the present invention may be a product obtained by hydrolyzing sturgeon mucus with one or more hydrolytic enzymes selected from the group consisting of cellulase, pectinase, hemicellulase, arabinase, β-glucanase, xylanase, amylase, amyloglucosidase, protease, and lipase, and it is more preferable that the product is obtained by hydrolyzing with amylase, protease, or lipase.

[0038] In one embodiment, the hydrolyzed product of sturgeon mucus of the present invention can be produced by a production method comprising the steps of: obtaining mucus secreted by sturgeon; filtering; hydrolyzing by treating with a hydrolytic enzyme; and filtering.

[0039] In one embodiment, the hydrolyzate of sturgeon mucus of the present invention may have increased skin permeability compared to before hydrolysis.

[0040] In one embodiment, the hydrolysate of sturgeon mucus of the present invention can increase gene expression of TGM (transglutaminase) 1, AQP3 (aquaporin 3), or HAS3 (hyaluronan synthases 3), and can increase gene expression of TGM1, AQP3, or HAS3 compared to sturgeon mucus.

[0041] In one embodiment, the hydrolyzate of sturgeon mucus of the present invention may have a proportion of substances having a molecular weight of 1 to 3 kDa of 40 to 70%.

[0042] In one embodiment, the hydrolyzate of sturgeon mucus of the present invention may have a percutaneous permeability of 2 to 2.5 as measured by Franz Diffusion Cell analysis.

[0043] In one aspect, the present invention relates to a cosmetic composition comprising a low molecular weight fraction of the sturgeon mucus hydrolyzate of the present invention as an active ingredient.

[0044] In one embodiment, the low molecular weight fraction of the sturgeon mucus hydrolysate of the present invention may have a molecular weight of 10 kDa or less.

[0045] In one embodiment, the low molecular weight fraction of the sturgeon mucus hydrolysate of the present invention can be prepared by a manufacturing method comprising the step of ultrafiltration of the sturgeon mucus hydrolysate with a 10 kDa MWCO filter.

[0046] In one embodiment, the low molecular weight fraction of the sturgeon mucus hydrolysate of the present invention may have increased skin permeability compared to the sturgeon mucus hydrolysate.

[0047] In one embodiment, the low molecular weight fraction of the sturgeon mucus hydrolysate of the present invention can increase gene expression of TGM1, AQP3 or HAS3 compared to the sturgeon mucus hydrolysate.

[0048] In one embodiment, the cosmetic composition of the present invention may be for skin improvement, and the skin improvement may be at least one selected from the group consisting of skin wrinkle improvement, skin moisturizing improvement, skin whitening, skin aging prevention, skin immunity or defense enhancement, pore reduction, skin barrier improvement, pigmentation inhibition, sebum inhibition or acne improvement, atopy improvement, or skin soothing.

[0049] In one embodiment, the cosmetic composition of the present invention can have a skin moisturizing effect by increasing gene expression of TGM1, AQP3 or HAS3.

[0050] In the present invention, the expression can be confirmed by measuring the expression level of a gene or mRNA using a nucleic acid sequence, a nucleic acid sequence complementary to the nucleic acid sequence, a primer pair, a probe, or a primer pair and a probe that specifically recognize a fragment of the nucleic acid sequence and the complementary sequence, a polymerase chain reaction, real-time RT-PCR, reverse transcription polymerase chain reaction, competitive RT-PCR, nuclease protection assay (RNase, S1 nuclease assay), in situ hybridization, nucleic acid microarray, Northern blot, or DNA chip method, and using an antibody, antibody fragment, aptamer, avidity multimer, or peptidomimetics that specifically recognizes the full-length protein or a fragment thereof, a Western blot, an enzyme linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), The expression level of the protein can be measured and confirmed using radioimmunodiffusion, immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, mass spectrometry, or protein microarray methods.

[0051] The cosmetic composition of the present invention can be manufactured by including a cosmetically effective amount of the above-described active ingredients of the present invention and a cosmetically acceptable carrier.

[0052] The cosmetic composition may be in any form suitable for topical application, including solutions, gels, solids, pastes, anhydrous products, emulsions obtained by dispersing an oil phase in an aqueous phase, suspensions, microemulsions, microcapsules, microgranules, or vesicular dispersions of ionic (liposomes) and nonionic types, or in the form of creams, toners, lotions, powders, ointments, sprays, or concealer sticks. These compositions may be prepared according to methods conventional in the art. The composition according to the present invention may also be used in the form of a foam or an aerosol composition further containing a compressed propellant.

[0053] The cosmetic composition according to one embodiment of the present invention is not particularly limited in its formulation, and may be formulated as cosmetics such as, for example, a softening toner, an astringent toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, an eye essence, a cleansing cream, a cleansing foam, a cleansing water, a pack, a powder, a body lotion, a body cream, a body oil, and a body essence.

[0054] When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0055] When the cosmetic composition of the present invention is in the form of a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and particularly in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included.

[0056] When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0057] When the formulation of the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0058] When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolenic derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0059] The cosmetic composition of the present invention can be applied to cosmetics such as skin, lotion, cream, essence, pack, foundation, color cosmetics, sunscreen, two-way cake, face powder, compact, makeup base, skin cover, eye shadow, lipstick, lip gloss, lip fix, eyebrow pencil, toner, and cleansing agents such as shampoo and soap.

[0060] A cosmetic composition according to one embodiment of the present invention may further include, in addition to the above-described effective ingredient, a functional additive and an ingredient included in a general cosmetic composition. The functional additive may include an ingredient selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, high molecular weight polysaccharides, sphingolipids, and seaweed extract.

[0061] The cosmetic composition of the present invention may also contain, as necessary, ingredients included in general cosmetic compositions in addition to the above-described effective ingredients. Examples of other ingredients to be contained include fat components, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, sterilizers, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, blood circulation promoters, cooling agents, antiperspirants, purified water, and the like.

[0062] In one aspect, the present invention relates to a food composition for improving skin, comprising a hydrolyzate of sturgeon mucus of the present invention or a low molecular weight fraction thereof as an effective ingredient.

[0063] When the composition of the present invention is used as a food composition, the composition may be added as is or used in combination with other foods or food ingredients, and may be used appropriately according to conventional methods. In addition to the active ingredient, the composition may include a food-related acceptable food additive, and the amount of the active ingredient mixed may be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment).

[0064] The term "food supplement additive" used in the present invention means a component that can be added to food as an auxiliary, and can be appropriately selected and used by those skilled in the art as added in the manufacture of health functional foods of each formulation. Examples of food supplement additives include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., but the types of food supplement additives of the present invention are not limited by the above examples.

[0065] The food composition of the present invention may include a health functional food. The term "health functional food" as used herein refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients that have functionality useful to the human body. Here, "functionality" means obtaining a beneficial effect for health purposes, such as regulating nutrients for the structure and function of the human body or physiological functions. The health functional food of the present invention can be manufactured by methods commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art can be added. In addition, the formulation of the health functional food can be manufactured without limitation as long as it is a formulation recognized as a health functional food. The food composition of the present invention can be manufactured in various forms, and unlike general drugs, it has the advantage of not causing side effects that may occur with long-term administration of drugs because it uses food as a raw material. In addition, the health functional food of the present invention can be consumed as a supplement to enhance the effectiveness of anticancer agents.

[0066] In addition, there is no limitation on the type of health food to which the composition of the present invention can be used. In addition, the composition of the present invention can be manufactured by mixing other appropriate auxiliary ingredients that can be included in health functional foods and known additives according to the selection of a person skilled in the art. Examples of foods to which it can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and it can be manufactured by adding it to juice, tea, jelly, and juice, etc. manufactured using the hydrolyzate of sturgeon mucus according to the present invention or its low molecular weight fraction as a main ingredient.

[0067] In one aspect, the present invention relates to a method for producing a hydrolyzed sturgeon mucus, comprising the steps of: a) obtaining mucus secreted by sturgeon; b) filtering; c) adjusting the pH to pH 7.0; d) hydrolyzing by treating with amylase, protease or lipase; and e) filtering.

[0068] In one embodiment, the filtration may be filtration at 0.2 to 5 μm.

[0069] In one embodiment, the method may further comprise a lyophilizing step after step e).

[0070] In one aspect, the present invention relates to a hydrolyzed sturgeon mucus produced by the above production method.

[0071] In one aspect, the present invention relates to a method for producing a low molecular weight fraction of sturgeon mucus hydrolysate, comprising the steps of: a) obtaining mucus secreted by sturgeon; b) filtering; c) adjusting the pH to pH 7.0; d) hydrolyzing by treating with amylase, protease or lipase; e) filtering; and f) ultrafiltration to remove substances exceeding 10 kDa.

[0072] In one aspect, the present invention relates to a low molecular weight fraction of sturgeon mucus hydrolysate prepared by the above method.

[0073]

[0074] Below, specific embodiments of the present invention will be described.

[0075]

[0076] Example 1: Analysis of sturgeon mucus

[0077] 1-1. Obtaining sturgeon mucus

[0078] Healthy sturgeon were selected, their skin surfaces washed with clean water, and placed in a container to collect the secreted mucus for approximately 5 minutes. The mucus was then returned to the tank to recover. The obtained mucus was stored in a refrigerator, filtered using a 0.45 μm MF (microfiltration) syringe, freeze-dried, and powdered.

[0079]

[0080] 1-2. Component Analysis

[0081] As a result of analyzing the components of sturgeon mucus before freeze-drying (Korea Functional Food Research Institute), it was found to contain free amino acids, chondroitin sulfate, and moisture, as shown in Table 1 below.

[0082]

[0083]

[0084] Example 2: Hydrolysis and fractionation of sturgeon mucus

[0085] 2-1. Hydrolysis using enzymes

[0086] The freeze-dried powder of sturgeon mucus obtained in Example 1-1 was dissolved in distilled water at a concentration of 50 mg / ml to prepare 500 ml, and then sterilized at 80°C for 30 minutes. Thereafter, 30 ml of this was separated, centrifuged at 13,000 g for 10 minutes, and the supernatant was filtered through a 0.45 μm syringe filter (mucus stock solution: control). The remaining mucus was adjusted to pH 7.0, which was derived from the enzyme reaction optimization pH (data not shown), and then treated with 5 million U of amylase, 5,000 U of protease, and 500 LU of lipase, and hydrolyzed while stirring at 150 rpm at 35°C for 15 hours. The hydrolyzed mucus was centrifuged at 7,000 g for 20 minutes, and the supernatant was filtered using a 0.45 μm MF syringe. This was then freeze-dried to produce a low-molecular-weight sturgeon mucus hydrolyzate powder.

[0087]

[0088] 2-2. Fractionation by molecular weight

[0089] In the above Example 2-1, the freeze-dried sturgeon mucus was dissolved in distilled water at a concentration of 50 mg / mL, 500 μL was taken and placed in an Amicon Ultra-4 centrifugal Filter Diveices (Millipore, Ireland), centrifuged at 5,000 xg for 30 minutes, and filtered to obtain a low-molecular-weight fraction of sturgeon mucus hydrolysate with a molecular weight of 10 kDa or less (enzyme_low). In addition, the unfiltered fraction exceeding 10 kDa was placed in the filter with 500 μL of water, allowed to stand for 30 minutes, and then mixed well with a pipette to obtain a high-molecular-weight fraction of sturgeon mucus hydrolysate (enzyme_high).

[0090]

[0091] Example 3: Analysis of low molecular weight compounds in sturgeon mucus

[0092] 3-1. Molecular weight analysis

[0093] To confirm whether sturgeon mucus was reduced to low molecular weight by hydrolysis, columns with exclusion limit pullulan of 100 kDa or less, 10 kDa or less, and 1 kDa or less were sequentially connected and GPC analysis was performed using a buffer as a mobile phase. Then, a calibration curve was drawn using a GFC standard (molecular weight 739,000-168 Da) with a known molecular weight, and the retention time (RT) of the sample (mucous, enzyme treatment) was measured. The approximate molecular weight of each sample was measured through the GFC program.

[0094]

[0095] As a result, the original sturgeon mucus contained approximately 85% high molecular weight components with a molecular weight of 1,000 to 200 kDa, but the mucus hydrolyzed through enzyme treatment contained more than 57% low molecular weight components of 3 kDa or less (Table 2 and Fig. 1).

[0096]

[0097] 3-2. Reducing sugar analysis

[0098] To confirm the colorimetric reduction of sturgeon mucus, a high-molecular-weight glycoprotein, by hydrolysis, 1 ml each of sturgeon mucus stock (4-fold dilution) and its hydrolysate (40-fold dilution) were mixed with 1 ml of DNS (Dinitrosalicylic Acid) solution, reacted at 100°C for 5 minutes, cooled to room temperature, and measured for absorbance at 540 nm. Absorbance measurements were performed twice, and reducing sugars were quantitatively analyzed using glucose as a standard.

[0099] As a result, it was found that reducing sugar in sturgeon mucus was significantly increased by hydrolysis (Fig. 2), and through this, it was confirmed that sturgeon mucus was decomposed into low molecular weight substances.

[0100]

[0101] Example 4: Evaluation of skin moisturizing efficacy of sturgeon mucus hydrolysate and low-molecular fractions.

[0102] The expression levels of the TGM (transglutaminase) 1 gene, a differentiation-specific gene of corneocytes in the stratum corneum that play an important role in maintaining the skin's moisture content from a dry environment, the AQP3 (aquaporin 3), a transmembrane protein that transports water and glycerol into cells and the HAS3 (hyaluronan synthases 3), an enzyme that synthesizes hyaluronic acid, a water-retaining matrix, were analyzed by qRT-PCR to evaluate the skin moisturizing effects of sturgeon mucus, sturgeon mucus hydrolysate, low-molecular-weight fraction of mucus hydrolysate (enzyme_low), and high-molecular-weight fraction of sturgeon mucus hydrolysate (enzyme_high). Specifically, human keratinocyte (HaCaT) cell line (KCLE) was seeded in 6-well plates at a density of 3.0 x 10 5 Cells were seeded at a density of 10 cells / ml and cultured in DMEM medium supplemented with 10% FBS at 37°C in a 5% CO2 atmosphere. After culture, the medium was removed and cultured with culture medium containing sturgeon mucus, sturgeon mucus hydrolysate (enzyme), low-molecular-weight fraction of mucus hydrolysate (enzyme_low), and high-molecular-weight fraction of sturgeon mucus hydrolysate (enzyme_high), each at the highest non-toxic concentration of 2% v / v (data not shown), and further cultured for 24 hours. Afterwards, the cell pellet was obtained by centrifugation, and RNA isolated using RNeasay Mini Kit (Qiagen, Germany) was synthesized into cDNA, followed by qRT-PCR analysis using the primer sets in Table 3 below.

[0103] Gene primer type sequence (5'->3')TGM-1forwardGCACCACACAGACGAGTATGAReverseGGTGATGCGATCAGAGGATTCHAS3forwardCAGCCTATGTGACGGGCTACReverseCCTCCTGGTATGCGGCAATAQP3forwardCCTTTGGCTTTGCTGTCACTCTReverseTGACCCCTACAACAACCCCGGAPDHforwardTGCACCACCAACTGCTTAGCReverseGGCATGGACTGTGGTCATGAG

[0104]

[0105] As a result, the mRNA expression levels of genes related to skin hydration increased in the group treated with sturgeon mucus compared to the untreated control group (NC), and when treated with the hydrolysate (enzyme) of sturgeon mucus, the levels increased significantly compared to the group treated with sturgeon mucus alone (Table 4 and Fig. 3). In addition, compared to the group treated with the hydrolysate of sturgeon mucus and the high-molecular fraction (enzyme_high), the mRNA expression levels of genes related to skin hydration increased significantly when treated with the low-molecular fraction (enzyme_low) of sturgeon mucus hydrolysate (Table 4 and Fig. 3).

[0106]

[0107] Example 5: Skin permeability evaluation of sturgeon mucus hydrolyzate

[0108] To evaluate the skin permeability of sturgeon mucus and sturgeon mucus hydrolysate (enzyme), the process of making 1 ml by diluting 10-fold with distilled water was repeated 5 times, and 7.5 ml of the permeated solution was recovered using a Franz Diffusion Cell (Donor: 1 ml of sample, Receptor: 8 ml of distilled water, Temperature: 37°C, Incubation time: 12 hours, Number of sample repetitions: 2), and then the skin permeability was measured by analyzing glucose.

[0109] As a result, the skin permeability of the hydrolyzate was found to be significantly higher than that of the original sturgeon mucus (Fig. 4).

[0110]

[0111] Example 6: Evaluation of long-term storage stability and solubility of sturgeon mucus hydrolyzate

[0112] Samples of the original sturgeon mucus and its hydrolyzate with the same solid content were stored under refrigerated conditions for more than one month and then observed for sedimentation. While sedimentation was observed in the original sturgeon mucus, the hydrolyzed sturgeon mucus remained clear without any sedimentation (Fig. 5). Furthermore, considering that solubility typically decreases at low temperatures, the hydrolyzed sturgeon mucus exhibited excellent solubility. In addition, as a result of observing the precipitation of the high molecular weight fraction (enzyme_high) and the low molecular weight fraction (enzyme_low) of the sturgeon mucus hydrolysate and the mucus original solution, the low molecular weight fraction of the sturgeon mucus hydrolysate was found to be significantly clearer than the high molecular weight fraction of the sturgeon mucus hydrolysate, confirming that among the sturgeon mucus hydrolysates, the long-term storage stability and solubility of the low molecular weight fraction of the sturgeon mucus hydrolysate were significantly superior (Fig. 6).

[0113]

[0114]

[0115] Although embodiments of the present invention have been described with reference to the attached drawings, those skilled in the art will appreciate that the present invention can be implemented in other specific forms without altering the technical concept or essential features thereof. Therefore, the embodiments described above should be understood to be illustrative in all respects and not restrictive.

Claims

1. A cosmetic composition containing a hydrolyzed product of sturgeon mucus as an active ingredient.

2. In paragraph 1, A cosmetic composition, wherein the hydrolysate of sturgeon mucus is a product obtained by hydrolyzing sturgeon mucus with at least one hydrolytic enzyme selected from the group consisting of cellulase, pectinase, hemicellulase, arabinase, β-glucanase, xylanase, amylase, amyloglucosidase, protease, and lipase.

3. In paragraph 1, Hydrolysate of sturgeon mucus: a) A step of obtaining mucus secreted by an ironclad shark; b) filtering step; c) a step of hydrolyzing by treating with a hydrolytic enzyme; and d) A cosmetic composition manufactured by a manufacturing method including a filtering step.

4. In paragraph 1, A cosmetic composition having increased skin permeability compared to before hydrolysis.

5. In paragraph 1, A cosmetic composition that increases the gene expression of TGM (transglutaminase) 1, AQP3 (aquaporin 3), or HAS3 (hyaluronan synthases 3).

6. In paragraph 1, A cosmetic composition comprising 40 to 70% of a hydrolyzed sturgeon mucus having a molecular weight of 1 to 3 kDa.

7. A cosmetic composition comprising a low molecular weight fraction of sturgeon mucus hydrolysate as an effective ingredient.

8. In paragraph 7, A cosmetic composition, wherein the low molecular weight fraction of sturgeon mucus hydrolysate has a molecular weight of 10 kDa or less.

9. In paragraph 7, A cosmetic composition, wherein the low molecular weight fraction of sturgeon mucus hydrolysate is prepared by a manufacturing method comprising the step of ultrafiltration of sturgeon mucus hydrolysate using a 10 kDa MWCO filter.

10. In paragraph 7, A cosmetic composition having increased skin permeability compared to hydrolyzed sturgeon mucus.

11. In paragraph 7, A cosmetic composition that increases gene expression of TGM1, AQP3 or HAS3.

12. In paragraph 1 or paragraph 7, A cosmetic composition for improving skin.

13. In paragraph 12, A cosmetic composition wherein skin improvement is at least one selected from the group consisting of improving skin wrinkles, improving skin moisturizing, whitening skin, preventing skin aging, enhancing skin immunity or defense, reducing pores, improving skin barrier, suppressing pigmentation, suppressing sebum or improving acne, improving atopy or soothing skin. 14.a) A step of obtaining mucus secreted by a sturgeon; b) filtering step; c) Step of adjusting the pH to pH 7.0; d) a step of hydrolyzing by treating with amylase, protease or lipase; and e) A method for producing hydrolysed sturgeon mucus, comprising a filtering step.

15. In paragraph 14, A method for producing hydrolysate of sturgeon mucus, filtered to 0.2 to 5 μm.

16. In paragraph 14, A method for producing a hydrolysate of sturgeon mucus, further comprising a freeze-drying step.

17. Hydrolyzed sturgeon mucus produced by the method of Article 14. 18.a) A step of obtaining mucus secreted by a sturgeon; b) filtering step; c) Step of adjusting the pH to pH 7.0; d) a step of hydrolyzing by treating with amylase, protease or lipase; e) a filtering step; and f) A method for producing a low molecular weight fraction of sturgeon mucus hydrolysate, comprising the step of removing substances exceeding 10 kDa by ultrafiltration.

19. Low molecular weight fraction of sturgeon mucus hydrolysate manufactured by the method of Article 18.

Images