Multiple specific antibodies targeting CD19, CD20, and / or CD47

Abstract

The disclosure relates generally to multi-specific antibodies that specifically bind to two or more different antigens and comprising a signal -regulatory protein alpha protein, nucleic acids encoding the multi-specific antibodies, and compositions comprising the multi-specific antibodies or nucleic acids. The disclosure also relates to in vivo methods of making these multi-specific antibodies.

Description

MRNA THERAPEUTIC IN A LIPID DELIVERY WITH MULTIPLE TARGETING AGAINST CD19, CD20, AND / OR CD47CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 614,412, filed December 22, 2023, and U.S. Provisional Patent Application No. 63 / 649,868, filed May 20, 2024, the contents of which are hereby incorporated by reference in their entirety for any and all purposes.FIELD OF THE INVENTION

[0002] The present disclosure relates to the field of immuno-oncology, especially the treatment of B cell lymphoma. Specifically, the disclosure relates to multi-specific antibodies that bind to CD 19, CD20, and / or CD47 for stimulating an immune response in a subject.BACKGROUND

[0003] B Cell Lymphoma (BCL) is a form of blood cancer that starts with B-cells (e.g., lymphocytes). The standard treatment for BCL usually starts with chemotherapy, surgery, or local radiation therapy. Beyond the standard, follow-up treatments include stem cell transplantation, or immunotherapy including, but not limited to chimeric antigen receptor T-cell therapy (CAR T-cell therapy) or targeted B-cell agents (e.g., monoclonal antibodies). While mono-specific antibodies are the primary therapeutic intervention used to treat BCL, targeting or neutralizing a single tumor antigen expressed on a BCL has not always been sufficient for effective treatment of BCL. Moreover, mono-specific antibody -based therapies have been proven to show toxicities due to broad target expression, or off-target effect, which limits their therapeutic effectiveness.

[0004] Accordingly, there exists a need for multi-specific antibodies and therapeutics with increased specificity and selectivity for multiple antigens expressed by tumor cells and / or multiple epitopes with a single tumor antigen. The present disclosure addresses this need.SUMMARY OF THE INVENTION

[0005] The present disclosure provides multi-specific antibodies that recognize two or more different antigens, isolated nucleic acids encoding these multi-specific antibodies; cells expressing the multi-specific antibodies; and in vivo methods of producing these multi-specific antibodies

[0006] One aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: (a) a first polypeptide comprising an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD 19 or CD20, where the VH is operably linked to: (i) an immunoglobulin Fc fragment; and (ii) at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20, where the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or (iv) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL1 1, and CD 155; and (b) a second polypeptide comprising an immunoglobulin light chain (VL) of an antibody that targets the first antigen, where the VL is operably linked to: (i) a linker; (ii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155; and / or (iii) at least one antigen binding domain that binds the second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0007] In some embodiments, the at least one antigen binding domain that binds the second antigen is a scFv or a Fab that targets CD 19 or CD20.

[0008] In some embodiments, the immune modulator molecule is SIRPα. In some embodiments, the immunoglobulin Fc fragment is a human immunoglobulin G1 (IgGl) Fc fragment. In someembodiments, the immunoglobulin Fc fragment has a modified effector function, for example, an enhanced or increased effector function. In some embodiments, the immunoglobulin Fc fragment has an enhanced effector function.

[0009] In some embodiments, the first polypeptide comprises, in tandem from the N-terminal to the C-terminal: (a) an anti-CD19 or CD20 VH, the IgGl Fc fragment, and the anti-CD19 or anti- CD20 scFv; (b) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule; (c) the SIRPα molecule, the anti-CD19 or anti-CD20 VH, and the IgGl Fc fragment; (d) a first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a second SIRPα molecule; (e) the anti-CD19 or anti-CD20, the IgGl Fc fragment, and the first and the second SIRPα molecules; or (f) the first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, the anti-CD19 or anti-CD20 Fab fragment, and the second SIRPα molecule.

[0010] In some embodiments, the second polypeptide comprises, in tandem from the N-terminal to the C-terminal: (a) the anti-CD19 or anti-CD20 VL, the linker, and the SIRPα molecule; (b) the SIRPα molecule, the anti-CD19 or anti-CD20 VL, and the linker; (c) the anti-CD19 or anti- CD20 scFv, the anti-CD19 or anti-CD20 VL, and the linker; (d) the anti-CD19 or anti-CD20 VL, the linker, and the anti-CD19 or anti-CD20 scFv; or (e) the anti-CD19 or anti-CD20 VL and the linker.

[0011] In some embodiments: (a) the first polypeptide comprises the first SIRPα molecule, the anti-CD19 VH, the IgGl Fc fragment, and the second SIRPα molecule, and the second polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker; (b) the first polypeptide comprises the anti-CD19 VH, the IgGlFc fragment, and the first and the second SIRPα molecules and the second polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker; (c) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second polypeptide comprises the anti-CD19 VL, the linker, and the SIRPα molecule; (d) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second polypeptide comprises the anti-CD20 VL, the linker, and the SIRPα molecule; (e) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second polypeptide comprises the SIRPα molecule,the anti-CD19 VL, and the linker; (f) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti- CD20 scFv, the anti-CD19 VL, and the linker; (g) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD20VL, the linker, and the anti-CD19 scFv; (h) the first polypeptide comprises the anti- CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD19 scFv, the anti-CD20 VL, and the linker; (i) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker; (j) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv and the second polypeptide comprises the anti-CD19 VL and the linker; (k) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises theCD19 scFv, the anti-CD19 VL, and the linker; (1) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the SIRPα molecule, the anti-CD19 VL, and the linker; (m) the first polypeptide comprises the first SIRPα molecule, the anti-CD20 VH, the IgGl Fc fragment, the anti-CD20 Fab fragment, and the second SIRPαmolecule, and the second polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker; (n) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv and the second polypeptide comprises the anti-CD20 VL and the linker; (o)the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD20 scFv, the anti-CD20 VL, and the linker; (p) the first polypeptide comprises the anti- CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker.

[0012] In some embodiments of the multi -specific antibody described herein: (a) the first polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and / or (b) the second polypeptide comprises an amino acid sequence selected from the group consisting ofSEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0013] In some embodiments of the multi-specific antibody described herein, the multi-specific antibody comprises the amino acid sequences of: (a) SEQ ID NO: 5, and SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8; (b) SEQ ID NO: 6, and SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10; (c) SEQ ID NO: 1 1, and SEQ ID NO: 13; (d) SEQ ID NO: 12, and SEQ ID NO: 13; (e) SEQ ID NO: 14, and SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18; (f) SEQ ID NO: 16, and SEQ ID NO: 8, or SEQ ID NO: 13; (g) SEQ ID NO: 1 and SEQ ID NO: 2; (h) SEQ ID NO: 3, and SEQ ID NO: 4; (i) SEQ ID NO: 20, and SEQ ID NO: 10; (j) SEQ ID NO: 21, and SEQ ID NO: 2; or (k) SEQ ID NO: 22, and SEQ ID NO: 4.

[0014] In some embodiments, the multi-specific antibody comprises the amino acid sequences of: (a) SEQ ID NO: 5, and SEQ ID NO: 7; (b) SEQ ID NO: 5, and SEQ ID NO: 8; (c) SEQ ID NO: 6, and SEQ ID NO: 9; (d) SEQ ID NO: 11, and SEQ ID NO: 13; (e) SEQ ID NO: 12, and SEQ ID NO: 13; (f ) SEQ ID NO: 14, and SEQ ID NO: 15; or (h) SEQ ID NO: 16, and SEQ ID NO: 13.

[0015] Another aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where: (a) the first recombinant polypeptide comprises a first SIRPα molecule, an immunoglobulin heavy chain (VH) of an antibody that targets CD19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second recombinant polypeptide comprises a single variable fragment (scFv) that targets CD20 (anti-CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD 19 (anti-CD19 VL), and a linker; (b) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the first and the second SIRPα molecules and the second recombinant polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker; (c) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the secondrecombinant polypeptide comprises the anti-CD19 VL, the linker, and the SIRPα molecule; (k) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second recombinant polypeptide comprises the anti-CD20 VL, the linker, and the SIRPα molecule; (1) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second recombinant polypeptide comprises the SIRPα molecule, the anti-CDI9 VL, and the linker; (m) the first recombinant polypeptide comprises the anti-CDI9 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker; (n) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD20VL, the linker, and the anti-CD19 scFv; (o) the first recombinant polypeptide comprises the anti- CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD19 scFv, the anti-CD20 VL, and the linker; or (p) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second recombinant polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker.

[0016] Another aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: (a) at least one full-length antibody that specifically binds a first antigen selected from CD 19 or CD20, wherein the full-length antibody comprises: (i) an antibody fragment selected from the group consisting of a Fab fragment, or a F(ab')2 fragment, and (ii) two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antigen binding domain; and (b) at least two antigen binding domains that bind a second antigen, wherein the antigen binding domain is selected from: (i) a Fab fragment, or a scFv that targets CD 19 or CD20; and / or (ii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155, where the full-length antibody is operably linked to the at least two antigen binding domains. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0017] In some embodiments: (a) the at least two antigen binding domains are SIRPα molecules and the second target antigen is CD47; (b) the at least two antigen binding domains are scFv that target CD 19 or CD20; and (c) the antibody fragment is a F(ab')2 fragment comprising two immunoglobulin (Ig) heavy chains and two Ig light chains.

[0018] In some embodiments, each of the at least two antigen binding domains is operably linked to: (a) the N-terminus of the two Ig light chains; (b) the N-terminus of the two Ig heavy chains; (c) the C-terminus of the two Ig light chains; and / or (d) the C-terminus of the two Fc fragments.

[0019] In some embodiments, the multi-specific antibody comprises at about least about 4, at least about 6, at least about 8, at least about 10, at least about 12, at least about 14, at least about 16, at least about 18, at least about 20, or more than about 20 antigen binding domains.

[0020] In some embodiments, the multi-specific antibody comprises at least four antigen binding domains. In that embodiment, the four antigen binding domains are SIRPα molecules , and one of the four SIRPα molecules is operably linked to: (a) the C-terminus of each of the two Fc fragments; and (b) the N-terminus of each of the two Ig light chains.

[0021] In some embodiments, the multi-specific antibody comprises at least four antigen binding domains; and the at least four antigen binding domains are two anti-CD20 or anti-CD19 scFv and two SIRPα molecules. In one embodiment, the two SIRPα molecules are two monomeric SIRPα molecules or two dimeric SIRPα molecules.

[0022] In one embodiment, (a) each of the two SIRPa molecules is operably linked to the C- terminus of each of the two Fc fragments; (b) each of the two scFv is operably linked to the N- terminus of each of the two Ig light chains; (c) each of the two scFv is operably linked to the C- terminus of each of the two Ig light chains; (d) the two scFv target a different antigen than the full-length antibody.

[0023] In one embodiment, (a) each of the two SIRPα molecules is operably linked to the C- terminus of each of the two Fc fragments; (b) each of the two scFv is operably linked to the N-terminus of each of the two Ig light chains; and (c) the two scFv target the same antigen as the full-length antibody.

[0024] In one embodiment, (a) each of the two SIRPa molecules is operably linked to the C- terminus of each of the Fc fragments; (b) each of the two scFv is operably linked to the N- terminus of each of the two Ig light chains; and (c) the two scFv target a different antigen than the full-length antibody. In that embodiment, the multi -specific antibody further comprises two SIRPα molecules, and each of the two SIRPα molecules is operably linked to the N-terminus of each of the two Ig heavy chains. Alternatively, the multi-specific antibody further comprises two SIRPα molecules and wherein the two SIRPα molecules are operably linked to each of the two SIRPα molecules linked to the C-terminus of each of the Fc fragments.

[0025] In one embodiment, (a) each of the two SIRPα molecules is operably linked to the C- terminus of each of the Fc fragments; (b) each of the two scFv is operably linked to the C- terminus of each of the two Ig light chains; and (c) the two scFv target a different antigen than the full-length antibody.

[0026] In one embodiment: (a) each of the two SIRPα molecules is operably linked to the N- terminus of each of the two Ig light chains; (b) each of the two scFv is operably linked to the C- terminus of each of the two Fc fragments; and (c) the two scFv target different antigens as the full-length antibody.

[0027] In one embodiment: (a) each of the two SIRPα molecules is operably linked to the C- terminus of each of the two Ig light chains; (b) each of the two scFv is operably linked to the C- terminus of each of the two Fc fragments; and (c) the two scFv target different antigens as the full-length antibody.

[0028] In some embodiments of the multi-specific antibody described herein, when: (a) the full- length antibody targets CD 19 and the two scFv target CD20; or when (b) the full-length antibody targets CD20 and the two scFv target CD 19.

[0029] In some embodiments of the multi-specific antibody described herein, the multi-specific antibody comprises: (a) at least one full-length antibody comprising a F(ab')2 fragment thatspecifically binds CD19 or CD20 operably linked to an IgGl Fc fragment; and (b) the at least two antigen binding domains are selected from two scFv that bind to CD 19 or CD20, and / or two SIRPα molecules.

[0030] In some embodiments of the multi-specific antibody described herein, the Fab fragments, the F(ab')2 fragment, or the scFv comprises: (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 33; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 34; or (b) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 35; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 36.

[0031] In some embodiments, the Fab fragments comprise an amino acid sequence selected from the group consisting of SEQ ID NO:33, 34, 35 and 36. In some embodiments, the scFv comprises an amino acid sequence selected from the group consisting of SEQ ID NO:37, 38, 39, and 40. In some embodiments, the Fc fragment comprises the amino acid sequence of SEQ ID NO: 41 or 42. In some embodiments, the SIRPα molecule comprises the amino acid sequence of SEQ ID NO: 42.

[0032] In some embodiments, the multi-specific antibody is selected from the group consisting of M23028, M23043, M23040; M23046; M23029; M23041; M23039; M23034; M23044; M23036; M23037; M23032; M23045; M23042; M23035; M23038; and M23033. In some embodiments, the multi-specific antibody is selected from the group consisting of M23034; M23036; M23037; M23032; M23045; M23038; and M23033. In some embodiments, the multi- specific antibody is selected from the group consisting of M23032; M23034, and M23045.

[0033] In some embodiments, the multi-specific antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 21; and SEQ ID NO: 22.

[0034] One aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: (a) at least one full-length antibody that specifically binds a first antigen selected from CD19 or CD20, wherein the full-length antibody comprises: (i) an antibody fragment selected from the group consisting of a Fab fragment, or a F(ab')2 fragment and the antibody fragment comprises two immunoglobulin (Ig) heavy chains and two Ig light chains, and (ii) two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antibody fragment; and (b) a scFv that targets CD 19 or CD20; wherein the scFv targets a different antigen than the full-length antibody, and wherein the scFv is operably linked to: (i) the C-terminus of each of the Fc fragments, (ii) the C -terminus of each of the two Ig light chains of the full-length antibody, or (iii) the N-terminus of each of the two Ig light chains of the full- length antibody; and / or (c) a SIRPα molecule that binds to CD47 on a target cell, wherein the SIRPα molecule is operably linked to: (i) the C-terminus of each of the Fc fragments, (ii) the C- terminus of each of the two Ig light chains of the full-length CD 19 or CD20 antibody, or (iii) the N-terminus of each of the two Ig light chains of the full-length CD 19 or CD20 antibody, and / or (iv) the N-terminus of each of the two Ig heavy chains of the full-length CD 19 or CD20 antibody.

[0035] In some embodiments of the multi-specific antibody described herein, the multi-specific antibody exhibits enhanced binding affinity when compared to a Fab fragment, a F(ab')2 fragment, or a scFv derived from the same antibody. In some embodiments, the SIRPα enhances the binding and / or killing properties of the multi-specific antibody when compared to a multi- specific antibody lacking the SIRPα molecule.

[0036] In some embodiments, the multi-specific antibody has an EC50: (a) between about 0.01nM-0.5nM, about 0.01nM-0.2nM, about O.OlnM-O.lnM, about 0.01nM-0.07nM, or about 0.0InM-0.05nM; or (b) at least about 0.034nM, at least about 0.01618nM, at least about 0.1771nM, at least about 0.2I83nM, at least about 0.08312nM, at least about 0.034nM, at least about 0.069nM, at least about 0.117nM, at least about 0.534nM, at least about 0.6609nM, at least about 0.06841nM, at least about 0.1929nM, at least about 0.2734nM, at least about 0.04471nM, at least about 0.4725nM, at least about 0.8945nM, or at least about 0.027nM.

[0037] Another aspect of the present disclosure provides an isolated nucleic acid encoding a multi-specific antibody described herein. In some embodiments, the isolated nucleic acid is a DNA or an RNA. In some embodiments, the RNA is mRNA. In some embodiments, the isolated nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22; SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. In some embodiments, the isolated nucleic acid further comprises a nucleic acid encoding a secretory signal sequence.

[0038] Another aspect of the present disclosure provides a vector comprising the isolated nucleic acid described herein.

[0039] Another aspect of the present disclosure provides a cell comprising the isolated nucleic acid described herein, or a vector described herein.

[0040] Another aspect of the present disclosure provides A composition comprising: (a) a nucleic acid encoding a multi-specific antibody described herein; (b) an isolated nucleic acid described herein; (c) a vector described herein; or (d) a cell described herein.

[0041] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of: (a) a first nucleic acid encoding: (i) an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD 19 or CD20; (ii) an immunoglobulin Fc fragment; and (iii) at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or (iv) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155; and (b) a second nucleic acid encoding: (i) an immunoglobulin light chain (VL) of an antibody that targets thefirst antigen; (ii) a linker; (iii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155; and / or (iv) at least one antigen binding domain that binds the second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0042] In some embodiments of the in vivo method described herein, (a) the VH is operably linked to the immunoglobulin Fc fragment; and the at least one antigen binding domain that binds the first antigen; and / or an immune modulator; and / or (b) the VL is operably linked to: the linker; the immune modulator molecule; and / or the at least one antigen binding domain that binds the second antigen. In some embodiments, the at least one antigen binding domain that binds the second antigen is a scFv or a Fab that targets CD19 or CD20. In some embodiments, the immune modulator molecule is Signal regulatory protein alpha (SIRPα). In some embodiments, the immunoglobulin Fc fragment is a human immunoglobulin G1 (IgGl) Fc fragment. In some embodiments, the immunoglobulin Fc fragment has a modified effector function. In some embodiments, the immunoglobulin Fc fragment has an enhanced effector function.

[0043] In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: (a) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and anti-CD19 or anti-CD20 scFv; (b) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule; (c) the SIRPα molecule, the anti-CD19 or anti-CD20 VH, and the IgGl Fc fragment; (d) a first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a second SIRPα molecule; (e) the anti-CD19 or anti-CD20, the IgGl Fc fragment, and the first and the second SIRPα molecules; or (f) the first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, the anti-CD19 or anti-CD20 Fab fragment, and the second SIRPαmolecule; or (g) the VH and the Fc fragment.

[0044] In some embodiments, the second nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding:(a) the anti-CD19 or anti-CD20 VL, the linker, and the SIRPα molecule; (b) the SIRPα molecule, the anti-CD19 or anti-CD20 VL, and the linker; (c) the anti-CD19 or anti-CD20 scFv, the anti-CD19 or anti-CD20 VL, and the linker; (d) the anti-CD19 or anti-CD20 VL, the linker, and the anti-CD19 or anti-CD20 scFv; or (e) the anti-CD19 or anti- CD20 VL and the linker.

[0045] In some embodiments of the in vivo method described herein, the subject is administered: (a) the first nucleic acid comprising the first SIRPα molecule, the anti-CD19 VH, the IgGl Fc fragment, and the second SIRPα molecule, and the second nucleic acid comprising the anti- CD20 scFv, the anti-CD19 VL, and the linker; (b) the first nucleic acid comprising the anti- CD 19 VH, the IgGlFc fragment, and the first and the second SIRPα molecules and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; (c) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid comprising the anti-CD19 VL, the linker, and the SIRPα molecule; (d) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid comprising the anti-CD20 VL, the linker, and the SIRPα molecule; (e) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid comprising the SIRPα molecule, the anti -CD 19 VL, and the linker; (f) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; (g) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20VL, the linker, and the anti-CD19 scFv; (h) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti- CD 19 scFv, the anti-CD20 VL, and the linker; or (i) the first nucleic acid comprising the anti- CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acidcomprising the SIRPα molecule, the anti-CD20 VL, and the linker; (j) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv and the second nucleic acid comprising the anti-CD19 VL and the linker; (k) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising theCD19 scFv, the anti-CD19 VL, and the linker; (1) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD19 VL, and the linker; (m) the first nucleic acid comprising the first SIRPα molecule, the anti-CD20 VH, the IgGl Fc fragment, the anti-CD20 Fab fragment, and the second SIRPαmolecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD20 VL, and the linker; (n) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv and the second nucleic acid comprising the anti-CD20 VL and the linker; (o) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD20 VL, and the linker; (p) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD20 VL, and the linker.

[0046] In some embodiments of the in vivo method described herein: (a) the first nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and / or (b) the second nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19.

[0047] In some embodiments of the in vivo method described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: (a) SEQ ID NO: 5, and SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8; (b) SEQ ID NO: 6, and SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10; (c) SEQ ID NO: 11, and SEQ ID NO: 13; (d) SEQ ID NO: 12, and SEQ ID NO: 13; (e) SEQ ID NO: 14, and SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, orSEQ ID NO: 18; (f) SEQ ID NO: 16, and SEQ ID NO: 8, or SEQ ID NO: 13; (g) SEQ ID NO: 20, and SEQ ID NO: 10; (h) SEQ ID NO: 21, and SEQ ID NO: 2; (i) SEQ ID NO: 22, and SEQ ID NO: 4; (j) SEQ ID NO: 1 and SEQ ID NO: 2; or (k) SEQ ID NO: 3, and SEQ ID NO: 4.

[0048] In some embodiments of the in vivo method described herein the subject is administered the first and second nucleic acids encoding the amino acid sequences of: (a) SEQ ID NO: 5, and SEQ ID NO: 7; (b) SEQ ID NO: 5, and SEQ ID NO: 8; (c) SEQ ID NO: 6, and SEQ ID NO: 9; (d) SEQ ID NO: 11, and SEQ ID NO: 13; (e) SEQ ID NO: 12, and SEQ ID NO: 13; (f) SEQ ID NO: 14, and SEQ ID NO: 15; or (h) SEQ ID NO: 16, and SEQ ID NO: 13.

[0049] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules, wherein, when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and where: (a) the first nucleic acid encodes a polypeptide comprising a first SIRPα molecule, an immunoglobulin heavy chain (VH) of an antibody that targets CD 19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl ) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising a single variable fragment (scFv) that targets CD20 (anti-CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD 19 (anti -CD 19 VL), and a linker; (b) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the first and the second SIRPα molecules and the second nucleic acid encodes a polypeptide comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; (c) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid encodes a polypeptide comprising the anti-CD19 VL, the linker, and the SIRPα molecule; (e) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid encodes a polypeptide comprising the anti-CD20 VL, the linker, and the SIRPα molecule; (f) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid encodes a polypeptide comprising the SIRPα molecule, the anti-CD19 VL, and the linker; (g) thefirst nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti- CD20 scFv, the anti-CD19 VL, and the linker; (h) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD20VL, the linker, and the anti-CD19 scFv; (i) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD19 scFv, the anti-CD20 VL, and the linker; or (j) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid encodes a polypeptide comprising the SIRPα molecule, the anti-CD20 VL, and the linker.

[0050] In some embodiments of the in vivo method described herein, a single polynucleotide comprises the first and second nucleic acids.

[0051] In some embodiments of the in vivo method described herein, the first nucleic acid or the second nucleic acid further comprises a modified nucleotide, a cap structure, a poly A tail, a 5' untranslated region, and / or a 3' untranslated region. In some embodiments, the first or the second nucleic acid is a DNA or an RNA. In some embodiments, the RNA is an mRNA. In some embodiments, the first or the second nucleic acid is a synthetic mRNA or a modified mRNA. In some embodiments, the first or the second nucleic acid is synthesized from: (a) naturally occurring nucleotides; or (b) modified nucleotide analogues selected from the group consisting of 1 -methyladenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N-6-methyl- adenine, N-6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5- methyl-cytosine, 2,6-diaminopurine, 1 -methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methylguanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio- uracil, 4-thiouracil, 5-carboxymethylaminomethyl-2-thio- uracil, 5-(carboxyhydroxymethyl)- uracil, 5-fluorouracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio- uracil, 5 -methyluracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5- methoxyaminomethyl-2-thio-uracil, 5-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1 -methyl -pseudouracil, queosine, β-D- mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, 1 -methylpseudouridine, and inosine.

[0052] In some embodiments of the in vivo method described herein, the predetermined molar ratio of the first and the second nucleic acids is: (a) about 1 : 1, about 1 :2, about 1 :3, about 1 :4, about 2: 1: about 3:1, about 4:1, about 5: 1 or about 6: 1; or (b) about 1: 1 or about 2: 1.

[0053] In some embodiments of the in vivo method described herein, the first and second nucleic acids are encapsulated in one or more lipid nanoparticles (LPN). In some embodiments, the one or more lipid nanoparticles are selected from the group consisting of liposomes, lipid complexes, and lipoplexes. In some embodiments, the first and second nucleic acids are encapsulated in the same LPNs or in separate LPNs. In some embodiments, each LPN comprises: (a) a cationic lipid; or (b) a cationic lipid, a non-cationic lipid, a neutral lipid, a cholesterol, a cholesterol-based lipid, a PEG a PEG-modified lipid, or any combination thereof.

[0054] In some embodiments of the in vivo method described herein (a) the cationic lipids constitute about 5% to about 50% of the total lipids in the LPN; (b) the cationic lipids constitute about 10% to about 40% of the total lipids in the LPN; (c) the cationic lipids constitute about 30% to about 90% of the total lipids in the LPN; (d) the cationic lipids constitute about 30% to about 70% of the total lipids in the LPN; (e) the PEG-modified lipids constitute about 0.5% to about 20% of the total lipids in the LPN; or (f) the PEG-modified lipids constitute about 4% to about 10% of the total lipids in the LPN.

[0055] In some embodiments, the one or more LPNs have a size: (a) of about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, or about 250 nm; or (b) in the range from about 50 nm to about 300 nm, about 60 nm to about 250 nm, about 60 nm to about 150 nm, or about 60 nm to about 120 nm.

[0056] In some embodiments of the in vivo method described herein, the first nucleic acid or the second nucleic acid further comprises a nucleic acid encoding a secretory signal peptide.

[0057] In some embodiments of the in vivo method described herein, the multi-specific antibody is produced within about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, or about 120 hours post-administration.

[0058] In some embodiments of the in vivo method described herein, the multi-specific antibody is an IgG antibody.

[0059] In some embodiments of the in vivo method described herein, the subject is a cell or a whole organism. In some embodiments, the subject is a cell, and administering comprises transfecting the cell with the first and second nucleic acids. In some embodiments, the subject is a whole organism selected from a mammal, a non-human primate, or a human. In some embodiments, the subject is systemically administered the first and the second nucleic acids. In some embodiments, systemic administration comprises an intravenous or an intraperitoneal administration. In some embodiments, the subject has cancer (e.g., B cell lymphoma).

[0060] Another aspect of the present disclosure provides a multi-specific antibody produced by the in vivo method described herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0061] FIGs. 1A-J show schematic depictions of the structures of the anti-CD19 multi-specific antibodies disclosed herein, including mono-, bi-, and tri-specific antibodies. The mono-specific anti-CD19 antibodies include (FIG. 1A) M23027 (Anti-CD19 (VH)-IgGl + Anti-CD19 (VL)- CK); and (FIG. IB) M23031 (Anti-CD19 (VH)-lgGl (Tafa_enhanced ADCC) + Anti-CD19 (VL)-CK).

[0062] The anti-CD19 multi-specific antibodies are optionally operably linked to an immune modulator that targets a second antigen (e.g., Signal Regulatory Protein alpha (SIRPα) that targets CD47)) and / or an anti-CD20 or anti-CD19 single-chain variable fragment (scFv). The bi- specific anti-CD19 antibodies include (FIG. 1C) M23028 (Anti-CD19(VH)-IgGl-CD20 (scFv) + Anti-CD19 (VL)-CK); (FIG. ID) M23043 (Anti-CD19(VH)-IgGl -SIRPA + Anti-CD19(scFv)-Anti-CD19-(VK)-CK); and (FIG. IE) M23040 (Anti-CD19(VH)-IgGl-SIRPA + SIRPA-Anti-CD19 (VL)-CK).

[0063] The tri-specific anti-CD19 antibodies include (FIG. IF) M23034 or M23044 (Anti- CD 19(VH)-IgGl-CD20(scFv) + SIRPA-Anti-CD19 (VL)-CK); (FIG. 1G) M23036 (SIRPA- Anti-CD19 (VH)-IgGl-SIRPA + Anti-CD20 (scFv)-Anti-CD19(VL)-CK); (FIG. 1H) M23O37 (Anti-CD19 (VH)-IgGl -SIRPA (2X) + Anti-CD20 (scFv)-Anti-CD19(VL)-CK); (FIG. II) M23032 (Anti-CD19(VH)-IgGl-CD20(scFv) + Anti-CD19 (VL)-CK-SIRPA); and (FIG. 1J) M23045 (Anti-CD19(VH)-IgGl -SIRPA + Anti-CD20 (scFv)-Anti-CD19(VL)-CK).

[0064] FIGs. 2A-J show schematic depictions of the structures of the anti-CD20 multi-specific antibodies disclosed herein, including mono-, bi-, and tri-specific antibodies. The mono-specific anti-CD20 antibodies include (FIG. 2A) M23026 (Anti-CD20 (VH)-IgGl + Anti-CD20 (VL)- CK ); and (FIG. 2B) M23030 (Anti-CD20 (VH)-IgGl (Rituxan Fc) + Anti-CD20 (VL)-CK).

[0065] The anti-CD20 multi-specific antibodies are optionally operably linked to an immune modulator that targets a second antigen (e.g., Signal Regulatory Protein alpha (SIRPα) that targets CD47)); and / or an anti-CD20 or anti-CD19 single-chain variable fragment (scFv). The bi- specific anti-CD20 antibodies include (FIG. 2C) M23029 (Anti-CD20(VH-IgGl-CD19 (scFv)+ Anti-CD20 (VL)-CK); (FIG. 2D) M23041 (Anti-CD20 (VH)-IgGl -SIRPA + Anti-CD20(scFv)- Anti-CD20-(VK)-CK); (FIG. 2E) M23039 (Anti-CD20 (VH)-IgGl -SIRPA + SIRPA-Anti- CD20 (VL)-CK); and (FIG. 2F) M23046 (SIRPA-anti-CD20(VH)-IgG-anti-CD20(VH)-CHl + SIRPA-Anti-CD20 (VL)-CK).

[0066] The tri-specific anti-CD20 antibodies include (FIG. 2G) M23042 (anti-CD20 (VH)- IgGl-SIRPA + Anti-CD19(scFv)-Anti-CD20 (VK)-CK); (FIG. 1H) M23035 (Anti-CD20(VH- IgGl-CD19 (scFv) + SIRPA-Anti-CD20 (VL)-CK); (FIG. II) M23038 (Anti-CD20 (VH)-IgGl- SIRPA + Anti-CD20(VL)-CK-anti-CD19 (scFv)); and (FIG. 1J) M23033 (Anti-CD20(VH- IgGl-CD19 (scFv) + Anti-CD20 (VL)-CK-SIRPA).

[0067] FIGs. 3A-H show schematic depictions of the structures of anti-CD20 or an anti-CD19 chimeric single-chain variable fragment (scFv) Fc fusion molecules (FIGs. 3A-F) and chimeric SIRPα-Fc fusion molecules (FIGs. 3G-H). The chimeric scFv-Fc fusion molecules are mono-specific (FIGs. 3A-D) or tri-specific (FIGs. 3E-F). The mono-specific anti-CD19 chimeric scFv-Fc fusion molecules include (FIG. 3A) S1826 (Anti-CD19(scFv VL-VH)-IgGl); S1806 (Anti-CD19(scFv VH-VL)-IgGl); and (FIG. 3B) S1806 (Anti-CD19(scFv VH-VL)-IgGl). The mono-specific anti-CD20 chimeric scFv-Fc fusion molecules include (FIG. 3C) S1827 (Anti- CD20(scFv VL-VH)-IgGl); and (FIG. 3D) S1807 (Anti-CD20(scFv VH-VL)-IgGl).

[0068] The chimeric scFv-Fc fusion molecules are optionally operably linked to an immune modulator that targets a second antigen (e.g., Signal Regulatory Protein alpha (SIRPα) that targets CD47)); and / or an anti-CD20 or anti -CD 19 (scFv. The tri-specific anti-CD19 / CD20 chimeric scFv-Fc molecules include (FIG. 3E) S1820 (Anti-CD19(scFv)-SIRPA-IgGl-SIRPA- anti-CD20(ScFv)); and (FIG. 3F) S 1819 (SIRPA-anti-CD19&CD20 (scFv)-IgGl -SIRPA).

[0069] The chimeric SIRPα-Fc fusion molecules include bivalent WT SIRPα (FIG. 3G) and tetravalent WT SIRPα (FIG. 3H).

[0070] FIGs. 4A-C show a graph demonstrating the strong binding of the anti-CD19 and anti- CD20 tri-specific antibodies and chimeric scFv-Fc molecules (M23037, M23033, M23038, M23045, M23034 (M23044), M23032, M23042, S1820, M23035, and S 1819) to Raji cells (FIG. 4A). All tri-specific molecules showed very high binding affinity to Raji cells. The binding to Raji cells were ranked as follows M23037 was superior (>) to M23033, and M23033 > M23038> M23045> M23034 (M23044)> M23032> M23042>S1820> M23035>S1819 (FIG. 4B) The binding of M23033 to Raji cells was equal to that of M23036. The tri-specific chimeric scFv-Fc molecules (e.g, S1820 and S 1819) showed lower binding affinity to Raji cells when compared to the anti-CD19 and anti-CD20 tri-specific antibodies (FIG. 4C). The CD20 fab constructs operably linked to any molecules on the N-terminal of light chain of the tri-specific antibody (e.g., M23042 (anti-CD20 (VH)-IgGl- SIRPA + Anti-CD19(scFv)-Anti-CD20 (VK)- CK ) and M23035 (Anti-CD20(VH-IgGl-CD19 (scFv) + SIRPA-Anti-CD20 (VL)-CK)) showed slightly weaker binding when compared to other tri-specific antibodies (FIG. 4C).

[0071] FIG. 5 shows schematic depictions of the structures of exemplary multi-specific antibodies ranked based on: (a) in-depth binding analysis (e.g., ELISA, Biacore™, single target cell lines); (b) functional characterization (e.g., normal B-cell depletion with and without Raji,lymphoma B-cell depletion, Antibody-dependent cellular cytotoxicity (ADCC) on Raji, cynomolgus macaque (cyno) whole blood assay); (c) on-target off-tumor binding (e.g, RBC (human and cyno), T-cell (human)); and (d) in-vivo expression, mRNA quality, expression in mice, in-vivo purity. The exemplary multi-specific antibodies were M23032, M23033 ( EC50: 0.034), M23034 ( EC50: 0.069), M23036 ( EC50: 0.117), M23037 ( EC50: 0.534), M23038 ( EC50: 0.027), M23045. M23032 (Anti-CD19(VH)-IgGl-CD20(scFv) + Anti-CD19 (VL)-CK-SIRPA) showed stronger response followed by M23045 (Anti-CD19(VH)-IgGl-SIRPA + Anti-CD20 (scFv)-Anti-CD19(VL)-CK). M23026 (Rituximab with in-house Fc; EC50: 0.2980nM).1’0072] FIGs. 6A-D show graphs demonstrating the binding of the anti-CD20 and anti-CD19 tri- specific antibodies and the chimeric anti-CD20 and anti-CD19 scFv-Fc fusion molecules when compared to control Rituximab (anti-CD20 antibody) and Tafasitamab (anti-CD19 antibody).

[0073] FIG. 6A shows the binding of commercial Rituximab (Human IgG monoclonal) and Tafasitamab (commercial Fc; M23031(Anti-CD19 (VH)-IgGl (Tafa enhanced ADCC) + Anti- CD F (VL)-CK) and novel variants (in-house) of Rituximab and Tafasitamab to Raji cells; and demonstrates that both in house Tafasitamab (M23027; Anti-CD19 (VH)-IgGl + Anti-CD19 (VL)-CK); and in house Rituximab (in house Fc; M23026 (Anti-CD20 (VH)-IgGl + Anti-CD20 (VL)-C) showed better binding to Raji cells when compared to the commercial Tafasitamab and Rituximab.

[0074] FIG. 6B shows the binding of anti-CD19 tri-specific antibodies to Raji cells when compared to commercial Rituximab (anti-CD20 antibody), bivalent-SIRPα WT (SIRPα-Fc fusion molecule), or a tretravalent-SIRPα (SIRPα-Fc fusion molecule). All anti-CD19 tri-specific antibodies bound significantly to Raji cells compared to controls (CD19-Fab alone (M23027) and SIRPα bivalent / Tetravalent).

[0075] FIG. 6C shows the binding of anti-CD20 tri-specific antibodies (M23029, M23033, M23035, M23038, M23039, M23041, M23042, and M23046) to Raji cells when compared to commercial Rituximab, in-house Rituximab (M23026 or M23030), bivalent-SIRPα WT (SIRPα- Fc fusion molecule), or a tretravalent-SIRPα (SIRPα-Fc fusion molecule). The in house Rituximab (M23026) bounds higher than any tri-specific molecules with CD20-Fab as well aspurchased Rituximab. Anti-CD20 tri-specific molecules operably linked to SIRPα or scFv to the N-terminal of the heavy chain CD20-Fab (e.g., M23035, M23041, M23042 and M23046) resulted in reduced binding.

[0076] FIG. 6D shows the binding of anti-CD20 and anti-CD19chimeric scFv-Fc fusion molecules to Raji cells and shows variable binding results among S1826, S1806, S1820, S1827, S1807, and S1819.

[0077] FIG- 7 shows a workflow for the binding and occupation assays. The binding assay measures the binding of drug molecules to cells and the occupation assay measures available binding sites remaining after drug binding. The binding and occupation assays comprise 2-steps. Step 1 comprises coating cells with increasing concentration of drug of interest; and step 2 comprises staining cells with PE labeled anti-huFC (binding assay) or PE labeled SIRPα (occupation).

[0078] FIG. 8 shows a graph quantifying results of the occupancy assay and confirming target engagement by the multi-specific antibodies disclosed herein; and identifying M23042, SI 820, M23035, and S 1819 as showing weak binding (bold boxes), which is consistent with the Raji cell binding analysis shown in FIG. 4C. Most tri-specific antibodies bound their respective targets. Anti-CD20 arms of the tri-specific antibodies were more sensitive and lost binding in 5 designs (scFv or VL modified). M23036 and M23028 did not show binding to CD20. SIRPα binding was equal or superior to tetraval ent SIRPα regardless of valency.

[0079] FIGs. 9A-C show bar graphs quantifying the surface expression of CD 19 (FIG. 9A), CD20 (FIG. 9B), and CD47 (FIG. 9C) target antigens on primary B-cells, B-cell Lymphoma patient’s B-cells, and Raji cells. Specifically, the surface expression of CD19, CD20, and CD47 was high in Raji cells; the surface expression of CD19 and CD20 was very low in lymphoma cells (BCL) and primary B cells. The surface expression of CD47 was elevated (mod-range) in lymphoma cells (BCL) and primary B cells

[0080] FIGs. 10A-D show graphs demonstrating the cytotoxic effects of the anti-CD20 and anti-CD19 tri-specific antibodies on Raji cells and Human PBMC. The percentage of dead Raji Cells (FIG. 10A), the percentage of normal B cell depletion (FIG. 10B), and the percentage ofnormal B cell count (FIG. IOC) showed that the anti-CD20 and anti-CD19 tri-specific antibodies effectively bound to and killed Raji cells and human PBMC. The binding of M23034 was higher than (>) M23032 > M23037 > M23045 > M23038 > M23033. Unexpectedly, two anti-CD20 tri- specific molecules (M23033 and M23038) showed slightly reduced binding. Table 6 shows the EC50and EC90of the binding of each of the tri-specific antibodies. FIG. IOC shows the binding of the anti-CD20 and anti-CD19 tri-specific antibodies using B cell from a second donor (Donor 10), showing substantially comparable results as FIG. 10B. However, the binding of M23032 was higher than (>) M23034 > M23036 > M23037 > M23045 > M23038 > M23033.

[0081] The percentage of dead B Cell Lymphoma (BCL) cells following exposure to M23027, M23026, M23028, M23029, M23032, M23033, M23034, M23035, M23038, M23042, S 1819, or S I 820 is quantified in FIG. 10D. In particular, FIG. 10D shows that all tested anti- CD 19 / CD20 / SIRPα tri-specific antibodies induced primary lymphoma cells killing.

[0082] FIGs. 11A-B show graphs demonstrating that the tri-specific antibodies described herein (FIG. HA) killed Raji cells in Complement-Dependent Cytotoxicity (CDC) assay with Raji cells and human serum when compared to controls and bi-specific antibodies (FIG. 1 IB). All tested tri-specific antibodies e.g., M23034, M23045, M23036, M23032, and M23033) killed Raji cells with similar efficiency in the CDC assay, but the killing efficiency of M23034 was higher (>) than M23045 > M23036 > M23032 > M23033. The tri-specific antibodies showed stronger killing efficiency when compared to bi-specific antibodies (FIG. 11 A vs FIG. B).

[0083] FIGs. 12A-C show a graph (FIG. 12A) and a table (FIG. 12B) quantifying the Antibody-dependent cellular cytotoxicity (ADCC) of the anti-CD19 / anti-CD20 tri-specific antibodies using Raji cells; and demonstrating that most tri-specific antibodies showed similar binding affinity (EC50) to Raji. In particular, tri-specific antibodies comprising CD20 Fab showed superior max killing. M23033 and M23038 showed the best ADCC activity (perhaps because of the availability of more CD20 binding sites) when compared to M23032, M23034, M23036, M23045, and M23037. The affinity of tri-specific antibodies comprising a CD19 Fab (M23032 and M23034) also showed very high ADCC activity, which was weakly less than M23033 and M23038. FIG. 12C shows exemplary anti-CD19 / anti-CD20 tri-specific antibodiesbased on ADCC EC50values on Raji cells; and demonstrate that all evaluated tri-specific antibodies had double or low triple digit pMEC50. Unexpectedly, Raji cells had 5-fold higher expression of CD20 compared to CD 19.

[0084] FIGs. 13A-D show a workflow of a whole blood ex vivo assay (FIG. 13A) and graphs quantifying the results of B-cell depletion in the whole blood ex vivo assay (FIGs. 13B-D); and demonstrate that the tri-specific antibodies efficiently depleted Cyno B-cells in the whole blood ex vivo assay. FIG. 13B shows the effectiveness and ranking of the tri-specific antibodies. M23032 and M23034 showed significantly higher B-cell depletion compared to other tested tri- specific antibodies. The tri-specific antibodies were ranked as follows: M23032 > M23034 > M23037 > M23045 > M23036 > M23038 > M23033 > S1819. Unexpectedly, in contrast to the ADCC assay of FIGs. 12A-C, the B-cell depletion induced by M23033 and M23038 did not show any significant difference when compared to a control mono-specific antibody (M23026). FIG. 13C shows the effectiveness of tri-specific antibodies containing CD 19 Fab at depleting B- cells and demonstrating that M23032, M23034, and M23045 significantly enhanced B cell depletion when compared to the control mono-specific antibodies (M23026 or M23027). FIG. 13D shows the effectiveness of tri-specific antibodies containing CD20 Fab at depleting B-cells and demonstrating that M23033, and M23038 enhanced B cell depletion. Unexpectedly, tri- specific antibodies containing CD19 Fab showed a significantly higher B cell depletion when compared to tri-specific antibodies containing CD20 Fab.

[0085] FIGs. 14A-D show graphs quantifying the binding of the tri-specific antibodies to human red blood cells (RBCs) and T cells; and demonstrating the binding selectivity of the tri-specific antibodies for B-cells. FIG. 14A shows that none of the tested multi-specific molecules showed binding in human RBCs. In particular, the tri-specific antibodies did not bind to human RBCs. 1054 is a SIRPα-bivalent high affinity Fc chimeric molecule. FIG. 14B-C show that, expectedly*, at very high concentration (> InM), some tri-specific antibodies showed weak binding to cynomolgus macaque (cyno) RBCs from two donors. *SIRPα containing molecules are known to bind to RBC at very high concentration. All multi-specific molecules bound significantly lower than HA in both donors. The binding of M23034 to RBCs was slightly higherthan the binding of M23032 in both donors. FIG. 14D shows a graph demonstrating that some tested tri-specific antibodies showed weak binding to T cells at high concentration. In particular, the binding of M23033 was less than (<) M23032 < M23034, which was equal to (=) M23045 = M23038 < M23036 < M23037.

[0086] FIGs. 15A-C show an E-gel agarose electrophoresis image (FIG. 15A) and an automated electrophoresis system result (electropherogram trace (FIG. 15B) and a virtual gel image (FIG. 15C)) demonstrating the nucleic acid integrity of the engineered BCL constructs disclosed herein (See e.g., Table 7). Construct 1814 (SIRPA-Anti-CD19 (VH)-IgGl-SIRPA) showed an additional peak in the E-gel, the virtual gel, and the electropherogram trace. An electropherogram is a nucleic acid fluorescence vs. time trace.

[0087] FIG. 16 shows a bar graph quantifying the expression of the engineered multi-specific antibodies in vivo 24 hours after the heavy chain immunoglobulin (VH; H) and light chain immunoglobulin (VL; L) constructs were administered to mice at the disclosed ratios (H:L chain ratio). Expression was assessed by human IgGl ELISA. M23045 had the highest overall expression at all ratios evaluated (2: 1, 1 : 1, or 1 :2). The second best expression was seen with M23032, M23033 and M23037 generating constructs with a concentration of about 5ug / ml. EC90less or equal to 2ug / ml for M23032, M23034, M23045 based on human peripheral blood mononuclear cells (human PBMCs) B cell depletion. Tetravalent SIRPα had lower expression than expected with a concentration of about 2.5ug / ml when compared to about 15pg / ml in MS047 and MS049.

[0088] FIG. 17 shows automated Western Blot chromatograms demonstrating the expression and purity of the in-vivo expressed M23032 at different ratios. In particular, in-vivo expressed M23032 was homogenous (high purity), in all the three ratios evaluated (2: 1, 1:1, and 1 :2).

[0089] FIG. 18 shows automated Western Blot chromatograms demonstrating the expression and high purity of the in-vivo expressed M23033 in all the three ratios evaluated (2: 1, 1 :1, and 1 :2).

[0090] FIG. 19 shows automated Western Blot chromatograms demonstrating the expression and high purity of the in-vivo expressed M23033 in all the three ratios evaluated (2: 1, 1 :1, and 1 :2).

[0091] FIG. 20 shows a table summarizing the functional characteristics of the novel tri-specific antibodies disclosed herein.

[0092] FIGs. 21A-D show graphs demonstrating the Antibody-dependent cellular cytotoxicity (ADCC) induced by M23038 (FIGs. 21A-B) and the binding of M23038 on Raji cells (FIGs. 21C-D). The ADCC of M23038 was assessed as a purified protein, aggregated of proteins (FIG. 21A), or mRNA Sup (FIG. 21B). The ADCC EC50was 0.04131 (purified protein), 0.03052 (aggregated protein), and 0.08355 (mRNA Sup). The mRNA sup was used at a starting concentration of about lOnM because the concentration was relatively low.

[0093] FIGs. 22A-G show chromatographs illustrating the binding of the tri-specific antibodies, M23032 (FIG. 22A), M23033 (FIG. 22B), M23034 (FIG. 22C), M23036(FIG. 22D), M23037 (FIG. 22E), M23038 (FIG. 22F), M23045 (FIG. 22D) to their target antigens (CD 19; CD20, and CD47) on Raji cells using Biacore™. Most tri-specific antibodies bound strongly to the target antigen, except for M23032 and M23034 (C -terminal fusions), which showed reduced binding to CD20.

[0094] FIGs. 23A-E show graphs demonstrating the effect of a single target binding on the activity of the tri-specific antibodies. The binding of M23032, M23034, and M23045 on WT Raji cells (FIG. 23A), Raji cells expressing CD19 only (FIG. 23B), Raji cells expressing CD20 only (FIGs. 23D-E), or Raji cells expressing CD47 only (FIG. 23C) were substantially the same. M23026, M23027, and tetravalent SlRPα-Fc fusion molecule were used as control. Unexpectedly, M23045 showed the highest binding affinity to CD 19 or CD20 when compared to M23032 and M23034 under these circumstances.

[0095] FIGs. 24 A-C show that a single intravenous (IV) dose of M23032 mRNA resulted in robust (over 90%) circulating B cells depletion in cynomolgus macaques. FIG. 24A shows a schematic of the experimental set up. FIG. 24B shows flow cytometry data demonstrating the levels of circulating B cells in animals treated with a control mRNA, 0.3 mg / kg M23032 mRNA,0.3 mg / kg M23032 mRNA formulated with Compound 41 LPN at day 0, 3 and 7 (see also, FIG. 33). FIG. 24C shows a bar graph quantifying the data of FIG. 24B; and illustrating that treatment with the M23032 mRNA depleted over 90% of circulating B cells in treated animals by day 7. Robust B cell depletion in four out of four animals dosed with M23032 mRNA is shown (see also, FIG. 33). Furthermore, IV administration of M23032 mRNA was well- tolerated in NHPs.

[0096] FIGs. 25A-Y show Table 10, which discloses 59 examples of hydroxyalkyl-capped cationic peptoids.

[0097] FIGs. 26A-B show that intravenous (IV) dose of M23032 mRNA resulted in tumor control in Raji xenograft model. FIG 26A shows a schematic of study design. FIG 26B shows mean tumor growth over time and illustrates that animals that were dosed every 7 days with M23032 RNA at 15 pg or 30pg controlled growth of Raji tumors that were subcutaneously implanted 4 days before the first dose and not for untreated animals.

[0098] FIG. 27 shows serum titers of M23032 protein in Raji tumor-bearing animals of FIGs. 26A-B 24 hours after the first RNA administration.

[0099] FIGs. 28A-C show tumor growth of individual animals over time for untreated mice (FIG. 28A); mice IV administered with 15pg M23032 RNA (FIG 28B); and mice IV administered with 30pg M23032 RNA (FIG. 28C).

[0100] FIGs. 29A-B show that administering an intravenous (IV) dose of 0.75 mg / kg M23032 mRNA resulted in sustained depletion of circulating B cells in cynomolgus macaques through D52 post-dosing. FIG. 29A shows that cynomolgus macaques administered with M23032 RNA IV formulation had between 1-3% B cells in total lymphocytes from day 7 through 52, which was lower than B cells measured in animals that received a control RNA. FIG. 29B shows that the CD21+and CD21lowB cell subpopulations were both depleted in M23032 RNA treated cynomolgus macaques (n=2) compared to controls.

[0101] FIGs. 30 A-C show graphs quantifying the levels of M23032 protein on B cells (FIG. 30A), T cells (FIG. 30B), and Red Blood cells (RBC; FIG. 30C) from M23032 RNA treatedcynomolgus macaques of FIG. 29. FIG. 30A shows that significantly higher levels of M23032 protein were measured on B cells from IV M23032 RNA treated animals compared to animals that received a control RNA. FIG30B shows that higher levels of M23032 protein were measured on T cells from IV M23032 RNA treated animals compared to animals that received a control RNA. FIG. 30C shows that no detectable M23032 protein were observed on red blood cells in IV M23032 RNA treated animals. The M23032 protein levels were not above background levels was on red blood cells, which was similar to M23032 protein levels from animals that received a control RNA.

[0102] FIG. 31 shows plasma titers of M23032 protein in treated animals 24h after receiving an IV dose of M23032 RNA as described in FIG. 29.

[0103] FIG. 32 shows automated Western Blot chromatograms demonstrating the expression and high in vivo M23032 protein purity in plasma from IVM23032 RNA treated animals.

[0104] FIG. 33 shows a bar graph quantifying amounts of CD47 engagement by M23032 proteins on the surface of Raji cells assessed by purified M23032, SIRP-Fc, or high affinity SIRP-Fc proteins following incubation with different combinations of anti-CD19 and anti-CD20 antibodies. This data shows that CD47 engagement by M23032 was significantly enhanced by CD20 and CD 19 engagement; and that M23032 protein binding to tumor cells was significantly enhanced in tumor cells that expressed all three targets. See also, FIGs. 24B and 24C.

[0105] FIG. 34 shows a graph illustrating the binding of a monospecific CD20 antibody (M23026), a monospecific CD19 antibody (M23027), or a tri-specific CD19, CD20 and CD47 protein (M23032) to a single cell suspension of lymphoma cells from a primary lymphoma patient tumor biopsy. M23032 showed enhanced binding affinity to the primary CD219+ / CD20+primary lymphoma cells when compared to the monospecific antibody.

[0106] FIGs. 35A- B show graphs illustrating the target-specific killing of primary patient lymphoma cells by primary human Natural killer cells mediated by a monospecific CD20 antibody (M23026), a monospecific CD19 antibody (M23027), or a tri-specific CD19, CD20 and CD47 (M23032) protein. FIG. 35A shows results of an antibody-dependent cellular cytotoxicity (ADCC) assay illustrating the target specific cytotoxicity mediated by M23026 ( EC50= 1.929),M23027 ( EC50= 80.66), and M23032 ( EC50= 2.182) against all cells in the primary lymphoma patient tumor biopsy using the intracellular dye CellTrace™ violet (CTV). M23032 showed enhanced target-specific killing potency when compared to M23027. FIG. 35B shows results of ADCC assays illustrating the target-specific cytotoxicity mediated by M23026 ( EC50= 7.211), M23027 ( EC50= 0.1129), and M23032 ( EC50= 3.919) against lymphoma B cells in the primary lymphoma patient tumor biopsy.

[0107] FIG. 36 shows constructs of four variants (PN) of the tri-specific CD 19, CD20 and CD47 (M23032) protein comprising specific antigen binding domain structures (CD20 binders). Specifically, the anti-CD20 scFv of Rituximab in M23032 was replaced with the scFv of Ofatumumab or Ocrelizumab in the traditional heavy chain variable region (VH)-to-Light chain variable region (VL) orientation (VH-VL_ccl_balanced); or in light chain variable region (VL)- to- heavy chain variable region (VH) orientation (VL-VH_ccl balanced). In Protein No. 240001 (PN240001), the anti-CD20 scFv of Rituximab in M23032 was replaced with an anti-CD20 scFv of Ofatumumab in the traditional VH-VL orientation. In PN240003, the anti-CD20 scFv of Rituximab in M23032 was replaced with an anti-CD20 scFv of Ofatumumab in the VL-VH orientation. In PN240005, the anti-CD20 scFv of Rituximab in M23032 was replaced with an anti-CD20 scFv of Ocrelizumab in the VL-VH orientation. In PN240006, the anti-CD20 scFv of Rituximab in M23032 was replaced with an anti-CD20 scFv of Ocrelizumab in the traditional VH-VL orientation.

[0108] FIGs. 37A-D show graphs and tables illustrating the binding specificity of the four M23032 variants to CD20 expressed on CD19'CD20+CD47- Raji cells. FIG. 37A shows the binding affinity of the new trispecific antibody variants to CD20 when compared to M23032 based on fluorescence intensity (MFI) and illustrates that the binding of PN240006 was enhanced when compared to PN240003, PN240005, or PN240006. FIG. 37B shows a table summarizing the EC50of PN240001 ( EC50=36.04), PN240003 ( EC50=9.134), PN240005 ( EC50=22.46), PN240006 ( EC50=25.28), and M23032 ( EC50=47.14). FIG. 37C shows the binding affinity of the trispecific antibody variants to CD20 on Raji cells when compared to the binding of the monospecific anti-CD20 antibody (M23026; Rituximab) based on fluorescence intensity(MFI). FIG. 37D shows a table summarizing the EC50of the monospecific anti-CD20 antibody ( EC50=0.5526) when compared to the trispecific antibody variants.

[0109] FIGs. 38A-B show graphs illustrating the target-specific killing of primary patient lymphoma cells by primary human natural killer cells based on the binding of the trispecific antibody variants. FIG. 38A shows results of ADCC assays illustrating that the trispecific antibody variants enhanced NK cell-mediated killing efficacy. PN240006 showed enhanced maximal target-specific killing. FIG. 38B shows a table summarizing the target-specific cytotoxic potency of PN240001 (EC50=0.5562), PN240003 ( EC50=0.6311), PN240005 ( EC50=2.068), PN240006 ( EC50=0.4301), M23026 ( EC50= 0.1812), and M23032 ( EC50= 0.4099) against Raji cells.[01101 FIGs. 39A-B show Table 2, which summarizes B cell lymphoma (BCL) protein (multispecific antibody) production.DETAILED DESCRIPTIONI. OVERVIEWA. Vast unmet need in B-cell lymphoma treatment

[0111] B Cell Lymphoma (BCL) is a form of a blood cell cancer that starts with white B-cells (e.g., lymphocytes). In BCL patients, lymphocytes are not healthy, do not generate antibodies, do not fight infection, and continuously proliferate. BCL can be a very aggressive cancer because it can spread to lymph nodes, bone marrow, central nervous system, liver, spleen, and other organs. The standard treatment for BCL usually starts with chemotherapy, surgery, or local radiation therapy. Beyond the standard, follow-up treatments include stem cell transplantation, targeted B- cell agents (e.g, anti-CD20 antibodies), immunotherapy including, but not limited to chimeric antigen receptor T-cell therapy (CAR T-cell therapy). However, up to 50% of patients receiving any of these treatments become refractory or relapse after treatment. Relapse is associated with worse outcome. In particular, use of treatments that target only a single tumor antigen, such as CD20 or CD 19, can apply selective pressure to tumors that results in loss or down-regulation of antigen expression in patients. Thus, there is a vast yet unmet need for the treatment of refractoryor relapsed B cell lymphoma in patients that have undergone chemotherapy, surgery, and / or local radiation therapy.

[0112] To address this unmet need, the present disclosure provides novel and differentiated mRNA expressed molecules (i.e., multi-specific antibodies) for systemic administration for treating refractory or relapse B cell lymphoma in patients that have undergone chemotherapy, surgery, and / or local radiation therapy. The novel and differentiated mRNA expressed molecules are multi-specific antibodies that binds two or more antigens. To design the novel and differentiated mRNA expressed molecules (e.g., multi-specific antibodies), the most common antigens found in BCL were identified, the molecules were designed and evaluated. CD 19, CD20, and CD47 were selected as target antigens. In particular, CD 19 and CD20 binders that have clinical validation were identified and evaluated. In addition, a molecule that can bind to CD47 was identified (e.g., SIRPα).B. Novel and differentiated mRNA expressed molecules for systemic administration

[0113] A number of mono-specific, bi-specific, and multi-specific molecules with increasing complexity were generated with appropriate controls (FIGs. 1-3). Plasmids with codon optimized sequences were generated using pcDNA3.4 and pUC57 vectors (Table 2; FIGs. 39A- B). These plasmids were then expressed in HEK293 cells and purified. The integrity, purity, and aggregation of the mRNA molecules and / or DNA were performed. Relevant sequences are disclosed in Table 1.

[0114] These multi-specific antibodies comprise a first polypeptide comprising an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD 19 or CD20; and a second polypeptide comprising an immunoglobulin light chain (VL) of an antibody that targets the first antigen. The VH can be operably linked to an immunoglobulin Fc fragment; and at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20; and / or an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155. The VL can be operably linked to a linker; at least one antigen; and an immune modulator capable of binding toa molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα). The at least one antigen binding domain can be selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody.

[0115] Alternatively, the multi-specific antibody that binds two or more antigens comprises at least one full-length antibody that specifically binds a first antigen selected from CD 19 or CD20, operably linked to at least two antigen binding domains that bind a second antigen. The full- length CD19 or CD20 antibody comprises: an antibody fragment selected from the group consisting of a Fab fragment, or a F(ab')2 fragment that targets CD19 or CD20, and two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antigen binding domain. The at least two antigen binding domains that bind a second antigen are selected from (i) a Fab fragment, or a scFv that targets CD 19 or CD20; and / or an immune modulator capable of binding a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155. Exemplary embodiments of the multi-specific antibodies contemplated by the present disclosure are schematized in FIGs. 1A-J (CD 19), FIGs. 2A-J (CD20); and FIGs. 3A-F (scFv-chimeric fusion molecules).

[0116] Exemplary preferred embodiments of the novel and differentiated mRNA expressed molecules for systemic administration disclosed herein include M23028, M23043, M23040, M23034, M23044, M23036, M23037, M23032, M23045, M23029, M23041, M23039, M23046, M23042, M23035, M23038, M23033, S1826, S1806, S1827, S1807, S1820, and S 1819.

[0117] These multi-specific antibodies have increased complexities. For example, they showed increased valency of anti-CD20, CD20 / CD19, or CD20 / CD19 / SIRP when compared to the corresponding mono-specific antibody. The multi-specific antibodies were shown to be polyvalent and more than 20 permutations can be generated from the single nucleic acid molecules disclosed herein (e.g., Table 1, Table 2 (FIGs. 39A-B) and Table 7). The multi-specific antibodies are symmetric molecules involving one (1) to three (3) chains. The novel and differentiated mRNA expressed molecules were codon optimized for human use.C. Enhanced tumor binding and tumor killing profiles when compared to mono-specific antibodies

[0118] 11 tri-specific antibodies and 16 mono and bi-specific antibodies were generated as shown in FIGs. 1-3. The mono-specific and bi-specifics antibodies were used as controls for the tri-specific antibodies. The 26 constructs were produced and underwent a variety of analyses including, binding assays, preliminary ADCC assays on Raji cells, and Occupation assays (FIG. 7). As shown in FIG. 4A, the anti-CD19 and anti-CD20 tri-specific antibodies and chimeric scFv-Fc molecules (M23037, M23033, M23038, M23045, M23034 (M23044), M23032, M23042, S1820, M23035, and S 1819) showed strong binding to Raji cells. All tri-specific molecules showed very high binding affinity to Raji cells. The binding to Raji cells were ranked as follows M23037 was superior (>) to M23033, and M23033 = M23036 > M23038> M23045> M23034 (M23044)> M23032> M23042>S1820> M23035>S1819 (FIG. 4B).

[0119] While built upon SIRPα-CCR4 multi-specific scaffolds, which are chimeric Fc fusion molecules, the multi-specific antibodies disclosed herein exhibited enhanced binding affinity when compared to a Fab fragment, a F(ab')2 fragment, or a scFv derived from the same mono- specific antibody. The tri-specific chimeric scFv-Fc molecules (e.g., S1820 and S 1819) showed lower binding affinity to Raji cells when compared to the anti-CD19 and anti-CD20 tri-specific antibodies (FIG. 4C). Additional in-vitro binding and functional assessments of the mRNA expressed molecules were performed using in-vitro binding and ADCC analysis or in-vitro human and cynomolgus macaque (cyno) B-cell killing (FIG. 4A). Based on these assays, exemplary mRNA molecules were identified and selected (Table 3; FIG. 5).

[0120] FIG. 5 shows schematic depictions of the structures of exemplary multi-specific antibodies ranked based on (a) in-depth binding analysis (e.g., ELISA, Biacore™, single target cell lines);(b) functional characterization (e.g., normal B-cell depletion with and without Raji, lymphoma B-cell depletion, ADCC on Raji, cynomolgus macaque whole blood assay); (c) On- target off-tumor binding (e.g., RBC (human and cyno), T-cell (human)); and (d) in-vivo expression: mRNA quality, expression in mice, in-vivo purity (FIG. 20). Binding assays usingBiacore™ further confirmed that the novel multi-specific antibodies could engage or bind to their target antigens CD 19, CD20, and CD47as shown in Table 4. Comparable results were obtained with ELISA (Table 5).

[0121] Furthermore, as shown in FIGs. 26-33, intravenous administration of constructs in mice resulted in robust serum titers of M23032 (FIG. 27) and control of Raji tumors in a mouse xenograft model (FIGs. 26A-B). To assess M23032 pharmacodynamics in a relevant model, cynomolgus macaques were dosed intravenously with M23032 RNA, and the M23032 protein expression on B cells and B cell depletion were measured in circulation (e.g., serum from treated animals). A single intravenous administration of M23032 resulted in rapid and durable depletion of B cells in circulation with no detectable multispecific binding to red blood cells (FIGs. 29A-B and FIGs. 30A-C)

[0122] The cytotoxic effects of the anti-CD20 and anti-CD19 tri-specific antibodies on Raji cells and Human PBMC were evaluated as shown in FIGs. 10A-D. The percentage of dead Raji Cells (FIG. 10A), the percentage of normal B cell depletion (FIG. 10B), and the percentage of normal B cell count (FIG. 10C) showed that the anti-CD20 and anti-CD19 tri-specific antibodies effectively bound to and killed Raji cells and human PBMC. Table 6 shows the EC50and EC90of the binding of each of the tri-specific antibodies. FIG. 10C further shows the binding of the anti-CD20 and anti-CD19 tri-specific antibodies using B cells from a second donor (Donor 10), which showed substantially similar results as FIG. 10B. These results confirmed that the tri- specific antibodies were active against primary lymphoma cells. Furthermore, the results showed that the addition of SIRPα to target CD47 on lymphoma cells enhanced the activity of the tri- specific antibodies when compared to mono-specific antibodies and / or bi-specific antibodies. Thereby validating the rationale to include SIRPα in the multi-specific antibody designs.

[0123] Antibody-dependent cell-mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) assays also demonstrated that the novel and differentiated mRNA expressed molecules for systemic administration were effective at killing tumor cells. All tested tri-specific antibodies e.g., M23034, M23045, M23036, M23032, and M23033) killed Raji cells with similar efficiency in the CDC assay. The tri-specific antibodies also showed stronger killingefficiency when compared to control (Iso or HA) or bi-specific antibodies (M23026, M23027, M23028, M23029) (FIG. 11 A vs B). As shown in FIG. 12A-B, the ADCC of the anti- CD 19 / anti-CD20 tri-specific antibodies also showed that most tri-specific antibodies showed similar binding affinity (EC50) to Raji.

[0124] The novel and differentiated mRNA expressed molecules (i.e., the multi-specific antibodies) were also selective for tumor cells. None of the tested multi-specific molecules showed binding to human RBCs or T cells, which do not express the target antigens or weakly express the target antigen (FIG. 14A and FIG. 14D). In particular, the tri-specific antibodies did not bind to human RBCs. The tri-specific antibodies disclosed herein only showed weak binding to T cells at high concentration. As such, the multi-specific antibodies disclosed herein showed minimal to no off-target effects.

[0125] Engagement of CD47 by M23032 protein was enhanced by additionally binding to CD19 and CD20 (FIG. 33). When CD19 and / or CD20 binding was blocked on Raji cells, there was a reduction in CD47 engagement by M23032 protein. These results suggested that M23032 had preferential binding to tumor cells that expressed all three targets.D. An in vivo method of producing a multi-specific antibody with enhanced tumor binding and tumor killing profdes when compared to mono-specific antibodies

[0126] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of: (a) a first nucleic acid encoding: an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD19 or CD20; an immunoglobulin Fc fragment; at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20; and / or (iv) an immune modulator capable of binding a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP,CD47, CXCL9, CXCL10, CXCL11, and CD155; and (b) a second nucleic acid encoding: (i) an immunoglobulin light chain (VL) of an antibody that targets the first antigen; a linker; an immune modulator capable of binding a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155; and / or at least one antigen binding domain that bindsthe second antigen, where when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0127] The novel and differentiated mRNA expressed molecules (e.g., multi-specific antibodies) were also shown to form a multi-specific antibody in vivo following systemic administration in a subject. Plasmids with codon optimized sequences were generated using pcDNA3.4 and pUC57 vectors. These plasmids were then expressed in HEK293 cells; and purified. Table 7 shows some tested mRNA molecule constructs, which were purified by Fragment Analyzer and showed about 80% purity.

[0128] The expression of the engineered multi-specific antibodies were observed in mice in vivo 24 hours after the heavy chain immunoglobulin (VH; H) and light chain immunoglobulin (VL; L) constructs were administered to mice at a specified ratios (H:L chain ratio) (FIG. 16). M23045 showed the highest overall expression at all ratios evaluated (2: 1, 1 :1, or 1 :2). The concentration of M23045 was about 15 ug / ml at 2: 1 (H:L chain ratio); and about 10 ug / ml at 1 : 1 or 1 :2 ratio. The second best expression was seen with M23032, M23033 and M23037 with a concentration of about 5ug / ml. The ratio of 2: 1 was considered a safe choice for treatment.

[0129] FIGs. 17-19 show the purity of the in vivo generated multi-specific antibodies using the method disclosed herein. The multi-specific antibodies M23032, M23033, M23034, M23037, M23038, and M23045 showed high purity, based on homogenous population, in all the three chain ratios evaluated (2: 1, 1 :1 and 1:2) when manufactured in vivo. Table 8 shows some exemplary ratio recommendation for producing the disclosed multi-specific antibodies using the method disclosed herein.

[0130] Therefore, the present specification provides at least 11 novel, specific, and selective tri- specific molecules that were designed to target and kill tumor cells in patients suffering from B Cell lymphoma. As shown in the Examples provided herein, these novel tri-specific molecules showed superior anti-tumor properties and binding affinity when compared to related mono- specific antibodies and / or chimeric Fc fusion molecules comprising an antigen binding domain derived from the same mono-specific antibody. In particular, exemplary novel tri-specific molecules include M23032, M23033, M23034, M23035, M23036, M23037, M23038, M23042, M23044, M23045, S1820, and S 1819. These molecules were generated and evaluated in vivo and in vitro. Of these 11, 7 molecules were further characterized because they showed strong binding to Raji cells (Table 3). M23034 and M23044 were shown to be identical molecules. M23032, M23033, M23034, M23036, M23037, M23038, and M23045 were further characterized as described above. FIG. 20 summarizes the functional characteristics of the novel tri-specific antibodies disclosed herein.

[0131] M23032, an anti-CD19-anti-CD20-anti-CD47 tri-specific antibody showed the best functional effects when compared to the 10 molecules based on the cyno whole blood, B-cell depletion in PBMC and primary lymphoma cells, ADCC & CDC, and other in vitro / ex vivo assays (FIG. 20). Based on the expression level in mice and the trend seen across mono-specific antibodies and multi-specific antibodies, a 2: 1 Heavy: Light chain ratio can be a preferredembodiment for generating the multi-specific antibodies disclosed herein using the in-vivo method described herein and for drug product formulation.

[0132] Intravenous administration of M23032 RNA controlled growth of subcutaneously implanted Raji tumors in CB17 / SCID mice, resulting in a significant delay to tumor growth (FIGs. 26-28). Robust levels of M23032 protein was measured in serum of mice dosed with M23032 protein (FIG. 31).

[0133] Lastly, a single intravenous (IV) dose of M23032 mRNA resulted in robust (over 90%) circulating B cells depletion in cynomolgus macaques (FIGs. 24 B-C). Indeed, robust circulating B cell depletion in four out of four animals dosed with M23032 mRNA was observed. In addition, IV administration of M23032 mRNA was well-tolerated in Non-Human Primate (NHPs). B cell depletion was sustained through D52 post dosing with M23032 RNA (FIGs. 29A-B) and M23032 was shown to bind to B and T cells in dosed NHPs, but not to red blood cells (RBCs) (FIGs. 30A-C). M23032 protein was measured in plasma of dosed animals, and this protein from plasma was highly pure (FIG. 32).II. Multi-specific antibodies

[0134] One aspect of the present disclosure provides multi-specific antibodies that bind two or more antigens comprising: a first polypeptide comprising an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen; and a second polypeptide comprising an immunoglobulin light chain (VL) of an antibody that targets the first antigen. An aspect of the disclosure includes mRNA polynucleotides encoding such multispecific antibodies. In some embodiments, the VH is operably linked to an immunoglobulin Fc fragment; at least one antigen binding domain that binds to a second antigen; and an immune modulator. In some embodiments, the VL is operably linked to: a linker; an immune modulator molecule; and at least one antigen binding domain that binds the second antigen.

[0135] In some embodiments, the first or the second antigen is selected from the group consisting of CD19, CD22, CD20, BCMA, CD5, CD7, CD2, CD16, CD56, CD30, CD14, CD68, CDl lb, CD18, CD169, CDlc, CD33, CD38, CD138, and CD13. In some embodiments, the firstor second antigen is CD19 or CD20. In some embodiments, the first antigen is CD19 and the second antigen is CD20. Alternatively, the first antigen is CD20 and the second antigen is CD 19.

[0136] In some embodiments, the first or second antigen is expressed on cancer cells. In some embodiments, the first and / or second antigen are expressed on cancer cell, such as for example, B cell lymphoma cell. In some embodiments, the first and / or second antigen are B cell lymphoma tumor antigens.A. The first polypeptide and the second polypeptide

[0137] In some embodiments, the first polypeptide comprising the immunoglobulin heavy chain (VH) of an antibody comprises in tandem from the N-terminal to the C-terminal: an anti-CD19 or CD20 VH, the IgGl Fc fragment, and the anti-CD19 or anti-CD20 scFv. In that embodiment, the first polypeptide comprises the VH of M23032, M23033, orM23034.

[0138] In some embodiments, the first polypeptide comprises in tandem from the N-terminal to the C-terminal an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule. In that embodiment, the first polypeptide comprises the VH of M23038, or M23045.

[0139] In some embodiments, the first polypeptide comprises in tandem from the N-terminal to the C-terminal the SIRPα molecule, the anti-CD19 or anti-CD20 VH, and the IgGl Fc fragment.

[0140] In some embodiments, the first polypeptide comprises in tandem from the N-terminal to the C-terminal a first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a second SIRPα molecule. In that embodiment, the first polypeptide comprises the VH of M23036.

[0141] In some embodiments, the first polypeptide comprises in tandem from the N-terminal to the C-terminal the anti-CD19 or anti-CD20, the IgGl Fc fragment, and the first and the second SIRPα molecules. In that embodiment, the first polypeptide comprises the VH of M23037.

[0142] In some embodiments, the first polypeptide comprises in tandem from the N-terminal to the C-terminal the first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, the anti -CD 19 or anti-CD20 Fab fragment, and the second SIRPα molecule. In that embodiment, the first polypeptide comprises the VH of M23038 or M23045.

[0143] In some embodiments of the multi-specific antibody described herein, the second polypeptide comprising an immunoglobulin light chain (VL) of an antibody that targets the first antigen comprises, in tandem from the N-terminal to the C-terminal: the anti-CD19 or anti-CD20 VL, the linker, and the SIRPα molecule. In that embodiment, the second polypeptide comprises the VL ofM23032, or M23033.

[0144] In some embodiments, the second polypeptide described herein comprises, in tandem from the N-terminal to the C-terminal: the SIRPα molecule, the anti-CD19 or anti-CD20 VL, and the linker, the second polypeptide comprises the VL of M23034.

[0145] In some embodiments, the second polypeptide described herein comprises, in tandem from the N-terminal to the C-terminal: the anti-CD19 or anti-CD20 scFv, the anti-CD19 or anti- CD20 VL, and the linker. The second polypeptide comprises the VL of M23036 or M230367.

[0146] In some embodiments, the second polypeptide described herein comprises, in tandem from the N-terminal to the C-terminal: the anti-CD19 or anti-CD20 VL, the linker, and the anti- CD19 or anti-CD20 scFv. The second polypeptide comprises the VL of M23038. In some embodiments, the second polypeptide described herein comprises, in tandem from the N- terminal to the C-terminal the anti-CD19 or anti-CD20 VL and the linker.

[0147] In some embodiments of the multi-specific antibody described herein, the first polypeptide comprising the VH that targets a first antigen (e.g., CD 19) comprises the first SIRPα molecule, the anti-CD19 VH, the IgGl Fc fragment, and the second SIRPα molecule; and the second polypeptide comprising the VL that targets the first antigen (e.g., CD19) comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker. In that embodiment, the multi-specific antibody can be M23036.

[0148] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGlFc fragment, and the first and the second SIRPα molecules; and the second polypeptide comprising the VL that targets the first antigen (e.g., CD19) comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker. In that embodiment, the multi-specific antibody can be M23037.

[0149] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD19) comprises the anti-CD19 VL, the linker, and the SIRPα molecule. In that embodiment, the multi-specific antibody can be M23032.

[0150] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the anti-CD20 VL, the linker, and the SIRPα molecule. In that embodiment, the multi-specific antibody can be M23033.

[0151] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD 19) comprises the SIRPα molecule, the anti-CD19 VL, and the linker. In that embodiment, the multi-specific antibody can be M23034.

[0152] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g, CD20) comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker. In that embodiment, the multi-specific antibody can be M23045.

[0153] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g, CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the anti-CD20VL, the linker, and the anti-CD19 scFv. In that embodiment, the multi-specific antibody can be M23038.

[0154] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g, CD20) comprisesthe anti-CD19 scFv, the anti-CD20 VL, and the linker. In that embodiment, the multi-specific antibody can be M23042.

[0155] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the SIRPα molecule, the anti-CD20 VL, and the linker. In that embodiment, the multi -specific antibody can be M23035.

[0156] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv and the second polypeptide comprising the VL that targets the first antigen (e.g., CD19) comprises the anti-CD19 VL and the linker. In that embodiment, the multi-specific antibody can be M23028.

[0157] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD19) comprises the CD 19 scFv, the anti-CD19 VL, and the linker. In that embodiment, the multi-specific antibody can be M23043.

[0158] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD19) comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD19) comprises the SIRPα molecule, the anti-CD19 VL, and the linker. In that embodiment, the multi-specific antibody can be M23040.

[0159] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the first SIRPα molecule, the anti-CD20 VH, the IgGl Fc fragment, the anti-CD20 Fab fragment, and the second SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the SIRPα molecule, the anti-CD20 VL, and the linker. In that embodiment, the multi-specific antibody can be M23046.

[0160] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the anti-CD20 VL and the linker. In that embodiment, the multi-specific antibody can be M23029.

[0161] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the anti-CD20 scFv, the anti-CD20 VL, and the linker. In that embodiment, the multi-specific antibody can be M23041.

[0162] In some embodiments, the first polypeptide comprising the VH that targets a first antigen (e.g., CD20) comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprising the VL that targets the first antigen (e.g., CD20) comprises the SIRPα molecule, the anti-CD20 VL, and the linker. In that embodiment, the multi-specific antibody can be M23039.

[0163] In some embodiments of the multi-specific antibody described herein, the first polypeptide comprising the VH that targets a first antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22. In some embodiments, the first polypeptide comprising the VH that targets a first antigen comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22.

[0014] In some embodiments, the second polypeptide comprising he VL that targets the first antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2,SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. In some embodiments, the second polypeptide comprising he VL that targets the first antigen comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0165] In some embodiments of the multi-specific antibody described herein, the first polypeptide comprising the VH that targets a first antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and the second polypeptide comprising he VL that targets the first antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0166] In some embodiments of the multi-specific antibody described herein, the first polypeptide comprising the VH that targets a first antigen comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and the second polypeptide comprising he VL that targets the first antigen comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting ofSEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0167] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 5, and SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8. In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 5, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence ofM23028, M23044, M23034, or M23032.

[0168] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 6, and SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23033, M23035, or M23029.

[0169] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 6; and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10.

[0170] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 11, and SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23036.

[0171] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 11, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0172] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 12, and SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23037.

[0173] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 12, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0174] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 14, and SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23038, M23039, M23041, or M23042.

[0175] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 14, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, atleast about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18.

[0176] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 16, and SEQ ID NO: 8, or SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23040, M23043, or M23045.

[0177] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 16, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 8, or SEQ ID NO: 13.

[0178] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 1 and SEQ ID NO: 2. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23026.

[0179] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 1 and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 2.

[0180] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 3, and SEQ ID NO: 4. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23027.

[0181] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of

[0182] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 20, and SEQ ID NO: 10. In that embodiment, the multi -specific antibody described herein can have the amino acid sequence of M23046.

[0183] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 20, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 10.

[0184] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 21, and SEQ ID NO: 2. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23030.

[0185] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 21, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 2.

[0186] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of: SEQ ID NO: 22, and SEQ ID NO: 4. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23031.

[0187] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 22, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 4.

[0188] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 7. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23032.

[0189] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 5 and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 7.

[0190] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 5, and SEQ ID NO: 8. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23034.

[0191] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 5, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 8.

[0192] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 6, and SEQ ID NO: 9. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23033.

[0193] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 6, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 9.

[0194] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 11, and SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23036.

[0195] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 11, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0196] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 12, and SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23037.

[0197] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 12, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at leastabout 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0198] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 14, and SEQ ID NO: 15. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23038.

[0199] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 14, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 15.

[0200] In some embodiments, the multi-specific antibody described herein comprises the amino acid sequences of SEQ ID NO: 16, and SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23045.

[0201] In some embodiments, the multi-specific antibody described herein comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 16, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0202] One aspect of the present disclosure provides A multi-specific antibody that binds two or more antigens comprising: a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20 .

[0203] In some embodiments, the first recombinant polypeptide comprises a first SIRPα molecule, an immunoglobulin heavy chain (VH) of an antibody that targets CD 19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second recombinant polypeptide comprises a single variable fragment (scFv) that targets CD20 (anti-CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD19 (anti-CD19 VL), and a linker (i.e., M23036).

[0204] In some embodiments, the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the first and the second SIRPα molecules and the second recombinant polypeptide comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker (e. .,M23037).

[0205] In some embodiments, the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second recombinant polypeptide comprises the anti-CD19 VL, the linker, and the SIRPα molecule (e.g., M23032).

[0206] In some embodiments, the first recombinant polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second recombinant polypeptide comprises the anti-CD20 VL, the linker, and the SIRPα molecule e.g., M23033).

[0207] In some embodiments, the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second recombinant polypeptide comprises the SIRPα molecule, the anti-CD19 VL, and the linker e.g., M23034).

[0208] In some embodiments, the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker (e.g., M23045).

[0209] In some embodiments, the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD20VL, the linker, and the anti-CD19 scFv (e.g., M23038).

[0210] In some embodiments, the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD19 scFv, the anti-CD20 VL, and the linker (e.g., M23042).

[0211] In some embodiments, the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second recombinant polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker (e.g., M23035).

[0212] In some embodiments, the at least one antigen binding domain that binds to a second antigen described herein can be selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody. In some embodiments, the at least one antigen binding domain that binds the second antigen is a scFv or a Fab that targets CD19 or CD20. In one embodiment, the second antigen is a scFv that targets CD 19 or CD20.

[0213] The multi-specific antibodies of the present disclosure include at least one anti-CD19 and / or CD20 arms that modulate, block, inhibit, reduce, antagonize, neutralize, or otherwise interfere with the functional activity of CD 19 and / or CD20. In some embodiments, the immunoglobulin Fc fragment is a human immunoglobulin G1 (IgGl) Fc fragment. In some embodiments, the immunoglobulin Fc fragment has a modified effector function. In some embodiments, the immunoglobulin Fc fragment has an enhanced effector function.

[0214] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprises a first SIRPα molecule, an immunoglobulin heavy chain (VH) of an antibody that targets CD19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second recombinant polypeptide comprises a single variable fragment (scFv) that targets CD20 (anti-CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD 19 (anti-CD19 VL), and a linker; optionally M23036.

[0215] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprisingan immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the first and the second SIRPα molecules and the second recombinant polypeptide comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; optionally, M23037.

[0216] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti- CD20 scFv, and the second recombinant polypeptide comprising the anti-CD19 VL, the linker, and the SIRPα molecule; optionally, [M23032]

[0217] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD19 or CD20, where the first recombinant polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti- CD19 scFv, and the second recombinant polypeptide comprising the anti-CD20 VL, the linker, and the SIRPα molecule; optionally, M23033]

[0218] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti- CD20 scFv, and the second recombinant polypeptide comprising the SIRPα molecule, the anti- CD 19 VL, and the linker; optionally, M23034]

[0219] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprisingan immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprising the anti-CD20 scFv, the anti- CD19 VL, and the linker; optionally, M23045]

[0220] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprising the anti-CD20VL, the linker, and the anti-CD19 scFv; optionally, M23038.

[0221] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD19 or CD20, where the first recombinant polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprising the anti-CD19 scFv, the anti- CD20 VL, and the linker; optionally, M23042.

[0222] Another aspect of the present disclosure provide a multi-specific antibody that binds two or more antigens comprising: (a) a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, where the first recombinant polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti- CD19 scFv, and the second recombinant polypeptide comprising the SIRPα molecule, the anti- CD20 VL, and the linker; optionally, M23035.B. Immune modulators

[0223] In some embodiments, the immune modulator that is operably linked to the VH or the VL is capable of binding to a molecule selected from the group consisting of BTLA, HVEM,CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155. In some embodiments, the immune modulator is capable of binding to Signal regulatory protein alpha (SIRPα). SIRPα is a transmembrane protein that belongs to the immunoglobulin superfamily. The extracellular region of SIRPα comprises 3 immunoglobulin (Ig)-like domains and the cytoplasmic region contains immunoreceptor tyrosine-based inhibition motifs (ITIMs). SIRPα is especially abundant in myeloid cells such as macrophages.

[0224] SIRPα is a receptor for Cluster of Differentiation 47 (CD47). SIRPα and CD47 signaling pathway modulates phagocytosis as a component of an immune response. CD47 is expressed in most normal cell types and may be overexpressed in various disease states including cancer cells. The interaction of SIRPα with CD47 is an inhibitory immune checkpoint that negatively regulate phagocytotic activity of macrophages. The CD47-SIRPα interaction transmits inhibitory " don't eat me signals”. SIRPα and CD47 signaling pathway is implicated in the etiology of many diseases, including cancer. For example, the binding of SIRPα to CD47 triggers a signaling pathway that may be implicated in the inhibition of leukemia cells and leukemia stem cells (LSCs) phagocytosis by macrophages. See e.g., U.S. Pat. No. 6,541,615. Accordingly, immunomodulatory therapeutics which inhibit SIRPα / CD47 axis can be used in the treatment of cancer and other diseases. In some embodiments, SIRPα comprises the amino acid sequence of SEQ ID NO: 44.C. Fc region

[0225] The Fc region or a portion thereof is typically responsible for antibody effector function. It is contemplated that Fc regions with modified effector functions, for example, enhanced or increased effector functions, may be used in connection with the embodiments described herein.

[0226] Non-limiting examples of Fc molecules e.g., IgGl Fc molecules) having increased effector function include those having the following substitutions: S239D / I332E, S239D / A330S / I332E, S239D / A330L / I332E, S298A / D333A / K334A, P247I / A339D P247I / A339Q, D280H / K290S, D280H / K290S / S298D, D280H / K290S / S298V, F243L / 292P / Y300L, F243L / R292P / Y300L / P396L, F243L / R292P / Y300L / V305I / P396L,G236A / S239D / I332E, K326A / E333A, K326W / E333S K290E / S298G / T299A K290N / S298G / T299A, K290E / S298G / T299A / K326E, andK290N / S298G / T299A / K326E. Another method of increasing effector function of IgG Fc- containing proteins is by reducing the fucosylation of the Fc. Removal of the core fucose from the biantennary complex-type oligosaccharides attached to the Fc greatly increased ADCC effector function without altering antigen binding or CDC effector function. Several ways are known for reducing or abolishing fucosylation of Fc-containing molecules, e.g., antibodies.

[0227] It is known that human IgGl has a glycosylation site at N297 (EU numbering system) and glycosylation contributes to the effector function of IgGl antibodies. Groups have mutated N297 in an effort to make aglycosylated antibodies. The mutations have focused on substituting N297 with amino acids that resemble asparagine in physiochemical nature such as glutamine (N297Q) or with alanine (N297A) which mimics asparagine without polar groups.

[0228] Accordingly, additional exemplary Fc molecules having decreased effector function include those having the following substitutions: N297A or N297Q (IgGl), L234A / L235A (IgGl), V234A / G237A (lgG2) L235A / G237A / E318A (lgG4), H268Q / V309L / A330S / A331 S (lgG2), C220S / C226S / C229S / P238S (IgGl), C226S / C229S / E233P / L234V / L235A (IgGl), L234F / L235E / P331S (IgGl) S267E / L328F (IgGl).D. Linkers

[0229] In some embodiments of the multi-specific antibody disclosed herein, the VL is operably linked to: a linker; an immune modulator molecule; and at least one antigen binding domain that binds the second antigen. The linker is typically rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can link the heavy chain variable region or the light chain variable region to other part of the multi-specific antibody described herein. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6): 1910-1917 (2008) and WO 2014 / 087010.

[0230] Any suitable linker can be used with the present multi-specific antibody described herein. A suitable linker, including without limitation any variation of G(n)S(m)G(p) linker, where n=0, 1, 2, 3, 4, 5,6 , 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, m=0, l, 2, 3, 4, 5,6 , 7, 8, 9, 1011, 12, 13, 14, 15, 16, 17, 18, 19 or 20, p=0, 1, 2, 3, 4, 5,6 , 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, and n, m, and p are selected independently.

[0231] Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 46), (GGGS)n (SEQ ID NO:47), and (GGGGS)n (SEQ ID NO: 48), where n represents an integer of at least 1.

[0232] Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGGGS (SEQ ID NO: 30), GGGGSGGGGS (SEQ ID NO: 31), GGGGSGGGGSGGGGS (SEQ ID No: 32), GGSG (SEQ ID NO: 49), GGSGG (SEQ ID NO: 50), GSGSG (SEQ ID NO: 51), GSGGG (SEQ ID NO: 52), GGGSG (SEQ ID NO: 53), GSSSG (SEQ ID NO: 54), GGGGSGGGGSGGGGS (SEQ ID NO: 55) and the like. SEQ ID NO: 55, may be encoded by a nucleic acid sequence comprising the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCT (SEQ ID NO: 56). Those of skill in the art would be able to select the appropriate linker sequence for use in the present invention. In some embodiments, the linker can be CK linker. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 43.E. Recombinant multi-specific antibodies

[0233] Another aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: at least one full-length antibody that specifically binds a first antigen, and at least two antigen binding domains that bind a second antigen. In some embodiments, the full-length antibody comprises an antibody fragment selected from the group consisting of a Fab fragment, a F(ab')2 fragment, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody of a first antibody, and an Fc fragment. The Fc fragment is a functional Fc fragment that can be operable linked to the antibody fragment. The at least one antigen binding domain can be selected from the group consisting of a single chain antibody, a Fab fragment, a F(ab')2 fragment, a scFv, a scAb, a dAb, a single domain heavy chain antibody, a single domain light chain antibody, an immune modulator, and any combination thereof.

[0234] In some embodiments, the full-length antibody is operably linked to the at least two antigen binding domains. In some embodiments, the full-length antibody comprises two Fab fragments, or a F(ab')2 fragment comprising two immunoglobulin (Ig) heavy chains and two Ig light chains; and two Fc fragments.

[0235] In some embodiments, each of the at least two antigen binding domains is operably linked to: the N-terminus of the two Ig light chains; the N-terminus of the two Ig heavy chains; the C-terminus of the two Ig light chains; and / or the C-terminus of the two Fc fragments. In some embodiments, the two Fc fragments are human immunoglobulin G1 (IgGl) Fc fragments.

[0236] In some embodiments of the multi-specific antibody described herein, the multi-specific antibody comprises at about least about 4, at least about 6, at least about 8, at least about 10, at least about 12, at least about 14, at least about 16, at least about 18, at least about 20, or more than about 20 antigen binding domains. In some embodiments, the at least two antigen binding domains bind to the same antigen.

[0237] In some embodiments, the at least two antigen binding domains are immune modulators that are capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0238] In some embodiments, the at least two antigen binding domains are two SIRPα molecules. In some embodiments, the multi-specific antibody comprises at least four antigen binding domains (e.g., M23039, M23040).

[0239] In that embodiment, the four antigen binding domains can be SIRPα molecules, and one of the four SIRPα molecules is operably linked to the C-terminus of each of the two Fc fragments; and the N-terminus of each of the two Ig light chains e.g., M23039, M23040).

[0240] In some embodiments of the multi-specific antibody disclosed herein, the at least four antigen binding domains are two scFv and two SIRPα molecules (e.g., tri-specific antibody). Inthat embodiment, the two SIRPα molecules can be two monomeric SIRPα molecules or two dimeric SIRPα molecules (e.g., M23037).

[0241] In that embodiments of the multi-specific antibody disclosed herein, each of the two SIRPα molecules can be operably linked to the C-terminus of each of the two Fc fragments; each of the two scFv can be operably linked to the N-terminus of each of the two Ig light chains; and the two scFv can target the same antigen as the full-length chimeric antibody (e.g., M23043 and M23041; bi-specific antibodies).

[0242] In some embodiments the multi-specific antibody disclosed herein, each of the two SIRPα molecules can operably linked to the C-terminus of each of the Fc fragments; each of the two scFv can be operably linked to the N-terminus of each of the two Ig light chains; and the two scFv can target a different antigen than the full-length antibody (e.g., M23045 and M23042).

[0243] In that embodiment, the multi-specific antibody can further comprise two SIRPα molecules, and each of the two SIRPα molecules can be operably linked to the N-terminus of each of the two Ig heavy chains (e.g., M23036).

[0244] In some embodiments, the multi-specific antibody can further comprise two SIRPα molecules and the two SIRPα molecules can be two dimeric SIRPα molecules (e.g, M23037).

[0245] In some embodiments the multi-specific antibody disclosed herein, each of the two SIRPα molecules can be operably linked to the C-terminus of each of the Fc fragments; each of the two scFv is operably linked to the C-terminus of each of the two Ig light chains; and the two scFv target a different antigen than the full-length chimeric antibody (e.g, M23038).

[0246] In some embodiments the multi-specific antibody disclosed herein, each of the two SIRPα molecules can be operably linked to the N-terminus of each of the two Ig light chains; each of the two scFv can be operably linked to the C-terminus of each of the two Fc fragments; and the two scFv can target different antigens as the full-length chimeric antibody (e.g., M23034 / 44 and M23035).

[0247] In some embodiments the multi-specific antibody disclosed herein, each of the two SIRPα molecules can be operably linked to the C-terminus of each of the two Ig light chains;each of the two scFv can be operably linked to the C-terminus of each of the two Fc fragments; and the two scFv target different antigens as the full-length chimeric antibody (e.g., M23032 and M23033).

[0248] In some embodiments of the multi-specific antibody described herein, the first or the second antigen can be selected from the group consisting of CD 19, CD22, CD20, BCMA, CD5, CD7, CD2, CD16, CD56, CD30, CD14, CD68, CDl lb, CD18, CD169, CDlc, CD33, CD38, CD138, and CD13. In some embodiments, the first or the second antigen is CD19 or CD20.

[0249] In some embodiments of the multi-specific antibody disclosed herein, when the full- length antibody targets CD 19 and the two scFv target CD20. In some embodiments, when the full-length antibody targets CD20 and the two scFv target CD 19.

[0250] In some embodiments, the multi-specific antibody comprises at least one full-length antibody comprising a F(ab')2 fragment that specifically binds CD 19 or CD20 operably linked to an IgGl Fc fragment; and the at least two antigen binding domains are selected from two scFv that bind to CD 19 or CD20, and / or two SIRPα molecules.

[0251] Another aspect of the present disclosure provides a multi-specific antibody comprising: at least one full-length antibody comprising a F(ab')2 fragment that specifically binds a CD19 or CD20 operably linked to an IgGl Fc fragment; and at least two antigen binding domains selected from two scFv that bind to CD 19 or CD20, and / or two SIRPα molecules. In some embodiments, the Fab fragments, the F(ab')2 fragment, or the scFv comprises a heavy chain variable region of Rituximab or Tafasitamab and light chain variable region of Rituximab or Tafasitamab. In some embodiments, the Fab fragments, the F(ab')2 fragment, or the scFv comprises the amino acid sequence of SEQID NO: 33, 34, 35, 36, 37, 38, 39, or 40.

[0252] In some embodiments, the Fab fragments, the F(ab')2 fragment, or the scFv comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 33; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 34. In some embodiments, the Fab fragments, the F(ab')2 fragment, or the scFv comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 35; and a light chainvariable region comprising the amino acid sequence of SEQ ID NO: 36. In some embodiments, the scFv comprises the amino acid sequence of SEQ ID NO: 37 or SEQ ID NO: 38.

[0253] In some embodiments of the multi-specific antibody described herein, the Fc fragment comprises the amino acid sequence of SEQ ID NO: 41, 42, or 45. In some embodiments, the Fc fragment comprises the amino acid sequence of SEQ ID NO: 41.

[0254] In some embodiments, the multi-specific antibody is selected from the group consisting of M23028, M23043, M23040; M23046; M23029; M23041; M23039; M23034; M23044; M23036; M23037; M23032; M23045; M23042; M23035; M23038; and M23033.

[0255] In some embodiments, the multi-specific antibody is selected from the group consisting of M23034; M23036; M23037; M23032; M23045; M23038; and M23033. In some embodiments, the multi-specific antibody is selected from the group consisting of M23032; M23034, and M23045. In some embodiments of the multi-specific antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 22 as described herein.

[0256] In some embodiments, the first polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and / or the second polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, or and SEQ ID NO: 19.

[0257] Another aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: at least one full-length antibody that specifically binds a first antigen selected from CD 19 or CD20, and at least two antigen binding domains that bind asecond antigen; and the full-length antibody (e.g., anti-CD19 or anti-CD20) is operably linked to the at least two antigen binding domains.

[0258] In some embodiments, the full-length antibody comprises: an antibody fragment selected from the group consisting of a Fab fragment, or a F(ab')2 fragment, and two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antigen binding domain.

[0259] In some embodiments, the antigen binding domain is selected from: a Fab fragment, or a scFv that targets CD19 or CD20; and / or an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0260] In some embodiments, the at least two antigen binding domains are SIRPα molecules and the second target antigen is CD47; the at least two antigen binding domains are scFv that target CD19 or CD20; and the antibody fragment is a F(ab')2 fragment comprising two immunoglobulin (Ig) heavy chains and two Ig light chains.

[0261] Another aspect of the present disclosure provides a multi-specific antibody that binds two or more antigens comprising: (a) at least one full-length antibody that specifically binds a first antigen selected from CD 19 or CD20, (b) a scFv that targets CD 19 or CD20; and (c) a SIRPα molecule that binds to CD47 on a target cell. The full-length antibody comprises: an antibody fragment selected from the group consisting of a Fab fragment, or a F(ab')2 fragment and the antibody fragment comprises two immunoglobulin (Ig) heavy chains and two Ig light chains, and two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antibody fragment. In some embodiments, the scFv targets a different antigen than the full-length antibody, and the scFv is operably linked to: the C-terminus of each of the Fc fragments, the C- terminus of each of the two Ig light chains of the full-length antibody, or the N-terminus of each of the two Ig light chains of the full-length antibody. The SIRPα molecule is operably linked to: the C-terminus of each of the Fc fragments, the C-terminus of each of the two Ig light chains ofthe full-length CD 19 or CD20 antibody, or the N-terminus of each of the two Ig light chains of the full-length CD 19 or CD20 antibody, and / or the N-terminus of each of the two Ig heavy chains of the full-length CD 19 or CD20 antibody.

[0262] In some embodiments, the multi-specific antibody exhibits enhanced binding affinity when compared to a Fab fragment, a F(ab')2 fragment, or a scFv derived from the same antibody.

[0263] In some embodiments, the SIRPα enhances the binding and / or killing properties of the multi-specific antibody when compared to a multi-specific antibody lacking the SIRPα molecule.

[0264] In some embodiments, the multi-specific antibody has an EC50between about O.OlnM- 0.5nM, about 0.01nM-0.2nM, about O.OlnM-O.lnM, about 0.01nM-0.07nM, or about O.OlnM- 0.05nM. In some embodiments, the multi-specific antibody has an EC50of at least about 0.034nM, at least about 0.01618nM, at least about 0.1771nM, at least about 0.2183nM, at least about 0.08312nM, at least about 0.034nM, at least about 0.069nM, at least about 0.117nM, at least about 0.534nM, at least about 0.6609nM, at least about 0.06841nM, at least about0.1929nM, at least about 0.2734nM, at least about 0.0447 InM, at least about 0.4725nM, at least about 0.8945nM, or at least about 0.027nM.III. NUCLEIC ACIDS AND EXPRESSION VECTORSA. Nucleic Acids

[0265] One aspect of the present disclosure provides an isolated nucleic acid molecule encoding a multi-specific antibody described herein. In some embodiments, the isolated nucleic acid is a DNA or an RNA. The RNA can be a mRNA.

[0266] In some embodiments, the isolated nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22; SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0267] In some embodiments, the isolated nucleic acid further comprises a nucleic acid encoding a secretory signal sequence.

[0268] The multi-specific antibody described herein need not be encoded by any specific nucleic acid exemplified herein. For example, redundancy in the genetic code allows for variations in nucleotide codon sequences that nevertheless encode the same amino acid. Accordingly, a multi- specific antibody of the present disclosure can be produced from nucleic acid sequences that are different from those set forth herein, for example, being codon optimized for a particular expression system. Codon optimization can be performed, for example, as set forth in Athey et al., BMC Bioinformatics, 18:391-401 (2017).

[0269] Wild type nucleic acids may be isolated from naturally occurring sources or a commercial antibody (e.g., Rituximab or Tafasitamab) be used as starting material to generate the novel multi-specific antibody described herein. The nomenclature and the laboratory procedures in recombinant DNA technology described below are those well-known and commonly employed in the art. Standard techniques for cloning, DNA and RNA isolation, amplification and purification are known. Enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases are the like are performed according to the manufacturer's specifications. These techniques and various other techniques are performed according to Sambrook & Russell, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989) or Ausubel et al., Current Protocols in Molecular Biology, Vol. 1-3, John Wiley & Sons, Inc. (1994-1998).

[0270] The isolation of nucleic acids may be accomplished by a variety of techniques. The nucleic acids of the present disclosure can be generated from the wild type or original sequence sequences (e.g., Rituximab or Tafasitamab; Table 1). The wild type sequences can be altered to create modified sequences. Wild type molecules can be modified to create the engineered multi- specific antibody present application using methods that are well known in the art. Exemplary modification methods are site-directed mutagenesis, point mismatch repair, or oligonucleotide- directed mutagenesis.B. Vectors

[0001] Another aspect of the present disclosure provides an expression vector comprising the isolated nucleic acid encoding a multi-specific antibody described herein. A “vector” refers to a polynucleotide, which when independent of the host chromosome, is capable replication in a host organism. Preferred vectors include plasmids and typically have an origin of replication. Vectors can comprise, e.g., transcription and translation terminators, transcription and translation initiation sequences, and promoters useful for regulation of the expression of the particular nucleic acid. The polymerases of the present disclosure can be expressed in a variety of host cells, including E. coli, other bacterial hosts, yeasts, filamentous fungi, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines. Techniques for gene expression in microorganisms are described in, for example, Smith, Gene Expression in Recombinant Microorganisms (Bioprocess Technology, Vol. 22), Marcel Dekker, 1994. Examples of bacteria that are useful for expression include, but are not limited to, Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, and Paracoccus . Filamentous fungi that are useful as expression hosts include, for example, the following genera: Aspergillus, Trichoderma, Neurospora, Penicillium, Cephalosporium, Achlya, Podospora, Mucor, Cochliobolus, and Pyricularia. Synthesis of heterologous proteins in yeast is well known and described in the literature. There are many expression systems for producing the polymerase polypeptides of the present invention that are well known to those of ordinary skill in the art.C. Host cells

[0271] Another aspect of the present disclosure provides a host cell transfected with the expression vector comprising the isolated nucleic acid encoding a multi-specific antibody described herein.

[0272] Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. In yeast, vectors include Yeast Integrating plasmids (e.g., YIp5) and Yeast Replicating plasmids (the YRp series plasmids) and pGPD-2. Expression vectors containing regulatory elements from eukaryotic viruses are typically used ineukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the CMV promoter, SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells. Additional vectors and plasmids are described in the Examples.

[0273] Once expressed, the multi-specific antibody described herein or a derivative thereof can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity purification columns, column chromatography, gel electrophoresis and the like. Pure compositions of at least about 90 to about 95% homogeneity are preferred, and about 98 to about 99% or more homogeneity are most preferred. Once purified, partially or to homogeneity as desired, the polypeptides may then be used (e.g., as immunogens for antibody production).

[0274] To facilitate purification of the multi-specific antibody or a derivative thereof, the nucleic acids that encode the multi-specific antibody or derivatives thereof can also include a coding sequence for an epitope or “tag” for which an affinity binding reagent is available. Examples of suitable epitopes include the myc and V-5 reporter genes; expression vectors useful for recombinant production of fusion polypeptides having these epitopes are commercially available (e.g., Invitrogen (Carlsbad Calif.) vectors pcDNA3.1 / Myc-His and pcDNA3.1 / V5-His are suitable for expression in mammalian cells). Additional expression vectors suitable for attaching a tag to the fusion proteins of the disclosure, and corresponding detection systems are known to those of skill in the art as described herein, and several are commercially available (e.g., FLAG" (Kodak, Rochester N. Y.). Another example of a suitable tag is a polyhistidine sequence, which is capable of binding to metal chelate affinity ligands. Typically, six adjacent histidines are used (6His-tag, his-tag), although one can use more or less than six. Suitable metal chelate affinity ligands that can serve as the binding moiety for a polyhistidine tag include nitrilo-tri-acetic acid (NTA).

[0275] One of skill in the art would recognize that after biological expression or purification, the engineered reverse transcriptase or derivatives thereof may possess a conformation substantially different than the native conformations of the constituent polypeptides. In this case, it may be necessary or desirable to denature and reduce the engineered reverse transcriptase or a derivative thereof and cause the engineered reverse transcriptase or a derivative thereof to re-fold into the preferred conformation. Methods of reducing and denaturing proteins and inducing re-folding are well known to those of skill in the art.

[0276] The host cell described herein can be an immune cell. The immune cell may be modified. The modified immune cell described herein may be included in a composition for immunotherapy, in particular for treating a cancer.IV. COMPOSITIONS

[0277] Another aspect of the present disclosure provides a composition comprising a nucleic acid encoding a multi-specific antibody described herein. Another aspect of the present disclosure provides a composition comprising a vector described herein. Another aspect of the present disclosure provides a composition comprising a cell or a modified cell comprising a nucleic acid encoding a multi-specific antibody described herein.

[0278] The composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition comprising the modified host cells may be administered to a subject (e.g, a patient).

[0279] Pharmaceutical compositions of the present invention may comprise the modified immune cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g, aluminum hydroxide); and preservatives. In certain exemplary embodiments, compositions described herein are formulated for intravenous administration.

[0280] Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials. Cells of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Cell compositions may be administered multiple times at dosages within these ranges.

[0281] Any of the multi-specific antibodies described herein may be part of a therapeutic composition comprising an mRNA encoding the amino acid sequence of the multi-specific antibody and a delivery vehicle molecule. For example, any of the multi-specific antibodies described herein may be part of a method and / or composition (including kits). These methods may be, for example, methods for treating cancer and / or treating tumors.

[0282] The multi-specific antibodies described herein may be encoded by an mRNA nanoparticle and may be used as part of a patient treatment using these mRNA nanoparticles (e.g., including mRNA vaccines). In particular, described herein are mRNA therapies being administered to a patient in need thereof. The patient can be an animal, for example, a human. The therapies may be mRNA therapies involve administering (to a patient or a site of a patient) mRNA (treatment) nanoparticles, including mRNA encoding one or more patient-specific antigens and mRNA encoding mRNA encoding one or more multi-specific antibodies described herein, as well as apparatuses and methods for making patient-specific mRNA therapies including these.

[0283] The mRNA vaccines including any of the mRNA encoding multi-specific antibodies described herein may be used in a methods for treating cancer, including treating tumors that are not benign, or which can be benign or cancerous, using these mRNA treatments, and methods of forming these mRNA vaccines. For example, described herein are methods of that include the intratumoral injection of an mRNA treatment nanoparticle encoding a tumor-specific antigen, and an mRNA encoding a multi-specific antibody. In some embodiments, the mRNA encoding the tumor-specific antigen and the mRNA encoding the multi-specific antibody are encapsulatedtogether by a delivery vehicle molecule, for example, a hydroxy ethyl-capped cationic peptoid, including, for example, hydroxyethyl-capped tertiary amino lipidated cationic peptoid. While the injection may be intratumoral, as provided in some examples herein, other routes of administration are also possible. Any of the method of treatment described herein may include methods of treating a cancer (e.g., to reduce, or in some instances eliminate, a tumor).V. A METHOD OF PRODUCING A MULTI-SPECIFIC ANTIBODY

[0284] One aspect of the present disclosure comprises an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of: a first nucleic acid encoding an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen; and a second nucleic acid encoding an immunoglobulin light chain (VL) of an antibody that targets the first antigen, when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody.

[0285] In some embodiments, the VH is operably linked to: an immunoglobulin Fc fragment; and at least one antigen binding domain that binds a second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or (iii) an immune modulator. In some embodiments, the VL is operably linked to: (i) a linker (e.g., a CK linker); an immune modulator molecule; and / or at least one antigen binding domain that binds a second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody.

[0286] In some embodiments, he VH is operably linked to: an immunoglobulin Fc fragment; and at least one antigen binding domain that binds a second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or an immune modulator; and the VL is operably linked to: a linker (e.g., a CK linker); an immune modulator molecule; and / or at least one antigen binding domain that binds a second antigen, wherein the atleast one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody.

[0287] In some embodiments of the method described herein, the at least one antigen binding domain that binds the second antigen is a scFv or a Fab. In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the VH, the Fc fragment, and the scFv.

[0288] In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the VH, the Fc fragment, and the immune modulator molecule; (c) the immune modulator molecule, the VH, and the Fc fragment. In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: a first immune modulator molecule, the VH, the Fc fragment, and a second immune modulator molecule. In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the VH, the Fc fragment, and the first and the second immune modulator molecules. In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the first immune modulator molecule, the VH, the Fc fragment, the Fab fragment, and the second immune modulator molecule. In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the VH and the Fc fragment.

[0289] In some embodiments, the second nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the VL, the linker, and the immune modulator molecule. In some embodiments, the second nucleic acid comprises, in tandem from the N- terminal to the C-terminal, a nucleic acid encoding: the immune modulator molecule, the VL, and the linker. In some embodiments, the second nucleic acid comprises, in tandem from the N- terminal to the C-terminal, a nucleic acid encoding: the scFv, the VL, and the linker. In some embodiments, the second nucleic acid comprises, in tandem from the N-terminal to the C- terminal, a nucleic acid encoding: the VL, the CK linker, and the scFv. In some embodiments,the second nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: the VL and the linker.

[0290] In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the scFv and the second nucleic acid comprising the VL and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the immune modulator molecule, and the second nucleic acid comprising the scFv, the VL, and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the immune modulator molecule, and the second nucleic acid comprising the immune modulator molecule, the VL, and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the first immune modulator molecule, the VH, the Fc fragment, the Fab fragment, and the second immune modulator molecule, and the second nucleic acid comprising the immune modulator molecule, the VL, and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the scFv and the second nucleic acid comprising the VL and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the first immune modulator molecule, the VH, the Fc fragment, and the second immune modulator molecule, and the second nucleic acid comprising the scFv, the VL, and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the first and the second immune modulator molecules and the second nucleic acid comprising the scFv, the VL, and the linker. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the scFv, and the second nucleic acid comprising the VL, the linker, and the immune modulator molecule. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the immune modulator molecule, and the second nucleic acid comprising the scFv, the VL, and the CK linker. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, the Fc fragment, and the immune modulator molecule, and the second nucleic acid comprising the VL, the CK linker, and the scFv. In some embodiments, the subject is administered: the first nucleic acid comprising the VH, and the Fc fragment and the second nucleic acid comprising the VL, and the linker.

[0291] In some embodiments: (a) the second antigen is the same as the first antigen; or (b) the second antigen is different from the first antigen; or (c) the first and the second immune modulator molecules are the same molecule.

[0292] In some embodiments of the method described herein, the immune modulator is capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155. The immune modulator molecule can be a molecule that binds to Signal regulatory protein alpha (SIRPα). An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0293] In some embodiments of the method described herein, the first or the second antigen is selected from the group consisting of CD19, CD22, CD20, BCMA, CD5, CD7, CD2, CD16, CD56, CD30, CD14, CD68, CDl lb, CD18, CD169, CDlc, CD33, CD38, CD138, and CD13.

[0294] The first or second antigen can be CD 19 or CD20. The first antigen can be CD 19 and the second antigen can be CD20. The first antigen can be CD20 and the second antigen can be CD 19.

[0295] Another aspect of the present disclosure provides, an in vivo method of producing a multi-specific antibody, the method comprising administering to a subject a predetermined molar ratio of: (a) a first nucleic acid encoding: (i) an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD 19 or CD20; (ii) an immunoglobulin Fc fragment; and (iii) at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or (iv) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155; and (b) a second nucleic acid encoding: (i) an immunoglobulin light chain (VL) of an antibody that targets the first antigen; (ii) a linker; (iii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73,CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155; and / or (iv)at least one antigen binding domain that binds the second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody. An exemplary immune modulator capable of binding to CD47 is signal regulatory protein alpha (SIRPα).

[0296] In some embodiments of the method disclosed herein, (a) the VH is operably linked to the immunoglobulin Fc fragment; and the at least one antigen binding domain that binds the first antigen; and / or an immune modulator; and / or (b) the VL is operably linked to: the linker; the immune modulator molecule; and / or the at least one antigen binding domain that binds the second antigen.

[0297] In some embodiments, the at least one antigen binding domain that binds the second antigen is a scFv or a Fab that targets CD19 or CD20. The immune modulator molecule is Signal regulatory protein alpha (SIRPα). In some embodiments, the immunoglobulin Fc fragment is a human immunoglobulin G1 (IgGl) Fc fragment. In some embodiments, the immunoglobulin Fc fragment has a modified effector function. In some embodiments, the immunoglobulin Fc fragment has an enhanced effector function.

[0298] In some embodiments, the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding:(a) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and anti-CD19 or anti-CD20 scFv; optionally, M23032, M23033, M23034; (b)an anti- CD19 or anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule; optionally M23038, M23045; (c) the SIRPα molecule, the anti-CD19 or anti-CD20 VH, and the IgGl Fc fragment;(d) a first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a second SIRPα molecule; optionally, M23036; (e)the anti-CD19 or anti-CD20, the IgGl Fc fragment, and the first and the second SIRPα molecules, optionally [M23037]; or (f) the first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, the anti-CD19 or anti-CD20 Fabfragment, and the second SIRPαmolecule, optionally [M23038, M23045]; or (g) the VH and the Fc fragment.

[0299] In some embodiments, the second nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding: (a) the anti-CD19 or anti-CD20 VL, the linker, and the SIRPα molecule, optionally M23032, M23033; (b) the SIRPα molecule, the anti-CD19 or anti-CD20 VL, and the linker, optionally M23034; (c) the anti-CD19 or anti-CD20 scFv, the anti-CD19 or anti-CD20 VL, and the linker, optionally (M23036; M230367); (d) the anti-CD19 or anti-CD20 VL, the linker, and the anti-CD19 or anti-CD20 scFv; optionally M23038 or (e) the anti-CD19 or anti-CD20 VL and the linker optionally M23038.

[0300] In some embodiments, the subject is administered the first nucleic acid comprising the first SIRPα molecule, the anti-CD19 VH, the IgGl Fc fragment, and the second SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; optionally M23036.

[0301] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD19 VH, the IgGlFc fragment, and the first and the second SIRPα molecules and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker, optionally M23037.

[0302] In some embodiments, the subject is administered (the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid comprising the anti-CD19 VL, the linker, and the SIRPα molecule; optionally M23032.

[0303] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid comprising the anti-CD20 VL, the linker, and the SIRPα molecule, optionally M23033.

[0304] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid comprising the SIRPα molecule, the anti-CD19 VL, and the linker, optionally M23034.

[0305] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker, optionally M23045.

[0306] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20VL, the linker, and the anti-CD19 scFv, optionally M23038.

[0307] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD19 scFv, the anti-CD20 VL, and the linker, optionally M23042.

[0308] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid comprising the SIRPα molecule, the anti-CD20 VL, and the linker, optionally M23035.

[0309] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv and the second nucleic acid comprising the anti-CD19 VL and the linker, optionally M23028

[0310] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising theCD19 scFv, the anti-CD19 VL, and the linker, optionally M23043.

[0311] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD19 VL, and the linker, optionally M23040

[0312] In some embodiments, the subject is administered the first nucleic acid comprising the first SIRPα molecule, the anti-CD20 VH, the IgGl Fc fragment, the anti-CD20 Fab fragment, and the second SIRPαmolecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD20 VL, and the linker, optionally M23046.

[0313] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv and the second nucleic acid comprising the anti-CD20 VL and the linker, optionally M23029.

[0314] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD20 VL, and the linker, optionally M23041 .

[0315] In some embodiments, the subject is administered the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD20 VL, and the linker, optionally M23039.

[0316] In some embodiments, the first nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22. In some embodiments, the second nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19.

[0317] In some embodiments of the method of producing a multi-specific antibody described herein, (a) the first nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and (b) the second nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19.

[0318] In some embodiments of the method of producing a multi-specific antibody described herein, the first nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22. Insome embodiments, the first nucleic acid encodes an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22.

[0319] In some embodiments, the second nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. In some embodiments, the second nucleic acid encodes an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0320] In some embodiments of the method of producing a multi-specific antibody described herein, the first nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and the second nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0321] In some embodiments of the method of producing a multi-specific antibody described herein, the first nucleic acid encodes an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and the second nucleic acid encodes an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

[0322] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 5, and SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8. In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 5, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8. In that embodiment, the first and second nucleic acids encode M23028, M23044, M23034, or M23032.

[0323] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 6, and SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10. In that embodiment, the first and second nucleic acids encode M23033, M23035, or M23029.

[0324] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 6; and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, atleast about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10.

[0325] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequence of: SEQ ID NO: 11 , and SEQ ID NO: 13. In that embodiment, the multi-specific antibody described herein can have the amino acid sequence of M23036.

[0326] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 11, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0327] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequence of: SEQ ID NO: 12, and SEQ ID NO: 13. In that embodiment, t the first and second nucleic acids encode M23037.

[0328] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 12, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0329] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequence of: SEQ ID NO: 14, and SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ IDNO: 18. In that embodiment, the first and second nucleic acids encode M23038, M23039,M23041, or M23042.

[0330] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 14, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18.

[0331] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 16, and SEQ ID NO: 8, or SEQ ID NO: 13. In that embodiment, the first and second nucleic acids encode M23040, M23043, or M23045.

[0332] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 16, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 8, or SEQ ID NO: 13.

[0333] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 1 and SEQ ID NO: 2. In that embodiment, the first and second nucleic acids encode M23026.

[0334] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, atleast about 99% identical to an amino acid sequence of SEQ ID NO: 1 and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 2.

[0335] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 3, and SEQ ID NO: 4. In that embodiment, the first and second nucleic acids encode M23027.

[0336] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of

[0337] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 20, and SEQ ID NO: 10. In that embodiment, the first and second nucleic acids encode M23046.

[0338] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 20, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 10.

[0339] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 21, and SEQ ID NO: 2. In that embodiment, the first and second nucleic acids encode M23030.

[0340] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 21, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 2.

[0341] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of: SEQ ID NO: 22, and SEQ ID NO: 4. In that embodiment, the first and second nucleic acids encode M23031.

[0342] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 22, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 4.

[0343] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 7. In that embodiment, t the first and second nucleic acids encode M23032.

[0344] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 5 and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, atleast about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 7.

[0345] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 5, and SEQ ID NO: 8. In that embodiment, the first and second nucleic acids encode M23034.

[0346] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 5, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 8.

[0347] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 6, and SEQ ID NO: 9. In that embodiment, the first and second nucleic acids encode M23033.

[0348] In some embodiments, t the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 6, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 9.

[0349] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 11, and SEQ ID NO: 13. In that embodiment, the first and second nucleic acids encode M23036.

[0350] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 11, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0351] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 12, and SEQ ID NO: 13. In that embodiment, the first and second nucleic acids encode M23037.

[0352] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 12, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0353] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 14, and SEQ ID NO: 15. In that embodiment, the first and second nucleic acids encode M23038.

[0354] In some embodiments, t the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 14, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, atleast about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 15.

[0355] In some embodiments of the method of producing a multi-specific antibody described herein, the subject is administered the first and second nucleic acids encoding the amino acid sequences of SEQ ID NO: 16, and SEQ ID NO: 13. In that embodiment, the first and second nucleic acids encode M23045.

[0356] In some embodiments, the first and second nucleic acids encode an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 16, and an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 97%, at least about 98%, at least about 99% identical to an amino acid sequence of SEQ ID NO: 13.

[0357] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising a first SIRPα molecule, an immunoglobulin heavy chain (VH) of an antibody that targets CD 19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising a single variable fragment (scFv) that targets CD20 (anti- CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD 19 (anti-CD19 VL), and a linker; optionally M23036.

[0358] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the firstand the second SIRPα molecules and the second nucleic acid encodes a polypeptide comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; optionally M23037.

[0359] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and (the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti- CD20 scFv, and the second nucleic acid encodes a polypeptide comprising the anti-CD19 VL, the linker, and the SIRPα molecule; optionally M23032.

[0360] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti- CD19 scFv, and the second nucleic acid encodes a polypeptide comprising the anti-CD20 VL, the linker, and the SIRPα molecule; optionally M23033.

[0361] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti- CD20 scFv, and the second nucleic acid encodes a polypeptide comprising the SIRPα molecule, the anti-CD19 VL, and the linker; optionally M23034.

[0362] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPαmolecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker; optionally M23045.

[0363] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD20VL, the linker, and the anti-CD19 scFv; optionally M23038.

[0364] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD19 scFv, the anti-CD20 VL, and the linker; optionally M23042.

[0365] Another aspect of the present disclosure provides an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti- CD 19 scFv, and the second nucleic acid encodes a polypeptide comprising the SIRPα molecule, the anti-CD20 VL, and the linker; optionally M23035.A. RNA

[0366] In some embodiments of the in vivo method of producing a multi-specific antibody described herein, a single polynucleotide comprises the first and second nucleic acids. In some embodiments, the first nucleic acid or the second nucleic acid further comprises a modified nucleotide, a cap structure, a poly A tail, a 5' untranslated region, and / or a 3' untranslated region.In some embodiments, the first or the second nucleic acid is a DNA or an RNA. In some embodiments, the RNA is an mRNA. In some embodiments, the first or the second nucleic acid is a synthetic mRNA or a modified mRNA. In some embodiments, the first or the second nucleic acid is synthesized from naturally occurring nucleotides.

[0367] In some embodiments, the first or the second nucleic acid is synthesized from modified nucleotide analogues selected from the group consisting of 1 -methyladenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N-6-methyl-adenine, N-6-isopentenyl-adenine, 2-thio- cytosine, 3 -methyl -cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl- guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methylguanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thiouracil, 5-carboxymethylaminomethyl- 2-thio- uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fIuorouracil, 5-bromo-uracil, 5- carboxymethylaminomethyl-uracil, 5-methyl-2 -thio-uracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5- methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5- oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7- deazaguanosine, 5-methylcytosine, 1 -methylpseudouridine, and inosine.

[0368] Methods of making polynucleotides of a predetermined sequence are well-known. Solid- phase synthesis methods are known for both polyribonucleotides and polydeoxyribonucleotides (the well-known methods of synthesizing DNA are also useful for synthesizing RNA). Polyribonucleotides can also be prepared enzymatically. Non-naturally occurring nucleobases can be incorporated into the polynucleotide, as well. Any method known in the art for making RNA is contemplated herein for making the RNAs. Illustrative methods for making RNA include but are not limited to, chemical synthesis and in vitro transcription.

[0369] In some embodiments, the RNA for use in the methods herein is chemically synthesized. Chemical synthesis of relatively short fragments of oligonucleotides with defined chemical structure provides a rapid and inexpensive access to custom-made oligonucleotides of any desired sequence. Whereas enzymes synthesize DNA and RNA only in the 5' to 3' direction,chemical oligonucleotide synthesis does not have this limitation, although it is most often conducted in the opposite, i.e., the 3' to 5' direction. In some embodiments, the process is implemented as solid-phase synthesis using the phosphoramidite method and phosphoramidite building blocks derived from protected nucleosides (A, C, G, and U), or chemically modified nucleosides.

[0370] In some embodiments, modifications are included in the modified nucleic acid or in one or more individual nucleoside or nucleotide. For example, modifications to a nucleoside may include one or more modifications to the nucleobase, the sugar, and / or the internucleoside linkage. In some embodiments having at least one modification, the polynucleotide includes a backbone moiety containing the nucleobase, sugar, and internucleoside linkage of: pseudouridine-alpha-thio-MP, 1-methyl-pseudouridine-alpha-thio-MP, 1 -ethyl -pseudouridine- MP, 1-propyl-pseudouridine-MP, l-(2,2,2-trifluoroethyl)-pseudouridine-MP, 2-amino-adenine- MP, xanthosine-MP, 5-bromo-cytidine-MP, 5-aminoallyl-cytidine-MP, or 2- ami nopurinerib osi de-MP .

[0371] In other embodiments having at least one modification, the polynucleotide includes a backbone moiety containing the nucleobase, sugar, and internucleoside linkage of: pseudouridine-alpha-thio-MP, 1-methyl-pseudouridine-alpha-thio-MP, or 5-bromo-cytidine-MP. Nucleoside and nucleotide modifications contemplated for use in the present disclosure are known in the art.

[0372] To obtain the desired oligonucleotide, the building blocks are sequentially coupled to the growing oligonucleotide chain on a solid phase in the order required by the sequence of the product in a fully automated process. Upon the completion of the chain assembly, the product is released from the solid phase to the solution, deprotected, and collected. The occurrence of side reactions sets practical limits for the length of synthetic oligonucleotides (up to about 200 nucleotide residues), because the number of errors increases with the length of the oligonucleotide being synthesized. Products are often isolated by HPLC to obtain the desired oligonucleotides in high purity.

[0373] In some embodiments, RNA is made using in vitro transcription. The terms "RNA in vitro transcription" or "in vitro transcription" relate to a process wherein RNA is synthesized in a cell-free system (in vitro). DNA, particularly plasmid DNA, is used as template for the generation of RNA transcripts. RNA may be obtained by DNA-dependent in vitro transcription of an appropriate DNA template, which may be a linearized plasmid DNA template. The promoter for controlling in vitro transcription can be any promoter for any DNA-dependent RNA polymerase. Particular examples of DNA-dependent RNA polymerases are the T7, T3, and SP6 RNA polymerases. A DNA template for in vitro RNA transcription may be obtained by cloning of a nucleic acid, in particular cDNA corresponding to the respective RNA to be in vitro transcribed and introducing it into an appropriate vector for in vitro transcription, for example into plasmid DNA. In one embodiment of the present disclosure, the DNA template is linearized with a suitable restriction enzyme, before it is transcribed in vitro. The cDNA may be obtained by reverse transcription of mRNA or chemical synthesis. Moreover, the DNA template for in vitro RNA synthesis may also be obtained by gene synthesis.

[0374] Methods for in vitro transcription are known in the art. Reagents used in the methods typically include: 1) a linearized DNA template with a promoter sequence that has a high binding affinity for its respective RNA polymerase such as bacteriophage-encoded RNA polymerases; 2) ribonucleoside triphosphates (NTPs) for the four bases (adenine, cytosine, guanine and uracil); 3) in some aspects, a cap analogue as defined above (e.g. m7G(5')ppp(5')G(m7G)); 4) a DNA- dependent RNA polymerase capable of binding to the promoter sequence within the linearized DNA template (e.g. T7, T3 or SP6 RNA polymerase); 5) optionally a ribonuclease (RNase) inhibitor to inactivate any contaminating RNase; 6) optionally a pyrophosphatase to degrade pyrophosphate, which may inhibit transcription; 7) MgC12, which supplies Mg2+ions as a co- factor for the polymerase; 8) a buffer to maintain a suitable pH value, which can also contain antioxidants (e.g. DTT), and / or polyamines such as spermidine at optimal concentrations.B. Predetermined molar ratio of the first and the second nucleic acids

[0375] In some embodiments of the in vivo method of producing a multi-specific antibody described herein, a predetermined molar ratio of the first and the second nucleic acids isadministered to the subject. In some embodiments, redetermined molar ratio of the first and the second nucleic acids is between about 10: 1 to about 1 : 10. In some embodiments, the predetermined molar ratio of the first and the second nucleic acids is greater than about 1.

[0376] In some embodiments, the predetermined molar ratio of the first and the second nucleic acids is about 9: 1 to about 1 :9, about 8: 1 to about 1 :8, about 7: 1 to about 1:7, about 6: 1 to about 1 :6, about 5: 1 to about 1 :5, about 4: 1 to about 1 :4, about 3: 1 to about 1 :3, or about 2: 1 to about 1 :2. In some embodiments, the predetermined molar ratio of the first and the second nucleic acids is about 1 : 1, about 1 :2, about 1 :3, about 1 :4, about 2: 1 : about 3: 1, about 4: 1, about 5: 1 or about 6: 1. In some embodiments, the predetermined molar ratio of the first and the second nucleic acids is about 1 : 1, about 1 :2, about 1 :3, about 1 :4, about 2: 1 : about 3:1, about 4:1, about 5: 1 or about 6: 1.

[0377] In some embodiments, the predetermined molar ratio of the first and the second nucleic acids is about 1 : 1 or about 2: 1. In some embodiments, the predetermined molar ratio of the first and the second nucleic acids is 2: 1.C. Lipid nanoparticles (LPN)

[0378] Any appropriate delivery vehicle molecule may be used with the in vivo method of producing a multi-specific antibody described herein. For example, the delivery vehicle molecule may comprise an amino-lipidated peptoid delivery vehicle. The delivery vehicle molecule may be, for example, a lipid nanoparticle (LNP). LNP formulations may be composed of an ionizable or cationic lipid or polymeric material, bearing tertiary or quaternary amines to encapsulate the polyanionic mRNA; a zwitterionic lipid (e.g., l,2-dioleoyl-sn-glycero-3-phosphoethanolamine) that resembles the lipids in the cell membrane; cholesterol to stabilize the lipid bilayer of the LNP; and a polyethylene glycol (PEG)-lipid to lend the nanoparticle a hydrating layer, improve colloidal stability, and reduce protein absorption.

[0379] Multicomponent LNPs may be taken up by endocytosis and can electrostatically attach and fuse with the cell membrane using inverted non-bilayer lipid phases. Once inside the cell, LNPs may be routed into early endosomes, followed by late endosomes, and finally the lysosomes where the mRNA contents are enzymatically degraded.

[0380] One class of delivery vehicle molecules includes the cationic or ionizable lipids and lipid- like materials. Cationic lipids bear alkylated quaternary ammonium groups. Cationic lipids retain their cationic nature in a pH-independent fashion, while ionizable lipids acquire positive charges by protonation of free amines as pH is lowered. Lipid-like materials bear more hydrophobic side chains than natural lipids. Cationic lipids, such as N-[l-(2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA) may be used. Alternatively, or additionally, pH dependent ionizable materials may be used. The ionizable lipid named Dlin-MC3-DMA (MC3) can also be used to transfect mRNA in order to express therapeutic proteins.

[0381] Polymeric materials may be used for the delivery of therapeutic mRNA. For example, low-molecular-weight polyethyleneimine (PEI) modified with fatty chains may be used for siRNA and mRNA delivery to reduce toxicity of high-molecular weight PEI.Poly(glycoamidoamine) polymers modified with fatty chains, and / or. a tartrate backbone have been shown to deliver mRNA. Poly(β-amino)esters (PBAEs) are biodegradable polymers that may be used for nucleic acid delivery, including PBAEs formulated with PEG-lipid to increase their serum stability. Hyperbranched PBAEs may be used for mRNA delivery.

[0382] Polymethacrylates with amine-bearing side chains, polyaspartamides with oligoaminoethylene side chains, and polyacrylic acids amidated with tetramine with alternating ethyl-propyl-ethyl spacers have been reported to transfect mRNA and may be used as a delivery vehicle molecule. Self-immolative polycarbonate-block-poly(a-amino)esters may release mRNA upon rearrangement followed by degradation at pH 7.4, to facilitate endosomal escape.Biodegradable amino polyesters (APEs) may be synthesized with low dispersity from tertiary amino alcohols as initiators in ring-opening polymerization of various lactones. APEs may be capable of tissue-selective mRNA delivery. Other biodegradable polymers with biocompatible degradation products and enhanced endosomal escape capabilities may be used for mRNA delivery.

[0383] In some embodiments, the delivery vehicle molecule may include dendrimers. For example, polyamidoamine (PAMAM) or polypropylenimine-based dendrimers have been extensively studied for gene delivery. Fatty chain-modified PAMAM dendrimers, and / or amodified PAMAM dendrimer co-formulated with poly(lactic-co-glycolic acid) (PLGA) and ceramide-PEG may be used as a delivery vehicle molecule.

[0384] Alternatively, in some embodiments , cell -penetrating peptides (CPPs) may be used as delivery vehicle molecules. CPPs may promote clustering of the negatively charged glycosaminoglycans on the cell surface, which in turn triggers macropinocytosis and lateral diffusion or directly disrupts the lipid bilayer. A CPP with arginine-rich amphipathic RALA sequence repeats may be used. In some embodiments the delivery vehicle molecule may be a combination of cationic and zwitterionic lipids, reminiscent of cationic and helper lipids (“zwitterionic amino lipids” or ZALs). In particular, the delivery vehicle molecules described herein may be amino-lipidated peptoid delivery vehicles. For example, these delivery vehicles may be a lipid-containing amphipathic delivery vehicle that provides packaging and protection of mRNA cargos during circulation, avoid immune recognition, and may facilitate cellular uptake and release. Examples of these delivery vehicles may be found in international patent applications, PCT / US19 / 53661 and PCT / US 19 / 53655

[0385] One aspect of the present disclosure comprises an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of: a first nucleic acid encoding an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen; and a second nucleic acid encoding an immunoglobulin light chain (VL) of an antibody that targets the first antigen, and the first and second nucleic acids are encapsulated in one or more lipid nanoparticles (LPN); and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody.

[0386] In some embodiments, the one or more lipid nanoparticles are selected from the group consisting of liposomes, lipid complexes, and lipoplexes. In some embodiments, the first and second nucleic acids are encapsulated in the same LPNs or in separate LPNs.

[0387] In some embodiments, each LPN comprises a cationic lipid. In some embodiments, each LPN comprises a cationic lipid, a non-cationic lipid, a neutral lipid, a cholesterol, a cholesterol- based lipid, a PEG a PEG-modified lipid, or any combination thereof. In some embodiments, the cationic lipids constitute about 5% to about 50% of the total lipids in the LPN.

[0388] In some embodiments, the cationic lipids constitute about 10% to about 40% of the total lipids in the LPN. In some embodiments, the cationic lipids constitute about 30% to about 90% of the total lipids in the LPN. In some embodiments, the cationic lipids constitute about 30% to about 70% of the total lipids in the LPN. In some embodiments, the PEG-modified lipids constitute about 0.5% to about 20% of the total lipids in the LPN. In some embodiments, the PEG-modified lipids constitute about 4% to about 10% of the total lipids in the LPN.

[0389] In some embodiments, the one or more LPNs have a size of about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, or about 250 nm. In some embodiments, the one or more LPNs have a size of about in the range from about 50 nm to about 300 nm, about 60 nm to about 250 nm, about 60 nm to about 150 nm, or about 60 nm to about 120 nm.

[0390] In some embodiments, LNP or delivery vehicle compositions may comprise hydroxyalkyl-capped cationic peptoids, such as 2-aminopropane-l,3-diol-capped cationic peptoids (“cationic component”, sometimes referred to as an "ionizable lipid"). In some implementations, the hydroxyalkyl-capped cationic peptoids may comprise a compound of Formula (I):

[0391] In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; R1is H or C2-5 alkyl, optionally substituted with 1-3 OH; R2is H or C2-5alkylene-OH substituted with 1-3 additional OH; and each R3independently is C6-24 alkyl or C6-24 alkenyl. As used herein, “alkyl” refers to straight chained and branched saturated hydrocarbon groups containing one to thirty carbon atoms, for example, one to twenty four carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 carbon atoms).

[0392] The term Cn means the alkyl group has “n” carbon atoms. For example, C3 alkyl refers to an alkyl group that has 3 carbon atoms. Cl -24 alkyl refers to an alkyl group having a number ofcarbon atoms encompassing the entire range (z'.e., 1 to 24 carbon atoms), as well as all subgroups (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1- 19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 2-11, 2-12, 2-13, 2-14, 2- 15, 2-16, 2-17, 2-18, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3- 10, 3-11, 3-12, 3-13, 3-14, 3-15, 3-16, 3-17, 3-18, 3-19, 3-20, 3-21, 3-22, 3-23, 3-24, 4-5, 4-6, 4-7, 4-8, 4- 9, 4-10, 4-11, 4-12, 4-13, 4-14, 4-15, 4-16, 4-17, 4-18, 4-19, 4-20, 4-21, 4-22, 4-23, 4-24, 5-6, 5- 7, 5-8, 5-9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 5-16, 5-17, 5-18, 5-19, 5-20, 5-21, 5-22, 5-23, 5- 24, 6-7, 6-8, 6-9, 6-10, 6-11, 6-12, 6-13, 6- 14, 6-15, 6-16, 6-17, 6-18, 6-19, 6-20, 6-21, 6-22, 6- 23, 6-24, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 7-16, 7-17, 7-18, 7-19, 7-20, 7-21, 7-22, 7- 23, 7-24, 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21, 8-22, 8-23, 8-24, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22, 9-23, 9-24, 10- 11, 10-12, 10-13, 10-14, 10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21, 10-22, 10-23, 10-24, 11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20, 11-21, 11-22, 11-23, 11-24, 12- 13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 14-15, 14-16, 14-17, 14-18, 14- 19, 14-20, 14-21 , 14-22, 14-23, 14-24, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21 , 15-22, 15-23, 15-24, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 17-18, 17-19, 17-20, 17-21, 17- 22, 17-23, 17-24, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 19-20, 19-21, 19-22, 19-23, 19-24, 20-21, 20-22, 20-23, 20-24, 21-22, 21-23, 21-24, 22-23, 22-24, 23-24, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, or 24 carbon atoms).

[0393] Nonlimiting examples of alkyl groups include, methyl, ethyl, zz-propyl, isopropyl, n- butyl, sec-butyl (2-methylpropyl), and / -butyl (1,1-dimethylethyl). Unless otherwise indicated, an alkyl group can be an unsubstituted alkyl group or a substituted alkyl group. As used herein, “alkenyl” refers to straight chained and branched hydrocarbon groups having a double bond and containing two to thirty carbon atoms, for example, two to twenty four carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, or 24 carbon atoms).

[0394] The term Cn means the alkenyl group has “n” carbon atoms. For example, C3 alkenyl refers to an alkenyl group that has 3 carbon atoms. C2-C24 alkenyl refers to an alkenyl grouphaving a number of carbon atoms encompassing the entire range (z.c., 2 to 24 carbon atoms), as well as all subgroups (e.g, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 2-11, 2-12, 2-13, 2-14, 2-15, 2-16, 2-17, 2-18, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-11, 3-12, 3- 13, 3-14, 3-15, 3-16, 3-17, 3-18, 3-19, 3-20, 3-21, 3-22, 3-23, 3-24, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 4-11, 4-12, 4-13, 4-14, 4-15, 4-16, 4-17, 4-18, 4-19, 4-20, 4-21, 4-22, 4-23, 4-24, 5-6, 5-7, 5-8, 5- 9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 5-16, 5-17, 5-18, 5-19, 5-20, 5-21, 5-22, 5-23, 5-24, 6-7, 6- 8, 6-9, 6-10, 6-11, 6-12, 6-13, 6-14, 6-15, 6-16, 6-17, 6-18, 6-19, 6-20, 6-21, 6-22, 6-23, 6-24, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 7-16, 7-17, 7-18, 7-19, 7-20, 7-21, 7-22, 7-23, 7-24, 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21, 8-22, 8-23, 8-24, 9-10,9-11, 9-12, 9-13, 9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22, 9-23, 9-24, 10-11, 10-12,10-13, 10-14, 10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21, 10-22, 10-23, 10-24, 11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20, 11-21, 11-22, 11-23, 11-24, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 16- 17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 17-18, 17-19, 17-20, 17-21 , 17-22, 17-23, 17-24, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 19-20, 19-21, 19-22, 19-23, 19-24, 20-21, 20- 22, 20-23, 20-24, 21-22, 21-23, 21-24, 22-23, 22-24, 23-24, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17 ,18, 19, 20, 21, 22, 23, or 24 carbon atoms). Nonlimiting examples of alkenyl groups include ethenyl, propenyl, butenyl, geranyl, and oleyl. Unless otherwise indicated, an alkenyl group can be an unsubstituted alkenyl group or a substituted alkenyl group.

[0395] In some implementations, n is 2 to 5. In various implementations, n is 3 to 4. In some implementations, n is 1. In various implementations, n is 2. In some cases, n is 3. In various cases, n is 4. In some implementations n is 5. In various implementations, n is 6. In various cases, n is 7. In various cases, n is 8. In various cases, n is 9. In various cases, n is 10.

[0396] In some implementations, R1is H. In various implementations, R1is C2-5alkyl optionally substituted with 1-3 OH. In some cases, R1is methyl or ethyl. In someimplementations, R1is ethyl. In various implementations, R1is C2-5alkylene-OH substituted with 0-2 additional OH.

[0397] In some embodiments, R1 is(hydroxy ethyl).

[0398] In various cases, R1is ethyl or hydroxyethyl. In some cases, C2-5alkyl is substituted with 1 OH. In some cases, C2-5alkyl is substituted with 2 OH. In some cases, C2-5alkyl is substituted with 3 OH.

[0399] In some embodiments, R2is C2-5 alkylene-OH substituted with 1-3 additional OH. In some cases, R2is C2 alkylene-OH substituted with 1-3 additional OH. In some cases, R2is C3alkylene-OH substituted with 1-3 additional OH. In some cases, R2is C4alkylene-OH substituted with 1-3 additional OH. In some cases, R2is C5alkylene-OH substituted with 1-3 additional OH. In some cases, C2-5alkylene-OH is substituted with 1 additional OH. In some cases, C2-5alkylene-OH is substituted with 2 additional OH. In some cases, C2-5alkylene-OH is substituted with 3 additional OH. In some cases, R2 is propyl-l,3-diol.

[0400] In some embodiments, R2is

[0401] In some implementations, each R3independently is C8-18 alkyl or C8-18 alkenyl. In various implementations, each R3independently is C8-16 alkyl or C10-18 alkenyl. In some cases, each R3independently is C6-18 alkyl or C6-18 alkenyl. In some cases, each R3independently is C10-12 alkyl or C10-18 alkenyl. In some implementations, each R3independently is: C8-18 alkyl, or C8-16 alkyl, or C8-14 alkyl, or C8-12alkyl.

[0402] In various implementations, each R3independently is selected from the group consisting of:

[0403] In some embodiments, each R3independently is selected from the group consisting of:

[0404] In various embodiments, each R3independently is selected from the group consisting of

[0405] In some implementations, each R3independently is

[0406] Contemplated compounds of Formula (I) include, but are not limited to, the compounds listed in Table 10 (FIGs. 25A-Y).

[0407] In some implementations the compound of Formula (I) is compound 1, 6, 21, or 30. In some cases, the compound of Formula (I) is compound 1. In some cases, the compound of Formula (I) is compound 6. In some cases, the compound of Formula (I) is compound 21. In some cases, the compound of Formula (I) is compound 30.

[0408] The compounds disclosed in FIGs. 25A-Y are defined herein by their chemical structures and / or chemical names. Where a compound is referred to by both a chemical structure and a chemical name, and the chemical structure and chemical name conflict, the chemical structure is determinative of the compound's identity.

[0409] Unless otherwise indicated, structures depicted herein (FIG. 25) are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, cis-trans, conformational, and rotational) forms of the structure. For example, the R and S configurations for each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers are included in this disclosure, unless only one of the isomers is specifically indicated. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, cis / trans, conformational, and rotational mixtures of the present compounds are within the scope of the disclosure. In some cases, the compounds disclosed herein are stereoisomers. "Stereoisomers" refer to compounds that differ in the chirality of one or more stereocenters. Stereoisomers include enantiomers and diastereomers. The compounds disclosed herein can exist as a single stereoisomer, or as a mixture of stereoisomers. Stereochemistry of the compounds shown herein indicate a relative stereochemistry, not absolute, unless discussed otherwise. As indicated herein, a single stereoisomer, diastereomer, or enantiomer refers to a compound that is at least more than 50% of the indicated stereoisomer, diastereomer, or enantiomer, and in some cases, at least 90% or 95% of the indicated stereoisomer, diastereomer, or enantiomer.

[0410] The compounds described herein can exist in free form, or where appropriate, as a pharmaceutically acceptable salt. As used herein, the term "pharmaceutically acceptable salt" refers to salts of a compound which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue side effects, such as, toxicity, irritation, allergic response and the like, and are commensurate with a reasonablebenefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. Pharmaceutically acceptable salts of the compounds described herein include those derived from suitable inorganic and organic acids and bases. These salts can be prepared in situ during the final isolation and purification of the compounds. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, trifluoroacetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.

[0411] Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, glutamate, hemi sulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, ptoluenesulfonate, undecanoate, valerate salts, and the like. Salts of compounds containing a carboxylic acid or other acidic functional group can be prepared by reacting with a suitable base. Such salts include, but are not limited to, alkali metal, alkaline earth metal, aluminum salts, ammonium, N+(Cl-4alkyl)4 salts, and salts of organic bases such as trimethylamine, triethylamine, morpholine, pyridine, piperidine, picoline, dicyclohexylamine, N,N'-dibenzylethylenediamine, 2-hydroxyethylamine, bis-(2-hydroxyethyl)amine, tri-(2-hydroxyethyl)amine, procaine, dibenzylpiperidine, dehydroabietylamine, N,N'-bisdehydroabietylamine, glucamine, N-methylglucamine, collidine, quinine, quinoline, and basic amino acids such as lysine and arginine. This disclosure also envisions the quaternization of any basic nitrogen-containing groups of the compounds disclosed herein. Water or oil-soluble or dispersible products may be obtained by such quaternization. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions suchas halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and aryl sulfonate.

[0412] In some implementations, the delivery vehicle composition comprises between about 25 mol% to about 70 mol% of the hydroxyalkyl-capped cationic peptoids, such as 2-aminopropane- 1,3-diol-capped cationic peptoids e.g., a compound of Formula (I), such as compound 1, 6, 21, or 30), based on the total number of moles of components in the delivery vehicle composition. The unit “mol%” or “molar percentage” refers to the number of moles of a particular component of the delivery vehicle composition divided by the total number of moles of all components in the delivery vehicle composition, times 100%. The polyanionic cargo is not calculated as part of the total number of moles of the delivery vehicle composition. In some cases, the delivery vehicle composition comprises between about 30 mol% to about 60 mol%, or about 35 mol% to about 55 mol%, or about 30 mol% to about 45 mol%, or about 35 mol% to about 40 mol%, or about 45 mol% to about 60 mol%, or about 50 mol% to about 55 mol%, or about 38 mol% to about 52 mol%, or about 38 mol%, or about 52 mol% of the hydroxyalkylcapped cationic peptoids, such as 2-aminopropane-l,3-diol-capped cationic peptoids (e.g., a compound of Formula (I), such as compound 1, 6, 21, or 30), based on the total number of moles of components in the delivery vehicle composition.D. Secretory signal peptide

[0413] One aspect of the present disclosure comprises an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of: a first nucleic acid encoding an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen; and a second nucleic acid encoding an immunoglobulin light chain (VL) of an antibody that targets the first antigen, and the first nucleic acid or the second nucleic acid further comprises a nucleic acid encoding a secretory signal peptide.

[0414] In some embodiments, the secretory signal peptide is selected from the signal peptide of human growth hormone (hGH), Ig kappa chain V-I region Walker, a MHC I molecule, a MHC II molecule, Lampl, Tapasin, Erp57, Calretikulin, Calnexin, or MHC class I molecule HLA- A*0201.

[0415] In some embodiments, the secretory signal peptide is an Ig kappa chain V-I region Walker signal peptide. In some embodiments, the secretory signal peptide comprises the amino acid sequence of MDMRVPAQLLGLLLLWLRGARC (SEQ ID NO: 29).

[0416] One aspect of the present disclosure comprises an in vivo method of producing a multi- specific antibody, the method comprising administering to a subject a predetermined molar ratio of: a first nucleic acid encoding an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen; and a second nucleic acid encoding an immunoglobulin light chain (VL) of an antibody that targets the first antigen, and when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody.

[0417] In some embodiments, the multi-specific antibody is produced within about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, or about 120 hours post-administration. In some embodiments, the multi-specific antibody is produced within 24 hours. In some embodiments, the multi-specific antibody is produced within 72 hours.

[0418] In some embodiments of the in vivo method of producing a multi-specific antibody described herein, the subject is a cell or a whole organism.

[0419] In some embodiments, the subject is a cell. In that embodiment, administering comprises transfecting or transducing the cell with the first and second nucleic acids.

[0420] In some embodiments, the subject is a whole organism selected from a mammal, a non- human primate, or a human. In that embodiment, the subject is systemically administered the first and the second nucleic acids as described herein. In some embodiments, systemic administration comprises an intravenous or an intraperitoneal administration.

[0421] In some embodiments, the subject has a disease or condition. The disease or condition can be selected multiple myeloma malignant plasma cell neoplasm, Hodgkin’s lymphoma, nodular lymphocyte predominant Hodgkin’s lymphoma, Kahler’s disease and Myelomatosis, plasma cell leukemia, plasmacytoma, B-cell prolymphocytic leukemia, hairy cell leukemia, B-cell non-Hodgkin’s lymphoma (NHL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), follicular lymphoma, Burkitt’s lymphoma, marginal zone lymphoma, mantle cell lymphoma, large cell lymphoma, precursor B-lymphoblastic lymphoma, myeloid leukemia, Waldenstrom’s macroglobulienemia, diffuse large B cell lymphoma, follicular lymphoma, marginal zone lymphoma, mucosa-associated lymphatic tissue lymphoma, small cell lymphocytic lymphoma, mantle cell lymphoma, Burkitt lymphoma, primary mediastinal (thymic) large B-cell lymphoma, lymphoplasmactyic lymphoma, Waldenstrom macroglobulinemia, nodal marginal zone B cell lymphoma, splenic marginal zone lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, lymphomatoid granulomatosis, T cell / histiocyte-rich large B-cell lymphoma, primary central nervous system lymphoma, primary cutaneous diffuse large B-cell lymphoma (leg type), EBV positive diffuse large B-cell lymphoma of the elderly, diffuse large B-cell lymphoma. In some embodiments, the subject has B-cell lymphoma or refractory B-cell lymphoma.

[0422] Another aspect of the present disclosure provides a multi-specific antibody produced by a method disclosed herein. In some embodiments, the multi-specific antibody is an IgG antibody.

[0423] Another aspect of the present disclosure provide a method of treating a disease or condition using the multi-specific antibodies, or nucleic acids described herein.

[0424] In some embodiments, the subject has a disease or condition selected multiple myeloma malignant plasma cell neoplasm, Hodgkin’s lymphoma, nodular lymphocyte predominant Hodgkin’s lymphoma, Kahler’s disease and Myelomatosis, plasma cell leukemia, plasmacytoma, B-cell prolymphocytic leukemia, hairy cell leukemia, B-cell non-Hodgkin’s lymphoma (NHL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), follicular lymphoma, Burkitt’s lymphoma, marginal zone lymphoma, mantle cell lymphoma, large cell lymphoma, precursor B- lymphoblastic lymphoma, myeloid leukemia, Waldenstrom’s macroglobulienemia, diffuse large B cell lymphoma, follicular lymphoma, marginal zone lymphoma, mucosa-associated lymphatic tissue lymphoma, small cell lymphocytic lymphoma, mantle cell lymphoma, Burkitt lymphoma,primary mediastinal (thymic) large B-cell lymphoma, lymphoplasmactyic lymphoma, Waldenstrom macroglobulinemia, nodal marginal zone B cell lymphoma, splenic marginal zone lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, lymphomatoid granulomatosis, T cell / histiocyte-rich large B-cell lymphoma, primary central nervous system lymphoma, primary cutaneous diffuse large B-cell lymphoma (leg type), EBV positive diffuse large B-cell lymphoma of the elderly, diffuse large B-cell lymphoma.

[0425] In some embodiments, the disease or condition is a hematological cancer.VII. DEFINITIONS

[0426] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.

[0427] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0428] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0429] As used herein, the term “Antibody,” refers to an immunoglobulin molecules and / or molecules comprising one or more immunologically active portions of immunoglobulin (Ig) molecules, which specifically bind with an antigen. The term “antibody” is used in the broadest sense and specifically covers single (mono-specific) monoclonal antibodies (including agonist and antagonist antibodies), antibodies with polyepitopic specificity (bi-specific, tri-specific, ormulti-specific), antibody fragments, and chimeric or fusion molecules comprising one or more antibody fragments or a portion of an immunoglobulin molecule, so long as they exhibit the desired biological activity of an immunoglobulin molecule.

[0430] A multi-specific antibody means an engineered molecule comprising two or more binding domains that specifically binds to an antigen. The multi-specific antibodies are engineered to target distinct antigen epitopes simultaneously on the same or different cell types. For example, a multi-specific antibody can comprise 2, 3, 4, 5, 6, 7, 8, or more domains that bind to one or more antigens on the same cell or different cells. The binding domain can be a fragment or a portion of an immunoglobulin molecule, or the binding domain of any molecule, including but not limited to immune cell receptors, or tumor antigen receptors. In some embodiments, the multi-specific antibody is a bi-specific, tripecific antibody, a tetra-specific antibody, a penta-specific antibody, or a hexa-specific antibody.

[0431] In some embodiments, the multi-specific antibody is a tri-specific (or trispecific) antibody. In some embodiments, the tri-specific antibody comprises three different binding domains. In some embodiments, one binding domain is specific for a receptor on an immune cell (e.g., T cells or a B cell). A second binding domain is specific for a tumor associated antigen including but not limited to CD19, CD20, ROR1, CEA, HER2, EGFR, EGFRvIII, LMP1, LMP2A, Mesothelin, PSMA, EpCAM, glypican-3, gpA33, GD2, TROP2, BCMA, CD33, CD123, CD22, CD30. A third binding domain can be specific for an immune checkpoint modulator such as PDL1, PD1, 0X40, 4-1BB, GITR, TIGIT, TIM-3, LAG-3, CTLA4, CD40, VISTA, ICOS, BTLA, Light, HVEM, CD73, CD39, etc.

[0432] In some embodiments, the trispecific antigen comprises three different binding domains; and One binding domain is specific for a receptor on an immune cell e.g., CD47; CD20; or CD19); a second binding domain is specific for a first tumor associated antigen (e.g., CD19 or CD20); and the third binding domain is specific for a second tumor associated antigen (e.g., CD20; or CD 19). In some embodiments, at least one of the three binding domains targets an immune receptor. In some embodiments, at least one of the three binding domains targets a tumor antigens.

[0433] Molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen are also contemplated by the present definition. By “specifically bind” or “immunoreacts with” or “immunospecifically binds” is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react with other polypeptides or binds at much lower affinity (Kd >10').

[0434] Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present disclosure may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, chimeric molecules comprising a portion of an antibody, antibody fragments (e.g., Fv, Fab, F(ab')2, as well as single chain antibodies (scFv)) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y.; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0435] The basic antibody structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kDa) and one “heavy” chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. In general, antibody molecules obtained from humans relate to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgGl, IgG2, and others. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain.

[0436] An antibody may comprise a VH domain that has at least 60, 70, 80, 85, 90, 95, 98 or 99% amino acid sequence identity with a VH domain of any of the antibodies shown in the appended sequence listing, and / or comprising a VL domain that has at least 60, 70, 80, 85, 90,95, 98 or 99% amino acid sequence identity with a VL domain of any of those antibodies. Algorithms that can be used to calculate % identity of two amino acid sequences include e.g., BLAST, FASTA, or the Smith-Waterman algorithm, e.g., employing default parameters. Particular variants may include one or more amino acid sequence alterations (addition, deletion, substitution and / or insertion of an amino acid residue). Antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, dAb (domain antibody), single chain, Fab, Fab' and F(ab')2 fragments, scFv, and an Fab expression library.

[0437] By “specifically bind” or “immunoreact with” is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react with other polypeptides or binds at much lower affinity (Kd >10').]0438] As used herein, the term “antibody fragment” refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, and multi-specific antibodies formed from antibody fragments.

[0439] An “antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations.

[0440] An “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations, α and β light chains refer to the two major antibody light chain isotypes.

[0441] The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readilyapparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell, or a biological fluid.

[0442] As sued herein, the term “antigen-binding site,” or “binding portion” refers to the part of the immunoglobulin molecule that participates in antigen binding. The antigen binding site is formed by amino acid residues of the N-terminal variable (“V”) regions of the heavy (“H”) and light (“L”) chains. Three highly divergent stretches within the V regions of the heavy and light chains, referred to as “hypervariable regions,” are interposed between more conserved flanking stretches known as “framework regions,” or “FRs.” Thus, the term “FR” refers to amino acid sequences which are naturally found between, and adjacent to, hypervariable regions in immunoglobulins. In an antibody molecule, the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are disposed relative to each other in three dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as “complementarity-determining regions,” or “CDRs.” The assignment of amino acids to each domain is in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk, J. Mol. Biol. 196:901-917 (1987), Chothia et al., Nature 342:878-883 (1989).

[0443] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.

[0444] The term “ex vivo,” as used herein, refers to cells that have been removed from a living organism, (e.g., a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).

[0445] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter. “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis- acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.

[0446] An “isolated” or “purified” antibody or protein is one that has been identified, separated and / or recovered from a component of its production environment (e.g., natural or recombinant). For example, the antibody or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the antibody is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of an antibody in which the antibody is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, an antibody that is substantially free of cellular material includes preparations of antibody having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a “contaminating protein”). When the antibody is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation. When the antibody is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals. For example, the antibody is separated from chemical precursors or other chemicals, which are involved in the synthesis of the protein. Accordingly, such preparations of the antibody have less than about 30%, 20%, 10%, 5% (by dry weight) ofchemical precursors or compounds other than the antibody of interest. In a preferred embodiment, antibodies of the invention are isolated or purified.

[0447] The term “isolated polynucleotide” as used herein shall mean a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, which by virtue of its origin the “isolated polynucleotide” (1) is not associated with all or a portion of a polynucleotide in which the “isolated polynucleotide” is found in nature, (2) is operably linked to a polynucleotide which it is not linked to in nature, or (3) does not occur in nature as part of a larger sequence. Polynucleotides in accordance with the invention include the nucleic acid molecules encoding the heavy chain immunoglobulin molecules, and nucleic acid molecules encoding the light chain immunoglobulin molecules described herein.

[0448] The term “isolated protein” referred to herein means a protein of cDNA, recombinant RNA, or synthetic origin or some combination thereof, which by virtue of its origin, or source of derivation, the “isolated protein” (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g., free of marine proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.

[0449] The term “operably linked” as used herein refers to positions of components so described are in a relationship permitting them to function in their intended manner. A control sequence “operably linked” to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

[0450] “Homologous” as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.“Humanized” forms of non-human e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen- binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.

[0451] Furthermore, humanized antibodies can comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321 : 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

[0452] “Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of thepositions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.

[0453] The term “immunoglobulin” or “Ig,” as used herein is defined as a class of proteins, which function as antibodies. Antibodies expressed by B cells are sometimes referred to as the BCR (B cell receptor) or antigen receptor. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal secretions, and mucus secretions of the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response in most subjects. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defense against bacteria and viruses. IgD is the immunoglobulin that has no known antibody function, but IgD may serve as an antigen receptor. IgE is the immunoglobulin that mediates immediate hypersensitivity by causing release of mediators from mast cells and basophils upon exposure to allergen.

[0454] The term “immune response” as used herein is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and / or activate lymphocytes to remove the antigen.

[0455] The term “immunosuppressive” is used herein to refer to reducing overall immune response.

[0456] The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.

[0457] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides, and oligomers, for example, and to longer chains, which are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0458] The term “immunostimulatory” is used herein to refer to increasing overall immune response.

[0459] The term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. However, such cross-species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A,” the presence of a molecule containing epitope A (or free,unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.

[0460] As used herein, “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).

[0461] As used herein, “F(ab')2” refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ah') (bivalent) regions, wherein each (ah') region comprises two separate amino acid chains, a part of a H chain and a light (L) chain linked by an S — S bond for binding an antigen and where the remaining H chain portions are linked together. A “F(ab')2” fragment can be split into two individual Fab' fragments.

[0462] The term “therapeutic” as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.

[0463] The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0464] To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.

[0465] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells,such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and the like.

[0466] As used herein, “substantially pure” means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present.

[0467] A substantially pure composition will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, 90%, 95%, and 99%. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.

[0468] The term patient includes human and veterinary subjects.

[0469] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.VIII. EXAMPLES

[0470] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.[0471 Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present disclosure and practice the claimed methods. The following working examples specifically point out various aspects of the present disclosure and are not to be construed as limiting in any way the remainder of the disclosure.Example 1: Construct Formats and protein production

[0472] The experiments described herein were initiated to address a vast yet unmet need for the treatment of refractory or relapse B cell lymphoma in patients that have undergone chemotherapy, surgery, and / or local radiation therapy. B Cell Lymphoma (BCL) is a form of a cancer that starts with white B-cells (e.g., lymphocytes). In BCL, lymphocytes are not healthy,do not generate antibodies, do not fight infection, and continuously proliferate. BCL can be a very aggressive cancer because it can spread to lymph nodes, bone marrow, central nervous system, liver, spleen, and other organs. The standard treatment for BCL usually starts with chemotherapy, surgery, or local radiation therapy. Beyond the standard, treatments include stem cell transplantation, targeted B-cell agents (e.g., anti-CD20 antibodies), immunotherapy including, but not limited to chimeric antigen receptor T-cell therapy (CAR T-cell therapy). However, up to 50% of patients receiving any of these treatments become refractory or relapse after treatment, which is associated with worse outcome.

[0473] To address this unmet need, the present disclosure provides novel and differentiated mRNA expressed molecules for systemic administration for treating refractory or relapse B cell lymphoma in patients that have undergone chemotherapy, surgery, and / or local radiation therapy. The novel ovel and differentiated mRNA expressed molecules are multi-specific antibodies comprising anti-CD19, anti-CD20, and / or SIRPα. These multi-specific antibodies: (1) have increased complexities, for example, increased valency of anti-CD20, CD20 / CD19, CD20 / CD19 / SIRP; (2) are polyvalent and more than 20 permutations can be generated from the single nucleic acid molecules disclosed herein (e.g., Table 2 and Table 7); and (3) are symmetric molecules involving one to 3 chains. The novel and differentiated mRNA expressed molecules were codon optimized for human use.

[0474] To design the novel and differentiated mRNA expressed molecules ( .g., multi-specific antibodies), the most common antigens found in BCL were identified, designed, and tested. In particular, CD19 and CD20 binders that have clinical validation were identified. 15 - 30 mono- specific, bi-specific, and multi-specific molecules with increasing complexity were generated with appropriate controls. Plasmids with codon optimized sequences were generated using pcDNA3.4 and pUC57 vectors. These plasmids were then expressed in HEK293 cells; and purified. The integrity, purity, and aggregation of the mRNA molecules and / or DNA were performed. Relevant sequences are disclosed in Table 1. In-vitro binding and functional assessments of the mRNA molecules were performed using in-vitro binding and ADCC analysis or in-vitro human and cynomolgus macaque (cyno) B-cell killing. Based on these assays,exemplary mRNA molecules were selected (Table 3). In-vivo expression and purity assessments in mice were also perform. Specifically, the mRNA molecules were produced and administered to mice with a delivery vehicle (DV) containing Compound 41 (FIG. 25R). Expression and the purity of the multi-specific antibodies from the mice’s plasma were assessed 72 hours post administration.

[0475] Specifically, A total of 27 multi-specific antibody molecules were designed and generated based on 26 mRNA molecules (e.g., 1802-1827) (Table 2; FIGs. 39A-B). 8 mono- specific antibody molecules (FIGs. 1A-B; FIGs. 2A-B; and FIGs. 3A-D); 7 bi-specific antibodies (FIGs. 1C-E; and FIGs. 2C-F); and 11 tri-specifics (FIGs. 1F-J; FIGs. 2G-J; and FIGs. 3E-F) with purity over 90% and low endotoxin levels (<lEU / mg) were designed and produced. The multi-specific antibodies target three antigens: CD19, CD20, and CD47.

[0476] The schematic depictions of the structures of the anti-CD19 multi-specific antibodies, including mono-, bi-, and tri-specific antibodies are shown in FIGs. 1A-J. The mono-specific anti-CD19 antibodies include (FIG. 1A) M23027 (Anti-CD19 (VH)-IgGl + Anti-CD19 (VL)- CK); and (FIG. IB) M23031 (Anti-CD19 (VH)-IgGl (Tafa enhanced ADCC) + Anti-CD19 (VL)-CK). The anti-CD19 multi-specific antibodies are optionally operably linked to an immune modulator that targets a Signal Regulatory Protein alpha (SIRPα) and / or an anti-CD20 or anti- CD 19 single-chain variable fragment (scFv). SIRPα binds to CD47.

[0477] The bi-specific anti-CD19 antibodies include (FIG. 1C) M23028 (Anti-CD19(VH)- IgGl-CD20 (scFv) + Anti-CD19 (VL)-CK); (FIG. ID) M23043 (Anti-CD19(VH)-IgGl -SIRPA + Anti-CD19(scFv)-Anti-CD19-(VK)-CK); and (FIG. IE) M23040 (Anti-CD19(VH)-IgGl- SIRPA + SIRPA-Anti-CD19 (VL)-CK).

[0478] The tri-specific anti-CD19 antibodies include (FIG. IF) M23034 or M23044 (Anti- CD 19(VH)-IgGl-CD20(scFv) + SIRPA-Anti-CD19 (VL)-CK); (FIG. 1G) M23036 (SIRPA- Anti-CD19 (VH)-IgGl -SIRPA + Anti-CD20 (scFv)-Anti-CD19(VL)-CK); (FIG. 1H) M23O37 (Anti-CD19 (VH)-IgGl -SIRPA (2X) + Anti-CD20 (scFv)-Anti-CD19(VL)-CK); (FIG. II) M23032 (Anti-CD19(VH)-IgGl-CD20(scFv) + Anti-CD19 (VL)-CK-SIRPA); and (FIG. 1J) M23045 (Anti-CD19(VH)-IgGl -SIRPA + Anti-CD20 (scFv)-Anti-CD19(VL)-CK).

[0479] The structures of the anti-CD20 multi-specific antibodies, including mono-, bi-, and tri- specific antibodies are shown in FIGs. 2A-J. The mono-specific anti-CD20 antibodies include (FIG. 2A) M23026 (Anti-CD20 (VH)-IgGl + Anti-CD20 (VL)-CK ); and (FIG. 2B) M23030 (Anti-CD20 (VH)-IgGl (Rituxan Fc) + Anti-CD20 (VL)-CK).

[0480] Like the anti-CD19 multi-specific antibodies, the anti-CD20 multi-specific antibodies are operably linked to SIRPα (SIRPA) that targets CD47); and / or an anti-CD20 or anti-CD19 single- chain variable fragment (scFv). The bi-specific anti-CD20 antibodies include (FIG. 2C) M23029 (Anti-CD20(VH-IgGl-CD19 (scFv)+ Anti-CD20 (VL)-CK); (FIG. 2D) M23041 (Anti-CD20 (VH)-IgGl -SIRPA + Anti-CD20(scFv)-Anti-CD20-(VK)-CK); (FIG. 2E) M23039 (Anti-CD20 (VH)-IgGl -SIRPA + SIRPA-Anti-CD20 (VL)-CK); and (FIG. 2F) M23046 (SIRPA-anti- CD20(VH)-IgG-anti-CD20(VH)-CHl + SIRPA-Anti-CD20 (VL)-CK).

[0481] The tri-specific anti-CD20 antibodies include (FIG. 2G) M23042 (anti-CD20 (VH)- IgGl-SIRPA + Anti-CD19(scFv)-Anti-CD20 (VK)-CK); (FIG. 1H) M23035 (Anti-CD20(VH- IgGl-CD19 (scFv) + SIRPA-Anti-CD20 (VL)-CK); (FIG. II) M23038 (Anti-CD20 (VH)-IgGl- SIRPA + Anti-CD20(VL)-CK-anti-CD19 (scFv)); and (FIG. 1J) M23033 (Anti-CD20(VH- IgGl-CD19 (scFv) + Anti-CD20 (VL)-CK-SIRPA).

[0482] Chimeric single-chain variable fragment (scFv) Fc fusion molecules that target CD19, CD20, and / or SIRPα (SIRPA) were also generated. FIGs. 3A-F show schematic depictions of the structures of anti-CD20 or anti-CD19 chimeric single-chain variable fragment (scFv) Fc fusion molecules. The chimeric scFv-Fc proteins are mono-specific (FIGs. 3A-D) or tri-specific (FIGs. 3E-F). The mono-specific anti-CD19 chimeric scFv-Fc include (FIG. 3A) S1826 (Anti- CD19(scFv VL-VH)-IgGl); S1806 (Anti-CD19(scFv VH-VL)-IgGl); and (FIG. 3B) S1806 (Anti-CD19(scFv VH-VL)-IgGl).

[0483] The mono-specific anti-CD20 chimeric scFv-Fc molecules include (FIG. 3C) S1827 (Anti-CD20(scFv VL-VH)-IgGl); and (FIG. 3D) S1807 (Anti-CD20(scFv VH-VL)-IgGl).

[0484] The chimeric scFv-Fc protein molecules were operably linked to a SIRPα to target CD47; and / or an anti-CD20 or anti-CD19 scFv. The tri-specific anti-CD19 / CD20 chimeric scFv-Fcmolecules include (FIG. 3E) S1820 (Anti-CD19(scFv)-SIRPA-IgGl-SIRPA-anti-CD20(ScFv)); and (FIG. 3F) S1819 (SIRPA-anti-CD19&CD20 (scFv)-IgGl-SIRPA).

[0485] The nucleic acids of these designed multi-specific antibody molecules were generated, codon optimized and inserted into a pcDNA3.4 and pUC57 vectors for expression HEK293 cells.

[0486] Following their purification, integrity, and purity assessments (Table 2; FIGs. 39A-B), the molecules were functionally assessed using in-vitro cell-based assays, such as binding assays and preliminary ADCC assays on Raji cells, and Occupation assays (FIG. 7).

[0487] FIG. 4A shows the binding of the anti-CD19 and anti-CD20 tri-specific antibodies and chimeric scFv-Fc molecules (M23037, M23033, M23038, M23045, M23034 (M23044), M23032, M23042, S1820, M23035, and S1819) to Raji cells. Most tri-specific molecules showed very high binding affinity to Raji cells. The binding to Raji cells were ranked as follow. M23037 was superior (>) to M23033, and M23033 > M23038> M23045> M23034 (M23044)>M23032> M23042>S1820> M23035>S1819 (FIG. 4B). The binding of M23033 to Raji cells was equal to that of M23036 (M23033 =. M23036). The tri-specific chimeric scFv-Fc molecules (e.g., S1820 and S 1819) showed lower binding affinity to Raji cells when compared to the anti- CD19 and anti-CD20 tri-specific antibodies (FIG. 4C). The CD20 Fab constructs operably linked to any molecules on the N-terminal of light chain of the tri-specific antibody (e.g., M23042 (anti-CD20 (VH)-IgGl-SIRPA + Anti-CD19(scFv)-Anti-CD20 (VK)-CK ) and M23035 (Anti-CD20(VH-IgGl-CD19 (scFv) + SIRPA-Anti-CD20 (VL)-CK)) showed slightly weaker binding when compared to other tri-specific antibodies (FIG. 4C).

[0488] From these analyses, 7 molecules were selected for further analysis (FIG. 5; Table 3). FIG. 5 shows schematic depictions of the structures of exemplary multi-specific antibodies selected for further analysis. These molecules were selected based on: (a) binding analysis in- depth(e. ., ELISA, Biacore™, single target cell lines); (b) functional characterization e.g., normal B-cell depletion with and without Raji, lymphoma B-cell depletion, ADCC on Raji, cyno whole blood assay); (c) On-target off-tumor binding (e.g., RBC (human and cyno), T-cell (human)); and (d) in-vivo expression, mRNA quality, expression in mice, in-vivo purity.

[0489] The selected multi-specific antibodies were M23032, M23033 ( EC50: 0.034), M23034 (EC50: 0.069), M23036 (EC50: 0.117), M23037 (EC50: 0.534), M23038 (EC50: 0.027), M23045. M23032 (Anti-CD19(VH)-IgGl-CD20(scFv) + Anti-CD19 (VL)-CK-SIRPA) showed stronger response followed by M23045 (Anti-CD19(VH)-IgGl-SIRPA + Anti-CD20 (scFv)-Anti- CD19(VL)-CK). M23026 (Rituximab w in-house Fc; EC50: 0.2980nM).

[0490] Table 9 shows Size Exclusion Chromatography (SEC) analytical data demonstrating the purity of the selected molecules.Example 2: Molecule Characterization in vitro: production, binding, killing, depletion

[0491] To determine whether 27 novel designed molecules were functional, extensive characterization of the molecules was performed, including in-depth binding analysis, functional characterization; on-target off-tumor binding; and in-vivo expression. The in-depth binding analysis included ELISA, Biacore™, and single target cell lines. Additional functional characterization was performed using normal B-cell depletion assay with and without Raji cells, lymphoma B-cell depletion, ADCC on Raji, and cyno whole blood assay. The on-target off- tumor binding was performed using RBC (human and cyno), and T-cell (human). The in-vivo expression was performed using mRNA quality, expression in mice, and in-vivo purity. Based on the results of these assays,7 of the 11 tested tri-specific antibodies showed strong binding on Raji cells

[0492] To determine the binding of the designed molecules to Raji cells, Raji cells were seeded in 96-well plate, incubated with serially diluted molecules, stained with hu anti-lgG-FC and data were obtained via flow cytometry. As shown in FIG. 6, most tri-specific antibodies showed very high binding affinity, with the exception of CD20 Fab constructs that had any molecules on the N-terminal of light chain (M23042 and M23035). Both scFv-Fc fusion molecules (S1820 and S1819) also showed lower binding affinity

[0493] In particular, FIGs. 6A-D show graphs demonstrating the binding of the anti-CD20 and anti-CD19 tri-specific antibodies and the chimeric anti-CD20 and anti-CD19 scFv-Fc fusion molecules when compared to control Rituximab (anti-CD20 antibody) and Tafasitamab (anti- CD19 antibody). FIG. 6A shows the binding of commercial Rituximab (Human IgG monoclonal) and Tafasitamab (commercial Fc; M23031(Anti-CD19 (VH)-IgGl (Tafa enhanced ADCC) + Anti-CD19 (VL)-CK) and novel variants (in-house) of Rituximab and Tafasitamab to Raji cells. These data demonstrate that both in house Tafasitamab (M23027; Anti-CD19 (VH)- IgGl + Anti-CD19 (VL)-CK); and in-house Rituximab (in house Fc; M23026 (Anti-CD20 (VH)- IgGl + Anti-CD20 (VL)-C) showed better binding to Raji cells when compared to the commercial Tafasitamab and Rituximab.

[0494] All anti-CD19 tri-specific antibodies bound significantly to Raji cells compared to controls (CD19-Fab alone (M23027) and SIRPα bivalent / Tetravalent). FIG. 6B shows the binding of anti-CD19 tri-specific antibodies to Raji cells when compared to commercial Rituximab (anti-CD20 antibody), bivalent-SIRPα WT (SIRPα-Fc fusion molecule), or a tretravalent-SIRPα (SIRPα-Fc fusion molecule).

[0495] FIG. 6C shows the binding of anti-CD20 tri-specific antibodies (M23029, M23033, M23035, M23038, M23039, M23041, M23042, and M23046) to Raji cells when compared to commercial Rituximab, in-house Rituximab (M23026 or M23030), bivalent-SIRPα WT (SIRPα- Fc fusion molecule), or a tretravalent-SIRPα (SIRPα-Fc fusion molecule). The in-house Rituximab (M23026) bounds higher than any tri-specific molecules with CD20-Fab as well as purchased Rituximab. Anti-CD20 tri-specific molecules operably linked to SIRPα or scFv to theN-terminal of the heavy chain CD20-Fab (e.g., M23035, M23041, M23042 and M23046) resulted in reduced binding.

[0496] FIG. 6D shows that the binding of anti-CD20 and anti-CD19 chimeric scFv-Fc fusion molecules, S1826, S1806, S1820, S1827, S1807, and S1819 to Raji cells was variable binding results.Occupancy of CD19-CD20-CD47

[0497] To determine whether the designed molecules could bind their target antigens, binding and occupancy assays were performed as shown in FIG. 7. The binding assay measured the binding of drug molecules (e.g., tri-specific antibodies) to cells and the occupation assay measured available binding sites remaining after drug binding (e.g., tri-specific antibodies). The binding and occupation assays each comprised 2-steps. Step 1 comprised coating cells with increasing concentration of the tri-specific antibodies or control molecules; step 2 comprised staining cells with Phycoerythrin (PE) labeled anti-huFC (binding assay) or PE labeled SIRPα (SIRPα occupancy), Alexa Fluor 647 labeled anti-CD20 (CD20 occupancy) and Pacific Blue labeled anti-CD19 (CD 19 occupancy).

[0498] FIG. 8 shows a graph quantifying results of the occupancy assay. The data confirmed target engagement by the tested multi-specific antibodies. In addition, the data demonstrated that M23042, S1820, M23035, and S 1819 weakly bound to CD20 (bold boxes). These data were consistent with the Raji cell binding analysis shown in FIG. 4C. Most tri-specific antibodies bound their respective targets. Anti-CD20 arms of the tri-specific antibodies were more sensitive to modification. Indeed, binding was not observed with 5 molecules (scFv or VL modified). For example, M23036 and M23028 did not show binding to CD20. SIRPα binding was equal or superior to tetravalent SIRPα regardless of valency (FIG. 8).ELISA and Biacore™ Binding Assays

[0499] To determine whether the multi-specific antibodies could bind to their target antigens, CD19, CD20, and CD47, binding assays were performed using Biacore™. Biacore™ further confirmed that the novel multi-specific antibodies could engage their target antigens as shown in Table 4. Table 4 shows that target engagements by M23032 and M23034 were reduced whencompared to other tri-specific antibodies. Additional analyses confirmed that these tri-specific antibodies bound CD20+CD 19' CD47- cells. Thus, the weak binding observed in the Biacore™ assay could be due to the format and antigen in micelle.

[0500] Most tri-specific antibodies M23032 (FIG. 22A), M23033 (FIG. 22B), M23034 (FIG. 22C), M23036(FIG. 22D), M23037 (FIG. 22E), M23038 (FIG. 22F), M23045 (FIG. 22D)) bound to their target antigens (CD19; CD20, and CD47) on Raji cells. Unexpectedly, M23032 and M23034 (C -terminal fusions) showed reduced binding to CD20.

[0501] To further determine whether the multi-specific antibody design impacted individual binding domains (CD 19, CD47 and CD20) due to steric hindrance, ELISA assays were performed (Table 5). ELISA was performed using CD19 / CD47 antibodies and detected by HRP- anti-Fc. As shown in FIGs. 23A-E, all samples retained CD47 and CD 19 binding regardless of the number of antigens expressed by the cells.

[0502] To determine whether target engagement or binding was affected by the location of the binding entities (e.g., scFv), binding assays were performed using wild-type Raji cells, Raji cells expressing CD19 only, Raji cells expressing CD20 only, or Raji cells expressing CD47 only. The effect of a single target binding on the activity of the tri-specific antibodies is shown in FIGs. 23A-E. The binding of M23032, M23034, and M23045 on WT Raji cells (FIG. 23A), Raji cells expressing CD19 only (FIG. 23B), Raji cells expressing CD20 only (FIG. 23D), or Raji cells expressing CD47 only (FIG. 23C) were substantially the same. In addition, when compared tocontrol (M23026, M23027, and a tetravalent SIRPα-Fc fusion molecule were used as controls). Unexpectedly, M23045 showed the highest binding affinity to CD 19 or CD20 when compared to M23032 and M23034. Unexpectedly, M23045 showed the highest binding affinity to CD19 or CD20 when compared to M23032 and M23034. M23045 was shown to be an interesting molecule among the BCL molecules (multi-specific antibodies). FIG. 23E shows that tri-specific antibodies comprising a CD20 scFv attached to N-terminal of light chain (e.g., M23037 or M230 45) showed superior binding to Raji-CD20 cells when compared to tri-specific antibodies comprising a CD20 scFv attached to the Fc region (e.g., M23032 or M23034) in binding to the target. Binding of the tri-specific antibodies to only one of the three target antigens did not appear to affect the activity of the tri-specific antibodies.PBMC killing Assay

[0503] The objective for designing a tri-specific anti-CD19 / anti-CD20 / and SIRPct tri-was to target and kill B cell lymphoma cells for treating the cancer.

[0504] The surface expression of the CD19, CD20 and CD47 (i.e., target antigens) on BCL and BCL’s responsiveness to the tri-specific antibodies can be affected by prior or concurrent cancer therapies. This is because lymphoma patients who will receive the therapy would most likely undergo or had undergone through anti-CD20 and / or anti-CD19 based therapies. As such,experiments were performed to confirm that the novel tri-specific antibodies disclosed herein were active against primary lymphoma cells.

[0505] Initially, the relative surface expression of CD 19, CD20, and CD47 on primary B-cells, B-cell Lymphoma patient’s B-cells, and Raji cells were assessed. As shown in FIGs. 9A-C, Raji cells expressed high levels of all three antigens CD 19 (FIG. 9A); CD20 (FIG. 9B), and CD47 (FIG. 9C). The surface expression of CD19 and CD20 was low on primary B cells and B-cells from BCL patient (FIGs. 9A-B). However, the surface expression of CD47 appeared to be higher on primary B cells and B-cells from BCL patient when compared to CD 19 and CD20 expression (FIG. 9C). But the CD47 expression on primary B cells and B-cells from BCL patient remained lower when compared to the expression observed on Raji cells. EC50

[0506] The cytotoxic effects of the anti-CD20 and anti-CD19 tri-specific antibodies on Raji cells and Human PBMC were then evaluated as shown in FIGs. 10A-D. The percentage of dead Raji Cells (FIG. 10A), the percentage of normal B cell depletion (FIG. 10B), and the percentage of normal B cell count (FIG. 10C) showed that the anti-CD20 and anti-CD19 tri-specific antibodies effectively bound to and killed Raji cells and primary human B cells. The binding of M23034 was higher than (>) M23032 > M23037 > M23045 > M23038 > M23033. Unexpectedly, two anti-CD20 tri-specific molecules (M23033 and M23038) showed slightly reduced killing. Table 6 shows the EC50and EC90of the binding of each of the tri-specific antibodies. FIG. 10C furthershows the killing of the anti-CD20 and anti-CD19 tri-specific antibodies using B cells from a second donor (Donor 10), which showed substantially similar results as FIG. 10B. However, the binding of M23032 was higher than (>) M23034 > M23036 > M23037 > M23045 > M23038 > M23033.

[0507] The percentage of dead B Cell Lymphoma (BCL) cells following exposure to M23027, M23026, M23028, M23029, M23032, M23033, M23034, M23035, M23038, M23042, S1819, or S1820 in the presence of healthy donor PBMCs is quantified in FIG. 10D. In particular, FIG. 10D shows that all tested anti-CD19 / CD20 / SIRPα tri-specific antibodies induced primary lymphoma cells killing.

[0508] As noted herein, the cytotoxic activity of tri-specific antibodies comprising a CD20 Fab was slightly reduced when compared to tri-specific antibodies comprising a CD 19 Fab (FIGs. 10A-C). Conversely, tri-specific antibodies comprising CD19 Fab constructs showed enhanced cytotoxic activity when compared those comprising CD20 Fab construct for both Raji cell killing and normal B cell depletion.

[0509] These results confirmed that the tri-specific antibodies were active against primary lymphoma cells. Furthermore, the results showed that the addition of SIRPα to target CD47 on lymphoma cells enhanced the activity of the tri-specific antibodies when compared to mono- specific antibodies and bi-specific antibodies. Thereby validating the rationale to include SIRPα in the multi-specific antibody designs.Cynomolgus macaque (Cyno) PBMCs

[0510] Furthermore, the tri-specific antibodies induced strong B cell depletion in cynomolgus macaque PBMCs as shown by the depletion of B cells when exposed to M23027, M23026, M23028, M23029, M23032, M23033, M23034, M23035, M23038, M23042, M23045, S1819, S1820; or a trivalent SIRPα-Fc chimeric fusion protein. In that assay, no binding to CD20 was observed for M23035, and M23042.

[0511] To assess the killing of the tri-specific antibodies on cyno PBMCs, fresh cyno whole blood were incubated with or without M23032, M23034, M23037, M23045, M23036, M23038,M23033, M23026, M23027, M23030, or S 1819 for 24 hours (FIG. 13A). Following the incubation, the cells were stained with various markers to determine live / dead cells, CD3+cells, and / or CD40+cells using flow cytometry (FIG. 13A). The results of the cyno B cells in whole blood ex vivo assay are shown in FIGs. 13B-D.

[0512] FIG. 13B shows the effectiveness and ranking of selected tri-specific antibodies. M23032 and M23034 showed significantly higher B-cell depletion compared to other tested tri- specific antibodies (FIG. 13B). In the B-cell depletion assay, the tri-specific antibodies were ranked as follows: M23032 > M23034 > M23037 > M23045 > M23036 > M23038 > M23033 > S1819. Unexpectedly, the B-cell depletion induced by M23033 and M23038 did not show any significant difference when compared to a control mono-specific antibody (M23026). This result was unexpected because M23033 and M23038 had higher killing efficacy in the ADCC assay in FIGs. 12A-C.

[0513] In addition, the tri-specific antibodies containing CD19 Fab showed a significantly higher B cell depletion when compared to tri-specific antibodies containing CD20 Fab. FIG. 13C shows the effectiveness of tri-specific antibodies containing CD19 Fab at depleting B-cells and demonstrating that M23032, M23034, and M23045 significantly enhanced B cell depletion when compared to the control mono-specific antibodies (M23026 or M23027). FIG. 13D shows the effectiveness of tri-specific antibodies containing CD20 Fab at depleting B-cells and demonstrating that M23033, and M23038 enhanced B cell depletion. However, B-cell depletion with CD20 Fab containing tri-specific antibodies were not similar to B-cell depletion induced by CD 19 Fab containing tri-specific antibodies.Complement-Dependent Cytotoxicity (CDC) assay

[0051] Antibody-dependent cell-mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) are two important cell killing mechanisms of antibody drugs. To further demonstrate the cytotoxic profile, anti-tumor activity, or killing properties of the multi-specific antibody designs, a Complement-Dependent Cytotoxicity (CDC) assay was performed using Raji cells in the presence of 25% human serum.

[0515] CDC is mediated by the Cl complex-initiated complement activation that leads to anaphylatoxin generation and deposition of C3b fragments on the target cells. C3b, together with C4b and C2a, constitute the C5 convertase (C4b2a3b) which in turn cleaves C5 to C5a and C5b. C5b then takes part in the production of the C5b-C6-C7-C8-C9 complex, which is the subunit component of the membrane attack complex (MAC). MAC formation on the target cell’s surface results in subsequent cell lysis. As cancer therapeutic antibodies activate the typical complement pathway, they induce the production of MAC on cancer cells, thus causing the killing of cancer cells through CDC.

[0516] The tested tri-specific antibodies (e.g., M23034, M23045, M23036, M23032, and M23033) (FIG. 11A) killed Raji cells in CDC assay with Raji cells and human serum. All tested tri-specific antibodies e.g., M23034, M23045, M23036, M23032, and M23033) killed Raji cells with similar efficiency in the CDC assay, but the killing efficiency of M23034 was higher (>) than M23045 > M23036 > M23032 > M23033. The tri-specific antibodies also showed stronger killing efficiency when compared to control (Isotype control (Iso) or when using heat inactivated human serum (HA)) or bi-specific antibodies (M23026, M23027, M23028, M23029). (FIG. 11 A vs FIG. B)Antibody-dependent cellular cytotoxicity (ADCC)

[0517] ADCC is very important for the in vivo efficacy of many multi-specific antibodies (e.g., bispecific IgGs and Fc-containing bispecific antibodies). To determine if the multi-specific designs disclosed herein could efficiently induce ADCC, an ADCC killing assay on Raji cells was performed. FIG. 12A shows a graph demonstrating the killing profiles of the multi-specific antibodies in the presence Natural Killer Cells (NK) at Target : Effector ratio of 1 :5. Specifically, Raji cells (CTV-labeled) were seeded in 96-well plates, incubated with serially diluted tri- specific antibodies or controls, co-cultured with NK cells in 1 :5 (Target : Effector) ratio for 24h. The cells were then stained with Zombie NIR™ live / dead and hu anti-IgG-FC and data were obtained by flow cytometry.

[0518] As shown in FIG. 12A-B, the ADCC of the anti-CD19 / anti-CD20 tri-specific antibodies showed that most tri-specific antibodies showed similar binding affinity ( EC50) to Raji. Inparticular, tri-specific antibodies comprising CD20 Fab showed superior max killing. M23033 and M23038 showed the best ADCC activity (perhaps because of the availability of more CD20 binding sites) when compared to M23032, M23034, M23036, M23045, and M23037. The affinity of tri-specific antibodies comprising a CD19 Fab (M23032 and M23034) also showed very high ADCC activity, which was weakly less than M23033 and M23038. The killing EC 50 of the control antibodies was 1.510 (M23027); 1.070 (M23026); 4.720 (1051 -bivalent SIRPα-Fc chimeric fusion protein). The killingEC50of the tri-specific antibodies was 0.1233 (M23032), 0.05528 (M23034); 0.07260 (M23033); 0.06588 (M23038); and 0.1788 (M23045). Indeed, most tri-specific antibodies had double or low triple digit pMEC50. Unexpectedly, Raji cells had 5- fold higher expression of CD20 compared to CD 19. FIG. 12C further shows anti-CD19 / anti- CD20 tri-specific antibodies and their respective ADCCEC50values on Raji cells.

[0519] There was no difference in the killing efficacy between in house CD20-Fc (M23026) and commercial CD20-Fc (M23030). However, both performed better than the purchased Rituximab. The addition of SIRPα on the C-terminal of heavy chain of the CD20-Fab resulted in higher killing efficacy than when the SIRPα was fused to the C-terminal of Fc. TheEC50was 0.2980 (M23026), 0.2375 (M23030), 0.03388 (M23033), 0.04955(M23038), and 0.02685 (Rituximab). Conversely, the fusion of the CD 19 scFv on the C-terminal of the Fc fragment resulted in better killing efficacy than on the C-terminal of heavy chain of CD20-Fab.

[0520] Purchased Rituximab (from CHO cell line) showed slightly higher killing potency due to differences in the glycosylation which can impact Fc gamma receptor binding. M23035 bound cells at lower affinity (EC50of 0.2829) which correlated with the killing efficacy. The SIRPα at the N-terminal of CD20-Fab may have contributed to the receptor binding. M23034 bound cells with EC50of 0.0.06969. Thus, M23034 bound at higher affinity as well as showed higher killing efficacy. In the same assay, the EC 50 of Rituximab (mono-specific antibody) was 0.01899; and theEC50of Bivalent SIRPα WT was 1.118.

[0521] M23036 and M2303, which comprise a tetravalent SIRPα bound with higher affinity as well as showed higher killing efficacy when compared to control. TheEC50of M23036 was 0.1172; and the EC50of M23037 was 0.5339. A tri-specific antibody comprising SIRPα at bothN- and C-terminal (M23036) showed slightly better killing potency at lower concentrations than a tri-specific antibody comprising all four molecules at the C-terminal (M23037). In the same assay, the EC50of Rituximab (mono-specific antibody) was 0.001470; and the EC50 of tetravalent SIRPα WT was 0.1420.

[0522] FIGs. 21A-D further show that the ADCC induced by M23038 (FIGs. 21A-B) and the binding of M23038 on Raji cells (FIGs. 21C-D). The ADCC of M23038 was assessed as a purified protein, aggregated of proteins (FIG. 21A), or mRNA Sup (FIG. 21B). The ADCC EC50was 0.04131 (purified protein), 0.03052 (aggregated protein), and 0.08355 (mRNA Sup). The mRNA sup was used at a starting concentration of about lOnM because the concentration was relatively low.

[0523] These data show that the multi-specific antibodies disclosed herein efficiently killed tumor cells.Example 3: RBC and T-cell Binding -Off-Target CellsThe tri-specific antibodies did not bind to human RBCs

[0524] To determine the selectivity of the tri-specific antibodies for B cells and assess the off- target effects, the binding of the tri-specific antibodies to Red blood cells and T cells were assessed. Specifically, RBCs were seeded in 96-well plate. Serially diluted molecules (tri- specific antibodies, Rituximab, Iso control or SIRPα-Fc bivalent molecule) were added to the cells and incubated as shown in FIG. 14A. The RBCs were washed and stained with human anti- IgG-FC and analyzed by flow cytometry. The data were graphed as mean fluorescence intensity.

[0525] FIGs. 14A-C shows graphs quantifying the binding of the tri-specific antibodies to human red blood cells (RBCs). FIG. 14A shows that none of the tested multi-specific molecules showed binding in human RBCs. In particular, the tri-specific antibodies did not bind to human RBCs. 1054 is a SIRPα-bivalent high affinity Fc...

Claims

WHAT IS CLAIMED IS:

1. A multi-specific antibody that binds two or more antigens comprising:(a) a first polypeptide comprising an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD 19 or CD20, wherein the VH is operably linked to:(i) an immunoglobulin Fc fragment; and(ii) at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a sc Ab, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or(iv) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155; and(b) a second polypeptide comprising an immunoglobulin light chain (VL) of an antibody that targets the first antigen, wherein the VL is operably linked to:(i) a linker;(ii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155; and / or(iii) at least one antigen binding domain that binds the second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody.

2. The multi-specific antibody of claim 1, wherein the at least one antigen binding domain that binds the second antigen is a scFv or a Fab that targets CD19 or CD20.

3. The multi-specific antibody of claim 1 or 2, wherein the immune modulator molecule is SIRPα.

4. The multi-specific antibody of any one of c fragment:(a) is a human immunoglobulin G1 (IgGl) Fc fragment;(b) has a modified effector function;(c) has an enhanced effector function.

5. The multi-specific antibody of any one of claims 1-4, wherein the first polypeptide comprises, in tandem from the N-terminal to the C-terminal:(a) an anti-CD19 or CD20 VH, the IgGl Fc fragment, and the anti-CD19 or anti- CD20 scFv, optionally M23032, M23033, or M23034;(b) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a SIRPα molecule, optionally, M23038, or M23045;(c) the SIRPα molecule, the anti-CD19 or anti-CD20 VH, and the IgGl Fc fragment;(d) a first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a second SIRPα molecule, optionally, M23036;(e) the anti-CD19 or anti-CD20, the IgGl Fc fragment, and the first and the second SIRPα molecules, optionally, M23037; or(f) the first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, the anti-CD19 or anti-CD20 Fab fragment, and the second SIRPα molecule, optionally, M23038, or M23045.

6. The multi-specific antibody of any one of claims 1-5, wherein the second polypeptide comprises, in tandem from the N-terminal to the C-terminal:(a) the anti-CD19 or anti-CD20 VL, the linker, and a SIRPα molecule, optionally, M23032, or M23033;(b) the SIRPα molecule, the anti-CD19 or anti-CD20 VL, and the linker, optionally, M23034;(c) the anti-CD19 or anti-CD20 scFv, the anti-CD19 or anti-CD20 VL, and the linker, optionally, M23036 or M230367;(d) the anti-CD19 or anti-CD20 VL, th< scFv, M23038; or(e) the anti-CD19 or anti-CD20 VL and the linker.

7. The multi-specific antibody of any one of claims 1-6, wherein:(a) the first polypeptide comprises a first SIRPα molecule, the anti-CD19 VH, the IgGl Fc fragment, and a second SIRPα molecule, and the second polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker, optionally, M23036;(b) the first polypeptide comprises the anti-CD19 VH, the IgGlFc fragment, and the first and the second SIRPα molecules and the second polypeptide comprises the anti- CD20 scFv, the anti-CD19 VL, and the linker, optionally, M23037;(c) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second polypeptide comprises the anti-CD19 VL, the linker, and the SIRPα molecule, optionally, M23032;(d) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second polypeptide comprises the anti-CD20 VL, the linker, and the SIRPα molecule, optionally, M23033;(e) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second polypeptide comprises the SIRPα molecule, the anti-CD19 VL, and the linker, optionally, M23034;(f) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD20 scFv, the anti- CD19 VL, and the linker, optionally, M23045;(g) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD20VL, the linker, and the anti-CD19 scFv, optionally, M23038;(h) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD19 scFv, the anti- CD20 VL, and the linker, optionally, M23042;(i) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second polypeptide comprises the SIRPα molecule, the anti- CD20 VL, and the linker, optionally, M23035;(j) the first polypeptide comprises the < the anti-CD20 scFv and the second polypeptide comprises the anti-CD19 VL and the linker, optionally, M23028;(k) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises theCD19 scFv, the anti-CD19 VL, and the linker, optionally, M23043;(l) the first polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the SIRPα molecule, the anti- CD19 VL, and the linker, optionally, M23040;(m) the first polypeptide comprises the first SIRPα molecule, the anti-CD20 VH, the IgGl Fc fragment, the anti-CD20 Fab fragment, and the second SIRPαmolecule, and the second polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker, optionally, M23046;(n) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv and the second polypeptide comprises the anti-CD20 VL and the linker, optionally, M23029;(o) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the anti-CD20 scFv, the anti- CD20 VL, and the linker, optionally, M23041; or(p) the first polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second polypeptide comprises the SIRPα molecule, the anti- CD20 VL, and the linker, optionally, M23039.

8. The multi-specific antibody of any one of claims 1-7, wherein:(a) the first polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22; and / or(b) the second polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

9. The multi-specific antibody of any one of c antibody comprises the amino acid sequences of(a) SEQ ID NO: 5, and SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8, optionally, M23028, M23044, M23034, or M23032;(b) SEQ ID NO: 6, and SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10, optionally, M23033, M23035, or M23029;(c) SEQ ID NO : 11 , and SEQ ID NO : 13 , optionally, M23036;(d) SEQ ID NO: 12, and SEQ ID NO: 13, optionally, M23037;(e) SEQ ID NO: 14, and SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, orSEQ ID NO: 18, optionally, M23038, M23039, M23041, or M23042;(f) SEQ ID NO: 16, and SEQ ID NO: 8, or SEQ ID NO: 13, optionally, M23040, M23043, or M23045;(g) SEQ ID NO: 1 and SEQ ID NO: 2, optionally, M23026;(h) SEQ ID NO: 3, and SEQ ID NO: 4, optionally, M23027(i) SEQ ID NO: 20, and SEQ ID NO: 10, optionally, M23046;(j ) SEQ ID NO : 21 , and SEQ ID NO : 2, optionally, M23030; or(k) SEQ ID NO: 22, and SEQ ID NO: 4, optionally, M23031.

10. The multi-specific antibody of any one of claims 1-9, wherein the multi-specific antibody comprises the amino acid sequences of:(a) SEQ ID NO: 5, and SEQ ID NO: 7, optionally, M23032;(b) SEQ ID NO: 5, and SEQ ID NO: 8, optionally, M23034;(c) SEQ ID NO: 6, and SEQ ID NO: 9, optionally, M23033;(d) SEQ ID NO : 11 , and SEQ ID NO : 13 , optionally, M23036;(e) SEQ ID NO: 12, and SEQ ID NO: 13 optionally, M23037;(f SEQ ID NO: 14, and SEQ ID NO: 15, optionally, M23038; or(h) SEQ ID NO: 16, and SEQ ID NO: 13, optionally, M23045.

11. A multi-specific antibody that binds two or more antigens comprising: a first recombinant polypeptide comprising an immunoglobulin heavy chain (VH) that targets CD 19 or CD20 and a second recombinant polypeptide comprising an immunoglobulin light chain (VL) of the antibody that targets CD 19 or CD20, wherein:(a) the first recombinant polypeptide c< immunoglobulin heavy chain (VH) of an antibody that targets CD 19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second recombinant polypeptide comprises a single variable fragment (scFv) that targets CD20 (anti-CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD 19 (anti-CD19 VL), and a linker;(b) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the first and the second SIRPα molecules and the second recombinant polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker;(c) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second recombinant polypeptide comprises the anti-CD19 VL, the linker, and the SIRPα molecule;(k) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second recombinant polypeptide comprises the anti-CD20 VL, the linker, and the SIRPα molecule;(l) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second recombinant polypeptide comprises the SIRPα molecule, the anti-CD19 VL, and the linker;(m) the first recombinant polypeptide comprises the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD20 scFv, the anti-CD19 VL, and the linker;(n) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD20VL, the linker, and the anti-CD19 scFv;(o) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second recombinant polypeptide comprises the anti-CD19 scFv, the anti-CD20 VL, and the linker; or(p) the first recombinant polypeptide comprises the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second recombinant polypeptide comprises the SIRPα molecule, the anti-CD20 VL, and the linker.

12. A multi-specific antibody that binds two or more antigens comprising:(a) at least one full-length antibody tha from CD 19 or CD20, wherein the full-length antibody comprises:(i) an antibody fragment selected from the group consisting of a Fab fragment, or a F(ab')2 fragment, and(ii) two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antigen binding domain; and(b) at least two antigen binding domains that bind a second antigen, wherein the antigen binding domain is selected from:(i) a Fab fragment, or a scFv that targets CD19 or CD20; and / or(ii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD155, wherein the full-length antibody is operably linked to the at least two antigen binding domains.13 The multi-specific antibody of claim 12, wherein:(a) the at least two antigen binding domains are SIRPα molecules and the second target antigen is CD47;(b) the at least two antigen binding domains are scFv that target CD 19 or CD20; and(c) the antibody fragment is a F(ab')2 fragment comprising two immunoglobulin (Ig) heavy chains and two Ig light chains.

14. The multi-specific antibody of claim 13, wherein each of the at least two antigen binding domains is operably linked to:(a) the N-terminus of the two Ig light chains;(b) the N-terminus of the two Ig heavy chains;(c) the C-terminus of the two Ig light chains; and / or(d) the C-terminus of the two Fc fragments.

15. The multi-specific antibody of any one of claims 12-14, wherein the multi-specific antibody comprises at about least about 4, at least about 6, at least about 8, at least about 10,at least about 12, at least about 14, at least about 1( more than about 20 antigen binding domains.

16. The multi-specific antibody of claim 15, wherein the multi-specific antibody comprises at least four antigen binding domains.

17. The multi-specific antibody of claim 16, wherein the four antigen binding domains are SIRPα molecules, optionally, M23039, M23040, and wherein one of the four SIRPα molecules is operably linked to:(a) the C-terminus of each of the two Fc fragments; and(b) the N-terminus of each of the two Ig light chains, optionally,M23039, or M23040.

18. The multi-specific antibody of claim 16, wherein the at least four antigen binding domains are two anti-CD20 or anti-CD19 scFv and two SIRPα molecules (tri-specific).

19. The multi-specific antibody of claim 18, wherein the two SIRPα molecules are two monomeric SIRPα molecules (or two dimeric SIRPα molecules, optionally, M23037.

20. The multi-specific antibody of claim 18, wherein:(a) each of the two SIRPα molecules is operably linked to the C-terminus of each of the two Fc fragments, optionally, M23037, M23036, M23038, or M23045;(b) each of the two scFv is operably linked to the N-terminus of each of the two Ig light chains, optionally,M23036;(c) each of the two scFv is operably linked to the C-terminus of each of the two Ig light chains, optionally, M23038;(d) the two scFv target a different antigen than the full-length antibody, optionally, M23032, M23033, M23034, M23036, M23037, M23038, or M23045.

21. The multi-specific antibody of claim 18, wherein:(a) each of the two SIRPα molecules is operably linked to the C-terminus of each of the two Fc fragments;(b) each of the two scFv is operably lin light chains; and(c) the two scFv target the same antigen as the full-length antibody, optionally, M23043 and / or M23041.

22. The multi-specific antibody of claim 18, wherein:(a) each of the two SIRPα molecules is operably linked to the C-terminus of each of the Fc fragments;(b) each of the two scFv is operably linked to the N-terminus of each of the two Ig light chains; and(c) the two scFv target a different antigen than the full-length antibody, optionally, M23045 and / or M23042.

23. The multi-specific antibody of claim 22, wherein the multi-specific antibody further comprises two SIRPα molecules, and wherein each of the two SIRPα molecules is operably linked to the N-terminus of each of the two Ig heavy chains, optionally, M23036.

24. The multi-specific antibody of claim 22, wherein the multi-specific antibody further comprises two SIRPα molecules and wherein the two SIRPα molecules are operably linked to each of the two SIRPα molecules linked to the C-terminus of each of the Fc fragments, optionally, M23037.

25. The multi-specific antibody of claim 18, wherein:(a) each of the two SIRPα molecules is operably linked to the C-terminus of each of the Fc fragments;(b) each of the two scFv is operably linked to the C-terminus of each of the two Ig light chains; and(c) the two scFv target a different antigen than the full-length antibody, optionally, M23038.

26. The multi-specific antibody of claim 18, wherein:(a) each of the two SIRPα molecules is operably linked to the N-terminus of each of the two Ig light chains;(b) each of the two scFv is operably linFc fragments; and(c) the two scFv target different antigens as the full-length antibody, optionally, M23034, M23044 and / or M23035.

27. The multi-specific antibody of claim 18, wherein:(a) each of the two SIRPα molecules is operably linked to the C-terminus of each of the two Ig light chains;(b) each of the two scFv is operably linked to the C-terminus of each of the two Fc fragments; and(c) the two scFv target different antigens as the full-length antibody, optionally, M23032 and / or M23033.

28. The multi-specific antibody of any one of claims 22-27, wherein when:(a) the full-length antibody targets CD 19 and the two scFv target CD20; or(b) the full-length antibody targets CD20 and the two scFv target CD 19.

29. The multi-specific antibody of any one of claims 12-28, wherein, the multi-specific antibody comprises:(a) at least one full-length antibody comprising a F(ab')2 fragment that specifically binds CD 19 or CD20 operably linked to an IgGl Fc fragment; and(b) the at least two antigen binding domains are selected from two scFv that bind to CD 19 or CD20, and / or two SIRPα molecules.

30. The multi-specific antibody of any one of claims 12-29, wherein the Fab fragments, the F(ab')2 fragment, or the scFv comprises:(a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 33; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 34 , optionally, CD20 VH and VL; or(b) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 35; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 36, , optionally, CD19 VH and VL.

31. The multi-specific antibody of any one of c comprise an amino acid sequence selected from the group consisting of SEQ ID NO:33, 34, 35 and 36.

32. The multi-specific antibody of any one of claims 12-29, wherein the scFv comprises an amino acid sequence selected from the group consisting of SEQ ID NO:37, 38, 39, and 40.

33. The multi-specific antibody of any one of claims 12-32, wherein the Fc fragment comprises the amino acid sequence of SEQ ID NO: 41 or 42.

34. The multi-specific antibody of any one of claims 11-33, wherein the SIRPα molecule comprises the amino acid sequence of SEQ ID NO: 42.

35. The multi-specific antibody of any one of claims 12-34, wherein the multi-specific antibody is selected from the group consisting of M23028, M23043, M23040; M23046; M23029; M23041; M23039; M23034; M23044; M23036; M23037; M23032; M23045; M23042; M23035; M23038; and M23033.

36. The multi-specific antibody of any one of claims 12-34, wherein the multi-specific antibody is selected from the group consisting of M23034; M23036; M23037; M23032; M23045; M23038; and M23033.

37. The multi-specific antibody of any one of claims 12-34, wherein the multi-specific antibody is selected from the group consisting of M23032; M23034, and M23045.

38. The multi-specific antibody of any one of claims 11-37, wherein the multi-specific antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 21; and SEQ ID NO: 22.

39. A multi-specific antibody that binds two or more antigens comprising:(a) at least one full-length antibody that specifically binds a first antigen selected from CD 19 or CD20, wherein the full-length antibody comprises:(i) an antibody fragment selects fragment, or a F(ab')2 fragment and the antibody fragment comprises two immunoglobulin (Ig) heavy chains and two Ig light chains, and(ii) two human immunoglobulin G1 (IgGl) Fc fragments which are operable linked to the antibody fragment; and(b) a scFv that targets CD 19 or CD20; wherein the scFv targets a different antigen than the full-length antibody, and wherein the scFv is operably linked to:(i) the C-terminus of each of the Fc fragments,(ii) the C-terminus of each of the two Ig light chains of the full-length antibody, or(iii) the N-terminus of each of the two Ig light chains of the full-length antibody; and / or(c) a SIRPα molecule that binds to CD47 on a target cell, wherein the SIRPα molecule is operably linked to:(i) the C-terminus of each of the Fc fragments,(ii) the C-terminus of each of the two Ig light chains of the full-length CD 19 or CD20 antibody, or(iii) the N-terminus of each of the two Ig light chains of the full-length CD 19 or CD20 antibody, and / or(iv) the N-terminus of each of the two Ig heavy chains of the full-length CD 19 or CD20 antibody.

40. The multi-specific antibody of any one of claims 1-39, wherein the multi-specific antibody exhibits enhanced binding affinity when compared to a Fab fragment, a F(ab')2 fragment, or a scFv derived from the same antibody.

41. The multi-specific antibody of any one of claims 1-39, wherein the SIRPα enhances the binding and / or killing properties of the multi-specific antibody when compared to a multi- specific antibody lacking the SIRPα molecule.

42. The multi-specific antibody of any one of claims 1-39, wherein the multi-specific antibody has an EC50:(a) b etween ab out 0.01 nM-0.5 nM, ab oi about 0.01nM-0.07nM, or about 0.01nM-0.05nM; or(b) at least about 0.034nM, at least about 0.01618nM, at least about 0.1771nM, at least about 0.2183nM, at least about 0.08312nM, at least about 0.034nM, at least about 0.069nM, at least about 0.117nM, at least about 0.534nM, at least about 0.6609nM, at least about 0.06841nM, at least about 0.1929nM, at least about 0.2734nM, at least about 0.04471nM, at least about 0.4725nM, at least about 0.8945nM, or at least about 0.027nM.

43. An isolated nucleic acid encoding a multi-specific antibody of any one of claims 1-39.

44. The isolated nucleic acid of claim 43, wherein the isolated nucleic acid is a DNA or an RNA.

45. The isolated nucleic acid of claim 44, wherein the RNA is mRNA.

46. The isolated nucleic acid of any one of claims 43-45, wherein the isolated nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22; SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19.

47. The isolated nucleic acid of any one of claims 43-46, further comprising a nucleic acid encoding a secretory signal sequence.

48. A vector comprising the isolated nucleic acid of any one of claims 43-47.

49. A cell comprising the isolated nucleic acid of any one of claims 43-47, or the vector of claim 48.

50. A composition comprising:(a) a nucleic acid encoding a multi-specific antibody of any one of claims 1-39;(b) the isolated nucleic acid of any one of claims 43-47;(c) the vector of claim 48; or(d) The cell of claim 49.

51. An in vivo method of producing a multi-spc administering to a subject a predetermined molar ratio of:(a) a first nucleic acid encoding:(i) an immunoglobulin heavy chain (VH) of an antibody that targets a first antigen selected from CD 19 or CD20;(ii) an immunoglobulin Fc fragment; and(iii) at least one antigen binding domain that binds to a second antigen selected from CD 19 or CD20, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a sc Ab, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; and / or(iv) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155; and(b) a second nucleic acid encoding:(i) an immunoglobulin light chain (VL) of an antibody that targets the first antigen;(ii) a linker;(iii) an immune modulator capable of binding to a molecule selected from the group consisting of BTLA, HVEM, CSF1R, CCR4, CD39, CD40, CD73, CD96, CXCR2, CXCR4, CD200, GARP, CD47, CXCL9, CXCL10, CXCL11, and CD 155; and / or(iv) at least one antigen binding domain that binds the second antigen, wherein the at least one antigen binding domain is selected from the group consisting of a Fab, a scFv, a scAb, a dAb, a single domain heavy chain antibody, and a single domain light chain antibody; wherein, when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody.

52. The method of claim 51, wherein:(a) the VH is operably linked to the immunoglobulin Fc fragment; and the at least one antigen binding domain that binds the first antigen; and / or an immune modulator; and / or(b) the VL is operably linked to: the lin and / or the at least one antigen binding domain that binds the second antigen.

53. The method of claim 52, wherein the at least one antigen binding domain that binds the second antigen is a scFv or a Fab that targets CD19 or CD20.

54. The method of any one of claims 51-53, wherein the immune modulator molecule is Signal regulatory protein alpha (SIRPα).

55. The method of any one of claims 51-54, wherein the immunoglobulin Fc fragment:(a) is a human immunoglobulin G1 (IgGl) Fc fragment;((b) has a modified effector function;(c) has an enhanced effector function.

56. The method of any one of claims 51-55, wherein the first nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding:(a) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and anti-CD19 or anti- CD20 scFv, optionally, M23032, M23033, or M23034;(b) an anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, optionally, M23038, or M23045;(c) the SIRPα molecule, the anti-CD19 or anti-CD20 VH, and the IgGl Fc fragment;(d) a first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, and a second SIRPα molecule, optionally, M23036;(e) the anti-CD19 or anti-CD20, the IgGl Fc fragment, and the first and the second SIRPα molecules, optionally, M23037; or(f) the first SIRPα molecule, the anti-CD19 or anti-CD20 VH, the IgGl Fc fragment, the anti-CD19 or anti-CD20 Fab fragment, and the second SIRPamolecule, optionally, M23038, or M23045; or(g) the VH and the Fc fragment.

57. The method of any one of claims 51-56, wherein the second nucleic acid comprises, in tandem from the N-terminal to the C-terminal, a nucleic acid encoding:(a) the anti-CD19 or anti-CD20 VL, th< optionally, M23032, or M23033;(b) the SIRPα molecule, the anti-CD19 or anti-CD20 VL, and the linker, optionally, M23034;(c) the anti-CD19 or anti-CD20 scFv, the anti-CD19 or anti-CD20 VL, and the linker, optionally, M23036, or M230367;(d) the anti-CD19 or anti-CD20 VL, the linker, and the anti-CD19 or anti-CD20 scFv, optionally, M23038; or(e) the anti-CD19 or anti-CD20 VL and the linker, optionally, M23038.

58. The method of claim 56 or 57, wherein the subject is administered:(a) the first nucleic acid comprising the first SIRPα molecule, the anti-CD19 VH, the IgGl Fc fragment, and the second SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker, optionally, M23036;(b) the first nucleic acid comprising the anti-CD19 VH, the IgGlFc fragment, and the first and the second SIRPα molecules and the second nucleic acid comprising the anti- CD20 scFv, the anti-CD19 VL, and the linker, optionally, M23037;(c) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid comprising the anti-CD19 VL, the linker, and the SIRPα molecule, optionally, M23032;(d) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid comprising the anti-CD20 VL, the linker, and the SIRPα molecule, optionally, M23033;(e) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid comprising the SIRPα molecule, the anti-CD19 VL, and the linker, optionally, M23034;(f) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti- CD19 VL, and the linker, optionally, M23045;(g) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20VL, the linker, and the anti-CD19 scFv, optionally, M23038;(h) the first nucleic acid comprising the the SIRPα molecule, and the second nucleic acid comprising the anti-CD19 scFv, the anti- CD20 VL, and the linker, optionally, M23042;(i) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid comprising the SIRPα molecule, the anti- CD20 VL, and the linker, optionally, M23035;(j) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv and the second nucleic acid comprising the anti-CD19 VL and the linker, optionally, M23028;(k) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising theCD19 scFv, the anti-CD19 VL, and the linker, optionally, M23043;(l) the first nucleic acid comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the SIRPα molecule, the anti- CD19 VL, and the linker, optionally, M23040;(m) the first nucleic acid comprising the first SIRPα molecule, the anti-CD20 VH, the IgGl Fc fragment, the anti-CD20 Fab fragment, and the second SIRPαmolecule, and the second nucleic acid comprising the SIRPα molecule, the anti-CD20 VL, and the linker, optionally, M23046;(n) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv and the second nucleic acid comprising the anti-CD20 VL and the linker, optionally, M23029;(o) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the anti-CD20 scFv, the anti- CD20 VL, and the linker, optionally, M23041;(p) the first nucleic acid comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid comprising the SIRPα molecule, the anti- CD20 VL, and the linker, optionally, M23039.

59. The method of any one of claims 51-58, wherein:(a) the first nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NOSEQ ID NO: 22; and / or(b) the second nucleic acid encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19.

60. The method of any one of claims 51-58, wherein the subject is administered the first and second nucleic acids encoding the amino acid sequences of:(a) SEQ ID NO: 5, and SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 8, optionally, M23028, M23044, M23034, or M23032;(b) SEQ ID NO: 6, and SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10, optionally, M23033, M23035] orM23029;(c) SEQ ID NO : 11 , and SEQ ID NO : 13 , optionally, M23036;(d) SEQ ID NO: 12, and SEQ ID NO: 13, optionally, M23037;(e) SEQ ID NO: 14, and SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, orSEQ ID NO: 18, optionally, M23038, M23039, M23041, or M23042;(f) SEQ ID NO: 16, and SEQ ID NO: 8, or SEQ ID NO: 13, optionally, M23040, M23043, or M23045;(g) SEQ ID NO: 20, and SEQ ID NO: 10, optionally, M23046;(h) SEQ ID NO: 21, and SEQ ID NO: 2, optionally, M23030;(i) SEQ ID NO : 22, and SEQ ID NO : 4, optionally, M23031 ;(j) SEQ ID NO: 1 and SEQ ID NO: 2, optionally, M23026;(k) SEQ ID NO: 3, and SEQ ID NO: 4, optionally, M23027.

61. The method of any one of claims 51-58, wherein the subject is administered the first and second nucleic acids encoding the amino acid sequences of:(a) SEQ ID NO: 5, and SEQ ID NO: 7, optionally, M23032;(b) SEQ ID NO: 5, and SEQ ID NO: 8, optionally, M23034;(c) SEQ ID NO: 6, and SEQ ID NO: 9, optionally, M23033;(d) SEQ ID NO : 11 , and SEQ ID NO : 13 , optionally, M23036;(e) SEQ ID NO: 12, and SEQ ID NO: 13, optionally, M23037;(f SEQ ID NO: 14, and SEQ ID NO: 1(h) SEQ ID NO: 16, and SEQ ID NO: 13, optionally, M23045.

62. An in vivo method of producing a multi-specific antibody, the method comprising administering to a subject a predetermined molar ratio of a first and a second nucleic acid molecules, wherein, when administered to the subject, the first and the second nucleic acids generate a fully assembled multi-specific antibody; and wherein:(a) the first nucleic acid encodes a polypeptide comprising a first SIRPα molecule, an immunoglobulin heavy chain (VH) of an antibody that targets CD 19 (anti-CD19 VH), a human immunoglobulin G1 (IgGl) Fc fragment (IgGl Fc fragment), and a second SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising a single variable fragment (scFv) that targets CD20 (anti-CD20 scFv), an immunoglobulin light chain (VL) of an antibody that targets CD 19 (anti-CD19 VL), and a linker, optionally, M23036;(b) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the first and the second SIRPα molecules and the second nucleic acid encodes a polypeptide comprising the anti-CD20 scFv, the anti-CD19 VL, and the linker, optionally, M23037;(c) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid encodes a polypeptide comprising the anti-CD19 VL, the linker, and the SIRPα molecule, optionally, M23032;(e) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid encodes a polypeptide comprising the anti-CD20 VL, the linker, and the SIRPα molecule, optionally, M23033;(f) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the anti-CD20 scFv, and the second nucleic acid encodes a polypeptide comprising the SIRPα molecule, the anti-CD19 VL, and the linker, optionally, M23034;(g) the first nucleic acid encodes a polypeptide comprising the anti-CD19 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes apolypeptide comprising the anti-CD20 scFv, the arM23045;(h) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD20VL, the linker, and the anti-CD19 scFv, optionally, M23038;(i) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the SIRPα molecule, and the second nucleic acid encodes a polypeptide comprising the anti-CD19 scFv, the anti-CD20 VL, and the linker, optionally, M23042; or(j) the first nucleic acid encodes a polypeptide comprising the anti-CD20 VH, the IgGl Fc fragment, and the anti-CD19 scFv, and the second nucleic acid encodes a polypeptide comprising the SIRPα molecule, the anti-CD20 VL, and the linker, optionally, M23035.

63. The method of any one of claims 51-62, wherein a single polynucleotide comprises the first and second nucleic acids.

64. The method of any one of claims 51-63, wherein the first nucleic acid or the second nucleic acid further comprises a modified nucleotide, a cap structure, a poly A tail, a 5' untranslated region, and / or a 3 ' untranslated region.

65. The method of any one of claims 51-64, wherein the first or the second nucleic acid is a DNA or an RNA.

66. The method of claim 65, wherein the RNA is an mRNA.

67. The method of any one of claims 51-64, wherein the first or the second nucleic acid is a synthetic mRNA or a modified mRNA.

68. The method of claim 66 or 67, wherein the first or the second nucleic acid is synthesized from:(a) naturally occurring nucleotides; or(b) modified nucleotide analogues selected from the group consisting of 1- — ?-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N-6-methyl-adenine, N-6-isopentenyl-adenine, 2-thio-cytosine, methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl- guanine, 7-methylguanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2 -thio-uracil, 4-thiouracil, 5-carboxymethylaminomethyl-2-thio- uracil, 5- (carboxyhydroxymethyl)-uracil, 5-fluorouracil, 5-bromo-uracil, 5- carboxymethylaminomethyl-uracil, 5-methyl-2 -thio-uracil, 5-methyluracil, N-uracil-5- oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio- uracil, 5-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, 1 -methylpseudouridine, and inosine.

69. The method of any one of claims 51-68, wherein the predetermined molar ratio of the first and the second nucleic acids is:(a) about 1 :1, about 1 :2, about 1 :3, about 1 :4, about 2:1 : about 3: 1, about 4: 1, about 5: 1 or about 6: 1; or(b) about 1 : 1 or about 2: 1.

70. The method of any one of claims 51-69, wherein the first and second nucleic acids are encapsulated in one or more lipid nanoparticles (LPN).

71. The method of claim 70, wherein the one or more lipid nanoparticles are selected from the group consisting of liposomes, lipid complexes, and lipoplexes.

72. The method of any one of claims 51-71, wherein the first and second nucleic acids are encapsulated in the same LPNs or in separate LPNs.

73. The method of any one of claims 70-72, wherein each LPN comprises:(a) a cationic lipid; or(b) a cationic lipid, a non-cationic lipid, a neutral lipid, a cholesterol, a cholesterol-based lipid, a PEG a PEG-modified lipid, or any combination thereof.

74. The method of claim 73, wherein:(a) the cationic lipids constitute about 5LPN;(b) the cationic lipids constitute about 10% to about 40% of the total lipids in the LPN;(c) the cationic lipids constitute about 30% to about 90% of the total lipids in the LPN;(d) the cationic lipids constitute about 30% to about 70% of the total lipids in the LPN;(e) the PEG-modified lipids constitute about 0.5% to about 20% of the total lipids in the LPN; or(f) the PEG-modified lipids constitute about 4% to about 10% of the total lipids in the LPN.

75. The method of any one of claims 70-74, wherein the one or more LPNs have a size:(a) of about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, or about 250 nm; or(b) in the range from about 50 nm to about 300 nm, about 60 nm to about 250 nm, about 60 nm to about 150 nm, or about 60 nm to about 120 nm.

76. The method of any one of claims 51-75, wherein the first nucleic acid or the second nucleic acid further comprises a nucleic acid encoding a secretory signal peptide.

77. The method of any one of claims 51-76, wherein the multi-specific antibody is produced within about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, or about 120 hours post- administration.

78. The method of any one of claims 51-77, wherein the multi-specific antibody is an IgG antibody.

79. The method of any one of claims 51-78, wherein the subject is a cell or a whole organism.

80. The method of any one of claims 51-78, wl administering comprises transfecting the cell with the first and second nucleic acids.

81. The method of claim 82, wherein the subject is a whole organism selected from a mammal, a non-human primate, or a human.

82. The method of claim 81, wherein the subject is systemically administered the first and the second nucleic acids.

83. The method of claim 81, wherein systemic administration comprises an intravenous or an intraperitoneal administration.

84. A multi-specific antibody produced by the method of any one of claims 51-83.

Images