Dsrna molecules, small interfering RNA (SIRNA) molecules, compound, method of obtaining dsrna molecules, plasmid, host cell, pest control method

DsRNA molecules targeting specific genes in stink bugs using RNAi technology provide a sustainable and effective control method, overcoming insecticide resistance and reducing bug populations in soybean-corn systems.

WO2025137756A1PCT designated stage expired Publication Date: 2025-07-03SEMPRE AGTECH LTDA +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/BR2024/050604
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-29
Filing Date
2024-12-27
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

The increasing resistance of brown and green-bellied stink bugs to chemical insecticides poses a significant challenge in agricultural production systems, particularly in the soybean-corn system, necessitating a new, sustainable, and specific mode of action for pest control that does not cause permanent modification of the plant genome.

Method used

Development of dsRNA molecules targeting the Trehalase II, Trehalose Transporter II, and Transcription Initiation Factor TFIID Subunit 1 genes of the stink bugs, using RNAi technology, which are combined into concatamers for rapid mortality and oviposition reduction, and applied via spraying or microinjection.

Benefits of technology

The dsRNA molecules achieve high specificity and rapid mortality rates of up to 95% in stink bugs, reducing their population effectively without genetic modification of plants and with minimal environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BR2024050604_03072025_PF_FP_ABST
    Figure BR2024050604_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to double-stranded RNA (dsRNA) molecules, compounds comprising dsRNA molecules, a method of obtaining dsRNA molecules, and methods of plant health control in a soybean-maize production system. The compound comprising dsRNA molecules of the present invention has an efficient and specific mode of action against insect pests because it is biodirected, particularly in the control of brown stink bugs (Euschistus heros) and green-belly stink bugs (Diceraeus melacanthus), and is also sustainable, as well as being naturally non-toxic, non-allergenic and non-virulent.
Need to check novelty before this filing date? Find Prior Art

Description

dsRNA MOLECULES, SMALL INTERFERING RNA (siRNA) MOLECULES, COMPOUND, METHOD OF OBTAINING dsRNA MOLECULES, PLASMID, HOST CELL, PEST CONTROL METHOD TECHNICAL FIELD

[0001] The present invention relates to double-stranded RNA (dsRNA) molecules, compounds comprising dsRNA molecules, a method for obtaining dsRNA molecules, and methods for phytosanitary control in agricultural production systems, particularly in the soybean-corn production system. The compound comprising dsRNA molecules of the present invention has an efficient and specific mode of action against insect pests because it is biodirected, particularly in the control of brown stink bugs (Euschistus heros) and green-bellied stink bugs (Diceraeus melacanthus). It is also sustainable, in addition to being naturally non-toxic, non-allergenic, and non-virulent. BACKGROUND OF THE INVENTION

[0002] Producing enough food to feed the world's population represents one of the world's greatest challenges. With a population still growing, expected to reach 10 billion by 2057, producing food efficiently is one of the world's most pressing issues.

[0003] In this sense, agriculture plays a fundamental role, and today it is one of the economic activities that most demands innovation and new technological solutions. The quest to increase crop productivity and profitability worldwide, and on a large scale in Brazil—one of the world's breadbaskets—is a constant objective. Within this goal, one of the areas in which frequent evolution is needed is the control of insect pests in cultivated crops. Whether due to issues related to the resistance of the pests to be controlled, the need to improve the impact of agricultural pesticides to increase the country's production potential, or even all of the above.

[0004] Today, the search for cleaner, more modern, sustainable agriculture that results in increased productivity is the key to its technological development.

[0005] Specifically regarding insect pest control in agricultural production systems, such as the soybean-corn production system, we have a significant problem: stink bugs. The family Pentatomidae is the fourth largest family in the suborder Heteroptera and comprises over 36,000 species, with 760 genera and 4,100 species having been described. species in Brazil (Froeschner et al., 2019). The pentatomid stink bug complex is of great economic importance in the agricultural sector due to its polyphagous feeding habits and the significant damage it causes to attacked crops, resulting in reduced yield and quality (Corrêa-Ferreira et al., 2002). Among the bugs in this complex, two species have stood out in the agricultural production system, particularly in the soybean-corn production system: the brown stink bug (Euschistus heros) and the green-bellied stink bug (Diceraeus melacanthus). The brown stink bug is considered a key pest in soybean crops mainly due to its wide distribution and frequency of occurrence of 70% among the stink bugs that attack this crop, which can cause losses of up to 90% in the productivity of this crop if not treated properly, and the presence of just one stink bug can reduce productivity by up to nine kilograms per ha / day (Panizzi, 2016; Panizzi et al., 2022).The green-bellied stink bug has caused significant and increasing losses in corn crops (Chocorosqui; Panizzi, 2004). Controlling these bugs with chemical insecticides has proven increasingly ineffective due to the increasing resistance of these insects to the main chemical molecules traditionally used (Somavilla, 2020).

[0006] Thus, the economic importance of controlling brown and green-bellied stink bugs has been increasing in recent years, with brown stink bugs being considered the main pest of soybeans in Brazil (Panizzi et al., 2022). It is estimated that around 40% of chemical insecticides applied to soybeans are for stink bug control (Tuelher et al., 2018). Therefore, the development of a new alternative for controlling these stink bugs is extremely necessary.

[0007] RNA interference (RNAi) technology is an excellent alternative to chemical insecticides because it targets a narrow spectrum of insects, avoiding harmful effects on beneficial insects such as pollinators, and because it is a biodegradable molecule (Vogei et al., 2019). This natural biological process has enormous potential for agricultural applications, including its use as a dsRNA-based product with insecticidal action against specific genes of brown and green-bellied stink bugs.

[0008] This technology is based on the silencing, via RNAi, of the natural biological process of gene expression, a process observed in eukaryotic organisms. This process is activated by the presence of a double-stranded RNA (dsRNA) that targets a specific messenger RNA (mRNA), which would then be translated into a protein. Once inside the cell cytoplasm, the dsRNA is processed by the natural RNAi machinery, beginning with its recognition by the ribonuclease DICER, which cleaves it into smaller fragments of 19 to 22 nucleotides. These smaller fragments, called small-interfering RNA (siRNA), are then bound by the ARGONAUTE protein, generating the RNA-induced silencing complex (RISC) (Lee et al., 2004). After the formation of the RISC complex in the cell cytoplasm, the siRNA will bind to an mRNA with a complementary sequence and promote its cleavage and degradation, culminating in the silencing of that gene's expression (Okamura et al., 2004). The biological mechanism of RNAi is located entirely in the cell cytoplasm, so there is no risk of altering the nuclear DNA sequence.

[0009] This natural biological process has enormous potential for commercial applications, whether in healthcare, industry, or agriculture. In agriculture, efforts have been made to develop biotechnological solutions to obtain dsRNA that acts as an active ingredient in biodefensives against insect pests, pathogens, and weeds.

[0010] WO2018046312A2 discloses insecticidal compositions comprising a double-stranded ribonucleic acid, or dsRNA, wherein said compositions are proposed to regulate gene expression for gene silencing purposes.

[0011] However, there are still a number of challenges related to insecticidal compositions based on dsRNAs, especially with regard to pests that are harmful to the agricultural production system, such as the soybean-corn production system.

[0012] Therefore, insecticidal compositions based on dsRNA molecules that represent new, unique modes of action are necessary, in order to allow a marked mortality of brown and green-bellied stink bugs, both important insect pests in the agricultural production system, in addition to the aforementioned compositions not causing permanent modification of the genome of the plant to which they are applied, since they do not contain recombinant DNA.

[0013] The development of more sustainable bio-directed pesticides, based on RNAi technology, is necessary to enable cleaner, more modern and sustainable agriculture, with gains in productivity and profitability in plantations and crops, without necessarily increasing the cultivated area.

[0014] Therefore, the present invention relates to double-stranded RNA (dsRNA) molecules, compounds comprising dsRNA molecules, method of obtaining dsRNA molecules, plasmid, host cell and methods of controlling insect pests in an agricultural production system, particularly in a soybean-corn production system. SUMMARY OF THE INVENTION

[0015] The present invention discloses dsRNA molecules that contain sequences for the expression of dsRNAs that activate the silencing of transcripts of the Trehalase II (Trehall), Trehalose Transporter II (TreTran II) and Transcription Initiation Factor TFIID Subunit 1 (TAF1) genes of the brown stink bug (Euschistus heros) and green-bellied stink bug (Diceraeus melacanthus), both pests in the agricultural production system, particularly in the soybean-corn production system, in addition to the dsRNA molecule that is characterized by being a concatamer comprising the combination of said dsRNA molecules.

[0016] One embodiment of the invention relates to compounds comprising at least one of the dsRNA molecules described herein.

[0017] One embodiment of the invention relates to a method for obtaining dsRNA molecules comprising the steps of: a. cloning into a cloning vector with instructions for producing dsRNA for a target gene; b. producing via fermentation, in vitro transcription, chemical synthesis, biochemical synthesis, or a combination thereof, an unpurified dsRNA; c. purifying the obtained dsRNA molecules.

[0018] Another embodiment of the invention relates to a plasmid containing the synthetic sequences of the Trehalase II, Trehalose Transporter II, and Transcription Initiation Factor TFIID Subunit 1 genes that encode dsRNA sequences for silencing genes of the brown (Euschistus heros) and green-bellied (Diceraeus melacanthus) stink bugs.

[0019] The present invention also describes a host cell comprising the plasmid of the present invention.

[0020] In another embodiment of the invention, a method of pest control in an agricultural production system is described, which comprises: spraying the compound comprising molecules of dsRNA in insect pests so that they come into contact with the aforementioned dsRNA molecules. BRIEF DESCRIPTION OF THE FIGURES

[0021] To assist in identifying the main features of the present invention, some figures are presented to which reference is made, as follows:

[0022] Figures 1 aa to 1 d demonstrate the vector for dsRNA expression in E. coli HT1 15: a) Map of the pClone EZ vector modified to contain the multiple cloning site region and the bidirectional T7 promoters and terminators, b) Schematic of the multiple cloning site and the bidirectional T7 promoters and terminators contained in the modified pClone EZ vector, c) Nucleotide sequence of the multiple cloning site and the bidirectional T7 promoters and terminators and the two BsmBI restriction enzyme sites contained in the modified pClone EZ vector. D) Linear MCS map of the modified pClone EZ vector showing the location of the restriction enzyme sites highlighting the two BsmBI sites positioned adjacent to the two T7 promoters. *MCS = Multiple Cloning Site.

[0023] Figure 2 represents a schematic of E. coli strain HT1 15 transformed with a modified pClone EZ vector for heterologous expression of IPTG-inducible dsRNA. Modified from Klema et al. (2015).

[0024] Figure 3 shows the complete sequence of the modified pClone EZ plasmid.

[0025] Figure 4 shows the nucleotide sequence of the Beta-Lactamase gene contained in the pClone EZ vector and which confers resistance to the antibiotic ampicillin.

[0026] Figure 5 shows the amino acid sequence of the Beta-Lactamase gene contained in the pClone EZ vector and which confers resistance to the antibiotic ampicillin.

[0027] Figure 6 represents the general scheme of the production of dsRNA molecules in E. coli strain HT1 15.

[0028] Figure 7 represents the integrity and purity pattern of the dsRNA molecules dsTreha II, dsTreTran II and dsTAFI contained in compounds 001, 002 and 003 of the present invention, observed from electrophoresis in a 1% agarose gel stained with ethidium bromide.

[0029] Figure 8 shows the dsTAFI solution after purification, plated in LB medium with tetracycline antibiotic. Petri dish with and without lid indicating the absence of bacterial colony formation.

[0030] Figure 9 represents the dsTreTran solution / / after purification, plated in LB medium with tetracycline antibiotic. Petri dish with and without lid indicating the absence of bacterial colony formation.

[0031] Figure 10 represents the dsTreha solution / / after purification, plated in LB medium with tetracycline antibiotic. Petri dish with and without lid indicating the absence of bacterial colony formation.

[0032] Figure 1 1 represents the solution of E. coli HT115 bacteria transformed with pClone EZ vector containing dsTAFI fragment, plated in LB medium with Ampicillin + Tetracycline antibiotic. Petri dish with and without lid indicating the large growth of colonies that formed a “carpet”.

[0033] Figure 12 represents a solution of non-transformed E. coli HT1 15 bacteria, plated in LB medium with Ampicillin and Tetracycline antibiotics. Petri dish with and without lid indicating the absence of bacterial colony formation.

[0034] Figure 13 represents the solution of non-transformed E. coli HT1 15 bacteria, plated in LB medium containing only the antibiotic Tetracycline. Petri dish with and without lid indicating the large growth of colonies that formed a “carpet”.

[0035] Figure 14 represents the solution of E. coli HT115 transformed with pClone EZ vector containing dsTAFI fragment, plated in LB medium containing only the antibiotic Tetracycline. Petri dish with and without lid indicating the large growth of colonies that formed a “carpet”.

[0036] Figure 15 shows the electrophoresis in a 1% agarose gel with concentrations of 100, 500 and 1000 ng of the solution of dsRNAs Treha II, TreTran II and TAF1 stained with ethidium bromide.

[0037] Figure 16 shows the 1% agarose gel electrophoresis of a PCR of the dsRNA solution of the present invention with primers specific for the pClone EZ vector. A) PCR reactions with primers M13 Fw + Rv. Lanes 1, 2 and 3: using the solutions containing the dsRNAs Treha II, TreTran l and TAF1 as template: there was no amplification in any of the solutions; Lane 4: PCR with positive control pClone EZ (empty vector): there was expected amplification of 515 bp indicated by the red arrow; Lane 5: pCIone EZ vector recombined with dsTAFI, used as a second positive control: there was expected amplification of 940 bp; Lane 6: reaction blank (negative control); B) PCR reactions with primers Bla Fw + Rv. Lane 1: genomic DNA of the bacteria used as a template: amplification of an 81 bp sequence, indicating the presence of the pCIone EZ vector, as expected; Lane 2: positive control containing pCIone EZ vector: amplicon of 81 bp size, as expected; Lanes 3, 4 and 5: templates were the final solution of dsRNAs Treha II, TreTran II and TAF1: no amplification observed; Lane 6: negative control of the reaction. The gel was stained with ethidium bromide.

[0038] Figure 17 shows the PCR reactions of the dsRNA solutions of the present invention with primers specific for E. coli chromosomal DNA, with Dxs and Actin primers. Lanes 1 and 7: positive control of the reaction using bacterial chromosomal DNA: amplification of 113 bp for the Dxs primer and 131 bp for the Actin primer, as expected; Lanes 2 and 8: pCIone EZ vector, with amplification of 113 bp for the Dxs primer and 131 bp for the Actin primer; Lanes 3, 4, and 5: solutions of the dsRNAs Treha II, TreTran II, and TAF1 used as a template for the reactions with the Dxs primer: there was no amplification of bacterial genomic DNA; Lanes 9, 10, and 11: solutions of dsRNAs Treha II, TreTran II, and TAF1 used as templates for reactions with the Actin primer: no amplification of bacterial genomic DNA occurred; Lanes 6 and 12: reaction blanks. Electrophoresis in 1% agarose gel. The gel was stained with ethidium bromide.

[0039] Figure 18 shows 1% agarose gel electrophoresis of the digestion of the recombinant and empty pCIone EZ vector using the restriction enzymes BsmBI and XhoI. The TAF1 fragment released after digestion (red arrow) confirms the specificity of the cloning.

[0040] Figure 19 demonstrates the confirmation of the nucleotide sequences and alignment against the coding sequence (CDS) of the respective target genes of the dsRNAs dsTreha II, dsTreTran II, and dsTAFI of the present invention, contained in compounds 001, 002, and 003 also described herein.

[0041] Figure 20 shows the cumulative mortality graph in 2 o and 15th day after microinjection for the brown stink bug.

[0042] Figure 21 shows a graph of cumulative daily mortality after microinjection for the brown stink bug.

[0043] Figure 22 shows a graph of accumulated oviposition up to the 15th o after microinjection for the brown stink bug.

[0044] Figure 23 shows the cumulative mortality graph in 2 o and 15th day after microinjection for the green-bellied stink bug.

[0045] Figure 24 shows a graph of cumulative daily mortality after microinjection for the green-bellied stink bug.

[0046] Figure 25 shows a graph of accumulated oviposition up to the 15th o after microinjection for the green-bellied stink bug.

[0047] Figure 26 shows a graph of the mortality of Euschistus heros in Potter's tower up to 7 days after the application of dsRNA (Dre\)naked.

[0048] Figure 27 shows a graph of the mortality of Diceraeus melacanthus in a Potter tower up to 7 days after the application of dsRNA (Dre\)naked. DETAILED DESCRIPTION OF THE INVENTION

[0049] The present invention relates to double-stranded RNA (dsRNA) molecules, compounds comprising at least one of the dsRNA molecules, a method of obtaining the dsRNA molecules, and methods of controlling pests in an agricultural production system.

[0050] The present invention also relates to dsRNA molecules that are characterized by being a concatamer comprising combinations between said dsRNA molecules described herein.

[0051] The concatamer presents a characteristic that is completely different from all genes investigated to date for insect pests in agricultural production systems, with a very rapid mortality effect comparable to or superior to the mode of action of a conventional insecticide.

[0052] To this end, the present invention utilizes RNAi (RNA interference) technology, a natural cellular mechanism responsible for post-transcriptional gene silencing (PTGS). RNAi acts on the target messenger RNA (mRNA), so that a dsRNA molecule, upon incorporation into the cell, activates a protein complex that culminates in the degradation of the target mRNA by binding to a complementary region on the target mRNA. This binding results in silencing by inhibiting translation and / or degradation of the target organism's mRNA.

[0053] Silencing elements may include, and are not limited to, a sense suppression element, an antisense suppression element, a double-stranded RNA (dsRNA), a siRNA (small interfering RNA), an amiRNA, a miRNA, or a hairpin suppression element.

[0054] Gene silencing via RNAi is a highly specific process, meaning that any mRNA in a cell can be intentionally degraded. Furthermore, once activated in an initial cell, the RNAi signal is transmitted to other cells, exponentially increasing its effect. Consequently, the high specificity of the RNAi mechanism makes the technology safe for the environment and for human and animal health, with no effect on non-target organisms. This occurs because the gene sequences of both the pest and non-target species have variations that allow inventors to construct a specific dsRNA that acts only on the target organisms.

[0055] In particular, the inventors surprisingly developed dsRNA molecules—which are naturally non-toxic, non-allergenic, and non-virulent—that contain synthetic sequences for the expression of dsRNAs that activate the silencing of the transcripts of the Trehalase II, Trehalose Transporter II, and Transcription Initiation Factor TFIID Subunit 1 genes of the brown stink bug (Euschistus heros) and the green-bellied stink bug (Diceraeus melacanthus), both pests in agricultural production systems, particularly in the soybean-corn production system. They also developed possible combinations between them, the concatamers: dsTreha II, dsTreTrans II, and dsTAFI, respectively, and, as an example of a concatamer, dsDrei.

[0056] In a preferred embodiment of the invention, the dsRNA molecules are defined according to any of the synthetic sequences for expression of dsRNAs with at least 50%, 60%, 70%, 80%, preferably 90% identity with any of the synthetic sequences selected from SEQ ID NO: 1 to 6, or SEQ ID NO: 13 to 15, or their variants and fragments.

[0057] The dsRNA molecules described here comprise synthetic double-stranded RNA (dsRNA) sequences that act as inducers of the expression silencing mechanism of target genes with a corresponding sequence. These dsRNAs were obtained by cloning DNA fragments of the target genes into the pClone EZ vector, which is designed to contain two T7 promoters in opposite directions at the ends of the cloned fragments, thus allowing the transcription of two complementary RNA strands that will give rise to the dsRNA.

[0058] In another embodiment of the invention, the small interfering RNA (siRNA) molecules are derived from, modified by, or originating from the dsRNA molecules of the present invention.

[0059] In one embodiment of the invention, the compounds comprising at least one of the dsRNA molecules of the present invention do not have recombinant DNA and do not cause permanent modification of the genome of the plant in which they are used.

[0060] The compounds comprising the said dsRNA molecules of the present invention are used for spraying on crops, and can be applied alone or in combination with other existing technologies (such as chemical and biological pesticides, transgenic plants, among others), offering farmers a new sustainable tool, with a new mode of action, for the control and management of these insect pests.

[0061] Furthermore, the dsRNA molecules of the present invention can also be used to generate transgenic or edited plants via genome editing tools.

[0062] In another embodiment of the present invention, the method for obtaining dsRNA molecules comprises the steps of: a) cloning in a cloning vector with instructions for producing dsRNA for a target gene; b) producing via fermentation, in vitro transcription, chemical synthesis, biochemical synthesis, or a combination thereof, an unpurified dsRNA; c) purifying the obtained dsRNA molecules; d) formulating the dsRNA molecules with carrier compositions containing chitosans, liposomes, gelatins, carbon nanotubes, carbon nanoparticles, nanofibers, clays, metals, modified clays, adjuvants, pheromones, biopolymers, and others.

[0063] In one embodiment of the aforementioned method, the target gene is Trehalase II, which hydrolyzes the carbohydrate trehalose, releasing two glucose molecules. In another embodiment, the target gene is Trehalose Transporter II, which transports trehalose synthesized in adipocytes to other tissues requiring a carbon source, thus regulating trehalose levels in the hemolymph. In yet another embodiment of the invention, the target gene is Transcription Initiation Factor TFIID Subunit 1, a general factor. transcription that acts in the initiation of transcription. In a preferred embodiment, step a) comprises cloning into the cloning vector any of the synthetic sequences SEQ ID NO: 1 to 6, or SEQ ID NO: 13 to 15.

[0064] In some embodiments of the invention, step (b) of the above-described method is carried out via a transformation receptor such as fungi, yeast, algae, plants, or bacteria. More preferably, step (b) is carried out via any microorganism selected from the group consisting of: Picchia pastoris, Komagataella phaffii, Neurospora crassa, Saccharomyces cerevisae, Corynebacterium glutamicum, Aspergillus nidulans, Saccharomyces ssp., Bacillus ssp., Chlamydomonas reinhardtii, Nicotiana spp., Saccharum spp., Amaranthus spp.; E. coli, among others.

[0065] In a preferred embodiment of the invention, step (b) of the method described above, in vitro transcription of the dsRNA molecule of interest, is carried out via a host cell, preferably an E. coli bacterium of the HT1 15 (DE3) strain, transformed with the cloning vector from step (a), preferably the modified pClone EZ plasmid containing the sequences for the expression of the dsRNA of interest.

[0066] Another embodiment of the invention relates to a plasmid comprising the synthetic sequences of the Trehalase II, Trehalose Transporter II and Transcription Initiation Factor TFIID Subunit 1 genes, which encode dsRNA sequences for silencing genes of the brown stink bug (Euschistus heros) and / or green-bellied stink bug (Diceraeus melacanthus). In a preferred embodiment of the invention, the plasmid comprises the synthetic gene sequences as set forth in SEQ ID NO: 1 to 6.

[0067] In one embodiment of the present invention, the compounds comprising the dsRNA molecules as described herein can be used for the control of insect pests, preferably, the present invention discloses the method of controlling insect pests in an agricultural production system, which comprises: spraying the compound comprising at least one of the dsRNA molecules on the plant so that the insect pests come into contact with said dsRNA molecules. In a preferred embodiment of the invention, the method of controlling insect pests is carried out in a soybean-corn system. In a more preferred embodiment, the insect pest is a brown stink bug (Euschistus heros) or a green-bellied stink bug (Diceraeus melacanthus), or both.

[0068] The control of the pests Euschistus heros and Diceraeus melacanthus as described here presents great target specificity, high control efficiency and low environmental impact. EXAMPLES

[0069] The following examples, described in detail, serve to illustrate embodiments of the present invention without, however, having a limiting character to the scope of protection thereof. Obtaining dsRNA molecules

[0070] In vitro manipulation of the coding sequence (CDS) of three brown stink bug genes, identified below:

[0071] Gene 1: compound 001 - Trehalase II, acts in the hydrolysis of the carbohydrate trehalose, releasing two glucose molecules.

[0072] A 410-bp region was selected, starting at position 1385 of the CDS and ending at position 1795, and was used for in vitro transcription of double-stranded RNA (dsRNA) against the Trehalase II gene (dsTreha II). Below is the sequence of the region selected for expression of the synthetic gene, which encodes the dsRNA for silencing the Trehalase II gene of the brown stink bug and the green-bellied stink bug: SEQ ID NO:1 and SEQ ID NO:2: GGATGGAGATAAAGAAAAATTGTTCGTTGATATCAAATCAGCAGCGGAATCAGGATGGGA TTTCTCAACCAGGTGGTTTATACATAATGGCACTAACCATGGAAATATGTCTACTATCCAC ACTCGTTACATTATACCAGTGGATTTGAATGCACTACTACACAGCAATGCAAAAATACTGT CTAGTTGGTATAAAAAGTTTGGAAATAAAGATAAAGCTAAAAAATATGAATTACTATCAAAG GAAATTCTTGAAGGAATCGAAGAGATTCTATGGAATGATGAAGAAGGTATCTGGTTGGAC TATGATATTTTAAATGAAAACCAAGAAATTATTTCTATCTTCAAACTTTGTACCTTTCTGG ACAAAGTCGTACACATTTTCTTCAAAGCAAGCTGCAGCATTCG

[0073] Gene 2: compound 002 - Trehalose Transporter II, responsible for transporting trehalose synthesized in adipocytes to other tissues that require a carbon source, thus regulating trehalose levels in the hemolymph.

[0074] A 314 bp region was selected, starting at position 1268 to position 1582, which was used in the in vitro transcription of the double-stranded RNA (dsRNA) molecule against the Trehalose Transporter II (dsTreTran II) gene. Below is the sequence of the region selected for expression of the synthetic gene, which encodes dsRNA for silencing the Trehalose Transporter gene / / of the brown stink bug and the green-bellied stink bug: SEQ ID NO:3 and SEQ ID NO:4 CGAAAATGATTATGATAAAAAAGAAGTGAATTCACAGCTTTATAGTCCACCCCTGGATACA AATGAAGGAAGCAATAGTAATTCAGGAGGACTCTTTAAACATGCTTCGACACAATGTTTTT TTAACGATGTTATCGATAATGAAAAGGTAAAGAGTGGAGATAGAAGTGAAGCAGAGGAAC CAATGTTTAGATTTTTATTGAAACCTGAAATGTACAAGCCAACATTACTCATGCTAGTTTGC AGTTTCTTTGTTGTCGGACCTGGAGCTGACAGTATTTTAATTTATTTGAAGTTTTATTTGGA CGAATTTA

[0075] Gene 3: compound 003 - Transcription Initiation Factor TFIID Subunit 1, is a general transcription factor that acts in the initiation of transcription.

[0076] A 425 bp region was selected, starting at position 3696 to position 4121, which was used in the in vitro transcription of the double-stranded RNA (dsRNA) molecule against the Transcription Initiation Factor TFIID Subunit 1 (dsTAFT) gene. Below is the sequence of the region selected for expression of the synthetic gene, which encodes the dsRNA for the silencing of the Transcription Initiation Factor TFIID Subunit 1 gene of the brown stink bug and the green-bellied stink bug: SEQ ID NO:5 and SEQ ID NO:6 AATCAGCCTGGTCGTGTTTTGAAAATTTATAGGACCTTTAGGGATTCTGAAGGGAAAGAAT ACACTCGATCTGAGGTTGTTAGGAAGCCAGCGGTTATCGATATGTATTTAAAGATTAGGA ACACCAAGGACGAAGCGTTCATAAGACACTACGCAACTATGGACGATCAGCTCAAAGAG GAGATGAAACGGGAAAAGAGGAGGCTTCAAGAGCAGCTGAGGAGGCTAAAGAGAAATCA GGAACGAGAAAGAATCACCGGTGGTAGTAGTGGGCTATTTAATAAAACTCAGTCTCCTTT CTCTTTATTATCTACTCAAACTCTTGAAGGAGGTGAAACTAGAGATGGCTCACAATCTCCA ACACCGAAGTCTGGCTTCGTTAAGAATCGTCTACCTCCCCTCACTAACCCTACGACTCCT CCCAC Combinations of dsRNA molecules:

[0077] Below, sequences representing some of the possible combinations of the dsRNA molecules of the present invention: SEQ ID NO:13 AGGAGGACTCTTTAAACATGCTTCGACACAATGTTTTTTTAACGATGTATTCGATAATGAA AAGGTAAAGAGTGGAGATAGAAGTGAAGCAGAGGAACCAATGTTTAGATTTTGAAA CCTGAAATGTACAAGCCAACATTACTCATGCTAGTTTGCAGTTTCTTTGTTGTCGGACCTG GAGCTGACAGTAACCAGGTGGTTTATACATAATGGCACTAACCATGGAAATATGTCTACT GAATGCACTACTACACAGCAATGAAGGAAATTCTTGAAGGAATCGAAGAGATTCGGTATC TGGTTGGACTATGAGGGAAAGAATACACTCGATCTGAGGTTGTTAGGAAGCCAGCGGTTA TCGATATGTATTTAAAGATTAGGAACACCAAGGACGAAGCGTTCATAAGACACTACGCAA CTATGGACGATGAAACGGGAAAAGAGGGCTTCAAGAGCAGCTGAGGAGGCTAAAGAG GAATCACCGGTG SEQ ID NO:14 AGGGAAAGAATACACTCGATCTGAGGTTGTTAGGAAGCCAGCGGTTATCGATATGTATTT AAAGATTAGGAACACCAAGGACGAAGCGTTCATAAGACACTACGCAACTATGGACGATAG GAGGACTCTTTAAACATGCTTCGACACAATGTTTTTTTAACGATGTATTCGATAATGAAAA GGTAAAGAGTGGAGATAGAAGTGAAGCAGAGGAACCAATGTTTAGATTTTTATTGAAACC TGAAATGTACAAGCCAACATTACTCATGCTAGTTTGCAGTTTCTTTGTTGTCGGACCTGGA GCTGACAGTAACCAGGTGGTTTATACATAATGGCACTAACCATGGAAATATGTCTACTGAA TGCACTACTACACAGCAATGAAGGAAATTCTTGAAGGAATCGAAGAGATTCGGTATCTGG TTGGACTATGGAAACGGGAAAAGAGGGCTTCAAGAGCAGCTGAGGAGGCTAAAGAGG AATCACCGGTG SEQ ID NO:15 AACAGGTGGTTTATACATAATGGCACTAACCATGGAAATATGTCTACTGAATGCACTACT ACACAGCAATGAAGGAAATTCTTGAAGGAATCGAAGAGATTCGGTATCTGGTTGGACTAT GAGGGAAAGAATACACTCGATCTGAGGTTGTTAGGAAGCCAGCGGTTATCGATATGTATT TAAAGATTAGGAACACCAAGGACGAAGCGTTCATAAGACACTACGCAACTATGGACGATA GGAGGACTCTTTAAACATGCTTCGACACAATGTTTTTTTAACGATGTATTCGATAATGAAA AGGTAAAGAGTGGAGATAGAAGTGAAGCAGAGGAACCAATGTTTAGATTTTTATTGAAAC CTGAAATGTACAAGCCAACATTACTCATGCTAGTTTGCAGTTTCTTTGTTGTCGGACCTGG AGCTGACAGTGAAACGGGAAAAGAGGAGGCTTCAAGAGCAGCTGAGGAGGCTAAAGAG GAATCACCGGTG

[0078] The description of the bacteria and vector used to produce dsRNA, as well as other relevant information, are described in the table below (Table 1). Table 1. Elements used in the process of obtaining the compounds of the present invention. Modifications made to the transformation recipient organism - E. co / Z strain HT1 15 (DE3)

[0079] For the production of dsRNA molecules that make up the compounds of the present invention, gene cloning and heterologous expression techniques in E. coli bacteria, detailed below, were used.

[0080] A specific fragment of the target gene coding sequence was amplified by polymerase chain reaction (PCR) using complementary DNA (cDNA) from the brown stink bug. For PCR amplification, oligonucleotide primers were designed to add the recognition sequences of the restriction enzyme BsmBI to the ends of the amplified product, as shown in Table 2. Table 2. Oligonucleotide primers used in cloning target gene sequences in the modified pClone EZ vector. Oligo ID Sequence 5' - 3' TM (°C) Amplicon (bp) dsTreha-II F gggCGTCTCgcgaatGGAATCAGGATGGGATT 54 256 T (SEQ ID NO:7) dsTreha-ll R GggCGTCTCgagaccCCAACCAGATACCTTCT 54 TCA (SEQ ID NO:8) dsTreTran F GggCGTCTCgcgaatCACCCCTGGATACAAAT 54 219 G (SEQ ID NO:9) dsTreTran R GggCGTCTCgagaccCAGGTCCGACAACAAA 55 GA (SEQ ID NO:10) dsTAFI F GggCGTCTCgcgaatAATCAGCCTGGTCGTGT 56 425 TTT (SEQ ID NO:11 ) dsTAFI R GggCGTCTCgagaccGTGGGAGGAGTCGTAG 59 GGTT (SEQ ID NO:12) CGTCTC: BsmBI restriction enzyme recognition site.

[0081] After verification of specific amplification, both the PCR products and the modified pClone EZ vector, whose linear map containing the system for dsRNA production is shown in Figure 1 ac, were digested with the enzyme BsmBI and the digested products were subsequently ligated (Figure 1 - (a) to (d)). Then, the entire volume of the ligation reaction was used for the transformation of E. coll HT1 15 (DE3) cells (Timmons; Court; Fire, 2001) via heat shock. The E. coll HT1 15 strain was used for dsRNA production, since its RNase III activity is suppressed, allowing the accumulation of dsRNA within the cell without its degradation occurring. The bacterium E. coli HT1 15 also possesses the gene that encodes the RNA polymerase enzyme of bacteriophage T7, which is under the control of an IPTG-inducible promoter (Isopropyl pD-1-thiogalactopyranoside) (Figure 2).

[0082] The complete nucleotide sequence of the modified pClone EZ plasmid is shown in Figure 3 and as established in SEQ ID NO: 16, and the nucleotide sequence and protein of the Beta-Lactamase gene contained in the pClone EZ vector and which confers resistance to the antibiotic ampicillin is shown in Figures 4 and 5. The protein of the Beta-Lactamase gene is as established in SEQ ID NO: 17. The partial sequence of the fragment amplified with M13 primers is shown in Figure 1 c. The function and origin of the genetic elements present in the modified pClone EZ plasmid containing the dsRNA system inserted into E. coli HT115 (DE3) are shown in Table 3 below. Table 3. Location and function of the genetic elements present in the modified pClone EZ plasmid containing the system for the production of dsRNA of the present invention and which was inserted into the E. coli strain HT115 (DE3). Obtaining dsRNA molecules:

[0083] After transformation with the pClone EZ vector recombined with the DNA fragments of the target genes, the bacterial cells were used to produce pre-inoculums in 50 mL tubes containing 15 mL of TB medium (Terrific Broth, see Table 4) with the addition of the antibiotics tetracycline (12.5 pg / mL) and ampicillin (100 pg / mL) and incubated for 16 h at 37° C under shaking at 180 rpm. Table 4. Composition of the TB (Terrific Broth) medium, used in the fermentation process for dsRNA production. Medium Compounds Quantity Tryptone 12 g Yeast extract 24 g TB Glycerol 5 mL (Terrific Broth) Monopotassium phosphate 2.31 g Dipotassium phosphate 12.54 g Water 995 mL

[0084] After this period, it was centrifuged at 9000 xg for 5 min, the supernatant was discarded and the pellet with bacterial cells was resuspended in 5 mL of new nutrient medium and incubated for 15 min at 37°C.s C under shaking at 180 rpm. 2 mL of each pre-inoculum were inoculated for every 100 mL of TB medium in a 1 L Erlenmeyer flask and incubated at 37 s C under stirring at 180 rpm until reaching an OD6oo nm of 0.4. Then, the expression of dsRNAs was induced by the addition of 2.5 mL of the Lactose inducer (1 mM) and maintained under the same conditions mentioned above for another 1 h. Then, feedback was carried out every hour with the addition of nutrient medium containing ampicillin and lactose, the amount to be added was fractionated into 1 of the initial volume, for a period of 4 hours, totaling 6 hours of fermentation process.

[0085] Finally, the bacterial suspension was collected by centrifugation at 9000 xg for 5 min. The supernatant was discarded, and the bacterial pellet was used to obtain dsRNA molecules. The general scheme of the dsRNA molecule production process via bacterial fermentation is shown in Figure 6.

[0086] After production, the purification of dsRNA from compounds 001 to 003 of the present invention consisted of 3 steps: i) Extraction with Trizol; ii) Treatment with DNase I and RNAse A and iii) Purification with phenol:chloroform:isoamyl. The steps mentioned are detailed below: of the dsRNA molecules Extraction with Trizol

[0087] The cell wall and membrane of the bacteria contained in the pellets were dissolved by applying 800 μL of 0.1% SDS detergent in 1X PBS buffer, and the tubes were transferred to a 100°C water bath for 2 min to promote complete inactivation of the bacterial cells by completely disrupting the plasma membrane. Then, 800 μL of Trizol reagent (Invitrogen, Carlsbad, CA, USA) were added, and the tubes were incubated at room temperature for 5 min. Then, 200 μL of chloroform was added, and the tubes were incubated again at room temperature for 2 min, followed by centrifugation at 12,000 xg for 10 min. The supernatant was removed and transferred to a new tube, where 0.7 volume of isopropanol was added, incubated at room temperature for 10 min, and centrifuged again at 12,000 xg for 10 min. After these procedures, two washes with 75% ethanol followed, and the pellet was then completely dried in a speed vac and resuspended in 180 pl of nuclease-free water. Treatment with DNase and RNAse A

[0088] After the first extraction of nucleic acids including dsRNAs, the samples were subjected to treatment with TURBO™ DNase (Ambion) and RNase A (Invitrogen) to remove DNA from the parental microorganism and single-stranded RNA, as described by Ahn et al. (2019). The nucleic acids, including dsRNAs from the first extraction with Trizol, were diluted in 180 μL of water and treated with 2 μL of TURBO™ DNAse and 20 μL of RNAse A and incubated for 1 h at 37° C. After treatment, the purification step was performed with phenol:chloroform:isoamyl

[0089] After treatment with DNase and RNase, sample purification followed according to the protocol of Ahn et al. (2019). To each sample, 200 pL of phenol:chloroform:isoamyl (25:24:1) was added, and after vigorous shaking, centrifugation was followed at 12,000 xg for 15 min. The upper phase was transferred to another tube and then 100 pL of NH4OAc (7.5 M) and 100 pL of isopropanol were added, followed by further centrifugation at 12,000 xg for 45 min at 4 o C. This was followed by two washes with 70% ethanol and centrifugation at 12,000 xg for 10 min. The pellet was dried and resuspended in nuclease-free water.

[0090] The samples were quantified in Nanodrop and their quality and absence of other nucleic acids was verified by 1% agarose gel electrophoresis (Figure 7). Then, analyses were performed to verify the presence / absence of recombinant DNA in compounds 001, 002 and 003, using the following approaches: (a) Verification of the absence of live E. coli cells in the dsRNA solution (see Figures 8 to 14); (b) PCR analysis to prove the absence of recombinant DNA molecules (see Figures 15 to 18) and (c) Sequencing of the product after purification (see Figure 19). Proof of the absence of recombinant DNA molecules in the compounds, through the use of molecular methods

[0091] The analysis of the effectiveness of the purification process in eliminating any trace of bacteria and recombinant DNA in compounds 001, 002 and 003, after the production and purification process, was proven by three approaches: • verification of the absence of live E. coli cells in the dsRNA solution, by plating the compound solution on plates containing LB culture medium with the antibiotics tetracycline (12.5 pg / mL) and ampicillin (100 pg / mL); • PCR analysis to confirm the absence of recombinant DNA molecules and sequencing of the product after purification. Verification of the absence of live E. coli cells in the compounds

[0092] To analyze whether bacteria are detected in the dsRNA solution after the purification process, the final solution of the dsRNAs TAF1, Treha li and TreTran / / was plated on medium LB medium containing the antibiotic for the E. coli HT1 15 strain that is resistant to the antibiotic tetracycline. As a positive control, a solution of untransformed E. coli HT1 15 transformed with the pClone EZ vector containing the dsRNAs was plated before the purification process in LB medium containing the antibiotic tetracycline. As a negative control, a solution of untransformed E. coli HT1 15 was plated in LB medium containing the antibiotics tetracycline and ampicillin (resistance to the latter antibiotic is provided by transformation with the pClone EZ vector).

[0093] The results of this analysis show the total absence of bacteria in the final solution in the compounds of the present invention, as shown in Figures 8 to 14.

[0094] The results of the cultivation of the final dsRNA solution of the compounds of the present invention in petri dishes (Figures 8 to 14) confirmed the absence of live bacteria in the dsRNA solution after the purification process. Sequencing of compounds in the final dsRNA solution after purification

[0095] To investigate the specificity of the nucleotide sequences of the dsRNAs Treha II, TreTran II, and TAF1 contained in compounds 001, 002, and 003 of the present invention, Sanger sequencing of the cDNA synthesized from the final dsRNA solution was performed. Therefore, after purification and cDNA synthesis from the dsRNAs, the samples were subjected to sequencing using the BigDye® Terminator v3.1 kit (Thermo Fisher Scientific, Waltham, MA, USA) on an ABI PRISM Genetic Analyzer® 3100 automated sequencer (Applied Biosystems, Foster City, CA, USA). The sequencing results demonstrated the specificity of the nucleotide sequences of the dsRNAs Treha II, TreTran II, and TAF1 contained in the compounds of the present invention, as shown in Figure 19. Efficacy test - Bioassays Combined sequence test with part of dsTreTrans, dsTreha II, dsTAFI and dsDrei

[0096] Bioassay tests were performed to prove the effectiveness of the dsRNA molecules of the present invention.

[0097] In a first trial, the dsDrei sequence (dsTreTrans + dsTreha II + dsTAFT) was tested as follows: SEQ ID NO:13 AGGAGGACTCTTTAAACATGCTTCGACACAATGTTTTTTTAACGATGTTATCGATAATGAA AAGGTAAAGAGTGGAGATAGAAGTGAAGCAGAGGAACCAATGTTTAGATTTTTATTGAAA CCTGAAATGTACAAGCCAACATTACTCATGCTAGTTTGCAGTTTCTTTGTTGTCGGACCTG GAGCTGACAGTAACCAGGTGGTTTATACATAATGGCACTAACCATGGAAATATGTCTACT GAATGCACTACTACACAGCAATGAAGGAAATTCTTGAAGGAATCGAAGAGATTCGGTATC TGGTTGGACTATGAGGGAAAGAATACACTCGATCTGAGGTTGTTAGGAAGCCAGCGGTTA TCGATATGTATTTAAAGATTAGGAACACCAAGGACGAAGCGTTCATAAGACACTACGCAA CTATGGACGATGAAACGGGAAAAGAGGAGGCTTCAAGAGCAGCTGAGGAGGCTAAAGAG GAATCACCGGTG

[0098] The test was conducted using microinjection as the exposure method. The treatment consisted of:

[0099] 4 dsRNAs (dsDrei, dsTAFI, dsTreha li and dsTreTran) at a dose of 28 ng of dsRNA / mg of bedbug weight; 1 water (microinjection control); 1 control without microinjection (bedbug sample health control).

[0100] There are 4 replicates per treatment and 10 insects per replicate, that is, n=40.

[0101] After microinjection, the adult insects of each replicate were kept in Gerbox boxes (1 1x1 1x3.5 cm) with standard food for 20 days.

[0102] Mortality and oviposition were evaluated up to 20 days after application. ANOVA statistical analysis and Tukey mean comparison were used (P<0.05).

[0103] Just 48 h after microinjection with dsDrei, we observed mortality rates of over 80% and 90% in brown and green-bellied stink bugs, respectively. This action is similar to the shock effect of chemical insecticides, as shown in Figures 20 and 23.

[0104] In the brown stink bug, 15 days after microinjection with dsTAFI, we observed a mortality rate of 95% (Figure 20, 21).

[0105] In the brown stink bug, 15 days after microinjection with dsTreha II and TreTran II, we observed mortality of 65 and 70%, respectively (Figure 20, 21).

[0106] In the green-bellied stink bug, we observed an exclusive mortality of 90% on the second day after microinjection with dsDrei, indicating a specific effect of this molecule on the bug in question (Figure 23, 24).

[0107] Furthermore, the effect of dsRNA on oviposition is surprising and striking, as a drastic reduction in the number of eggs was observed for all dsRNAs tested. Therefore, microinjection of these dsRNAs not only caused significant mortality but also significantly reduced the population of survivors (Figures 22 and 25).

[0108] For the dsDrei naked spraying tests, spraying was carried out using a Potter tower (Burkard Manufacturing, Rickmansworth, Herts, England) calibrated at a pressure of 10 psi (68.95 kPa), using a volume of 2 mL of solution in each spray, obtaining an average deposition of wet residue of 1.50 mg / cm 2The tested treatments were: untreated control, 0.02 mg / L dsRNA aqueous solution, and 20 mg / L of naked dsDrei, with 4 replicates per treatment and 10 insects per replicate, n = 40. After spraying, adults were kept in Gerbox boxes (1 1 x 1 1 x 3.5 cm) with standard food for 7 days. Mortality assessments were performed daily until 7 days after spraying. The percentage mortality of brown and green-bellied stink bugs was calculated. Based on Figures 26 and 27, it was evident that the naked version of dsDrei tested presented mortality of approximately 50% for brown stink bugs and approximately 70% for green-bellied stink bugs, 7 days after spraying. Toxicity Tests

[0109] To evaluate the toxicity of the putative proteins generated by the dsRNAs of the present invention - compounds 001, 002 and 003 and the concatamer described herein, the ToxinPred2 software (https: / / webs.iiitd.edu.in / raghava / toxinpred2 / blast_action.php) was used. The ToxinPred2 software was developed to predict protein toxicity (Gupta et al., 2013; Sharma et al., 2022). This is the latest version of the software with an improved algorithm and expanded database.

[0110] The software was developed by researchers at the Bioinformatics Center of the CSIR - Institute of Microbial Technology, Chandigarh, India. It is expert in the field, as it is widely used in the literature for toxicity prediction. It uses a wide range of information and prediction techniques, including machine learning, BLAST, and MERCI. The models were trained on a large dataset containing 8,233 toxic and 8,233 non-toxic compounds.

[0111] The method was tested and evaluated on three curated SwissProt datasets. To provide an unbiased assessment, internal validation was performed on 80% of the data and external validation on the remaining 20%. The techniques used to predict protein toxicity are: (a) Similarity based on Basic Local Alignment Search Tool, (2) Motif-EmeRging with Class Identification based motif search and (3) Prediction Models.

[0112] Similarity- and motif-based techniques achieve a high probability of correct prediction with low sensitivity / coverage, while models based on machine learning techniques achieved balanced sensitivity and specificity with high accuracy. The algorithm uses a hybrid analysis method that combines all three approaches and achieves a maximum area under the receiver operating characteristic curve of approximately 0.99 with a Matthews correlation coefficient (MCC) of 0.91 in the validation dataset. Furthermore, the software uses models on alternative and realistic datasets. This method was developed to predict protein toxicity regardless of its source.

[0113] The results of the toxicity tests can be seen in tables 5 and 6 below: Table 5. Toxicity of hypothetical peptides generated by dsRNAs Treha II, TreTran II, and TAF1. Legend: T1 to T5 = peptides generated by dsRNA Treha II. TT1 to TT3 = peptides generated by dsRNA TreTran II. TF1 to TF3 = peptides generated by dsRNA TAF1. Table 6. Toxicity of hypothetical peptides generated by the dsRNA concatamer dsDrei of the present invention coconut SC2 No hits found Non-toxin SC3 No hits found Non-toxin SC4 No hits found Non-toxin SC5 No hits found Non-toxin Allergenicity Tests

[0114] It is well known that dsRNA sequences are not translated into proteins (Liu et al., 2015). This information reinforces the idea that dsRNA-based products are unlikely to elicit immune responses in humans or animals. This is corroborated by the observation that the immune response mechanism begins with protein antigens. The immune response mechanisms that trigger allergies are described in detail in articles published in Nature Medicine (Akdis, 2012) (Impact factor 87.241) and in Clinical and Experimental Allergy (Scheurer; Toda; Vieths, 2015) (Impact factor 5.018).

[0115] Briefly, the mechanisms involved include the perception of the allergen (5-100 kDa proteins) by specific memory T and B cells and the production of specific antibody isotypes to trigger the inflammatory immune response, as well as the activation, tissue migration, and degranulation of mast cells, basophils, and eosinophils, which will release reactive substances such as histamine. As mentioned above, most allergens are relatively small proteins or glycoproteins that are, in most cases, water-soluble (Akdis, 2012; Scheurer; Toda; Vieths, 2015).

[0116] Therefore, some intrinsic biochemical characteristics of the protein structure must be present to trigger immune responses, which does not apply to dsRNAs, as they are not translated into proteins. Furthermore, the allergic condition depends not only on the presence of the protein allergen but is also determined by additional factors, such as the amount and duration of exposure to the immune system (Akdis, 2012; Scheurer; Toda; Vieths, 2015). According to Das and Sherif (2020), the residual effect of an encapsulated dsRNA after application does not exceed 30 days, demonstrating a very short shelf life. However, dsRNA in its Naked version can be degraded in a matter of hours or minutes, depending on its composition, size, and environmental conditions to which it is exposed, such as solar radiation and temperature, which can further diminish its effect after application (Bachman et al., 2020).

[0117] Given the importance of protein structure in assessing allergenicity, according to the aforementioned authors, allergens are classified into structural groups. This approach facilitates the risk assessment of cross-reactivity. Cross-reactivity refers to the same allergic response triggered by different allergens but with very similar structural components. In other words, it occurs when the immune system reacts to proteins with similar sequences in the same way. Therefore, similarity between proteins can facilitate the identification of new allergens.

[0118] Because allergenicity is a complex and dynamic topic, it is constantly under study. Data obtained are updated annually, compiled, and deposited in several specific databases, facilitating access to information regarding allergenicity and cross-reactivity between proteins from different species. Although several databases exist to assess whether a protein may or may not be potentially allergenic, some are more robust and curated than others.

[0119] Among the most reliable databases are AHergenOnline (Sircar et al., 2014) and AllerTOP v2.0 (Dimitrov et al., 2013). AHergenOnline is considered by researchers at the Swiss Institute of Allergy and Asthma Research (SIAF), an institute associated with the University of Zurich, Switzerland, to be one of the leading allergen banks available (Sircar et al., 2014). SIAF is a member of national and international organizations, such as the European Academy of Allergy and Clinical Immunology (EAACI). SIAF focuses on human immunology and patient-relevant cell biology, with a number of research projects on immune regulatory aspects and, particularly, allergen tolerance, regulation of cell and tissue barriers, methods for detecting tissue barriers, regulatory aspects of non-coding DNA, and vaccine development.

[0120] The AHergenOnline database provides access to a peer-reviewed allergen list and a searchable sequence database for the identification of proteins that may present a potential risk of allergen cross-reactivity. It contains 2,233 allergen sequences from 912 taxonomic groups and is updated annually. This database was developed to aid in the safety assessment of proteins that may be introduced into foods through genetic engineering or food processing methods. The goal is to identify proteins that may require additional testing, such as serum IgE binding, histamine release by basophils, or in vivo challenge to assess potential cross-reactivity.

[0121] The second highly robust database used to double-check the allergenicity assessment of sequences was AllerTOP v. 2.0 (2013). This second database uses a method based on the automatic cross-covariance transformation (ACC) of protein sequences into uniform vectors of equal length. ACC is a protein sequence mining method developed by Wold et al. (1993). It has been applied to quantitative structure-activity relationship (QSAR) studies of peptides of different lengths. In this database, the main properties of amino acids are represented by five descriptors, originally derived from Venkatarajan and Braun (2001).

[0122] The descriptors used are: amino acid hydrophobicity, molecular size, helix formation propensity, relative amino acid abundance, and p-strand formation propensity. Furthermore, proteins are classified using the k-nearest neighbor algorithm (kNN, k=1) based on a training set containing 2427 known allergens from different species.

[0123] Although dsRNAs are not translated into proteins as previously mentioned, an in-depth study was conducted on the potential allergenicity of putative proteins that could be generated from the dsRNA sequences of the present invention. The proteins were evaluated from the two aforementioned libraries.

[0124] Tables 7 and 8 below show the results of the allergenicity tests. Table 7. Allergenicity of hypothetical peptides generated by dsRNAs Treha II, TreTran II and TAF1. Legend: CR = cross-reactivity. T1 to T5 = peptides generated by dsRNA Treha II. TT1 to TT3 = peptides generated by dsRNA TreTran II. TF1 to TF3 = peptides generated by dsRNA TAF1. Table 8. Allergenicity of hypothetical peptides generated by concatamer dsRNA - dsDrei. Legend: % identity in relation to protein sequences considered allergens in the evaluated banks

[0125] It is clear from the data mentioned above that the dsRNAs related to compounds 001, 002 and 003 and to the concatamer of the present invention do not present allergenicity and toxicity, being in accordance with the CODEX Alimentarius (2003) guidelines.

[0126] It should be understood that the embodiments described above are merely illustrative and that various modifications may be made by a person skilled in the art to them without departing from the scope of the present invention. Consequently, the present invention should not be considered limited to the exemplary embodiments described in this application. Furthermore, the present disclosure may include subject matter not claimed in currently, but which may be claimed in the future in combination with or separately from the features now claimed.

Claims

CLAIMS 1. dsRNA molecules characterized by the fact that they contain synthetic sequences for the expression of dsRNAs that activate the silencing of the transcripts of the genes selected from Trehalase II (Trehall), Trehalose Transporter II (TreTran II), Transcription Initiation Factor TFIID Subunit 1 (TAF1) or at least one concatamer comprising a combination between said sequences.

2. dsRNA molecules according to claim 1, characterized in that they are defined according to: synthetic sequences for expression of dsRNAs with at least 50%, 60%, 70%, 80%, preferably 90% identity with any of the synthetic sequences selected from SEQ ID NO: 1 to 6, or SEQ ID NO: 13 to 15 or their variants and fragments.

3. Small interfering RNA (siRNA) molecules characterized by the fact that they are derived, modified or originating from the dsRNA molecules as defined in any one of claims 1 to 2.

4. Compound characterized by the fact that it comprises at least one dsRNA molecule as defined in any one of claims 1 to 2.

5. Method of obtaining dsRNA molecules characterized by the fact that it comprises the steps of: a. cloning in a cloning vector with instructions for producing dsRNA for a target gene; b. producing via fermentation, in vitro transcription, chemical synthesis, biochemical synthesis or a combination of them an unpurified dsRNA; c. purifying the obtained dsRNA molecules.

6. Method for obtaining dsRNA molecules according to claim 5, characterized in that step (a) comprises cloning into the cloning vector the synthetic sequences for the expression of dsRNAs that activate the silencing of the transcripts of the Trehalase II (Trehall), Trehalose Transporter II (TreTran II) and Transcription Initiation Factor TFIID Subunit 1 (TAF1) genes or at least one concatamer comprising a combination of said sequences.

7. Method for obtaining dsRNA molecules according to any one of claims 5 to 6, characterized in that step (a) comprises cloning into the cloning vector any one of the synthetic sequences selected from SEQ ID NO: 1 to 6, or SEQ ID NO: 13 to 15.

8. Plasmid characterized by the fact that it comprises at least one of the synthetic sequences of the genes that encode dsRNA sequences for the silencing of target genes of insect pests.

9. Plasmid according to claim 8, characterized in that it comprises at least one of the synthetic sequences of the Trehalase II, Trehalose Transporter II, Transcription Initiation Factor TFIID Subunit 1 genes, which encode dsRNA sequences for silencing genes of the brown stink bug (Euschistus heros) and / or green-bellied stink bug (Diceraeus melacanthus).

10. Plasmid according to any one of claims 8 to 9, characterized in that it comprises the synthetic gene sequences as set out in SEQ ID NO: 1 to 6.

11. Plasmid according to any one of claims 8 to 10, characterized in that it comprises SEQ ID NO:

16.

12. Host cell characterized by the fact that it comprises the plasmid as defined in any one of claims 8 to 11.

13. Host cell according to claim 12, characterized in that said cell is from a bacterium.

14. Method of controlling pests in an agricultural production system characterized by the fact that it comprises spraying the compound as defined in claim 4 on the insect pests so that they come into contact with at least one of said dsRNA molecules as defined in any one of claims 1 to 2.

15. Method according to claim 14, characterized in that the agricultural production system is the soybean-corn production system.

16. Method according to claims 14 to 15, characterized in that the insect pest is a brown stink bug (Euschistus heros) or a green-bellied stink bug (Diceraeus melacanthus) or both.

Citation Information

Patent Citations

  • Improvements in or relating to gene silencing

    WO2018046312A2