Nucleic acid molecule for nucleic acid detection, detection product, and method
By designing a sensitizing ligation area in the CRISPR detection system to connect the nucleic acid region marked with a marker, combining the stem ring structure and specific nucleic acid region, the problems of low sensitivity and long time in traditional CRISPR detection are solved, and efficient nucleic acid detection is achieved.
Patent Information
- Application Number
- PCT/CN2024/143577
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-30
- Filing Date
- 2024-12-30
- Publication Date
- 2025-07-03
AI Technical Summary
The traditional CRISPR detection system has low sensitivity and a long detection time, making it difficult to meet the needs of fast and efficient nucleic acid detection.
A nucleic acid molecule is designed to connect the first nucleic acid region labeled with the marker to the second nucleic acid region through the sensitization linkage region to form a double-strand structure that does not form complementary pairing. The cleavage characteristics of the Cas protein are used to achieve hypersensitive detection of nucleic acids, and the stem loop structure region and specific nucleic acid region are combined to improve detection efficiency.
It significantly improves the sensitivity of nucleic acid detection and shortens the detection time, achieving faster and more efficient nucleic acid detection.
Smart Images

Figure PCTCN2024143577-FTAPPB-I100001 
Figure PCTCN2024143577-FTAPPB-I100002 
Figure PCTCN2024143577-FTAPPB-I100003
Abstract
Description
Nucleic acid molecules, detection products and methods for nucleic acid detection
[0001] Related applications
[0002] This application claims priority to Chinese patent application No. 2023118663501, filed on December 30, 2023, entitled “Nucleic Acid Molecules, Detection Products and Methods for Nucleic Acid Detection,” the entire text of which is hereby incorporated by reference. Technical Field
[0003] The present application relates to the field of biological detection technology, and specifically to a nucleic acid molecule, a nucleic acid detection product and a method for nucleic acid detection. Background Art
[0004] CRISPR technology is used in molecular diagnostics primarily due to its specificity: guided by guide RNA, CRISPR-Cas proteins recognize target sequences with exceptional specificity, even accurately distinguishing single-base differences. Furthermore, upon contact with the target sequence, the Cas protein activates its indiscriminate trans-cleavage activity, efficiently cleaving all surrounding cleavable nucleic acid sequences, thereby amplifying the signal.
[0005] The traditional gene editing CRISPR system includes cas enzyme, crRNA, reporter probe, reaction buffer, etc. Among them, crRNA includes a guide RNA sequence and a target RNA sequence, and the reporter probe is independent of the crRNA.
[0006] The sensitivity of traditional CRISPR detection systems needs to be improved, and the detection time needs to be further shortened. Summary of the Invention
[0007] Based on this, according to various embodiments of the present application, a nucleic acid molecule for nucleic acid detection is provided, which couples one or more first nucleic acid regions labeled with markers to a second nucleic acid region through a sensitization linker region to achieve ultrasensitive detection of nucleic acids.
[0008] The specific technical solutions are as follows:
[0009] A nucleic acid molecule for nucleic acid detection is formed by connecting a first nucleic acid region labeled with a marker to a second nucleic acid region via a sensitization linker region;
[0010] The first nucleic acid region is a single-stranded nucleic acid to be cleaved; wherein the single-stranded nucleic acid to be cleaved presents different detection states when cleaved and not cleaved by the Cas protein, thereby being detected;
[0011] The second nucleic acid region includes a stem-loop structure region and a specific nucleic acid region that binds to the target nucleic acid; wherein the stem-loop structure region is a nucleic acid that can guide the Cas protein to specifically bind to the target nucleic acid;
[0012] The sensitization linking region includes a chemical bond, a ligand-receptor system, and a compound containing a phosphate group, a hydroxyl group, and / or an amino group;
[0013] The first nucleic acid region and the second nucleic acid region do not form a double-stranded structure region of complementary pairing.
[0014] In one embodiment, from the 5' end to the 3' end, the nucleic acid molecule has at least one of the following structural formulas:
[0015] First nucleic acid region-sensitization linking region-second nucleic acid region formula I,
[0016] The second nucleic acid region-sensitization linking region-first nucleic acid region formula II.
[0017] In one embodiment, each of the second nucleic acid regions is connected to at least one of the first nucleic acid regions.
[0018] In one embodiment,
[0019] The chemical bond comprises a phosphodiester bond, the ligand-receptor system comprises at least one of streptavidin-biotin and antigen-antibody, and the compound containing a phosphate group, a hydroxyl group, and / or an amino group comprises a hydroxyl-polyethylene glycol-phosphate group. When the sensitization linking region is different, the number of first nucleic acid regions connected thereto is different.
[0020] In one embodiment, the length of the single-stranded nucleic acid to be cut is 3 bp to 30 bp.
[0021] Optionally, the single-stranded nucleic acid to be cleaved is single-stranded DNA or single-stranded RNA.
[0022] Optionally, the bases of the single-stranded DNA include A and T.
[0023] Optionally, the base of the single-stranded RNA includes U.
[0024] In one embodiment, the label comprises a fluorescent group and a quencher group; or,
[0025] The label includes one of the ligand-receptor members and further includes a fluorescent group or a quenching group.
[0026] Optionally, the fluorescent group includes any one of FAM, HEX, TET, NED, ROX, CY5, CY3, TFAM and VIC.
[0027] Optionally, the quenching group includes any one of BHQ1, TAMRA, Dabcyl, Eclipse and NFQ-MGB.
[0028] Optionally, one of the ligand-receptor members comprises one of digoxin-anti-digoxin antibody, or one of biotin-streptavidin.
[0029] Optionally, the label is coupled to the 3' end and the 5' end of the single-stranded nucleic acid to be cleaved.
[0030] Optionally, different labels are coupled to different positions on the single-stranded nucleic acid to be cleaved.
[0031] A product for nucleic acid detection, comprising a CRISPR detection reagent, wherein the CRISPR detection reagent comprises n nucleic acid molecules, where n is a positive integer greater than or equal to 1.
[0032] In one embodiment, from the 5' end to the 3' end, the nucleic acid molecule is selected from at least one of the following groups:
[0033] The nucleic acid molecule comprises a first nucleic acid region-a phosphodiester bond-a second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group and the 3' end is labeled with a quenching group;
[0034] The nucleic acid molecule comprises a first nucleic acid region-a phosphodiester bond-a second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a quencher group and the 3' end is labeled with a fluorescent group;
[0035] The nucleic acid molecule comprises a second nucleic acid region-a phosphodiester bond-a first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a quencher group and the 3' end is labeled with a fluorescent group;
[0036] The nucleic acid molecule comprises a second nucleic acid region-a phosphodiester bond-a first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group and the 3' end is labeled with a quenching group;
[0037] The nucleic acid molecule includes a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) 3, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group and the 3' end is labeled with a quenching group;
[0038] The nucleic acid molecule includes a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) 3, wherein the 5' end of the first nucleic acid region is labeled with a quencher group and the 3' end is labeled with a fluorescent group;
[0039] The nucleic acid molecule comprises a first nucleic acid region-phosphodiester bond-second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members, and the 3' end is labeled with a fluorescent group or a quenching group;
[0040] The nucleic acid molecule comprises a first nucleic acid region-phosphodiester bond-second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3' end is labeled with one of the ligand-receptor members;
[0041] The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3' end is labeled with one of the ligand-receptor members;
[0042] The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3' end is labeled with a fluorescent group or a quenching group;
[0043] The nucleic acid molecule includes a second nucleic acid region-biotin-streptavidin-(first nucleic acid region) 3, wherein the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3' end is labeled with a fluorescent group or a quenching group;
[0044] The nucleic acid molecule comprises a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) n , n is a positive integer and 1≤n≤3, the 5' end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3' end is labeled with one of the ligand-receptor members;
[0045] The nucleic acid molecule comprises a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) n , n is a positive integer and 1≤n≤3, the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members, and the 3' end is labeled with a fluorescent group or a quenching group.
[0046] In one embodiment, the CRISPR detection reagent further comprises a Cas protein, wherein the Cas protein has a bypass single-stranded nucleic acid cleavage function;
[0047] Optionally, the Cas protein includes Cas12 and / or Cas13;
[0048] Optionally, the Cas12 includes at least one of Cas12a, Cas12b and Cas12c;
[0049] Optionally, the Cas13 includes Cas13a and / or Cas13b.
[0050] In one embodiment, the CRISPR detection reagent further comprises one or more of NTP MIX, RNase inhibitor, RNA polymerase, HEPES, MgCl2 and a buffer for CRISPR detection.
[0051] In one embodiment, the product further comprises a constant temperature amplification reagent.
[0052] Optionally, the isothermal amplification reagent includes amplification primers.
[0053] Optionally, the amplification primers include at least one of the following primer pairs:
[0054] Primer pair SEQ ID NO: 1-2, primer pair SEQ ID NO: 2 and SEQ ID NO: 12, primer pair SEQ ID NO: 24-25, primer pair SEQ ID NO: 25 and SEQ ID NO: 36.
[0055] In one embodiment, the isothermal amplification reagent is amplified using any one of the following methods:
[0056] Recombinase isothermal amplification, loop-mediated isothermal amplification, cross-primer isothermal amplification, rolling circle amplification, strand displacement amplification, and helicase-dependent amplification.
[0057] In one embodiment, the product further comprises a test strip, the test strip comprising a sample pad, a conjugation pad, a reaction membrane and an absorption pad, wherein the reaction membrane is provided with a detection line and a quality inspection line;
[0058] Wherein, the detection line is coated with another of the ligand-receptor members; the binding pad is coated with colloidal gold labeled with anti-fluorescent group antibody and / or colloidal gold labeled with anti-quenching group antibody; the quality control line is coated with a secondary antibody of anti-fluorescent group antibody and / or a secondary antibody of anti-quenching group antibody.
[0059] A detection system for nucleic acid detection, comprising n nucleic acid molecules, where n is a positive integer greater than or equal to 1.
[0060] n is a positive integer of n≥2. In the same detection system, the fluorescent groups or ligand-receptor members in the n nucleic acid molecules are different from each other.
[0061] The detection system also includes the Cas protein in the product.
[0062] A method for detecting target nucleic acids in a sample uses the nucleic acid molecule, the product or the detection system to detect one or more target nucleic acids in the sample.
[0063] Optionally, the target nucleic acid comprises one or more of KPC and RP.
[0064] Optionally, the target nucleic acid includes one or more of DNA and RNA.
[0065] The target nucleic acid in the sample is detected by fluorescence or immunochromatography.
[0066] The details of one or more embodiments of the present application are set forth in the description below, and other features, objects, and advantages of the application will become apparent from the description and from the claims thereof. BRIEF DESCRIPTION OF THE DRAWINGS
[0067] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the conventional technology, the following briefly introduces the drawings required for use in the embodiments or the conventional technology descriptions. Obviously, the drawings described below are merely embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on the disclosed drawings without any creative work.
[0068] Figure 1 is a diagram of the KPC target cas12 system (fluorescence method)-crRNA design method in Example 1;
[0069] Figure 2 is a comparison of the results of different designs of the KPC target cas12 system (fluorescence method)-crRNA in Example 1, where 100 is 100 ng and NTC is a negative control; abscissa: Cycles, ordinate: Fluorescence;
[0070] Figure 3 is a diagram of the KPC target cas13 system (chromatography)-crRNA design method in Example 2;
[0071] Figure 4 is a comparison of the results of different designs of the KPC target cas13 system (chromatography)-crRNA in Example 2, where 100 is 100 copies and NTC is a negative control;
[0072] Figure 5 is a comparison of different crRNA design methods for the RP target cas12 system (fluorescence method) in Example 3, where 100 is 100 ng and NTC is a negative control; abscissa: Cycles, ordinate: Fluorescence;
[0073] Figure 6 is a comparison of the results of different designs of the RP target cas13 system (chromatography)-crRNA in Example 4, where 100 is 100 copies and NTC is a negative control;
[0074] FIG7 is a graph comparing the results of the KPC / RP dual-target - common two-step dual detection (fluorescence method) and the dual detection (fluorescence method) in Example 5 of the present application, wherein 100 is 100 ng, NTC is the negative control; abscissa: cycles, ordinate: fluorescence;
[0075] Figure 8 is a comparison of the results of the KPC / RP dual-target-common two-step dual detection (chromatographic method) and the dual detection (chromatographic method) in Example 6 of the present application, where 100 is 100 copies and NTC is a negative control. DETAILED DESCRIPTION
[0076] The following will be combined with the drawings in the embodiments of this application to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.
[0077] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application.
[0078] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0079] One embodiment of the present application provides a nucleic acid molecule for nucleic acid detection, which is formed by connecting a first nucleic acid region marked with a marker to a second nucleic acid region through a sensitization connection region; the first nucleic acid region and the second nucleic acid region do not form a double-stranded structure region with complementary pairing.
[0080] In a specific example, the first nucleic acid region is a single-stranded nucleic acid to be cut; wherein, the single-stranded nucleic acid to be cut presents different detection states when it is cut by the Cas protein and when it is not cut, and is thus detected.
[0081] In a specific example, the second nucleic acid region includes a stem-loop structure region and a specific nucleic acid region that binds to the target nucleic acid; the stem-loop structure region is a nucleic acid that can guide the Cas protein to specifically bind to the target nucleic acid.
[0082] Specifically, the second nucleic acid region, from the 5' end to the 3' end, includes a stem-loop structure region and a specific nucleic acid region that binds to the target nucleic acid.
[0083] In a specific example, the sensitization linking region includes a chemical bond, a ligand-receptor system, a compound containing a phosphate group, and a hydroxyl and / or amino group.
[0084] Optionally, the chemical bond comprises a phosphodiester bond.
[0085] Alternatively, the ligand-receptor system comprises streptavidin-biotin and / or antigen-antibody.
[0086] Optionally, the compound containing a phosphate group and containing a hydroxyl group and / or an amino group includes a hydroxy-polyethylene glycol-phosphate group.
[0087] In a specific example, from the 5' end to the 3' end, the nucleic acid molecule has at least one of the following structural formulas:
[0088] First nucleic acid region-sensitization linking region-second nucleic acid region formula I,
[0089] The second nucleic acid region-sensitization linking region-first nucleic acid region formula II.
[0090] In a preferred specific example, from the 5' end to the 3' end, the structural formula of the nucleic acid molecule is: second nucleic acid region-sensitization linking region-first nucleic acid region (Formula II). When the first nucleic acid region labeled with a marker is connected to the 3' end of the second nucleic acid region through the sensitivity-enhancing linking region, the sensitivity of nucleic acid detection is higher.
[0091] In one specific example, a first nucleic acid region labeled with a marker is linked to a second nucleic acid region via a sensitization linker in a 1:n ratio, where n ≥ 1. Changing the number of n is achieved by changing the sensitization linker. For example, when the sensitization linker is streptavidin-biotin or hydroxy-polyethylene glycol-phosphate, 1 ≤ n ≤ 3, and each second nucleic acid region is linked to 1 to 3 first nucleic acid regions labeled with a marker. The sensitization linker can achieve rapid aggregation and cleavage of nucleic acid reporter molecules.
[0092] In a preferred embodiment, the first nucleic acid region labeled with a marker is linked to the 3' end of the second nucleic acid region via streptavidin-biotin or hydroxy-polyethylene glycol-phosphate group.
[0093] In a specific example, the first nucleic acid region labeled with a marker includes a single-stranded nucleic acid fragment to be cut that is labeled with a marker.
[0094] In a specific example, the length of the single-stranded nucleic acid to be cut is 3bp to 30bp. Optionally, the length of the single-stranded nucleic acid to be cut is 3bp, 5bp, 8bp, 10bp, 15bp, 20bp, 25bp, 30bp, or a range consisting of two arbitrary values.
[0095] In a specific example, the single-stranded nucleic acid fragment to be cleaved includes single-stranded DNA and / or single-stranded RNA.
[0096] In a specific example, the single-stranded nucleic acid fragment to be cleaved is single-stranded DNA, and the detection signal is generated based on the cleavage of the DNA.
[0097] Optionally, the bases of the single-stranded DNA include A and T, and an exemplary single-stranded nucleic acid fragment to be cleaved includes TTATT.
[0098] In a specific example, the single-stranded nucleic acid fragment to be cleaved is single-stranded RNA, and the detection signal is generated based on the cleavage of the RNA.
[0099] Optionally, the base of the single-stranded RNA includes U, and exemplary single-stranded nucleic acid fragments to be cleaved include UUUUUUUUUUUUUUUUUUUU. A T base can also be attached to either end of the single-stranded RNA to facilitate labeling of the marker;
[0100] In one embodiment, the label includes a fluorescent group and a quencher group.
[0101] In one embodiment, the label includes one of the ligand-receptor members and further includes a fluorescent group or a quencher group.
[0102] In a specific example, the fluorescent group includes any one of FAM, HEX, TET, NED, ROX, CY5, CY3, TFAM and VIC.
[0103] In a specific example, the quencher group includes any one of BHQ1, TAMRA, Dabcyl, Eclipse, and NFQ-MGB.
[0104] Optionally, one of the ligand-receptor members includes one of digoxigenin (DIG) / anti-digoxigenin antibody, or one of biotin (BIO) / streptavidin (SA).
[0105] In a specific example, the marker can be labeled on the 3' end and the 5' end of the single-stranded nucleic acid fragment to be cut. Optionally, different markers are labeled at different positions on the single-stranded nucleic acid fragment to be cut. For example, the fluorescent group is labeled on the 3' end of the single-stranded nucleic acid fragment to be cut, and the quencher group is labeled on the 5' end of the single-stranded nucleic acid fragment to be cut; or, the fluorescent group is labeled on the 5' end of the single-stranded nucleic acid fragment to be cut, and the quencher group is labeled on the 3' end of the single-stranded nucleic acid fragment to be cut. For another example, one of the ligand-receptor members is labeled on the 3' end of the single-stranded nucleic acid fragment to be cut, and the quencher group or the fluorescent group is labeled on the 5' end of the single-stranded nucleic acid fragment to be cut; or, the quencher group or the fluorescent group is labeled on the 5' end of the single-stranded nucleic acid fragment to be cut, and one of the ligand-receptor members is labeled on the 3' end of the single-stranded nucleic acid fragment to be cut.
[0106] One embodiment of the present application provides a product for nucleic acid detection, including a CRISPR detection reagent, wherein the CRISPR detection reagent includes n types of the above-mentioned nucleic acid molecules, where n is a positive integer of n≥1.
[0107] In a specific example, from the 5' end to the 3' end, the nucleic acid molecule is selected from at least one of the following groups:
[0108] The nucleic acid molecule comprises a first nucleic acid region-a phosphodiester bond-a second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group and the 3' end is labeled with a quenching group;
[0109] The nucleic acid molecule comprises a first nucleic acid region-a phosphodiester bond-a second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a quencher group and the 3' end is labeled with a fluorescent group;
[0110] The nucleic acid molecule comprises a second nucleic acid region-a phosphodiester bond-a first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a quencher group and the 3' end is labeled with a fluorescent group;
[0111] The nucleic acid molecule comprises a second nucleic acid region-a phosphodiester bond-a first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group and the 3' end is labeled with a quenching group;
[0112] The nucleic acid molecule includes a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) 3, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group and the 3' end is labeled with a quenching group;
[0113] The nucleic acid molecule includes a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) 3, wherein the 5' end of the first nucleic acid region is labeled with a quencher group and the 3' end is labeled with a fluorescent group;
[0114] The nucleic acid molecule comprises a first nucleic acid region-phosphodiester bond-second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members, and the 3' end is labeled with a fluorescent group or a quenching group;
[0115] The nucleic acid molecule comprises a first nucleic acid region-a phosphodiester bond-a second nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3' end is labeled with one of the ligand-receptor members;
[0116] The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3' end is labeled with one of the ligand-receptor members;
[0117] The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3' end is labeled with a fluorescent group or a quenching group;
[0118] The nucleic acid molecule includes a second nucleic acid region-biotin-streptavidin-(first nucleic acid region) 3, wherein the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3' end is labeled with a fluorescent group or a quenching group;
[0119] The nucleic acid molecule comprises a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) n , n is a positive integer and 1≤n≤3, the 5' end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3' end is labeled with one of the ligand-receptor members;
[0120] The nucleic acid molecule comprises a second nucleic acid region-hydroxyl-polyethylene glycol-phosphate-(first nucleic acid region) n , n is a positive integer and 1≤n≤3, the 5' end of the first nucleic acid region is labeled with one of the ligand-receptor members, and the 3' end is labeled with a fluorescent group or a quenching group.
[0121] In a specific example, the working concentration of the nucleic acid molecule can be 0.5 μM-2.5 μM.
[0122] In a specific example, the nucleic acid detection product includes reagents, kits and systems.
[0123] In one specific example, the CRISPR detection reagent further includes a Cas protein, wherein the Cas protein has a bypass single-stranded nucleic acid cleavage function. Optionally, the Cas protein includes Cas12 and / or Cas13; alternatively, Cas12 includes at least one of Cas12a, Cas12b, and Cas12c. Alternatively, Cas13 includes Cas13a and / or Cas13b.
[0124] In a specific example, the CRISPR detection reagent further includes one or more of NTP Mix (a mixture comprising rATP, rCTP, rGTP, and rUTP), an RNase inhibitor, an RNA polymerase, HEPES, MgCl2, and a buffer for CRISPR detection.
[0125] In one specific example, the CRISPR detection reagent includes a nucleic acid molecule, Cas12, and a buffer for CRISPR detection.
[0126] In a specific example, the CRISPR detection reagent includes a nucleic acid molecule, Cas13, NTP Mix, an RNase inhibitor, an RNA polymerase, and HEPES.
[0127] In one specific example, the product also includes isothermal amplification reagents.
[0128] In a specific example, the isothermal amplification reagent is amplified using any one of the following methods:
[0129] Recombinase isothermal amplification, loop-mediated isothermal amplification, cross-primer isothermal amplification, rolling circle amplification, strand displacement amplification, and helicase-dependent amplification.
[0130] In a specific example, recombinase isothermal amplification includes recombinase polymerase amplification (RPA) and recombinase-mediated isothermal nucleic acid amplification (RAA).
[0131] In a specific example, the isothermal amplification reagent includes at least one of an amplification primer, a buffer of the isothermal amplification system, a recombinase, a single-stranded DNA binding protein, and a strand-displacing DNA polymerase.
[0132] In one specific example, the product further includes a test strip, which includes a sample pad, a conjugate pad, a reaction membrane, and an absorption pad. The reaction membrane is provided with a detection line and a quality control line; the detection line is coated with another ligand-receptor member; the conjugate pad is coated with a signal substance labeled with an anti-fluorescent group antibody and / or an anti-quenching group antibody; and the quality control line is coated with a secondary antibody for the anti-fluorescent group antibody and / or a secondary antibody for the anti-quenching group antibody. Optionally, the signal substance includes colloidal gold. Optionally, there can be multiple detection lines, and different detection lines are coated with different ligand-receptor members.
[0133] One embodiment of the present application further provides a detection system for nucleic acid detection, which includes n types of the above-mentioned nucleic acid molecules, where n is a positive integer of n≥1.
[0134] In a specific example, n≥2, where n is a positive integer; in the same detection system, the fluorescent groups or ligand-receptor members in n nucleic acid molecules are different from each other, thereby different target nucleic acids can be distinguished and detected.
[0135] In a specific example, the detection system also includes the Cas protein in the above-mentioned product and other CRISPR detection reagents.
[0136] One embodiment of the present application also provides a method for detecting target nucleic acids in a sample. This method is more sensitive, simple to operate, and has a short detection time. The above-mentioned nucleic acid molecules, the above-mentioned products, or the above-mentioned detection system are used to detect one or more target nucleic acids in a sample.
[0137] Optionally, the target nucleic acid includes one or more of KPC (Klebsiella Pneumoniae Carbapenemase) and RP (ribonuclease P).
[0138] Optionally, the target nucleic acid comprises DNA and / or RNA.
[0139] In one specific example, the target nucleic acid in the sample is detected using a fluorescence method or an immunochromatographic method.
[0140] If the nucleic acid molecule is cut by the Cas protein, it means that the corresponding target nucleic acid exists in the sample; if the nucleic acid molecule is not cut by the Cas protein, it means that the corresponding target nucleic acid does not exist in the sample.
[0141] In a specific example, when the target nucleic acid is KPC and / or RP,
[0142] The isothermal amplification primers include at least one of the following primer pairs:
[0143] Primer pairs for amplifying KPC: primer pairs as shown in SEQ ID NO: 1 to SEQ ID NO: 2, primer pairs as shown in SEQ ID NO: 2 and SEQ ID NO: 12; and / or,
[0144] Primer pairs for amplifying RP: the primer pairs are shown in SEQ ID NO:24 to SEQ ID NO:25, and the primer pairs are shown in SEQ ID NO:25 and SEQ ID NO:36.
[0145] Optionally, the working concentration of each amplification primer is 0.1 μM to 0.3 μM.
[0146] In a specific example, when the target nucleic acid is KPC and / or RP,
[0147] In the nucleic acid molecule, the stem-loop structure region of the second nucleic acid region includes at least one of the following sequences:
[0148] UAAUUUCUACUAAGUGUAGAUU, and
[0149] In the nucleic acid molecule, the specific nucleic acid region to which the target nucleic acid binds includes at least one of the following sequences:
[0150] GUCAACAUGAAGACGGACUU, and
[0151] In a specific example, when the target nucleic acid is KPC and / or RP, the nucleic acid molecule includes one or more of the crRNAs in Table 1, Table 4, Table 6, and Table 7.
[0152] In one specific example, the method can be nucleic acid detection for diagnostic purposes.
[0153] In one specific example, this method can also be used for non-diagnostic nucleic acid detection. For example, those skilled in the art can adjust the specific nucleic acid region sequence of the second nucleic acid region based on the target gene being detected, thereby enabling applications in agricultural, forestry, animal husbandry, and fishery pest control, such as detecting specific microorganisms in the air or soil; or providing guidance on medication use by detecting KPC resistance genes.
[0154] Depending on the detection requirements, the detection method of the present application can detect target nucleic acids extracted from the environment, food, sewage, animal body fluids, plant tissues, etc.
[0155] In one specific example, the target nucleic acid in the sample is detected using a fluorescence method or an immunochromatographic method.
[0156] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manuals or conventional conditions in this area, or according to the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.
[0157] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.
[0158] Example 1
[0159] This example compares the nucleic acid detection effects of different crRNA designs of the KPC target cas12 system (fluorescence method).
[0160] 1. Experimental materials:
[0161] 1. Reagents: The amplification reagent used in Example 1 is the RNA Constant Temperature Rapid Amplification Kit (Cat. No.: WLRE8208KIT) of Weifang Anpu Future Biotechnology Co., Ltd. Plasmids, primers, reporter probes, and crRNA are synthesized by General Bio (Anhui) Co., Ltd. The primers, reporter probes, and crRNA sequences in Example 1 are shown in SEQ ID NOs: 1-11, respectively, as shown in Table 1; the KPC amplicon sequence is shown in SEQ ID NO: 46. The Cas12 protein is LbCas12a (Cat. No.: E00201) of Jiangsu Dongkang Biopharmaceutical Technology Co., Ltd.
[0162] Among them, SEQ ID NO: 46 (KPC amplicon sequence):
[0163] 2. Instruments used: clean bench (SW-CJ-1D, Longyang Scientific Instruments), conventional PCR instrument (A100, Hangzhou Langji Scientific Instruments), LightCycler 480 real-time fluorescence quantitative PCR instrument (Roche).
[0164] 2. Experimental methods:
[0165] 1. crRNA design:
[0166] There are eight crRNA design methods, and the structural schematic diagrams of the eight methods are shown in Figure 1. The sequences of crRNAs of methods 1 to 8 are shown in Table 1.
[0167] Table 1
[0168] 2. RAA amplification:
[0169] Follow the kit instructions. See Table 2 for the RAA system preparation. Mix thoroughly and amplify at 42°C for 15 minutes. Use DNA extracted from Klebsiella pneumoniae as the template.
[0170] Table 2 RAA system preparation
[0171] 3. CRISPR:
[0172] See Table 3 for CRISPR / Cas12 system reagent configuration. System 1 is suitable for crRNA from Method 1, and System 2 is suitable for crRNA from Methods 2 to 8. The product is the product of RAA amplification in Example 1. Add 5 μL of the product to 45 μL of CRISPR / Cas12 reagent, mix well, and centrifuge before testing. CRISPR assay protocol: 37°C, 30 s, 30 cycles. Instrument: Roche 480.
[0173] Table 3 CRISPR / Cas12 system preparation
[0174] 3. Test Results
[0175] The results of nucleic acid detection using crRNA of Methods 1 to 8 in Example 1 are shown in Figure 2. Among them, the sensitivity of crRNA detection of nucleic acid in Methods 4 to 8 is better than that of crRNA in Methods 1 to 3.
[0176] In addition to crRNA methods seven and eight, crRNA methods five and six have the highest sensitivity in detecting nucleic acids and take a shorter time to reach the plateau phase.
[0177] Comparing the effects of crRNA detection of nucleic acid using methods 5 and 6 and comparing the effects of crRNA detection of nucleic acid using methods 7 and 8 shows that the detection effect is the same whether the fluorescent group is set at the middle position of crRNA or at the 3' end.
[0178] Comparing the effects of crRNA detection of nucleic acid using methods one and seven shows that the sensitization linker region can significantly improve the detection sensitivity of crRNA and shorten the time to reach the plateau phase.
[0179] Example 2
[0180] This example compares the nucleic acid detection effects of different crRNA designs in the KPC target cas13 system (chromatography).
[0181] 1. Experimental materials:
[0182] 1. Reagents: The amplification reagents used in Example 2 are the same as those in Example 1. The plasmids, primers, reporter probes, and crRNA synthesis manufacturers are the same as those in Example 1. The primers, reporter probes, and crRNA sequences in Example 2 are shown in SEQ ID NOs: 2, 12-22, respectively, as shown in Table 4; the KPC amplicon sequence is shown in SEQ ID NO: 46. The Cas13 protein is LWaCas13a (Cat. No.: E003-02) from Jiangsu Dongkang Biopharmaceutical Technology Co., Ltd. The test strips are custom-made and the manufacturer is Shanghai Liangrun.
[0183] 2. Instruments used: Same as in Example 1.
[0184] 2. Experimental methods:
[0185] 1. crRNA design:
[0186] There are nine crRNA design methods, and the structural schematic diagrams of the nine methods are shown in Figure 3. The sequences of crRNAs of methods 1 to 9 are shown in Table 4.
[0187] Table 4
[0188] 2. RAA amplification:
[0189] The amplification steps were the same as those in Example 1. The RNA extracted from Klebsiella pneumoniae was used as a template.
[0190] 3. CRISPR
[0191] Pipette 5 μL of the RAA product from step 2 and add it to 45 μL of CRISPR / Cas13 reagent. The CRISPR / Cas13 system reagent configuration is shown in Table 5. System 1 is suitable for crRNA of method 1, and system 2 is suitable for crRNA of methods 2 to 9. Mix and centrifuge, and then incubate the CRISPR reaction at 37°C for 15 minutes. After the reaction, take 50 μL of the CRISPR product into a 1.5 ml centrifuge tube, soak the test strip in the tube for 5 minutes, then take it out and place it on a piece of white paper. Wait for another 5 minutes and take a picture to record the results.
[0192] Among them, there is colloidal gold-labeled anti-FAM antibody on the conjugate pad of the test strip, streptavidin (SA) bound to biotin (BIO) on the detection line, and a secondary antibody of anti-FAM antibody on the quality control line.
[0193] When there is a target sequence in the reaction system, crRNA binds to the specific sequence and cuts the BIO / FAM labeled in the crRNA into a free state. At this time, the detection line T will not show color, and the quality control line C will show color, indicating a positive sample.
[0194] When there is no target sequence in the reaction system, the Cas enzyme cannot be activated, the BIO / FAM labeled in the crRNA remains in a connected state, and both the quality control line C and the detection line T are colored, indicating a negative sample.
[0195] Table 5 CRISPR / Cas13 system reagent preparation
[0196] 3. Experimental results:
[0197] The results of nucleic acid detection using crRNA of Methods 1 to 9 in Example 2 are shown in Figure 4. The sensitivity of crRNA detection of nucleic acid in Methods 4 to 9 is better than that of crRNA in Methods 1 to 3. The sensitivity of crRNA detection of nucleic acid in Method 1 is better than that of crRNA in Methods 2 and 3.
[0198] The sensitivity of crRNA detection of nucleic acids using methods 7, 8, and 9 is consistent. In addition to crRNA using methods 7, 8, and 9, crRNA using methods 5 and 6 has the highest sensitivity.
[0199] Comparing the effects of crRNA detection of nucleic acid using methods 5 and 6 and comparing the effects of crRNA detection of nucleic acid using methods 8 and 9 shows that the detection effect is the same whether the BIO is set at the middle position or the 3' end of the crRNA.
[0200] Comparing the effects of crRNA detection of nucleic acids using methods one and seven shows that the introduction of a sensitization linker region can significantly improve the detection sensitivity.
[0201] Example 3
[0202] This example compares the nucleic acid detection effects of different crRNA designs in the human RP target cas12 system (fluorescence method).
[0203] 1. Experimental materials:
[0204] 1. Reagents: The amplification reagents used in Example 3 are the same as those in Example 1; the plasmids, primers, reporter probes, and crRNA synthesis manufacturers are the same as those in Example 1; the primers, reporter probes, and crRNA sequences in Example 3 are shown in SEQ ID NOs: 24-34, see Table 6; the RP amplicon sequence is shown in SEQ ID NO: 47; and the Cas12 protein is the same as in Example 1.
[0205] Among them, SEQ ID NO: 47 (RP amplicon sequence):
[0206] 2. Instruments used: Same as in Example 1.
[0207] 2. Experimental methods:
[0208] 1. crRNA design:
[0209] The crRNA design method of the RP target cas12 system (fluorescence method) in this embodiment is the same as the crRNA design method of the KPC target in Example 1. The sequences of the crRNAs of Methods 1 to 8 are shown in Table 6.
[0210] Table 6
[0211] 2. RAA amplification:
[0212] The amplification steps are the same as in Example 1.
[0213] 3. CRISPR
[0214] The steps are the same as in Example 1.
[0215] 3. Experimental results:
[0216] The results of nucleic acid detection using crRNA of Methods 1 to 8 in Example 3 are shown in Figure 5.
[0217] In addition to crRNA methods seven and eight, crRNA methods five and six have the highest sensitivity in detecting nucleic acids and take a shorter time to reach the plateau phase.
[0218] Comparing the effects of crRNA detection of nucleic acid using methods 5 and 6 and comparing the effects of crRNA detection of nucleic acid using methods 7 and 8 shows that the detection effect is the same whether the fluorescent group is set at the middle position of crRNA or at the 3' end.
[0219] Comparing the effects of crRNA detection of nucleic acid using methods one and seven shows that the sensitization linker region can significantly improve the detection sensitivity of crRNA and shorten the time to reach the plateau phase.
[0220] Example 4
[0221] This example compares the nucleic acid detection effects of different crRNA designs in the cas13 system (chromatography) using human RP as the target.
[0222] 1. Experimental materials:
[0223] 1. Reagents: The amplification reagents used in Example 4 are the same as those in Example 1; the plasmid, primers, reporter probes, and crRNA synthesis manufacturers are the same as those in Example 1; the primers, reporter probes, and crRNA sequences in Example 4 are shown in SEQ ID NO: 14 / 25 / 36-45; the RP amplicon sequence is shown in SEQ ID NO: 47; and the Cas13 protein is the same as that in Example 2.
[0224] 2. Instruments used: Same as in Example 1.
[0225] 2. Experimental Methods
[0226] 1. crRNA design:
[0227] The crRNA design method of the RP target cas13 system (chromatography) of this embodiment is the same as the crRNA design method of the KPC target in Example 2. The sequences of the crRNAs of Methods 1 to 9 are shown in Table 7.
[0228] Table 7
[0229] 2. RAA amplification:
[0230] The amplification steps are the same as in Example 1.
[0231] 3. CRISPR
[0232] The steps are the same as in Example 2.
[0233] Among them, there is anti-TAMRA antibody labeled with colloidal gold on the conjugate pad of the test strip, there is anti-digoxin antibody bound to digoxin (DIG) on the detection line, and there is a secondary antibody of anti-TAMRA antibody on the quality control line.
[0234] When there is a target sequence in the reaction system, crRNA binds to the specific sequence, activates the Cas enzyme cleavage activity, and cuts the DIG / TAMRA labeled in the crRNA into a separated state. At this time, the detection line T will not show color, and the quality control line C will show color, indicating a positive sample;
[0235] When there is no target sequence in the reaction system, the Cas enzyme cannot be activated, the DIG / TAMRA labeled in the crRNA remains in a connected state, and both the quality control line C and the detection line T are colored, indicating a negative sample.
[0236] 3. Experimental results:
[0237] The results of nucleic acid detection using crRNA of Methods 1 to 9 in Example 4 are shown in Figure 6. Among them, the sensitivity of crRNA detection of nucleic acid in Methods 4 to 9 is better than that of crRNA in Methods 1 to 3.
[0238] The sensitivity of crRNA detection of nucleic acids using methods 7, 8, and 9 is consistent. In addition to crRNA using methods 7, 8, and 9, crRNA using methods 5 and 6 has the highest sensitivity.
[0239] Comparing the effects of crRNA detection of nucleic acid using methods 5 and 6 and comparing the effects of crRNA detection of nucleic acid using methods 8 and 9 shows that the detection effect is the same whether the BIO is set at the middle position or the 3' end of the crRNA.
[0240] Example 5
[0241] This example is a dual CRISPR-cas12 / cas13 fluorescence detection of KPC / RP targets.
[0242] 1. Experimental Materials
[0243] 1. Reagents: The amplification reagents used in Example 5 are the same as those in Example 1; the plasmids, primers, reporter probes, and crRNA synthesis manufacturers are the same as those in Example 1; the crRNA sequence of KPC is shown in SEQ ID NO: 23, and the crRNA sequence of RP is shown in SEQ ID NO: 34, as shown in Table 8; the KPC primer in Example 5 is the same as that in Example 2, and the RP primer is the same as that in Example 3; the KPC amplicon sequence is shown in SEQ ID NO: 46, and the RP amplicon sequence is shown in SEQ ID NO: 47; the Cas12 / Cas13 protein manufacturer and product number are the same as those in Example 1 / 2.
[0244] Table 8
[0245] 2. Instruments used: Same as in Example 1.
[0246] 2. Experimental Methods
[0247] 1. RAA amplification
[0248] The procedure was performed according to the kit instructions. The dual RAA system of Example 5 was prepared as shown in Table 9. After mixing, amplification was performed at 42°C for 15 minutes.
[0249] Table 9 Dual RAA system preparation
[0250] 2. CRISPR
[0251] Pipette 5 μL of the RAA product from step 1 into 45 μL of dual CRISPR fluorescence assay reagent. See Table 10 for the system configuration. System 1 represents a common two-step dual assay, while System 2 represents the dual assay of this example. After mixing and centrifugation, perform the CRISPR reaction at 37°C for 15 minutes. After mixing and centrifugation, the assay can be performed on the instrument. CRISPR assay protocol: 37°C, 30 seconds, 30 cycles. Instrument: Roche 480.
[0252] Table 10 Dual CRISPR fluorescence system preparation
[0253] 3. Experimental Results
[0254] Figure 7 shows a comparison of the KPC / RP dual-target dual detection results (fluorescence method) using a conventional two-step dual method and this embodiment. Figure 7A shows the results of the conventional two-step dual detection method (fluorescence method), while Figure 7B shows the results of the dual detection method (fluorescence method) using this embodiment. This embodiment significantly outperforms the conventional two-step dual detection method (fluorescence method).
[0255] Example 6
[0256] This example is a dual CRISPR-cas12 / cas13 chromatography detection of KPC / RP targets.
[0257] 1. Experimental Materials
[0258] 1. Reagents: The amplification reagents used in Example 6 are the same as those in Example 1; the plasmids, primers, reporter probes, and crRNA synthesis manufacturers are the same as those in Example 1; the KPC primers in Example 6 are the same as those in Example 2, and the RP material is the same as that in Example 3; the crRNA sequence of KPC is shown in SEQ ID NO: 20, and the crRNA sequence of RP is shown in SEQ ID NO: 35, as shown in Table 11; the KPC amplicon sequence is shown in SEQ ID NO: 46, and the RP amplicon sequence is shown in SEQ ID NO: 47; the Cas12 / Cas13 protein manufacturer and product number are the same as those in Example 1 / 2.
[0259] Table 11
[0260] 2. Instruments used: Same as in Example 1.
[0261] 2. Experimental Methods
[0262] 1. RAA amplification
[0263] The steps are the same as in Example 5.
[0264] 2. CRISPR
[0265] 5 μL of the RAA product from the previous step was added to 45 μL of dual CRISPR chromatography reagent. The system configuration is shown in Table 12. System 1 is a common two-step dual detection method, and System 2 is a dual detection method in this example. After mixing, centrifuge and incubate the CRISPR reaction at 37°C for 15 minutes. After the reaction, 50 μL of the CRISPR product was transferred to a 1.5 ml centrifuge tube. The test strip was placed in the tube and soaked for 5 minutes. After that, it was removed and placed on a piece of white paper. After waiting for another 5 minutes, a photo was taken to record the results.
[0266] Table 12 Dual CRISPR chromatography system preparation
[0267] The test strip has colloidal gold-labeled anti-FAM and anti-TAMRA antibodies on the conjugate pad, streptavidin (SA) conjugated to biotin (BIO) on the KPC test line, anti-DIG antibody conjugated to DIG on the RP test line, and secondary antibodies for anti-FAM and anti-TAMRA antibodies on the quality control line.
[0268] When there is a target sequence in the reaction system, crRNA binds to the specific sequence and cuts the BIO / FAM and DIG / TAMRA labeled in the crRNA into a free state. At this time, the detection line T will not show color, and the quality control line C will show color, indicating a positive sample.
[0269] When there is no target sequence in the reaction system, the Cas enzyme cannot be activated, the BIO / FAM and DIG / TAMRA labeled in the crRNA remain in a connected state, and both the quality control line C and the detection line T are colored, indicating a negative sample.
[0270] 3. Experimental Results
[0271] Figure 8 shows a comparison of the results of a conventional two-step dual detection method for KPC / RP dual targets and the dual detection method of this embodiment (chromatographic method). Figure 8 A shows the results of the conventional two-step dual detection method (chromatographic method), and Figure 8 B shows the results of the dual detection method of this embodiment (chromatographic method). This embodiment significantly outperforms the conventional two-step dual detection method (chromatographic method).
[0272] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0273] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art could make several modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the patent in this application shall be based on the appended claims, and the specification and drawings may be used to interpret the claims.
Claims
1. A nucleic acid molecule for nucleic acid detection, characterized in that, It is formed by connecting a first nucleic acid region labeled with a marker to a second nucleic acid region through a sensitizing linker region; The first nucleic acid region is a single-stranded nucleic acid to be cleaved; wherein, when the single-stranded nucleic acid to be cleaved is cleaved and not cleaved by the Cas protein, different detection states are presented and thus detected; The second nucleic acid region includes a stem-loop structure region and a specific nucleic acid region that binds to the target nucleic acid; wherein, the stem-loop structure region is a nucleic acid that can guide the Cas protein to specifically bind to the target nucleic acid; The sensitizing linker region includes a chemical bond, a ligand-receptor system, a compound containing a phosphate group, and a compound containing a hydroxyl group and / or an amino group; The first nucleic acid region and the second nucleic acid region do not form a complementary double-stranded structure region.
2. The nucleic acid molecule according to claim 1, wherein From the 5'-end to the 3'-end, the nucleic acid molecule has at least one of the following structural formulas: First nucleic acid region - sensitizing linker region - second nucleic acid region Formula I, and, Second nucleic acid region - sensitizing linker region - first nucleic acid region Formula II.
3. The nucleic acid molecule according to claim 1 or 2, characterized in that, At least 1 first nucleic acid region is connected to each second nucleic acid region.
4. The nucleic acid molecule according to any one of claims 1 to 3, characterized in that, The chemical bond includes a phosphodiester bond, the ligand-receptor system includes at least one of streptavidin-biotin and antigen-antibody, and the compound containing a phosphate group and a hydroxyl group and / or an amino group includes hydroxy-polyethylene glycol-phosphate group.
5. The nucleic acid molecule according to any one of claims 1 to 4, characterized in that, The length of the single-stranded nucleic acid to be cleaved is about 3 bp to 30 bp; Optionally, the single-stranded nucleic acid to be cleaved is single-stranded DNA or single-stranded RNA; Optionally, the bases of the single-stranded DNA include A and T; Optionally, the bases of the single-stranded RNA include U.
6. The nucleic acid molecule according to any one of claims 1 to 5, characterized in that, The marker includes a fluorescent group and a quenching group; or, The marker includes one of the ligand-receptor members and also includes a fluorescent group or a quenching group; Optionally, the fluorescent group includes any one of FAM, HEX, TET, NED, ROX, CY5, CY3, TFAM, and VIC; Optionally, the quenching group includes any one of BHQ1, TAMRA, Dabcyl, Eclipse, and NFQ-MGB; Optionally, one of the ligand-receptor members includes one of digoxin-anti-digoxin antibody or biotin-streptavidin; Optionally, the marker is labeled at the 3'-end and 5'-end of the single-stranded nucleic acid to be cleaved; Optionally, different markers are labeled at different positions on the single-stranded nucleic acid to be cleaved.
7. A product for nucleic acid detection, characterized in that, The product includes a CRISPR detection reagent, and the CRISPR detection reagent includes n nucleic acid molecules according to any one of claims 1 to 6, where n is a positive integer of n≥1.
8. The product according to claim 7, characterized in that, From the 5'-end to the 3'-end, the nucleic acid molecule is selected from at least one of the following groups: The nucleic acid molecule includes a first nucleic acid region - phosphodiester bond - second nucleic acid region, and the 5'-end of the first nucleic acid region is labeled with a fluorescent group and the 3'-end is labeled with a quenching group; The nucleic acid molecule includes a first nucleic acid region - phosphodiester bond - second nucleic acid region, and the 5'-end of the first nucleic acid region is labeled with a quenching group and the 3'-end is labeled with a fluorescent group; The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5'-end of the first nucleic acid region is labeled with a quenching group and the 3'-end is labeled with a fluorescent group; The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5'-end of the first nucleic acid region is labeled with a fluorescent group and the 3'-end is labeled with a quenching group; The nucleic acid molecule comprises a second nucleic acid region-hydroxy-polyethylene glycol-phosphate group-(first nucleic acid region)3, wherein the 5'-end of the first nucleic acid region is labeled with a fluorescent group and the 3'-end is labeled with a quenching group; The nucleic acid molecule comprises a second nucleic acid region-hydroxy-polyethylene glycol-phosphate group-(first nucleic acid region)3, wherein the 5'-end of the first nucleic acid region is labeled with a quenching group and the 3'-end is labeled with a fluorescent group; The nucleic acid molecule comprises a first nucleic acid region-phosphodiester bond-second nucleic acid region, wherein the 5'-end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3'-end is labeled with a fluorescent group or a quenching group; The nucleic acid molecule comprises a first nucleic acid region-phosphodiester bond-second nucleic acid region, wherein the 5'-end of the first nucleic acid region is labeled with a fluorescent group or a quenching group and the 3'-end is labeled with one of the ligand-receptor members; The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5'-end of the first nucleic acid region is labeled with a fluorescent group or a quenching group and the 3'-end is labeled with one of the ligand-receptor members; The nucleic acid molecule comprises a second nucleic acid region-phosphodiester bond-first nucleic acid region, wherein the 5'-end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3'-end is labeled with a fluorescent group or a quenching group; The nucleic acid molecule comprises a second nucleic acid region-biotin-streptavidin-(first nucleic acid region)3, wherein the 5'-end of the first nucleic acid region is labeled with one of the ligand-receptor members and the 3'-end is labeled with a fluorescent group or a quenching group; The nucleic acid molecule comprises a second nucleic acid region - hydroxy - polyethylene glycol - phosphate group - (first nucleic acid region) n , n is a positive integer and 1 ≤ n ≤ 3, the 5'-end of the first nucleic acid region is labeled with a fluorescent group or a quenching group, and the 3'-end is labeled with one of the ligand - receptor members; The nucleic acid molecule comprises a second nucleic acid region - hydroxy - polyethylene glycol - phosphate group - (first nucleic acid region) n , where n is a positive integer and 1 ≤ n ≤ 3, the 5' end of the first nucleic acid region is labeled with one of a ligand - receptor pair, and the 3' end is labeled with a fluorescent group or a quenching group.
9. The product according to claim 7 or 8, characterized in that, The CRISPR detection reagent further comprises a Cas protein, and the Cas protein has a bypass single-stranded nucleic acid cleavage function; Optionally, the Cas protein comprises one or more of Cas12 and Cas13; Optionally, the Cas12 comprises at least one of Cas12a, Cas12b and Cas12c; Optionally, the Cas13 comprises Cas13a and / or Cas13b.
10. The product according to any one of claims 7 to 9, characterized in that, The CRISPR detection reagent further comprises one or more of NTP Mix, RNase inhibitor, RNA polymerase, HEPES, MgCl2 and a buffer for CRISPR detection.
11. The product according to any one of claims 7 to 10, characterized in that, The product further comprises an isothermal amplification reagent; Optionally, the isothermal amplification reagent comprises amplification primers; Optionally, the isothermal amplification reagent further comprises at least one of a buffer for the isothermal amplification system, recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase.
12. The product according to claim 11, wherein, The isothermal amplification reagent is amplified by any one of the following methods: Recombinase isothermal amplification, loop-mediated isothermal amplification, cross-priming isothermal amplification, rolling circle amplification, strand displacement amplification and helicase-dependent amplification.
13. The product according to any one of claims 7 to 12, characterized in that, The product further comprises a test strip, and the test strip comprises a sample pad, a conjugate pad, a reaction membrane and an absorption pad, and a detection line and a quality control line are arranged on the reaction membrane; Among them, the other of the ligand-receptor members is coated on the detection line; one or more of colloidal gold labeled with an anti-fluorophore antibody and colloidal gold labeled with an anti-quencher antibody are coated on the binding pad; one or more of the secondary antibodies of the anti-fluorophore antibody and the secondary antibody of the anti-quencher antibody are coated on the quality control line.
14. A detection system for nucleic acid detection, characterized in that, The detection system includes n nucleic acid molecules according to any one of claims 1 to 6, where n is a positive integer with n≥1.
15. The detection system according to claim 14, characterized in that, n is a positive integer with n≥2. In the same detection system, the fluorophores or ligand-receptor members in the n nucleic acid molecules are pairwise different.
16. The detection system according to claim 14 or 15, characterized in that, The detection system further includes the Cas protein in the product according to claim 9 or 10.
17. A method for detecting a target nucleic acid in a sample, characterized in that, One or more target nucleic acids in a sample are detected using the nucleic acid molecule according to any one of claims 1 to 6, the product according to any one of claims 7 to 13, or the detection system according to any one of claims 14 to 16. Optionally, the target nucleic acid includes one or more of DNA and RNA.
18. The method according to claim 17, wherein The target nucleic acid in the sample is determined by fluorescence method or immunochromatography.
Citation Information
Patent Citations
A molecule adaptor and applications thereof
CN106906211A
Methods and compositions for target detection
CN109312336A
CRISPR multi-target detection method and kit thereof
CN112301101A
Nucleic acid detection system, device and method
CN116287144A
Nucleic acid molecule, detection product and method for nucleic acid detection
CN117778534A