Novel double-stranded RNA based on c5 RNA sequence, and use thereof
Double-stranded RNA targeting the C5 signal peptide region effectively inhibits C5 expression, addressing the limitations of existing pharmaceuticals by providing a cost-effective and reliable method to suppress cell proliferation.
Patent Information
- Application Number
- PCT/JP2024/045860
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-27
- Filing Date
- 2024-12-25
- Publication Date
- 2025-07-03
AI Technical Summary
Existing pharmaceutical compositions targeting C5 activation in the complement system, such as antibody drugs and siRNA, are costly and difficult to maintain uniform quality, while nucleic acid drugs face challenges in effectively inhibiting the proliferation of cells involved in complement component C5 expression.
Development of double-stranded RNA (dsRNA) with specific sequences targeting the signal peptide region of C5, functioning as siRNA to suppress C5 expression, potentially combined with a peptide fragment for cell membrane permeability to enhance delivery.
The dsRNA effectively inhibits the proliferation of cells, particularly tumor cells, by specifically targeting C5 expression, offering a cost-effective and reliable method to suppress excessive activation or inappropriate regulation of the complement system.
Smart Images

Figure JP2024045860_03072025_PF_FP_ABST
Abstract
Description
Novel double-stranded RNA based on C5 RNA sequence and its use
[0001] The present disclosure relates to double-stranded RNA, compositions containing the double-stranded RNA, and methods of using the same. Specifically, the present disclosure relates to double-stranded RNA used to suppress or inhibit tumor cell growth or metastasis, and compositions containing the double-stranded RNA. This application claims priority to Japanese Patent Application No. 2023-221597, filed December 27, 2023, the entire contents of which are incorporated herein by reference.
[0002] The complement system, part of the innate immune system, protects the body from infection by pathogens such as bacteria and viruses. It consists of dozens of interacting proteins. Complement system proteins are primarily produced in the liver and circulate in the blood and extracellular fluid. Most complement system proteins are normally inactive, but are activated by infection with bacterial and viral pathogens. There are three complement activation pathways: the classical pathway (first pathway), the lectin pathway (mannose-binding lectin pathway), and the alternative pathway (second pathway). Complement system activation leads to opsonization, migration of phagocytes and lymphocytes, and pathogen elimination by the membrane attack complex (MAC). However, excessive complement activation or inappropriate regulation has been suggested to contribute to autoimmune diseases, inflammatory diseases, tumor cell proliferation, and metastasis.
[0003] Although the initial components of each of the above pathways act locally, each pathway ultimately leads to the activation of complement component C5 (hereinafter simply referred to as "C5"). During C5 activation, C5 is cleaved into C5a and C5b. The cleaved C5b binds to C6, 7, 8, and 9 to form the MAC. C5a acts alone as a diffusible signal, attracting phagocytes and lymphocytes to the site of infection and promoting the inflammatory response. As described above, C5 plays an important role as a late component of the complement activation pathway, and pharmaceutical compositions that inhibit C5 activation and C5 expression have also been disclosed. For example, Japanese Patent Laid-Open Publication No. 2018-123125 discloses an antibody pharmaceutical composition targeting C5. Furthermore, Japanese Patent Laid-Open Publication No. 2019-518028 discloses siRNA targeting C5.
[0004] Japanese Patent Application Laid-Open No. 2018-123125 Japanese Patent Application Laid-Open No. 2019-518028
[0005] Antibody drugs and the like are expensive and it is difficult to maintain consistent quality. Nucleic acid drugs can be mass-produced by organic synthesis, making it easy to control the consistency of quality. The inventors focused on nucleic acid drugs, particularly on the signal peptide region of C5, which plays a central role in the complement system.
[0006] A primary object of the present disclosure is to provide a technique for suppressing or inhibiting cell proliferation associated with gene expression of complement component C5.
[0007] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand. The first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence is determined from a base sequence encoding the signal peptide region of complement component C5.
[0008] The double-stranded RNA can function as at least small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). This effect is due to the suppression of the expression of at least complement component C5, thereby inhibiting the proliferation of cells associated with complement components.
[0009] In one embodiment of the double-stranded RNA disclosed herein, the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence. Such double-stranded RNA can function favorably as siRNA. This allows for more reliable inhibition of cell proliferation involving complement components.
[0010] In one embodiment of the double-stranded RNA disclosed herein, at least three of the five bases on the 3'-end of the main sequence are adenine (A) and / or uracil (U), thereby more fully suppressing the expression of complement component C5 and inhibiting the proliferation of cells associated with complement components.
[0011] In one embodiment of the double-stranded RNA disclosed herein, the base sequence encoding the signal peptide region of complement component C5 consists of any of the following base sequences: GGGCCTTTTTGGGAATACTT (SEQ ID NO: 1); GGCCTTTTGGGAATACTTT (SEQ ID NO: 2); CCTTTTGGGAATACTTTGT (SEQ ID NO: 3); CTTTTGGGAATACTTTGTT (SEQ ID NO: 4); GGAATACTTTGTTTTTTTAA (SEQ ID NO: 5). Such double-stranded RNA more specifically suppresses the expression of complement component C5, thereby making it possible to inhibit the proliferation of cells expressing increased amounts of complement component C5.
[0012] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.
[0013] The present disclosure provides a composition capable of inhibiting the proliferation of at least one type of cell. One embodiment of the composition disclosed herein comprises a first strand and a second strand complementary to the first strand, the first strand having a main sequence of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence comprises double-stranded RNA determined from a base sequence encoding the signal peptide region of complement system factor C5. When supplied to cells, such a composition inhibits the expression of at least complement component C5, thereby inhibiting the proliferation of cells in which a complement component is involved.
[0014] In one embodiment of the composition disclosed herein, the cell type whose proliferation is inhibited by the composition is tumor cells, thereby enabling more reliable inhibition of cell proliferation.
[0015] One embodiment of the composition disclosed herein comprises a peptide fragment having cell membrane permeability that allows a foreign substance to be introduced into the cytoplasm by passing through the cell membrane from the outside of the cell, thereby facilitating the introduction of double-stranded RNA into a target cell.
[0016] The present disclosure provides a method for inhibiting the proliferation of at least one type of cell. One embodiment of the method disclosed herein comprises the steps of (1) preparing a composition disclosed herein and (2) supplying the composition to a target cell in vitro. This allows the proliferation of cells associated with complement components to be inhibited.
[0017] In one embodiment of the method disclosed herein, the biological species of the cells is the same as the biological species containing complement component C5, thereby more reliably inhibiting the proliferation of cells in which complement components are involved.
[0018] 1 is a schematic diagram showing an overview of the complement pathway; 2 is a graph showing the cell viability of neuroblastoma cells in Samples 1 to 5 and a Comparative Example; 3 is a graph showing the cell viability of neuroblastoma cells at different addition amounts for Samples 1 to 4 and a Comparative Example; 4 is a graph showing the cell viability of breast cancer cells in Samples 1 to 4 and a Comparative Example; and 5 is a graph showing the cell viability of lung cancer cells in Sample 5 and a Comparative Example.
[0019] <Definition of Terms> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.
[0020] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).
[0021] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. Also, if the second strand is a sense strand, the first strand refers to an antisense strand. The first strand and the second strand may be completely complementary to each other, or may be at least partially complementary. That is, they may be capable of hybridizing at least under physiological conditions.
[0022] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.
[0023] As used herein, the term "tumor" is broadly interpreted and refers to tumors in general (typically malignant tumors), including carcinomas and sarcomas, as well as lesions of the blood or hematopoietic tissues (leukemia, lymphoma, etc.). Furthermore, "tumor cells" are synonymous with "cancer cells," and refer to cells that form such tumors, typically cells that have reached the stage of abnormal proliferation independent of surrounding normal tissues (so-called cancerous cells). Therefore, unless otherwise specified, any cell that is classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or properties.
[0024] In this specification, when a numerical range is described as "A to B (where A and B are any numerical values)," it means "A or more and B or less," and also encompasses the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."
[0025] <Complement Components> As used herein, "complement components" refers to proteins involved in the complement pathway and its activation. Examples of complement components include C1 (C1r, C1s, C1p), C2, C3, C4, C5, C6, C7, C8, C9, CFB, CFD, MBL, and MASP. FIG. 1 is a schematic diagram outlining complement activation. In the classical pathway, complement components C1, C2, C4, and the like are mainly involved. The classical pathway begins with the binding of IgM or IgG antibody molecules to complement component C1q. C1r and C1s are activated, and C2 and C4 are degraded into C2a and C2b, and C4a and C4b, respectively. C4b and C2a then form a complex. The C4b-C2a complex acts as a C3 convertase, degrading C3 into C3a and C3b. The alternative pathway begins with the hydrolysis of C3 on the cell membrane of a microorganism. Complement factor B (CFB) binds to the hydrolyzed C3 to form a complex. Complement factor D (CFD) acts on this complex, acting as a C3 convertase and degrading C3 into C3a and C3b. The lectin pathway begins with the activation of serum lectins such as mannose-binding lectin (MBL) by binding to mannose or other sugar chains on the surface of pathogens. MASP, a type of serine protease, is activated, degrading C2 and C4 into C2a and C2b, and C4a and C4b, respectively. Subsequently, as in the classical pathway, C4b and C2a form a complex. The C4b-C2a complex acts as a C3 convertase, degrading C3 into C3a and C3b. Thus, each pathway in the complement system converges on the activation of C3.
[0026] After C3 activation, in the classical and lectin pathways, C3b forms a complex with C2a and C4b. The C4bC2aC3b complex acts as a C5 convertase, degrading C5 into C5a and C5b. C5b binds to C6, C7, C8, and multiple C9s to form MAC. In the alternative pathway, a complex of CFB and two C3b molecules acts as a C5 convertase. Thus, each pathway in the complement system ultimately converges on the activation of C5. Therefore, inhibiting C5 expression is effective in suppressing excessive complement activation and inappropriate regulation.
[0027] <Complement Component C5> As used herein, "complement component C5 (also simply referred to as "C5")" refers to a protein involved in the complement system. However, the term is intended to encompass all synonyms, including naturally occurring C5 and its variants. The biological species from which C5 is derived is not particularly limited, but is preferably the same as the animal species of the cells to which the double-stranded RNA or composition disclosed herein is to be delivered. For example, when delivering the double-stranded RNA or composition disclosed herein to cells derived from humans, it is preferable to use a base sequence based on the base sequence of human C5 as the main sequence. Note that while human-derived C5 is described as a preferred example, the present technology can also be applied to C5 derived from biological species, including mammals other than humans and other animal species.
[0028] C5 is known to be overexpressed in various diseases and disorders. For example, its expression level has been suggested to be involved in macular degeneration (retinal detachment, chorioretinal degeneration, retinal degeneration, photoreceptor degeneration, RPE degeneration, mucopolysaccharidosis, rod-cone dystrophy, cone-rod dystrophy, cone degeneration), age-related macula, cancer, Stargardt's disease, Best's disease, paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, rheumatoid arthritis, and neurodegenerative diseases. It is also involved in the inflammatory responses and cell death associated with these diseases and disorders. Specifically, it is known that the expression of complement system proteins is increased on the surface of tumor cells. That is, the double-stranded RNA and compositions disclosed herein can act favorably on cells in which C5 expression is increased due to the above-mentioned diseases and disorders, and inhibit their proliferation. Furthermore, C5 activation is downstream of C3 activation in the complement pathway. Therefore, suppressing the expression of C5 has the advantage of inhibiting the proliferation of cells in which the expression of C5 is increased due to the above-mentioned diseases and disorders, while maintaining the opsonization and phagocytic function of C3b.
[0029] <Signal Peptide Region> The base sequence of C5 can be obtained from international databases. For example, international databases include NCBI (National Center for Biotechnology Information), ENA (European Nucleotide Archive), DDBJ (DNA Data Bank of Japan), UniPlot, Ensembl, etc. Specifically, the base sequence of human C5 is provided by NCBI under accession number NM_001735.3, etc. Information on the signal peptide region of C5 can also be obtained from the above-mentioned international databases.
[0030] C5 consists of approximately 1,676 amino acid residues. The amino acid sequence shown in SEQ ID NO: 11 consists of 18 amino acid residues and represents the amino acid sequence of the signal peptide of human C5. The nucleotide sequence shown in SEQ ID NO: 12 consists of 54 bases and represents the nucleotide sequence of the signal peptide of human C5.
[0031] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is a double-stranded RNA having a first strand and a second strand complementary to the first strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is determined from the base sequence encoding the signal peptide region of complement component C5.
[0032] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).
[0033] The main sequence of the sense strand may be, for example, a partial base sequence encoding the signal peptide region of C5. This allows the double-stranded RNA to function as an siRNA (small interfering RNA) targeting C5. Furthermore, since the base sequence of the signal peptide region of C5 is located upstream of the mRNA, the double-stranded RNA may be able to effectively suppress the expression of C5 when functioning as an siRNA.
[0034] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to homologous sequences in mRNA transcribed from the target gene (here, the C5 gene) and specifically cleaves the mRNA, thereby inhibiting translation.
[0035] The main sequence is preferably selected from the signal peptide region of C5 or a base sequence encoding the signal peptide region of C5, but one or more bases (e.g., two bases) may be substituted with other bases, deleted, and / or added (inserted) within the scope in which the effects of the present technology are exhibited.
[0036] The proportion of the C5 signal peptide region or the nucleotide sequence encoding the C5 signal peptide region in the main sequence is, when the entire main sequence is taken as 100%, preferably 45% or more, and may be 60% or more, 75% or more, 90% or more, or 100% or more.
[0037] The 5' end of the main sequence is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand with the more energetically unstable 5' end between the sense strand and the antisense strand. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.
[0038] Of the five bases on the 3'-end of the main sequence, adenine and / or uracil preferably account for 60% or more (i.e., 3 or more bases), but may also account for 80% or more (i.e., 4 or more bases), or even 100% (i.e., 5 bases). This makes the 5'-end of the antisense strand less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.
[0039] The GC content of the entire main sequence (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 20% to 60% or less, preferably 30% to 50% or less, or may be 30% to 45% or less. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. The above GC content allows the RNAi effect to be efficiently exerted.
[0040] The main sequence can be selected from 19 to 23 bases from G or C of the gene encoding human C5. For example, the main sequence can be any of the following base sequences: GGGCCUUUUGGGAAUACUU (SEQ ID NO: 21); GGCCUUUUGGGAAUACUUU (SEQ ID NO: 22); CCUUUUGGGAAUACUUUGU (SEQ ID NO: 23); CUUUUGGGAAUACUUUGUU (SEQ ID NO: 24); GGAAUACUUUGUUUUUUAA (SEQ ID NO: 25). All of the base sequences shown in SEQ ID NOs: 21 to 25 are composed of RNA. All of the base sequences shown in SEQ ID NOs: 21 to 25 are specific to the C5 gene, and can avoid the risk of inhibiting translation of mRNA in a host cell having a base sequence similar to the target sequence (so-called off-target effect). Furthermore, double-stranded RNAs having as their main sequences the base sequences shown in SEQ ID NOs: 21 to 25 significantly suppress the proliferation of abnormally proliferating cells even at low concentrations, thereby avoiding nonspecific inhibition of expression, nonspecific inhibition of cell proliferation, stress on cells, etc.
[0041] The nucleotide sequence shown in SEQ ID NO: 1 (the DNA sequence corresponding to the RNA sequence of SEQ ID NO: 21) is the 3rd to 21st nucleotide sequence of the nucleotide sequence encoding human C5 (i.e., the sequence from the initiation codon to the termination codon). The nucleotide sequence shown in SEQ ID NO: 2 (the DNA sequence corresponding to the RNA sequence of SEQ ID NO: 22) is the 4th to 22nd nucleotide sequence of the nucleotide sequence encoding human C5. The nucleotide sequence shown in SEQ ID NO: 3 (the DNA sequence corresponding to the RNA sequence of SEQ ID NO: 23) is the 6th to 24th nucleotide sequence of the nucleotide sequence encoding human C5. The nucleotide sequence shown in SEQ ID NO: 4 (the DNA sequence corresponding to the RNA sequence of SEQ ID NO: 24) is the 7th to 25th nucleotide sequence of the nucleotide sequence encoding human C5. The nucleotide sequence shown in SEQ ID NO: 5 (the DNA sequence corresponding to the RNA sequence of SEQ ID NO: 25) is the 13th to 21st nucleotide sequence of the nucleotide sequence encoding human C5. The nucleotide sequences shown in SEQ ID NOs: 1 to 5 are partial nucleotide sequences of the signal peptide region of human C5.
[0042] Double-stranded RNAs composed of the main sequences shown in SEQ ID NOs: 21 to 25 can suppress or inhibit the proliferation of at least one type of cell by supplying them to the cell. Typically, by supplying them to tumor cells (e.g., neuroblastoma, breast cancer, lung cancer, etc.), the proliferation of the tumor cells can be suppressed or inhibited. Note that C5 is expressed at low levels in normal cells other than tumor cells, but is overexpressed in tumor cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to normal cells, the amount of C5 present in normal cells is relatively small, and therefore it is thought that the double-stranded RNA will have little effect.
[0043] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.
[0044] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.
[0045] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).
[0046] <Sense strand and antisense strand> The sense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, it is composed of 21 bases, consisting of a 19-base main sequence and a 2-base additional sequence. In such an example, RNAi can be effectively induced.
[0047] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).
[0048] In the double-stranded RNA of the present disclosure, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, chemically modified DNA or RNA, other known nucleotide analogs, etc., to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of chemically modified RNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, or inosine. For example, one or more bases (e.g., two bases) of uridine in the double-stranded RNA of the present disclosure can be substituted with pseudouridine.
[0049] In the double-stranded RNA of the present disclosure, the antisense strand may have a main sequence complementary to the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function of the siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.
[0050] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.
[0051] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.
[0052] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.
[0053] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in medicines as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).
[0054] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).
[0055] The compositions disclosed herein inhibit the proliferation of at least one type of cell. The cells whose proliferation is inhibited are cells in which C5 expression is involved, such as tumor cells (e.g., neuroblastoma, breast cancer, lung cancer, lymphoma, etc.), hepatocytes, ocular cells, etc. Among these, the compositions disclosed herein preferably inhibit the proliferation of tumor cells. In other words, the double-stranded RNA and compositions disclosed herein can be preferably used as antitumor agents (anticancer agents) that suppress the proliferation of tumor cells.
[0056] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.
[0057] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.
[0058] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.
[0059] <Method for producing the composition disclosed herein and use thereof> The present disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.
[0060] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.
[0061] In the supplying step, the composition disclosed herein is supplied to at least one type of cell (e.g., tumor cells) in vivo or ex vivo. The animal species of the supplied cells is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Preferably, the animal species from which the C5 that forms the main sequence of the double-stranded RNA contained in the composition is derived is the same as the animal species of the target cells. The type of target cells is also not particularly limited, but is preferably tumor cells, more preferably neuroblastoma, breast cancer, or lung cancer. Note that, although cells other than tumor cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., tumor cells).
[0062] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.
[0063] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. The amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 10 μM or less, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.
[0064] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.
[0065] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.
[0066] <Preparation of double-stranded RNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 9 to 31 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare double-stranded RNAs used in Samples 1 to 5 and Sample 6 shown in Table 1. The double-stranded RNAs shown in Samples 1 to 5 and Sample 6 were each dissolved in PBS to a RNA concentration of 2 mM to prepare an RNA solution.
[0067]
[0068] As shown in Table 1, the sense strand of the double-stranded RNA of Sample 1 is composed of a main sequence consisting of SEQ ID NO: 21 (a part of the base sequence encoding the C5 signal peptide region) and an additional sequence consisting of TT added to the 3' end of the main sequence. Similarly, the sense strand of the double-stranded RNA of Samples 2 to 5 shown in Table 1 is composed of a main sequence consisting of SEQ ID NOs: 22 to 25 (a part of the base sequence encoding the C5 signal peptide region) and an additional sequence consisting of TT added to the 3' end of the main sequence. The sense strand of the double-stranded RNA of Sample 6 is composed of a main sequence consisting of SEQ ID NO: 8 (a randomly artificially generated sequence) and an additional sequence consisting of TT added to the 3' end of the main sequence. The antisense strand in each example is composed of a sequence complementary to the main sequence and an additional sequence consisting of TT added to the 3' end of the sequence.
[0069] <Cell proliferation test of human neuroblastoma cells> Human neuroblastoma cells, the SK-N-SH strain, were used as tumor cells. SK-N-SH cells were pre-cultured in a culture medium containing 10% FBS (fetal bovine serum) + E-MEM (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 051-07615) + 1% MEM non-essential amino acid solution (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 139-15651). Note that 0.5% penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 168-23191) was added to the culture medium only during pre-culture, but was not added during the following culture and evaluation.
[0070] On day 1, the SK-N-SH cells that had adhered to the culture plate were washed with PBS, and then a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After this incubation, the above-mentioned culture medium was added to inactivate the trypsin. The cells were then precipitated by centrifugation at 150 x g for 5 minutes. After removing the supernatant resulting from centrifugation, the above-mentioned culture medium was added to the precipitate (cell pellet), and approximately 5 x 10 4 A cell suspension of 5 × 10 cells / mL was prepared. One commercially available 96-well plate was prepared, and the cell suspension was added to each well at a concentration of 5 × 10 3 The cells were seeded at 100 μL per well and incubated at 37°C, 5% CO 2 and incubated overnight under
[0071] (Sample 1) On the second day, 3 μL of RNA solution adjusted to 2 mM with PBS was mixed with 75 μL of Opti-MEM™ to prepare Solution A. Furthermore, 4.5 μL of Lipofectamine™ RNAiMAX was mixed with 75 μL of Opti-MEM™ to prepare Solution B. Next, equal amounts of Solution A and Solution B were mixed to prepare Solution C, which was then incubated at room temperature for 5 minutes. The prepared Solution C was added to wells where SK-N-SH cells had been cultured, at 11 μL / well (final concentration of double-stranded RNA: 4 μM). The mixture was then incubated at 37°C, 5% CO 2 The mixture was incubated under reduced pressure for 3 days.
[0072] Cell proliferation was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). On day 5 (day 3 after siRNA addition), the 96-well plate in which SK-N-SH cells had been cultured was removed, 10 μL of CCK-8 was added to each well, and the cells were incubated at 37°C, 5% CO 2 The wells were incubated for 1.5 hours under reduced pressure. The absorbance at 450 nm of each well was measured. The absorbance was calculated as the average of the absorbances of three wells. In addition, a blank well was prepared containing only the culture medium and CCK-8 reagent. The absorbance of Sample 1 minus the absorbance of the blank was used as the measured value for Sample 1.
[0073] (Samples 2 to 6) Samples 2 to 6 were prepared in the same manner as Sample 1, except that the double-stranded RNA in Samples 2 to 6 was changed to the double-stranded RNA in Samples 2 to 6 shown in Table 1.
[0074] Comparative Example In the comparative example, the procedure was the same as that of Sample 1, except that a PBS solution was used instead of the RNA solution in Sample 1. That is, in the comparative example, no double-stranded RNA was introduced.
[0075] Untreated wells were prepared in the same manner as Sample 1, except that the RNA solution and Lipofectamine™ RNAiMAX were not added. The cell viability in each test example is expressed as a percentage when the measured value for the untreated well was set to 100%, and is shown in Figure 2. Figure 2 shows the results of a test using the double-stranded RNAs shown in Table 1, i.e., double-stranded RNAs whose main sequence is a portion of the base sequence encoding the C5 signal peptide region (SEQ ID NOS: 1 to 5), on neuroblastoma cells.
[0076] As shown in Figure 2, the cell viability of Samples 1 to 5 was reduced, significantly lower than that of the comparative example. Furthermore, Sample 1 (SEQ ID NO: 1) had the lowest cell viability. Based on these test results, the double-stranded RNAs of Samples 1 to 5 are believed to have the ability to inhibit the proliferation of tumor cells (neuroblastoma cells). Furthermore, the base sequence of SEQ ID NO: 7 is a random sequence with an ATCG content nearly equivalent to that of the base sequences of Samples 1 to 5. Sample 6, which contains SEQ ID NO: 7 as the main sequence, did not affect cell proliferation. Therefore, the sequences of Samples 1 to 5 are specific to the C5 gene. Therefore, the double-stranded RNAs of Samples 1 to 5 can avoid off-target effects, do not affect other organs, and are therefore expected to be useful for clinical applications.
[0077] <Cell proliferation test of human neuroblastoma cells using low-concentration double-stranded RNA> Double-stranded RNA was prepared for Samples 1 to 5 shown in Table 1. Each double-stranded RNA shown in Samples 1 to 5 was dissolved in PBS to a 2 mM RNA concentration to prepare an RNA solution. This was then further diluted 10-fold with PBS to prepare a low-concentration RNA solution with an RNA concentration of 200 μM. A test similar to the cell proliferation test of human neuroblastoma cells was performed, except that the low-concentration RNA solution was used. Specifically, the final concentration of double-stranded RNA added to wells containing cultured SK-N-SH cells was adjusted to 0.4 μM. The cell viability in each test example was expressed as a percentage of the measured value for untreated wells, which was set to 100%.
[0078] Figure 3 is a graph comparing cell viability when the final concentration of added double-stranded RNA was 4.0 μM and 0.4 μM. As shown in Figure 3, the cell viability of Samples 1 to 5 decreased. Furthermore, the cell viability of Samples 1 to 5 was significantly lower than that of the comparative example. This indicates that the double-stranded RNA of Samples 1 to 5 had the ability to inhibit the proliferation of tumor cells (neuroblastoma cells) even at low concentrations. Because the double-stranded RNA of Samples 1 to 5 had sufficient tumor cell growth inhibition function even at low concentrations, it can avoid nonspecific expression inhibition and nonspecific cell growth inhibition, making clinical applications highly promising. Among these, the double-stranded RNA of Samples 1 and 2 exhibited particularly excellent inhibitory effects on the proliferation of human neuroblastoma cells. Furthermore, the double-stranded RNA of Samples 1 to 5 had equivalent or superior cell-inhibiting function even at one-tenth the concentration. Of these, the double-stranded RNA of Sample 2 further improved its ability to inhibit the proliferation of human neuroblastoma cells by reducing its concentration.
[0079] <Cell proliferation test of human breast cancer cells> The same procedure as in the cell proliferation test of human neuroblastoma cells was performed except that the human breast cancer cell line MDA-MB-231 was used as the tumor cells. The cell viability in each test example is expressed as a percentage, with the measured value for the untreated well set at 100%, and is shown in Figure 4.
[0080] As shown in Figure 4, the cell viability of Samples 1 to 5 was reduced, and was significantly lower than that of the comparative example. Sample 5 (SEQ ID NO: 5) showed the lowest decrease in cell viability. From these results, it is believed that the double-stranded RNAs of Samples 1 to 5 have the function of inhibiting the proliferation of tumor cells (breast cancer cells).
[0081] <Cell proliferation test of A549 strain> Human lung cancer cells, A549 strain, were used as tumor cells. Cell proliferation was evaluated by removing the 96-well plate in which A549 cells had been cultured on day 4 (day 2 after siRNA addition), adding 10 μL of CCK-8 to each well, and then incubating the plate at 37°C and 5% CO 2The cells were incubated for 2.0 hours under the same conditions as in the human neuroblastoma cell proliferation test. The cell viability in each test example is shown in Figure 5 as a percentage of the measured value in the untreated well, which is set at 100%.
[0082] As shown in Figure 5, the cell viability of Sample 5 decreased, and was significantly lower than that of the comparative example. Furthermore, even though two days had passed since the addition of siRNA, the cell viability of Sample 5 decreased significantly. This suggests that the double-stranded RNA of Sample 5 has a special function of inhibiting the proliferation of tumor cells (lung cancer cells). The above tests, i.e., the tests shown in Figures 2 to 5, were each conducted independently on separate days.
[0083] Although specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.
[0084] In the technology disclosed herein, each component and each process mentioned herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.
[0085] Item 1: A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is determined from a base sequence encoding a signal peptide region of complement component C5.
[0086] Item 2: The double-stranded RNA according to Item 1, wherein the second strand is composed of a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.
[0087] Item 3: The double-stranded RNA according to Item 1 or 2, wherein at least three of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).
[0088] Item 4: The double-stranded RNA according to any one of Items 1 to 3, wherein the nucleotide sequence encoding the signal peptide region of complement component C5 consists of any one of the following nucleotide sequences: GGGCCTTTTTGGGAATACTT (SEQ ID NO: 1); GGCCTTTTGGGAATACTTT (SEQ ID NO: 2); CCTTTTGGGAATACTTTGT (SEQ ID NO: 3); CTTTTGGGAATACTTTGTT (SEQ ID NO: 4); GGAATACTTTGTTTTTTTAA (SEQ ID NO: 5).
[0089] Item 5: The double-stranded RNA according to any one of Items 1 to 4, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
[0090] Item 6: A composition that inhibits the proliferation of at least one type of cell, comprising the double-stranded RNA of any one of Items 1 to 5.
[0091] Item 7: The composition of Item 6, wherein the cells are tumor cells.
[0092] Item 8: The composition according to Item 6 or 7, wherein the composition comprises a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.
[0093] Item 9: A method for suppressing the proliferation of at least one type of cell, comprising: preparing the composition according to any one of Items 6 to 8; and supplying the composition to the cell in vitro or in vivo.
[0094] Item 10: The method according to Item 9, wherein the biological species of the cells is the same as the biological species containing the complement component C5.
[0095] As described above, the double-stranded RNA disclosed herein can inhibit (or suppress) cell proliferation, and therefore, by using the double-stranded RNA, a composition (e.g., an anti-tumor agent) that inhibits the proliferation of at least one type of cell (e.g., tumor cell) can be provided.
Claims
1. A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases with a base at the 5'-end being guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-end side of the main sequence, and wherein the main sequence is determined from among the base sequences encoding the signal peptide region of complement component C5, the double-stranded RNA.
2. The double-stranded RNA according to claim 1, wherein the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end side of the complementary main sequence.
3. The double-stranded RNA according to claim 1, wherein at least 3 bases out of the 5 bases on the 3'-end side of the main sequence are adenine (A) and / or uracil (U).
4. The double-stranded RNA according to claim 1, wherein the base sequence encoding the signal peptide region of complement component C5 is any one of the following base sequences: GGGCC TTTTG GGAA TACTT (SEQ ID NO: 1); GGCC TTTTG GGAA TACTTT (SEQ ID NO: 2); CCTTT TGGGA ATACT TTG T (SEQ ID NO: 3); CTTTT TGGGA ATACT TTGT T (SEQ ID NO: 4); GGAA TACTTT GTTTT TTA A (SEQ ID NO: 5).
5. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).
6. A composition for inhibiting the proliferation of at least one type of cell, comprising the double-stranded RNA according to any one of claims 1 to 5.
7. The composition according to claim 6, wherein the cell is a tumor cell.
8. The composition according to claim 7, comprising a peptide fragment having cell membrane permeability capable of introducing a foreign substance into the cytoplasm through the cell membrane from outside the cell.
9. A method for suppressing the proliferation of at least one type of cell, comprising a preparation step of preparing the composition according to claim 8, and a step of supplying the composition to the cell in vitro.
10. The method according to claim 9, wherein the cell species is the same as the species containing complement component C5.
Citation Information
Patent Citations
Pharmaceutical composition for treating or preventing c5 related disease and method for treating or preventing c5 related disease
JP2018123125A
COMPLEMENT COMPONENT C5IRNA COMPOSITIONS AND METHODS OF USE THEREOF
JP2016518331A
Complement component C5iRNA compositions and methods of use thereof for treating paroxysmal nocturnal hemoglobinuria (PNH)
JP2019518028A
Methods and compositions for the specific inhibition of complement component 5(C5) by double-stranded RNA
US20190218550A1
JP2023221597A