Cosmetic composition for skin whitening and wrinkle reduction containing mixed extract of flower, branch, and fruit of rosa multiflora thunb as active ingredient

Abstract

The present invention relates to a cosmetic composition for skin whitening and wrinkle reduction containing a mixed extract of a flower, a branch, and a fruit of Rosa multiflora Thunb as an active ingredient. The cosmetic composition of the present invention has a total polyphenol content of 134.63 mg GAE / g and a total flavonoid content of 18.08 mg GAE / g, and exhibits an ability to scavenge DPPH radicals and ABTS radicals, an ability to inhibit activities of tyrosinase and elastase, a melanin synthesis reduction effect, and an effect of decreasing expression levels of tyrosinase, MITF, TRP1, and TRP2 at both gene and protein levels, thereby exhibiting skin whitening and wrinkle reduction effects. Accordingly, the composition of the present invention can be effectively utilized as a material for cosmetics and health functional foods for skin whitening and wrinkle reduction.

Description

Cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches and fruits of Rosa multiflora thunbergii (ROSA MULTIFLORA THUNB) as an active ingredient

[0001] The present invention relates to a cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches and fruits of a thistle tree as an active ingredient.

[0002] The skin, the outermost epithelial tissue of the human and other animals, not only protects the body from external impact but also prevents the invasion of various pathogenic substances. It is composed of the epidermis, the outermost epithelial tissue, and the dermis, the connective tissue beneath it. Melanin pigment is distributed just above the mitotic layer among the various cell layers of the epidermis. The dermis layer is composed mostly of collagen and contains capillaries, sebaceous glands, and hair follicles. Beneath the dermis are subcutaneous fat and muscle layers.

[0003] Beyond its protective function, as described above, the skin is also an organ that senses sensations thanks to its distribution of various nerve cells. It also performs various other functions, including body temperature regulation, sweat excretion, and vitamin D synthesis. Among these, aesthetic and social functions are increasingly prominent in modern society. People can assess their mood and health by looking at the skin, and even perceive its attractiveness.

[0004] As skin ages, it becomes thinner and more vulnerable to damage. The epidermis and dermis thin, elasticity decreases, and glandular function declines, reducing the production of essential oils like sebum, leading to dryness. In particular, collagen, elastin, proteoglycans, glucosaminoglycans, laminin, and fibronectin in the dermis become oxidized and unable to function properly, leading to skin loss of elasticity and the formation of wrinkles.

[0005] Meanwhile, human skin color varies depending on the concentration and distribution of melanin pigment. In melanosomes, organelles within melanocytes, tyrosinase acts on tyrosine, an amino acid, to convert it to DOPA and dopaquinone, and then synthesizes melanin. Melanin absorbs ultraviolet rays within the skin and protects DNA from UV-induced damage. However, excessive melanin synthesis can darken skin tone and cause spots and freckles. Therefore, inhibiting tyrosinase activity and thus melanin synthesis, is an important part of skin whitening.

[0006] The present invention was derived under the above circumstances, and relates to a cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb. as an active ingredient, and the present invention was completed by confirming the scavenging ability of the composition for DPPH radicals and ABTS radicals, the activity inhibition ability of tyrosinase and elastase, the reduction in melanin synthesis, and the reduction in the gene and protein expression levels of tyrosinase, MITF, TRP1, and TRP2.

[0007] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.

[0008]

[0009] One aspect of the present invention for achieving the above object provides a cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb as an active ingredient.

[0010] In the present invention, the concentration of the mixed extract of flowers, branches, and fruits of the thistle tree may be 10 to 1000, 25 to 1000, 50 to 1000, 100 to 1000, 10 to 200, 25 to 200, 50 to 200, or 100 to 200 μg / mL. Preferably, the concentration of the extract may be 100 μg / mL, but is not limited thereto.

[0011] In the present invention, the extract may be extracted using water, a lower alcohol of C1 to C4, or a mixture thereof as an extraction solvent, and more specifically, may be ethanol, and even more specifically, may be ethanol of 60 to 80, 65 to 75% (v / v).

[0012] In the present invention, the flowers and branches of the thistle are 1:0.1 to 1:10, 1:0.1 to 1:7, 1:0.1 to 1:5, 1:0.1 to 1:3, 1:0.1 to 1:1, 1:0.2 to 1:10, 1:0.2 to 1:7, 1:0.2 to 1:5, 1:0.2 to 1:3, 1:0.2 to 1:1, 1:0.3 to 1:10, 1:0.3 to 1:7, 1:0.3 to 1:5, 1:0.3 to 1:3, 1:0.3 to 1:1, 1:0.4 to 1:10, 1 : It may be mixed in a dry weight ratio of 0.4 to 1:7, 1:0.4 to 1:5, 1:0.4 to 1:3, 1:0.4 to 1:1, 1:0.5 to 1:10, 1:0.5 to 1:7, 1:0.5 to 1:5, 1:0.5 to 1:3, 1:0.5 to 1:1, 1:1 to 1:10, 1:1 to 1:7, 1:1 to 1:5, 1:1 to 1:3, 1:3 to 1:10, 1:3 to 1:7, 1:3 to 1:5, 1:5 to 1:10 or 1:5 to 1:7, It is not limited thereto. Preferably, the flowers and branches of the thorn tree may be mixed in a dry weight ratio of 1:0.5 to 1:3, and more preferably, the flowers and branches of the thorn tree may be mixed in a dry weight ratio of 1:1.

[0013] In the present invention, the flowers and fruits of the thistle are mixed in an amount of 1:0.1 to 1:10, 1:0.1 to 1:7, 1:0.1 to 1:5, 1:0.1 to 1:3, 1:0.1 to 1:1, 1:0.2 to 1:10, 1:0.2 to 1:7, 1:0.2 to 1:5, 1:0.2 to 1:3, 1:0.2 to 1:1, 1:0.3 to 1:10, 1:0.3 to 1:7, 1:0.3 to 1:5, 1:0.3 to 1:3, 1:0.3 to 1:1, 1:0.4 to 1:10, It may be mixed in a dry weight ratio of 1:0.4 to 1:7, 1:0.4 to 1:5, 1:0.4 to 1:3, 1:0.4 to 1:1, 1:0.5 to 1:10, 1:0.5 to 1:7, 1:0.5 to 1:5, 1:0.5 to 1:3, 1:0.5 to 1:1, 1:1 to 1:10, 1:1 to 1:7, 1:1 to 1:5, 1:1 to 1:3, 1:3 to 1:10, 1:3 to 1:7, 1:3 to 1:5, 1:5 to 1:10 or 1:5 to 1:7. However, it is not limited thereto. Preferably, the flowers and fruits of the thorn tree may be mixed in a dry weight ratio of 1:3 to 1:7, and more preferably, the flowers and fruits of the thorn tree may be mixed in a dry weight ratio of 1:5.

[0014] In the present invention, the branches and fruits of the thistle are mixed in a ratio of 1:0.1 to 1:10, 1:0.1 to 1:7, 1:0.1 to 1:5, 1:0.1 to 1:3, 1:0.1 to 1:1, 1:0.2 to 1:10, 1:0.2 to 1:7, 1:0.2 to 1:5, 1:0.2 to 1:3, 1:0.2 to 1:1, 1:0.3 to 1:10, 1:0.3 to 1:7, 1:0.3 to 1:5, 1:0.3 to 1:3, 1:0.3 to 1:1, 1:0.4 to 1:10, It may be mixed in a dry weight ratio of 1:0.4 to 1:7, 1:0.4 to 1:5, 1:0.4 to 1:3, 1:0.4 to 1:1, 1:0.5 to 1:10, 1:0.5 to 1:7, 1:0.5 to 1:5, 1:0.5 to 1:3, 1:0.5 to 1:1, 1:1 to 1:10, 1:1 to 1:7, 1:1 to 1:5, 1:1 to 1:3, 1:3 to 1:10, 1:3 to 1:7, 1:3 to 1:5, 1:5 to 1:10 or 1:5 to 1:7. However, it is not limited thereto. Preferably, the branches and fruits of the thorn tree may be mixed in a dry weight ratio of 1:3 to 1:7, and more preferably, the branches and fruits of the thorn tree may be mixed in a dry weight ratio of 1:5.

[0015] In summary of the above dry weight ratios, preferably, the flowers, branches, and fruits of the thistle tree may be mixed in a dry weight ratio of 1:1:5. At the above dry weight ratio, the cosmetic composition for skin whitening and wrinkle improvement of the present invention may have the best antioxidant effect.

[0016] In the present invention, the composition is for skin whitening and wrinkle improvement. The skin whitening may be achieved by inhibiting melanin synthesis by inhibiting tyrosinase activity and reducing the gene and protein expression levels of tyrosinase, MITF, TRP1, and TRP2 involved in the melanin synthesis pathway.

[0017] The above wrinkle improvement may be achieved by preventing oxidation by scavenging DPPH radicals and ABTS radicals and inhibiting the activity of elastase to prevent wrinkle formation and maintain skin elasticity.

[0018] In the present invention, the cosmetic composition for skin whitening and wrinkle improvement can be manufactured in any formulation commonly manufactured in the art, for example, can be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, oil, powder foundation, emulsion foundation, wax foundation, and spray, and more specifically, can be manufactured in the cosmetic formulation of skin, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, eye cream, moisture cream, hand cream, essence, nutrition essence, pack, cleansing foam, cleansing water, cleansing lotion, cleansing cream, body lotion, body cleanser, soap, or powder, but is not limited thereto.

[0019] In the present invention, when the formulation of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0020] In the present invention, when the formulation of the cosmetic composition is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and particularly in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included.

[0021] In the present invention, when the formulation of the cosmetic composition is a solution or emulsion, a solvent, a solubilizer or an emulsifier is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0022] In the present invention, when the formulation of the cosmetic composition is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0023] The cosmetic composition of the present invention comprises, in addition to the above-mentioned effective ingredient, components commonly used in cosmetic compositions, such as fatty substances, organic solvents, solubilizers, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, metal ion sequestering and chelating agents, preservatives, vitamins, blocking agents, humectants, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles, and conventional auxiliary agents, and carriers.

[0024] The term "Rosa multiflora Thunb" used in the present invention is a shrub belonging to the Rosaceae family and is a deciduous broad-leaved tree commonly seen in mountains and fields throughout South Korea. It is mainly used for ornamental purposes, and its flower petals are edible and its fruits are used medicinally. The fruits of Rosa multiflora Thunb are called "Yeongsil" in traditional Korean medicine and are known to be used for insomnia, amnesia, liver diseases, diabetes, etc.

[0025]

[0026] Another aspect of the present invention provides a method for preparing a cosmetic composition for skin whitening and wrinkle improvement, comprising the steps of: extracting the flowers, branches, and fruits of Rosa multiflora Thunb in 70% ethanol at 100 °C; filtering each extract using filter paper, freeze-drying after concentration under reduced pressure to obtain powders of the flowers, branches, and fruits of Rosa multiflora Thunb; mixing the powders of the flowers, branches, and fruits of Rosa multiflora Thunb in a weight ratio of 1:1:1 to prepare a mixed extract; and preparing a cosmetic composition containing the mixed extract.

[0027]

[0028] Another aspect of the present invention provides a health functional food composition for skin whitening and wrinkle improvement containing a mixed extract of the flowers, branches, and fruits of Rosa multiflora Thunb as an active ingredient.

[0029] In the above health functional food composition, the mixed extract of the flowers, branches, and fruits of Rosa multiflora Thunb is as described above

[0030] The above health functional food composition is preferably prepared in any one of the forms of powder, granule, pill, tablet, capsule, candy, syrup, and beverage, but is not limited thereto. The health functional food composition of the present invention can be prepared by adding a new variety of watermelon as it is or mixing it with other foods or food ingredients, and can be appropriately prepared according to conventional methods.

[0031] The present invention relates to a cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb. as an active ingredient, wherein the cosmetic composition of the present invention has a total polyphenol content of 134.63 mg GAE / g and a total flavonoid content of 18.08 mg GAE / g. In addition, it was confirmed that the composition has excellent DPPH radical and ABTS radical scavenging ability, and thus, based on such antioxidant action, it can improve wrinkles and inhibit the activity of elastase to prevent wrinkle formation. In addition, it was confirmed that the composition not only inhibits the activity of tyrosinase related to melanin synthesis, but also reduces the expression levels of tyrosinase, MITF, TRP1, and TRP2 involved in melanin synthesis, thereby having an excellent skin whitening effect.

[0032] Figure 1 shows the DPPH radical scavenging activity of the mixed extract of flowers, branches, and fruits of the thistle tree at different concentrations.

[0033] Figure 2 shows the ABTS radical scavenging activity of the mixed extract of flowers, branches, and fruits of the thistle tree at different concentrations.

[0034] Figure 3 shows the tyrosinase inhibitory activity of a mixed extract of flowers, branches, and fruits of the common thorn tree at different concentrations.

[0035] Figure 4 shows the inhibition of elastase activity according to the concentration of a mixed extract of flowers, branches, and fruits of the common thorn tree.

[0036] Figure 5 shows the cell viability of B16F10 cells treated with a mixture of extracts of flowers, branches, and fruits of the common thorn tree.

[0037] Figure 6 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on melanin production in α-MSH-induced B16F10 cells.

[0038] Figure 7 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of tyrosinase mRNA in α-MSH-induced B16F10 cells.

[0039] Figure 8 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of MITF mRNA in α-MSH-induced B16F10 cells.

[0040] Figure 9 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of TRP1 mRNA in α-MSH-induced B16F10 cells.

[0041] Figure 10 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of TRP2 mRNA in α-MSH-induced B16F10 cells.

[0042] Figure 11 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of tyrosinase protein in α-MSH-induced B16F10 cells.

[0043] Figure 12 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of MITF protein in α-MSH-induced B16F10 cells.

[0044] Figure 13 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of TRP1 protein in α-MSH-induced B16F10 cells.

[0045] Figure 14 shows the effect of a mixed extract of flowers, branches, and fruits of the common thorn on the expression of TRP2 protein in α-MSH-induced B16F10 cells.

[0046] One aspect of the present invention provides a cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb as an active ingredient.

[0047] In the present invention, the concentration of the mixed extract of flowers, branches, and fruits of the thistle tree may be 100 μg / mL.

[0048] In the present invention, the extract may be extracted using 65 to 75% (v / v) ethanol as an extraction solvent.

[0049] In the present invention, the flowers and branches of the thistle tree may be mixed in a dry weight ratio of 1:1.

[0050] In the present invention, the flowers and fruits of the thistle tree may be mixed in a dry weight ratio of 1:5.

[0051] In the present invention, the branches and fruits of the thistle tree may be mixed in a dry weight ratio of 1:5.

[0052] Another aspect of the present invention provides a method for preparing a cosmetic composition for skin whitening and wrinkle improvement, comprising the steps of: extracting flowers, branches, and fruits of a thorn tree, respectively, in 70% ethanol at 100°C; filtering each extract using a filter paper, concentrating under reduced pressure, and then freeze-drying to obtain powders of flowers, branches, and fruits of a thorn tree; mixing the powders of flowers, branches, and fruits of the thorn tree in a weight ratio of 1:1:1 to prepare a mixed extract; and preparing a cosmetic composition comprising the mixed extract.

[0053] Another aspect of the present invention provides a health functional food composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb as an active ingredient.

[0054] Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are provided for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0055]

[0056] Preparation Example 1. Materials

[0057] The flowers, branches, and fruits of the thistle tree used as samples in the present invention were received from We Beauty Co., Ltd. (Korea).

[0058] In the present invention, gallic acid, quercertin, sodium carbonate, aluminum nitrate nonahydrate, potassium acetate solution, 1,1-diphenyl-2-picryl-hydrazyl (DPPH), 2,2'-azinobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS), penicillin-streptomycin, trypan blue, alpha-melanocyte stimulating hormone (α-MSH), melanin, protease inhibitor cocktail, phosphatase inhibitor cocktail, mushroom tyrosinase, and levodopa used as reagents were products of Sigma-Aldrich (USA), and EZ-cytox was a product of DoGenBio (Korea). Dulbecco's modified eagle's medium (DMEM) and fetal bovine serum (FBS) were from Gibco (USA). Easy-spin™ total RNA extraction kit, acrylamide-Bis Solution 30%, 1.5 M Tris-HCl (pH 8.8), 0.5 M Tris-HCl (pH 6.8), 10X Tris-Glycine-SDS buffer, GangNam-STAIN™ prestained protein ladder, 10X transfer buffer, 10X TBS with Tween 20, miracle-star™ western blot detection system were from iNtRON Biotechnology (Korea). Accupower® cyclescript RT premix (dT20) and DEPC-DW were from Bioneer (Korea).In addition, qPCRBIO SyGreen Blue Mix Lo-ROX was used from PCR Biosystems (USA), RIPA lysis and extraction buffer, Pierce™ BCA protein assay Kit, and 10% ammonium persulfate were used from Thermo Fisher Scientific (USA). Sample buffer was from ELPISbiotech (Korea), TEMED was from Bio-RAD (USA), ultra pure bovine serum albumin; BSA was from GenDEPOT (USA), tyrosinase, MITF, TRP1, and TRP2 antibodies were from Santa Cruz Biotechnology (USA), and peroxidase-conjugated affinipure goat anti-rabbit IgG (H + L) and peroxidase-conjugated affinipure goat anti-mouse IgG (H + L) were from Jackson immunoresearch (USA).

[0059] Among the devices used in the present invention, the extraction mantle was manufactured by Misung Scientific (Korea), the rotary vacuum evaporator was manufactured by EYELA (Japan), the freeze dryer was manufactured by ilShinbiobase (Korea), the CO2 incubator, autoclave (deep-freezer) was manufactured by Sanyo (Japan), the clean bench was manufactured by Vision scientific (Korea), the vortex mixer, centrifuge, and ice-maker were manufactured by Vision scientific (Korea), the plate shaker was manufactured by Lab-Line (USA), the micro plate reader was manufactured by Molecular Devices (USA), the nanodrop was manufactured by Thermo Fisher Scientific (USA), the PCR cycler; alpha cycler 1 PCRmax was manufactured by PCRmax (UK), the real-time PCR cycler; Exicycler 96 was manufactured by Bioneer (Korea), chemidoc; and the fusion FX was manufactured by Vilber Lourmat (France).

[0060]

[0061] Preparation Example 2. Sample Extraction

[0062] 10 g of Rosa multiflora Thunb flowers, 30 g of branches, and 30 g of fruits were each extracted with 1 L of 70% ethanol at 100℃ for 3 hours, and the extracts were filtered using a filter paper. The filtered extracts were concentrated under reduced pressure using a rotary vacuum evaporator and freeze-dried using a freeze dryer. After freeze-drying, powder was obtained, and the three powders were mixed in equal amounts to prepare a mixture (Rosa multiflora Thunb complex; RMC). The prepared mixture was stored at -20℃, divided into portions on the day of the experiment, and dissolved in distilled water for use. Information on the extracts used in the present invention is as follows in Table 1.

[0063] Scientific namePartsOriginYield (g)Yield ratio (%)Rosa multifloraThunbFlowersKorea3.3533.45Leaves and branchKorea13.2044.00FruitKorea9.4131.36

[0064]

[0065] Example 1. Measurement of total polyphenol content

[0066] A mixed extract of the flowers, branches, and fruits of the common thorn was prepared at a concentration of 1 mg / mL, and 0.5 mL of 50% Folin-Ciocalteu's phenol reagent was added to 1 mL of the sample and reacted at room temperature for 3 minutes. 1 mL of a saturated Na2CO3 solution and 7.5 mL of distilled water were mixed sequentially in the reaction solution, allowed to stand for 30 minutes, and centrifuged at 14,000 g for 10 minutes. The supernatant was collected and the absorbance was measured at a wavelength of 760 nm. The total phenol content was determined according to a calibration curve prepared using gallic acid as a standard.

[0067] The total polyphenol content in the extract was measured using gallic acid as a standard substance, and was found to be 134.63±3.02 mg GAE / g (GAE is galic acid equivalent).

[0068]

[0069] Example 2. Measurement of total flavonoid content

[0070] A mixed extract of the flowers, branches, and fruits of the common thorn tree was prepared at a concentration of 1 mg / mL. 0.5 mL of a mixture of 0.1 mL of the sample and 0.9 mL of 80% ethanol was added, 10% aluminum nitrate, 0.1 mL of 1 M potassium acetate, and 4.3 mL of 80% ethanol. After leaving it at room temperature for 40 minutes, the absorbance was measured at a wavelength of 415 nm, and the content was determined from a standard curve prepared using quercetin.

[0071] The total flavonoid content in the extract was measured using quercetin as a standard substance, and was found to be 18.08±0.27 mg QE / g (QE is quercetin equivalent).

[0072]

[0073] Example 3. Measurement of DPPH radical scavenging activity

[0074] The final concentrations of the mixed extracts of the flowers, branches, and fruits of the common thorn were diluted to 1, 10, 100, and 1000 μg / mL, and 100 μL of the sample was mixed with 150 μL of a 0.2 mM DPPH solution dissolved in ethanol, and the mixture was reacted at 37°C for 30 minutes. After the reaction, the absorbance was measured at a wavelength of 517 nm. Distilled water was added as the control group for the sample, and ethanol was added as the control group for the DPPH solution to obtain a correction value. The DPPH radical scavenging activity was calculated according to the following equation (1).

[0075] Absorbance (%) = ((absorbance of control group) - (absorbance of sample added group)) ÷ (absorbance of control group) × 100 (1)

[0076] As a result of measuring DPPH radical scavenging activity, the extract showed a concentration-dependent increase in scavenging activity, as shown in Table 2 below (Fig. 1).

[0077] Concentration (μg / mL)DPPH radical scavenging activity (%)12.84±1.381035.43±1.4810090.43±2.50100093.06±0.15

[0078]

[0079] Example 4. Measurement of ABTS radical scavenging activity

[0080] The final concentrations of the mixed extracts of the flowers, branches, and fruits of the common thorn were diluted to 1, 10, 100, and 1000 μg / mL, and the ABTS solution was prepared by mixing 7.4 mM ABTS (2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)) and 2.6 mM potassium persulfate. The solution was left in the dark for one day to form cations (ABTS·+), and then the absorbance was measured at 732 nm. The solution was diluted to obtain an absorbance value of 1.5 or less. 150 μL of the diluted ABTS·+ solution and 5 μL of the sample were mixed, reacted at room temperature for 10 minutes, and then the absorbance was measured at a wavelength of 732 nm. The ABTS radical scavenging activity was calculated according to the following equation (2).

[0081] Absorbance (%) = (1 - (absorbance of sample added group) ÷ (absorbance of control group)) × 100 (2)

[0082] As a result of measuring ABTS radical scavenging activity, the extract showed a concentration-dependent increase in scavenging activity, as shown in Table 3 below (Fig. 2).

[0083] Concentration (μg / mL)ABTS radical scavenging activity (%)10.80±0.441011.61±0.5310092.53±0.34100094.23±0.07

[0084]

[0085] Example 5. Measurement of Tyrosinase Inhibition

[0086] Since inhibition of tyrosinase, an enzyme involved in melanin biosynthesis, suppresses melanin production and results in a whitening effect, the tyrosinase inhibition activity was measured. The mixed extract of flowers, branches, and fruits of the common holly tree was diluted to final concentrations of 10, 50, 100, 500, and 1000 μg / mL, and 200 μL of 100 mM sodium phosphate buffer (pH 6.5) and 20 μL of 2000 U / mL mushroom tyrosinase were added to 20 μL of each concentration sample and mixed. 40 μL of 1.5 mM levodopa was added to this solution and reacted at 37°C for 15 minutes, and the absorbance was measured using a microplate reader at a wavelength of 490 nm. The tyrosinase inhibition activity was calculated according to the following equation (3).

[0087] Inhibition (%) = (1 - (absorbance of sample added group) ÷ (absorbance of control group)) × 100 (3)

[0088] As a result of measuring tyrosinase inhibitory activity, the extract showed a concentration-dependent increase in inhibitory activity, as shown in Table 4 below (Fig. 3).

[0089] Concentration (μg / mL)Tyrosinase inhibitory activity (%)1013.39±2.825019.08±3.8310027.30±3.5150034.37±3.43100043.87±1.95

[0090]

[0091] Example 6. Evaluation of Elastase Activity Inhibition

[0092] When the activity of elastase, an enzyme involved in skin elasticity, is inhibited, elastase cannot form wrinkles, resulting in an improvement in wrinkles. Therefore, the degree of inhibition of elastase activity was evaluated using Kraunsoe's method. Specifically, test products diluted at various concentrations in 50 mM Tris-HCl (pH 8.0) were dispensed into 96-well plates, and 1 mg / ml N-succinyl-tri-alanyl-p-nitroanilide (Sigma) and 0.6 U / ml porcine pancreas elastase (Sigma) were added and reacted at 25°C for 15 minutes. After that, the absorbance was measured at 405 nm using a microplate reader, and the experiment was repeated three times. The degree of inhibition of elastase activity was expressed by calculating the absorbance of the sample-added group and the control group using the following equation.

[0093] Elastase activity inhibition (%) = ((absorbance of negative control group - absorbance of control group) - (absorbance of sample addition group - absorbance of control group)) ÷ (absorbance of negative control group - absorbance of control group) × 100 (4)

[0094] As a result of measuring the inhibition of elastase activity, the extract showed a concentration-dependent increase in inhibition activity, as shown in Table 5 below (Fig. 4).

[0095] Concentration (mg / mL)Elastase inhibitory activity (%)00.0000.011.146 * 0.11.394 ** 19.416 ** 1060.787 **

[0096]

[0097] Example 7. Cell culture

[0098] B16F10 cells, mouse-derived melanoma cells, were purchased from the Korean Cell Line Bank (KCLB) and cultured in DMEM medium supplemented with 10% FBS in a cell incubator maintained at 37°C and 5% CO2. Cell passages were performed every 2-3 days.

[0099]

[0100] Example 8. Measurement of cell viability

[0101] B16F10 cells were seeded in 48-well plates at 2X10 4 The cells were seeded at 1 cell / well and cultured for 24 hours. The mixed extract of flowers, branches, and fruits of the common thorn was treated at concentrations of 25, 50, 100, and 200 μg / mL and cultured for another 24 hours. After all cultures were completed, 10 μL of EZ-Cytox solution was added per 100 μL of culture medium and incubated in a cell incubator for 30 minutes. After the reaction, the absorbance was measured at a wavelength of 450 nm, and the cell viability was expressed as a percentage compared to the control group.

[0102] As a result of measuring cell viability, as shown in Table 6 below, the extract showed proliferation of cells at a concentration of 100 μg / mL or less, and toxicity was observed at a concentration of 200 μg / mL or more, so subsequent experiments were conducted at a concentration of up to 100 μg / mL (Fig. 4).

[0103] Concentration (μg / mL)Cell viability (% of Control)Control100.00±0.5525105.85±1.365099.09±0.7210095.00±2.6820087.24±1.20

[0104]

[0105] Example 9. Evaluation of melanin production

[0106] B16F10 cells were seeded at 1X10 in a 6-well plate 5The cells were seeded at 1 cell / well and cultured for 18 hours, and treated with a mixed extract of flowers, branches, and fruits of the common thorn at concentrations of 25, 50, and 100 μg / mL. 20 nM α-MSH was added and cultured for another 60 hours. After all cultures were completed, 100 μL of the culture solution was transferred to a 96-well plate, and the absorbance was measured at a wavelength of 490 nm. A standard curve was obtained using melanin, and the amount of melanin produced in the medium was analyzed by calculating it.

[0107] As a result of measuring the amount of melanin production, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 50 μg / mL or higher, as shown in Table 7 below (Fig. 5).

[0108] Concentration (μg / mL)Melanin level (μg / mL)Normal72.37±1.09Control153.15±0.93 +++ 25155.20±2.2950144.44±1.47 ** 10052.50±0.88 ***

[0109]

[0110] Example 10. Measurement of gene expression levels

[0111] B16F10 cells were seeded at 1X10 in a 6-well plate 5The cells were seeded at 1 / well and cultured for 18 hours, and treated with a mixed extract of flowers, branches, and fruits of the common thorn at concentrations of 25, 50, and 100 μg / mL, and 20 nM α-MSH was added and cultured for another 60 hours. After all cultures were completed, RNA was extracted from the cells obtained by centrifugation using a total RNA prep kit, and the extracted RNA was mixed with the reverse transcription premix and synthesized as cDNA through a reaction at 45°C for 60 minutes and 95°C for 5 minutes using a PCR cycler. Real-time PCR was performed to amplify and identify a specific gene from the synthesized cDNA. The cDNA, primers for a specific gene, and SYBR green premix were mixed and reacted at 95°C for 2 minutes, and the specific gene was amplified by 40 cycles of 95°C for 5 seconds and 62.5°C for 30 seconds. Gene expression levels were quantified relative to the control group's gene expression levels, and information on the primers used is shown in Table 8 below.

[0112] Seq ID NoGene nameSize (bp)F / RSequences1Tyrosinase116FATCGGCCAACGATCCCATTT2RTAGGTGCATTGGCTTCTGGG3MITF94FCCAGGCCTTACCATCAGCAA4RTTGCTTCAGAC TCTGTGGGG5TRP173FCTACAGACAGTTTTTCGAAAT6RCTTCGAACAGCAGGGTCATA7TRP2103FCAGGAATGCACTGGAAGGGT8RGGCATTGGTCCCATTCAGGA9Beta actin102FCACTGTCGAGTCGCGTCC10RCGCAGCGATATCGTCATCCA

[0113]

[0114] As a result of measuring the expression level of the tyrosinase gene, as shown in Table 9 below, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 25 μg / mL or higher (Fig. 6).

[0115] Concentration (μg / mL)Tyrosinase mRNA expressionNormal0.41±0.07Control1.00±0.00 ++ 250.80±0.06 * 500.60±0.06 ** 1000.23±0.04 ***

[0116]

[0117] As a result of measuring the MITF gene expression level, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 25 μg / mL or higher, as shown in Table 10 below (Figure 7).

[0118] Concentration (μg / mL)MITF mRNA expressionNormal0.08±0.03Control1.00±0.00 +++ 250.80±0.06 * 500.33±0.06 ** 1000.23±0.06 **

[0119]

[0120] As a result of measuring the TRP1 gene expression level, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 100 μg / mL or higher, as shown in Table 11 below (Fig. 8).

[0121] Concentration (μg / mL)TRP1 mRNA expressionNormal0.37±0.04Control1.00±0.00 ++ 250.98±0.04500.88±0.061000.64±0.02 ***

[0122]

[0123] As a result of measuring the TRP2 gene expression level, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 25 μg / mL or higher, as shown in Table 12 below (Fig. 9).

[0124] Concentration (μg / mL)TRP2 mRNA expressionNormal0.26±0.07Control1.00±0.00 ++ 250.76±0.07 * 500.37±0.06 ** 1000.28±0.04 **

[0125]

[0126] Example 11. Measurement of protein expression level

[0127] B16F10 cells were seeded at 1X10 in a 6-well plate 5The cells were seeded at 1 / well and cultured for 18 hours, and treated with a mixed extract of flowers, branches, and fruits of the common thorn at concentrations of 25, 50, and 100 μg / mL. 20 nM α-MSH was added and cultured for another 60 hours. After washing twice with cold PBS, the cells were added to RIPA buffer containing protease inhibitor cocktail I, phosphatase inhibitor II, and III to extract proteins. The extracted proteins were quantified using a Pierce BCA protein assay kit and mixed with loading sample buffer for incubation at 95°C for 5 minutes. The prepared proteins were separated by size by SDS-PAGE on a 10% acrylamide gel and transferred to a PVDF membrane. The membrane with the transferred proteins was soaked in 5% BSA and incubated at room temperature for 2 hours. After washing three times with TBS-T buffer, the cells were incubated with tyrosinase (1:500), MITF (1:1000), TRP1 (1:1000), and TRP2 (1:500) primary antibodies at 4°C for 14 hours. After washing three more times, secondary antibodies (1:10000) were added, and incubated for 1 hour at room temperature. After washing ten more times, the proteins were developed using ECL solution. Afterwards, the protein expression level was analyzed using Chemidoc Fusion FX.

[0128] As a result of measuring the expression level of tyrosinase protein, as shown in Table 13 below, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 25 μg / mL or higher (Fig. 10).

[0129] Concentration (μg / mL)Tyrosinase protein expressionNormal0.51±0.01Control1.00±0.02 +++ 250.69±0.04*** 500.68±0.04 *** 1000.18±0.01 ***

[0130]

[0131] As a result of measuring the MITF protein expression level, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 25 μg / mL or higher, as shown in Table 14 below (Fig. 11).

[0132] Concentration (μg / mL)MITF protein expressionNormal0.40±0.01Control1.00±0.02 +++ 250.53±0.03 *** 500.44±0.03 *** 1000.38±0.02 ***

[0133]

[0134] As a result of measuring the TRP1 protein expression level, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 100 μg / mL or higher, as shown in Table 15 below (Fig. 12).

[0135] Concentration (μg / mL)TRP1 protein expressionNormal0.54±0.07Control1.00±0.09 +++ 251.00±0.03501.04±0.041000.43±0.03 ***

[0136]

[0137] As a result of measuring the TRP2 protein expression level, the extract showed a concentration-dependent and significant decrease compared to the control group at a concentration of 25 μg / mL or higher, as shown in Table 16 below (Fig. 13).

[0138] Concentration (μg / mL)TRP2 protein expressionNormal0.72±0.02Control1.00±0.02 +++ 250.61±0.03 ***500.59±0.04 *** 1000.33±0.02 ***

[0139]

[0140] Example 12. Comparison of antioxidant efficacy according to the weight ratio of flowers, branches, and fruits of the common thorn tree.

[0141] In order to derive the optimal combination of flower, branch, and fruit contents in the mixed extract of the flower, branch, and fruit of the common thorn tree, the antioxidant efficacy according to each weight ratio was compared. The same method as described in Preparation Example 2 was used for sample preparation, and the mass (g) of the flower, branch, and fruit of each sample was combined as shown in Table 17 below. The antioxidant efficacy was measured using ABTS radical scavenging activity, which is more suitable for evaluating the efficacy of hydrophilic antioxidants.

[0142] NO.RatioABTS꽃가지열매Sample 111112.48Sample 211311.26Sample 311518.87Sample 411711.18Sample 513110.24Sample 61336.56Sample 713513.85Sample 813713.11Sample 915115.67Sample 1015312.20Sample 1115513.58Sample 1215710.72Sample 131717.41Sample 141736.66Sample 1517511.91Sample 1617713.20Sample 1731114.23Sample 1831312.19Sample 1931514.64Sample 2031711.60Sample 213317.48Sample 223336.53Sample 2333513.02Sample 2433713.10Sample 2535113.41Sample 2635312.43Sample 2735513.17Sample 2835710.89Sample 2937111.44Sample 3037312.01Sample 3137512.33Sample 3237713.49Sample 335119.84Sample 3451313.12Sample 3551513.35Sample 3651712.34Sample 3753114.52Sample 3853313.88Sample 395357.51Sample 405379.33Sample 4155114.08Sample 4255313.00Sample 4355512.45Sample 4455711.83Sample 455717.39Sample 465735.50Sample 475758.10Sample 4857711.71Sample 4971113.00Sample 507139.92Sample 5171512.45Sample 527178.62Sample 537316.36Sample 547335.53Sample 557357.95Sample 5673710.97Sample 5775113.50Sample 5875312.10Sample 5975512.40Sample 6075710.85Sample 617719.78Sample 627739.22Sample 6377510.63Sample 6477712.05.

[0143]

[0144] In the above results, only the results for flowers and branches are shown in Table 18 below. The case where the weight ratio of flowers and branches was 1:1 was the best, and as the ratio of flowers increased, the antioxidant efficacy decreased, and no consistent results were shown for the ratio of branches.

[0145] Sample No. Flower Branch ABTS1-41113.455-81310.949-121513.0413-16179.8017-203113.1621-243310.0325-283512.4829-323712.3233-365112.1637-405311.3141-445512.8445-48578.1849-527111.0053-56737.7057-607512.2161-647710.42

[0146]

[0147] The results for flowers and fruits only are shown in Table 19 below. The antioxidant efficacy was the best when the weight ratio of flowers and fruits was 1:5, and the antioxidant efficacy tended to decrease as the flower ratio increased based on the weight ratio of 1:5, and the antioxidant efficacy tended to decrease when the fruit ratio was greater or less than 5.

[0148] Sample No. Flower Fruit ABTS1,5,9,131111.452,6,10,14139.173,7,11,151514.554,8,12,161712.0517,21,25,293111.6418,22,26,303310.7919,23,27,313513.2920,24,28,323712.2 733,37,41,455111.4634,38,42,465311.3835,39,43,475510.3536,40,44,485711.3049,53,57,617110.6650,54,58,62739.1951,55,59,637510.8652,56,60,647710.62

[0149]

[0150] Comparing the results for eggplant and fruit, as shown in Table 20 below, the case where the weight ratio was 1:5 was the best, and as the content of eggplant increased based on the weight ratio of 1:5, the antioxidant efficacy tended to decrease.

[0151] Sample No. Eggplant Fruit ABTS1,17,33,491112.392,18,34,501311.623,19,35,511514.834,20,36,521710.935,21,37,53319.656,22,38,54338.137,23,39,553510.598,24,40,563711. 639,25,41,575114.1710,26,42,585312.4311,27,43,595512.9012,28,44,605711.0713,29,45,61719.0014,30,46,62738.3515,31,47,637510.7416,32,48,647712.61

[0152]

[0153] Statistical processing

[0154] The experimental results were expressed as mean ± standard deviation of the mean, and SPSS Statistics Version 21.0 (IBM, USA) was used. Statistical comparisons between the two groups were performed using independent sample t-tests, and statistical significance was expressed at three significance levels: p < 0.05, p < 0.01, and p < 0.001.

[0155]

[0156] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0157] The present invention relates to a cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb. as an active ingredient. The cosmetic composition of the present invention has a total polyphenol content of 134.63 mg GAE / g and a total flavonoid content of 18.08 mg GAE / g, and has been confirmed to exhibit scavenging activity of DPPH radicals and ABTS radicals, inhibitory activity of tyrosinase and elastase, reduction of melanin synthesis, and reduction of gene and protein expression levels of tyrosinase, MITF, TRP1, and TRP2, thereby exhibiting skin whitening and wrinkle improvement effects. Therefore, the composition of the present invention can be usefully used as a material for cosmetics and health functional foods for skin whitening and wrinkle improvement.

Claims

1. A cosmetic composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb. as an effective ingredient.

2. A cosmetic composition for skin whitening and wrinkle improvement, wherein the concentration of the extract in paragraph 1 is 100 to 1000 μg / mL.

3. A cosmetic composition for skin whitening and wrinkle improvement in paragraph 1, wherein the extract is extracted using water, a lower alcohol of C1 to C4, or a mixture thereof as an extraction solvent.

4. A cosmetic composition for skin whitening and wrinkle improvement, characterized in that in paragraph 1, the extract scavenges DPPH radicals, scavenges ABTS radicals, inhibits the activity of tyrosinase and elastase, reduces the amount of melanin production, and reduces the expression of tyrosinase, MITF, TRP1, and TRP2.

5. A cosmetic composition for skin whitening and wrinkle improvement, wherein the flowers and branches of the thistle tree are mixed in a dry weight ratio of 1:0.1 to 1:10 in the first paragraph.

6. A cosmetic composition for skin whitening and wrinkle improvement, wherein the flowers and fruits of the thistle tree are mixed in a dry weight ratio of 1:0.1 to 1:10 in the first paragraph.

7. A cosmetic composition for skin whitening and wrinkle improvement, wherein the branches and fruits of the thistle tree are mixed in a dry weight ratio of 1:0.1 to 1:10 in the first paragraph.

8. Step of extracting the flowers, branches, and fruits of the thistle tree in 70% ethanol at 100℃; A step of filtering each extract using a filter paper, concentrating under reduced pressure, and then freeze-drying to obtain powder of flowers, branches, and fruits of the thistle; A step of preparing a mixed extract by mixing powders of flowers, branches, and fruits of the above-mentioned thistle in a weight ratio of 1:1:1; and A method for producing a cosmetic composition for skin whitening and wrinkle improvement, comprising: a step of producing a cosmetic composition containing the above mixed extract.

9. A health functional food composition for skin whitening and wrinkle improvement containing a mixed extract of flowers, branches, and fruits of Rosa multiflora Thunb. as an effective ingredient.

Images