High-isoprenol-producing strain and method for producing isoprenol using same

A recombinant E. coli strain with precise gene expression control optimizes carbon flow for isoprenol production in minimal media, addressing economic costs and improving productivity by 37.5%.

WO2025143854A1PCT designated stage expired Publication Date: 2025-07-03POSTECH ACADEMY INDUSTRY FOUNDATION
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/021247
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-29
Filing Date
2024-12-27
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing isoprenol production methods require nutrient-rich media to avoid competition between acetyl-CoA flow for isoprenol production and cell-building block formation, leading to high economic costs.

Method used

A recombinant E. coli strain with precise control of gene expression using different inducible promoters to balance precursors, optimizing carbon flow towards mevalonate production, cultured in a minimal medium.

Benefits of technology

Enhances isoprenol productivity by 37.5% compared to overexpression alone, enabling economical production without nutrient supplements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024021247_03072025_PF_FP_ABST
    Figure KR2024021247_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for producing isoprenol in a minimal medium by precisely regulating an isoprenol biosynthesis metabolic pathway and the growth of a strain. Specifically, by producing a recombinant Escherichia coli strain having maximized isoprenol productivity and allowing cultivation thereof in a minimal medium, the present invention enables economically superior production of isoprenol, and thus can be widely applied in the aviation fuel industry where isoprenol is used as a precursor, or in the biofuel industry where isoprenol is used directly.
Need to check novelty before this filing date? Find Prior Art

Description

High-producing strain of isoprenol and method for producing isoprenol using the same

[0001] The present invention relates to a method for producing isoprenol in a minimal medium by precisely controlling the isoprenol biosynthetic metabolic pathway and the growth of the strain, and more specifically, to a recombinant strain with improved productivity of isoprenol by optimizing the carbon flow for isoprenol production by precisely controlling foreign genes simultaneously with different inducible promoters and different inducers, and to a method for producing isoprenol using the same.

[0002] The importance of biofuels is growing increasingly crucial to addressing oil depletion and the accumulation of greenhouse gases resulting from climate change. While electric vehicles are advancing in the transportation market, their use is limited for long-distance vehicles and aircraft, necessitating the replacement of oil with sustainable biofuels.

[0003] As an alternative, isoprenol, which boasts similar energy density and combustion efficiency to gasoline and is considered a gasoline substitute, is attracting attention in the shared fuel industry as a biological precursor to DMCO, a future high-performance aviation fuel.

[0004] Biological production of isoprenol can be achieved by introducing foreign genes to avoid feedback inhibition of endogenous genes, a process called isoprenol production along the mevalonate pathway. The upstream mevalonate pathway consists of the mvaE and mvaS genes from Enterococcus faecalis, while the downstream mevalonate pathway involves the introduction of MK, PMK, and MDD genes from Saccharomyces cerevisiae and nudF from Bacillus subtilis, resulting in isoprenol production.

[0005] Because mevalonate is a key precursor for isoprenol production, it is crucial to concentrate acetyl-CoA upstream of mevalonate into the isoprenol production pathway. However, within cells, acetyl-CoA has struggled to compete with isoprenol production for cell building block formation and energy production.

[0006] Therefore, most previous studies have attempted to circumvent this competition by culturing cells in nutrient-rich media supplemented with large amounts of nutritional supplements (beef extract, yeast extract, peptone, citrate). These richly nutrient-rich media are rich in amino acids and cell-building blocks, allowing the carbon flow from the substrate to be concentrated in isoprenol rather than being diverted to other pathways, such as the TCA cycle. However, this approach presents significant economic challenges.

[0007] To address the above issues, research is currently underway to increase production by precisely controlling gene expression in key metabolic pathways to balance precursors. This research approach is expected to contribute to increasing the economic efficiency of biofuel production by enabling the production of sufficient amounts of isoprenol even in economically viable minimal media.

[0008] Accordingly, the inventors of the present invention completed the present invention by identifying a recombinant strain that improved the productivity of isoprenol by precisely controlling the amount of gene expression for the balance between precursors and optimizing the carbon flow toward mevalonic acid and strongly expressing genes downstream of mevalonic acid.

[0009] The present invention aims to provide a recombinant strain that optimizes the carbon flow toward mevalonic acid by precisely controlling the amount of gene expression for a balance between precursors and enhances the productivity of isoprenol by strongly expressing genes downstream of mevalonic acid.

[0010] Another object of the present invention is to provide a method for producing isoprenol, which comprises a step of culturing a recombinant E. coli for producing isoprenol.

[0011] In order to solve the above problems, the present invention comprises (1) the mvaE gene represented by SEQ ID NO. 1 linked to the Tet promoter represented by SEQ ID NO. 7 and the Nar promoter (P represented by SEQ ID NO. 8) FdeA ) is linked to a recombinant vector; (2) a recombinant vector comprising an MK gene represented by SEQ ID NO: 3 linked to a T7 promoter represented by SEQ ID NO: 9, a PMK gene represented by SEQ ID NO: 4 linked to a T7 promoter represented by SEQ ID NO: 9, and an MDD gene represented by SEQ ID NO: 5 linked to a T7 promoter represented by SEQ ID NO: 9; and (3) a recombinant strain into which a recombinant vector comprising a nudF gene represented by SEQ ID NO: 6 linked to a T7 promoter represented by SEQ ID NO: 9 is introduced.

[0012] It is preferable that the recombinant vector of the above (1) is pACYC-based.

[0013] It is preferable that the recombinant vector of the above (2) is pET-based.

[0014] It is preferable that the recombinant vector of the above (3) is pCDF-based.

[0015] It is preferable that the above strain is Escherichia coli.

[0016] In addition, the present invention provides a method for producing isoprenol obtained by culturing the recombinant strain described above in a minimal medium.

[0017] It is preferred that the above minimum badge be an M9 badge.

[0018] It is preferred that the above minimal medium contain aTc and naringenin.

[0019] It is preferable that the above cultivation be a fed-batch cultivation.

[0020] According to the present invention, when the gene expression of mvaE and mvaS is precisely controlled simultaneously for precursor balance, carbon optimization for isoprenol production is possible, and a recombinant E. coli with maximized isoprenol productivity can be produced and cultured in a minimal medium.

[0021] Accordingly, isoprenol can be produced economically and efficiently using the recombinant E. coli, and can be used in various fields such as aviation fuel where isoprenol is used as a precursor or in the biofuel industry where isoprenol is used directly.

[0022] Figure 1 is a schematic diagram showing an outline of an invention for efficient production of isoprenol in E. coli.

[0023] Figure 2 is a graph showing the production of isoprenol by controlling the expression of mvaE and mvaS genes by combining two inducers, naringenin and aTc, at various concentrations in the BI02 strain of the present invention.

[0024] Figure 3 is a graph showing the isoprenol production of the BI01 strain of the present invention in M9 medium (A), isoprenol production of the BI01 strain in M9Y medium (B), and isoprenol production of the BI02 strain in M9 medium under optimized induction conditions (C).

[0025] Figure 4 is a graph showing the results of fed-batch culture of the BI02 strain of the present invention.

[0026] Hereinafter, the present invention will be described in detail.

[0027] Most previous studies on isoprenol production have cultivated isoprenol-producing strains in nutrient-rich media supplemented with large amounts of nutrients, thereby avoiding competition between intracellular acetyl-CoA flow toward isoprenol production and the flow toward cell-building block formation and energy production. These rich media, rich in nutrients, contain abundant amino acids and cell-building blocks, allowing the carbon flux from substrates to be concentrated in isoprenol rather than diverted to other pathways, such as the TCA cycle. However, for economic reasons, it is necessary to increase isoprenol production without supplementing nutrients.

[0028] Since isoprenol production along the mevalonate pathway requires the condensation of acetyl-CoA and acetoacetyl-CoA in a 1:1 ratio, an imbalance between these precursors is expected to be a major factor hindering isoprenol production. Although various studies have demonstrated that a balance between precursors plays a crucial role in improving target compound production, this strategy has not been implemented in isoprenol production. If this strategy is also applied to isoprenol-producing strains bypassing IPP, further enhanced isoprenol production can be expected.

[0029] According to the present invention, by precisely simultaneous control of gene expression of mvaE and mvaS to maintain precursor balance, carbon optimization required for isoprenol production is possible, thereby producing a recombinant E. coli strain with maximized isoprenol productivity. A strain with precisely controlled gene expression in minimal medium can be usefully utilized for isoprenol production.

[0030] Therefore, the present invention provides (1) a mvaE gene represented by SEQ ID NO. 1 linked to a Tet promoter represented by SEQ ID NO. 7 and a Nar promoter represented by SEQ ID NO. 8 (P FdeA) is linked to a recombinant vector; (2) a recombinant vector comprising an MK gene represented by SEQ ID NO: 3 linked to a T7 promoter represented by SEQ ID NO: 9, a PMK gene represented by SEQ ID NO: 4 linked to a T7 promoter represented by SEQ ID NO: 9, and an MDD gene represented by SEQ ID NO: 5 linked to a T7 promoter represented by SEQ ID NO: 9; and (3) a recombinant strain into which a recombinant vector comprising a nudF gene represented by SEQ ID NO: 6 linked to a T7 promoter represented by SEQ ID NO: 9 is introduced.

[0031] It is preferable that the recombinant vector of the above (1) is pACYC-based.

[0032] It is preferable that the recombinant vector of the above (2) is pET-based.

[0033] It is preferable that the recombinant vector of the above (3) is pCDF-based.

[0034] It is preferable that the above strain is Escherichia coli.

[0035] In addition, the present invention provides a method for producing isoprenol obtained by culturing the recombinant strain described above in a minimal medium.

[0036] It is preferred that the above minimum badge be an M9 badge.

[0037] It is preferred that the above minimal medium contain aTc and naringenin.

[0038] It is preferable that the above cultivation be a fed-batch cultivation.

[0039] In the present invention, "vector" means a self-replicating DNA molecule used to transport a clone gene (or other piece of clone DNA).

[0040] In the present invention, an "expression vector" refers to a recombinant DNA molecule containing a desired coding sequence and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked to a specific host organism. The expression vector may preferably include one or more selectable markers. The markers are typically nucleic acid sequences having properties that can be selected by chemical methods, and include all genes that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, antibiotic resistance genes such as ampicillin, kanamycin, geneticin (G418), bleomycin, hygromycin, and chloramphenicol, and can be appropriately selected by those skilled in the art.

[0041] The term "recombinant vector" of the present invention refers to a type of expression vector that is a recombinant plasmid capable of expressing a target peptide in a suitable host cell, and includes essential regulatory elements operably linked to enable expression of the inserted target gene. The recombinant vector of the present invention may include expression regulatory elements such as a promoter, an operator, an initiation codon, and a stop codon, as elements included in a typical recombinant vector. The initiation codon and the stop codon are generally considered to be part of the nucleotide sequence encoding the polypeptide, and must be functional when the recombinant vector is introduced into a host cell and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

[0042] In the present invention, the recombinant strain refers to one transformed with the recombinant vector of the present invention.

[0043] As used herein, "transformation" refers to introducing a vector containing a promoter according to the present invention, or additionally, a gene encoding a target protein, into a host cell. Furthermore, the gene encoding the transformed target protein may be located within the host cell's chromosome or extrachromosomally, as long as it can be expressed within the host cell.

[0044] In addition, it refers to all acts that cause genetically stable inheritance so that the recombinant vector fragment can move into the genome of the host cell and express the desired peptide. Any transformation method can be used for the transformation method of the present invention, and can be easily performed according to a conventional method in the art. Common transformation methods include the CaCl2 precipitation method, the Hanahan method that increases efficiency by using a reducing substance called DMSO (dimethyl sulfoxide) in the CaCl2 method, electroporation, calcium phosphate precipitation method, protoplast fusion method, stirring method using silicon carbide fiber, Agrobacterium-mediated transformation method, transformation method using PEG, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation methods.

[0045] The base sequences of the promoters and genes used in the present invention are as shown in Table 1 below.

[0046] 서열번호명칭염기서열 (5′-3′)1mvaE 유전자CTCCTGGACGTTAGACGGAGAACAATTAATCGGGGAAATCTCAGTTCCACTGGCTTTGGCTACGGTCGGTGGGGCGACTAAGGTTCTGCCTAAGTCACAAGCTGCAGCAGATCTGTTAGCTGTAACTGATGCGAAAGAATTGTCCCGCGTTGTGGCGGCCGTAGGACTGGCCCAAAACCTGGCAGCATTGCGCGCGTTAGTCTCCGAGGGGATCCAAAAGGGACATATGGCGCTGCAAGCTCGTTCCCTGGCTATGACTGTGGGAGCGACGGGTAAAGAGGTTGAAGCGGTGGCCCAGCAATTGAAGCGCCAGAAGACCATGAATCAAGACCGCGCGCTTGCCATTCTTAATGACCTTCGCAAACAATAA2mvaS 유전자AGTTATCTATCGCCGAGTACGAGGCGATGTTTGCAGAAACCCTGGATACCGACATCGACCAAACTTTAGAAGATGAACTGAAGTACTCAATTTCAGCGATCAATAACACTGTACGCTCGTATCGTAACTAA3MK 유전자ATTTGAGAATTGGCTCCACAAAACTTACCGGTGCTGGTGGCGGCGGTTGCTCTTTGACTTTGTTACGAAGAGACATTACTCAAGAGCAAATTGACAGCTTCAAAAAGAAATTGCAAGATGATTTTAGTTACGAGACATTTGAAACAGACTTGGGTGGGACTGGCTGCTGTTTGTTAAGCGCAAAAAATTTGAATAAAGATCTTAAAATCAAATCCCTAGTATTCCAATTATTTGAAAATAAAACTACCACAAAGCAACAAATTGACGATCTATTATTGCCAGGAAACACGAATTTACCATGGACTTCATAA4PMK유전자GTCAAAAGTATCCTGAAATCACAGAAGTTAGAGATGCAGTTGCCACAATTAGACGTTCCTTTAGAAAAATAACTAAAGAATCTGGTGCCGATATCGAACCTCCCGTACAAACTAGCTTATTGGATGATTGCCAGACCTTAAAAGGAGTTCTTACTTGCTTAATACCTGGTGCTGGTGGTTATGACGCCATTGCAGTGATTACTAAGCAAGATGTTGATCTTAGGGCTCAAACCGCTAATGACAAAAGATTTTCTAAGGTTCAATGGCTGGATGTAACTCAGGCTGACTGGGGTGTTAGGAAAGAAAAAGATCCGGAAACTTATCTTGATAAATAA5MDD 유전자AGCTTGAGGCTTTCAACCATCAATTTGAATCATCTAACTTTACTGCACGTGAATTGGATCTTGAGTTGCAAAAGGATGTTGCCAGAGTGATTTTAACTCAAGTCGGTTCAGGCCCACAAGAAACAAACGAATCTTTGATTGACGCAAAGACTGGTCTACCAAAGGAATAA6nudFGene promoter (tetR / tetA promoter)TTCTCTATCACTGATAGGGAGTGGTAAAATAACTCTATCAACGATAGAGTGTCAAC8Nar promoter (P FdeA )TTGATCAATATCAAGCTCACTCTTAAGCTTCACTC9T7 PromoterGTTGACACTCTATCGTTGATAGAGTTATTTTACCACTCCCTATCAGTGATAGAGAA

[0047] The isoprenol produced by the above recombinant strain can be obtained by known separation and purification methods such as column chromatography, HPLC, and TLC.

[0048]

[0049] Hereinafter, the present invention will be described in more detail through specific examples. The following examples illustrate preferred embodiments of the present invention, and the scope of the present invention is not limited to the matters described in the following examples.

[0050]

[0051] Example

[0052] Example 1. Construction of plasmids and basic strains for isoprenol production.

[0053] An outline of the invention for efficient production of isoprenol in E. coli is shown in Fig. 1. First, to confirm the presence or absence of isoprenol production, the pET_MVAdown, pACYC_MVA1, and pCDF-NudF plasmids were introduced into E. coli BL21 (DE3), and this was named BI01.

[0054] To construct the mevalonate upstream cycle plasmid pACYC_MVA1, the mvaE and mvaS genes from Enterococcus faecalis were constructed under the T7 promoter, a strong inducible promoter, using codons optimized for Escherichia coli. MvaE of the pACYC_MVA1 plasmid is an enzyme that converts acetyl-CoA to acetoacetyl-CoA and HMG-CoA to mevalonate, and MvaS is an enzyme that converts acetyl-CoA and acetoacetyl-CoA to HMG-CoA.

[0055] To construct the mevalonate downstream cycle plasmid, pET_MVAdown, the MK, PMK, and MDD genes from Saccharomyces cerevisiae were introduced under the T7 promoter, a strong inducible promoter, using codons optimized for Escherichia coli. The pET_MVAdown plasmid contains the MK, PMK, and MDD genes, which are mevalonate downstream genes, and are enzymes that convert mevalonate to mevalonate 5-phosphate (MVAP), mevalonate 5-phosphate (MVAP) to mevalonate 5-pyrophosphate (MVAPP), and mevalonate 5-pyrophosphate (MVAPP) to isopentenyl pyrophosphate (IPP), respectively.

[0056] To construct the mevalonate downstream cycle plasmid, pCDF-NudF, the nudF gene from Bacillus subtilis was codon-optimized and introduced under the strong inducible T7 promoter. NudF is an enzyme that dephosphorylates IPP to convert it to isoprenol.

[0057] Specifically, to construct pET_MVAdown, each codon-optimized MK, PMK, and MDD gene was amplified using the primer pairs MK ins F and MK ins R, PMK ins F and PMK ins R, and MDD ins F and MDD ins R, respectively. The basic backbone plasmid pETduet-1 was amplified using the primer pair pET vec_F and pET vec_R. All of the amplified fragments were assembled to construct the pET_MVAdown plasmid. To construct pCDF-NudF, the codon-optimized nudF gene was amplified using the primer pair nudF ins F and nudF ins R, and the basic backbone plasmid pCDFduet-1 was amplified using the primer pair pCDF vec F and pCDF vec R. All of the amplified fragments were assembled to construct the pCDF-NudF plasmid. The base sequences of the primers used to construct the above recombinant vectors, pET_MVAdown and pCDF-NudF, are shown in Table 2 below.

[0058] In addition, the strains and plasmids used in the present invention are shown in Table 3 below.

[0059] 서열번호명칭Sequence (5′-3′)10fdeR mvaE FCTCAAGGGCATCGGTCGAGATC11fdeR mvaE FGAAGGAGATTTTATCGATCCCGATGGTCAT GTCTGTCTCCTTGTCTCCTACCCT12mvaS FdeR FdeR FGACCATCGATCGATTCGATCGATCVA VEC RATTGGTGCCCTTAAACGCCTGGTGCTACGC CAGTGTGACCGTGTGCTTCTC14VEC mvaS FGCGTAGCACCAGGCGTTTAAG15VEC mvaE RGGGCTGACTTCAGGTGCTACA16mvaE VEC FCTCTTCAAATGTAGCACCTGAAGTCAGCCCC GTCTCTCATGGACCATGGACCTT RGGCACCGGGATCTCGACCGATGCCCTTGAG GCGAAAAAACCCCGCCGAAG18pET vec FGGAAGAGCGCCTGATGCG19pET vec RAACATGTGAGCAAAAGGCCAGCAAAAGGCC AGGAACCGTAAAAAGGCCGC20MK ins FGGCCCTTTTGCTGCCTTGCCTT TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTAAAAACAAAAAAAGG21MK ins RAATCGATGATCGAATGCTAGCTCGAATGCG TTATGAAGTCCATGGTAAATTCGTGTTTC22PMK ins FCGCATTCGAGCTAGCATTCGATCATCGATT TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTAAAACAAAGG23PMK ins RAGATCCAACGCTAGGTCGCTAGAATCGGCG TTATTTATCAAGATAAGTTTCCGGATCTTTTTCTTTC24MDD ins FCGCCGATTCTAGCGACCTAGCGTTGGATCT TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTAATAGAGAAAAAAGG25MDD ins RAGAAAATACCGCATCAGGCGCTCTTCCGCTGCGAAAAAACCCCGCCG26pCDF vec FCTGAAACCTCAGGCATTTGAGAAGCA27pCDF vec RGGGCTGACTTCAGGTGCTAC28nudF ins FCTCTTCAAATGTAGCACCTGAAGTCAGCCCGGTTGAAGG TTGACGGCTAGCTCAGTCC29nudF ins RCGTGTGCTTCTCAAATGCCTGAGGTTTCAG CAAAAAACCCCTCAAGACCCG

[0060]

[0061] Next, plasmids were isolated using the GeneAll ExprepTM Plasmid SV Mini Kit from GeneAll (Seoul, Korea), and DNA purification was performed using the GeneAll Expin Gel SV Kit or Expin CleanUp SV Kit. For cloning, PrimeSTAR HS DNA Polymerase from Takara (Shiga, Japan) and NEBuilder HiFi DNA Assembly from New England Biolabs (Ipswich, USA) were used.

[0062] To confirm isoprenol production by the BI01 strain, into which the pACYC_MVA1, pET_MVAdown, and pCDF-NudF plasmids were introduced, the strain was cultured in a test tube and the isoprenol production was analyzed. Cultivation of the strain and confirmation of isoprenol production were performed as in Example 2.

[0063] Although the production results were not presented, the isoprenol production of the BI01 strain, which overexpressed all genes with the T7 promoter, a strong inducible promoter, was lower than that of the BI02 strain with the optimal isoprenol production conditions established in Example 3 (BI01: 62.7 mg / L, BI02: 86.18 mg / L; in vitro culture results).

[0064]

[0065] Example 2. Method for producing and analyzing isoprenol

[0066] To confirm isoprenol production, the strain was cultured and the isoprenol production was analyzed. The BI02 strain was cultured in M9 medium, which contains 10.68 g K2HPO4, 5.2 g KH2PO4, 1 g NaCl, 1 g NH4Cl, 0.5 g MgSO4?7H2O, 10 g / L glucose, and appropriate antibiotics per liter. To compare the isoprenol production of the BI02 strain, which is the optimal balance between precursors cultured in minimal medium as in Example 4, and the BI01 strain cultured in a medium supplemented with nutrients, M9Y (M9 + 2 g / L yeast extract) supplemented with nutrients was used.

[0067] All cultures for isoprenol production were cultured in 5 mL of LB medium for one day, and the initial OD 600 =0.1 and was cultured in 5 mL of M9 or M9Y. In the secondary culture, OD 600 When =1.0, add 3 mL of new M9 or M9Y with added glucose to OD 600 =1 was inoculated to confirm isoprenol production. All experiments were performed in triplicate. All strains were cultured under conditions of 30°C and 200 rpm, and cell concentration (OD 600 ) was confirmed by measuring the absorbance at a wavelength of 600 nm using a UV-1700 spectrometer.

[0068] Isoprenol was analyzed using a gas chromatography system with ionization detector (GC-FID). Isoprenol analysis was performed using a DB-WAX capillary column (15 m, 0.25 μm, 320 μm). The initial oven temperature was set at 40°C, increased at 15°C / min until reaching 100°C, and then increased at 40°C / min until reaching 230°C, where it was held for 3 min. Helium was used as the carrier gas, and the injector, detector, and inlet temperatures were set at 250°C, 250°C, and 180°C, respectively. Isoprenol was isolated using the ethyl acetate extraction method, with 30 mg / L butanol as the internal standard. Isoprenol was isolated by mixing the cell culture medium and the ethyl acetate containing the internal standard in a 1:1 ratio. The above mixture was centrifuged at 13000 rpm for 10 minutes, and separated into an organic phase containing isoprenol, cell debris, and an aqueous solution.

[0069]

[0070] Example 3. Construction of an isoprenol-producing strain through a balance between precursors in the mevalonate pathway and isoprenol production.

[0071] Unlike the linear mevalonate pathway downstream, the upstream pathway produces HMG-CoA in equal molecular ratios of acetyl-CoA and acetoacetyl-CoA, which necessitates balancing the amounts of the two precursors. To achieve this, the expression of the mvaE and mvaS genes is induced by different inducible promoters, the Tet and Nar promoters (P FdeA ) was replaced with pACYC_MVA3.

[0072] Specifically, the codon-optimized mvaE and mvaS genes were amplified using primer pairs mvaE VEC F and mvaE fdeR R, VEC mvaS F and VEC mvaE R, and mvaS VEC R and mvaS FdeR F. Codon-optimized FdeR-P FdeA was amplified using the primer pairs fdeR mvaE F and FdeR mvaS R, and all of the amplified fragments were assembled to construct the pACYC_MVA3 plasmid. The base sequences of the primers used to construct the recombinant vector pACYC_MVA3 are shown in Table 2.

[0073] To confirm isoprenol production by the BI02 strain introduced with the pET_MVAdown, pACYC_MVA3, and pCDF-NudF plasmids, the strain was cultured using the method described in Example 2 and the isoprenol production was analyzed. Isoprenol production was confirmed by controlling the expression of the mvaE and mvaS genes by combining two inducers, naringenin and aTc, at various concentrations in the BI02 strain, and the results are shown in Fig. 2.

[0074] The above experiment was conducted at the in vitro level, and isoprenol production was the highest (86.2 mg / L) when induced with 40 ug / mL naringenin and 30 ng / mL aTc. Although the results are not presented, isoprenol production was improved by 37.5% compared to the existing BI01 strain under the same culture conditions.

[0075] Accordingly, it was confirmed that precisely controlling the expression levels of the mvaE and mvaS genes to achieve precursor balance is a more effective strategy for isoprenol production than simply maximizing their expression.

[0076]

[0077] Example 4. Comparison of isoprenol production by strains BI01 and BI02 in M9Y medium with added nutrients or minimal medium M9.

[0078] Acetyl-CoA is used as the main precursor for isoprenol production and is also competitively used in the TCA cycle. Most previous studies have used media containing nutrient supplements (yeast extract) to increase the acetyl-CoA pool. When 2 g / L yeast extract was added to the culture medium of the BI01 strain used in Example 1, isoprenol production was enhanced by 22.8% compared to the culture medium without yeast extract, as shown in Fig. 3A and B (Fig. 3A: BI01 strain in M9, Fig. 3B: BI01 strain in M9Y). However, the use of such additives can negatively affect the economical microbial-based production of isoprenol. When the balance between precursors was controlled by precisely controlling gene expression, as in the BI02 strain described in Example 3 and Fig. 2, isoprenol production was enhanced by 37% compared to the BI01 strain even without the use of yeast extract. This is shown in Fig. 3C.

[0079]

[0080] Example 5. Fed-batch cultivation of BI02 strain, a recombinant E. coli strain for isoprenol production.

[0081] To confirm the glucose metabolism and isoprenol production potential of the BI02 strain shown in Example 4, fed-batch culture was performed with continuous glucose supply. As shown in Fig. 3C, when the BI02 strain was cultured in the minimal medium M9, isoprenol was continuously produced until 10 g / L of glucose was almost exhausted. Therefore, it was expected that isoprenol production could be increased by additional glucose supply.

[0082] In the fed-batch culture, glucose was repeatedly supplied for 72 hours.

[0083] Specifically, the pH of the medium and the amount of remaining glucose were measured every 6 hours, and the pH was adjusted to 7 using a 10 M NaOH solution. When 5-6 g / L of glucose remained in the medium, neutralized 200 g / L glucose was added to maintain the final glucose concentration of the medium at 10 g / L. The results of fed-batch culture of the BI02 strain are shown in Fig. 4.

[0084] Referring to Fig. 4, the BI02 strain metabolized 73 g / L of glucose and produced 284.73 mg / L of isoprenol during 72 hours of fed-batch culture.

[0085] Therefore, this means that the BI02 strain with optimized precursor balance according to the present invention can metabolize glucose in minimal medium and maximize isoprenol production.

[0086]

[0087] In summary, it was confirmed that isoprenol production using strain BI02, an isoprenol-producing strain constructed by optimizing the balance between precursors by simultaneously controlling gene expression using different inducers, resulted in increased isoprenol production compared to using strain BI01, which simply overexpressed the genes.

[0088] In addition, since the above BI02 strain was confirmed to produce isoprenol even in a minimal medium without adding expensive nutrients, the isoprenol-producing E. coli of the present invention can be utilized in the biofuel industry, particularly in the aviation fuel industry, where isoprenol is directly or indirectly utilized.

[0089] According to the present invention, when the gene expression of mvaE and mvaS is precisely controlled simultaneously for precursor balance, carbon optimization for isoprenol production is possible, and a recombinant E. coli with maximized isoprenol productivity can be produced and cultured in a minimal medium.

[0090] Accordingly, isoprenol can be produced economically and efficiently using the recombinant E. coli, and isoprenol can be used in various fields such as aviation fuel where it is used as a precursor or biofuel industry where it is used directly, so it has industrial applicability.

Claims

1. Recombinant strains into which the following recombinant vectors have been introduced: (1) The mvaE gene represented by SEQ ID NO. 1 linked to the Tet promoter represented by SEQ ID NO. 7 and the Nar promoter (P) represented by SEQ ID NO. 8 FdeA ) A recombinant vector containing the mvaS gene represented by sequence number 2; (2) a recombinant vector comprising an MK gene represented by SEQ ID NO: 3 linked to a T7 promoter represented by SEQ ID NO: 9, a PMK gene represented by SEQ ID NO: 4 linked to a T7 promoter represented by SEQ ID NO: 9, and an MDD gene represented by SEQ ID NO: 5 linked to a T7 promoter represented by SEQ ID NO: 9; and (3) A recombinant vector containing the nudF gene represented by SEQ ID NO: 6 linked to the T7 promoter represented by SEQ ID NO:

9.

2. A recombinant strain, characterized in that the recombinant vector of paragraph 1 (1) is pACYC-based.

3. A recombinant strain, characterized in that the recombinant vector of paragraph 1 (2) is pET-based.

4. A recombinant strain, characterized in that the recombinant vector of paragraph 1 (3) is pCDF-based.

5. A recombinant strain according to claim 1, characterized in that the strain is E. coli.

6. A method for producing isoprenol, obtained by culturing the recombinant strain described in any one of claims 1 to 5 in a minimal medium.

7. A method for producing isoprenol, characterized in that in paragraph 6, the minimum medium is M9 medium.

8. A method for producing isoprenol, characterized in that in paragraph 6, the minimum medium contains aTc and naringenin.

9. A method for producing isoprenol, characterized in that the culture in paragraph 6 is a fed-batch culture.

Citation Information

Patent Citations

  • Method for increasing alcohol tolerance of microorganism and microorganism preparing the same

    KR101703439B1

  • Compositions and methods for producing isoprene free of c5 hydrocarbons under decoupling conditions and / or safe operating ranges

    KR1020110076868A

  • Fuel compositions comprising isoprene derivatives

    KR1020120047908A

  • Submersible buoy system

    KR1020240140681A