Methods and insulators for regulation of transgene expression in plant genetic environments

Short, plant-specific enhancer-blocking insulators are developed using high-throughput methods to address transgene mis-expression and variability, enhancing crop stability and resilience by regulating transgene expression effectively.

WO2025147656A1PCT designated stage expired Publication Date: 2025-07-10UNIV OF WASHINGTON
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/010297
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-04
Filing Date
2025-01-03
Publication Date
2025-07-10

AI Technical Summary

Technical Problem

Existing biotechnological approaches for crop improvement face challenges with transgene mis-expression, silencing, and plant-to-plant variability due to regulatory crosstalk between transgene promoters and adjacent genes, and there is a lack of effective, plant-specific enhancer-blocking insulators that are too large for practical use in transgenic crops.

Method used

Development of short, highly effective plant-specific enhancer-blocking insulators identified through high-throughput methods, such as Plant STARR-seq, which can be used to regulate transgene expression by cloning candidate sequences between enhancers and promoters, and measuring transcription levels to distinguish insulators and silencers.

Benefits of technology

The identified insulators provide consistent transgene regulation, reducing spurious expression and variability, enabling improved crop stability and resilience, and facilitating predictable transgene expression patterns in plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025010297_10072025_PF_FP_ABST
    Figure US2025010297_10072025_PF_FP_ABST
Patent Text Reader

Abstract

High-throughput methods for screening candidate DNA sequences for functionality as genetic insulators in plant genetic environments, as well as genetic insulators identified by the methods and plants that include the genetic insulators as transgenic elements. Genetic insulators can be cloned with transgenes, and introduced to plant cells, tissues, and organisms, for tighter control of transgene expression.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND INSULATORS FOR REGULATION OF TRANSGENE EXPRESSION IN PLANT GENETIC ENVIRONMENTSCROSS-REFERENCE(S) TO RELATED APPLICATION(S)

[0001] This PCT application claims the benefit of, and priority to, U.S. Provisional Application No. 63 / 617,726, filed January 04. 2024; the content of which is incorporated herein by reference in its entirety for all purposes.STATEMENT REGARDING SEQUENCE LISTING

[0002] The Sequence Listing XML associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the sequence listing is 3915-P1334WO_UW_SL.xml. The XML file is 26,995,762 bytes; was created on December 17, 2024; and is being submitted electronically via Patent Center with the filing of the specification.STATEMENT OF GOVERNMENT LICENSE RIGHTS

[0003] This invention was made with government support under Grant No. 1748843, awarded by the National Science Foundation. The government has certain rights in the invention.BACKGROUND

[0004] Faced with accelerating climate change and rapid population grow th, there is a significant need for crops with higher yields and greater resilience to ensure food security. Biotechnological approaches to improve agronomic traits in crops commonly rely on transgenes. However, transgenic plants often suffer from transgene mis-expression, silencing, and plant-to-plant variability within plant genetic environments. Regulatory- crosstalk between the transgene promoter and cis-regulatory elements from adjacent genes in plant genetic environments can be a source for inconsistent transgene expression in plants.

[0005] In animals, genetic elements, termed enhancer-blocking insulators, have been identified that can interrupt interactions between surrounding cis-regulatory elements. Such enhancer-blocking insulators could help ensure the consistent performance of crop transgenes by preventing their mis-regulation (FIGs 1A-1B). However, to date, only ahandful of insulators that function in plants have been identified, and their large size prevents their effective use in transgenic crops. Furthermore, elements that are functional for enhancer-blocking activity in an animal genetic environment do not necessarily correlate with elements that are functional as insulators in plants.

[0006] Accordingly, there is a need for methods for identification and development of short, but highly effective plant-specific enhancer-blocking insulators, methods for the use of such insulators for improved regulation of transgenes in plants and crops, and transgenic plants and crops comprising such insulators. The present disclosure addresses these and other long-felt and unmet needs in the art.SUMMARY

[0007] This summary' is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This summary is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0008] In an aspect, the disclosure provides a method for determining whether a candidate sequence is an insulator in a plant genetic environment, the method comprising: cloning the candidate sequence between an enhancer and a promoter to produce a test sequence; and attempting to initiate transcription from the test sequence, wherein reduced transcription relative to a control construct without the candidate sequence indicates the candidate sequence or a portion thereof is the insulator.

[0009] In embodiments, the method further comprises: cloning the candidate sequence upstream of the enhancer and the promoter to produce a second test sequence and attempting to initiate transcription from the second test sequence, wherein transcript levels similar to that of the control construct indicate the candidate sequence or the portion thereof is the insulator, and wherein reduced transcription relative to the control construct indicates the candidate sequence or the portion thereof is a silencer.

[0010] In embodiments, the method further comprises: cloning a lurality of candidate sequences between a plurality of enhancers and promoters to produce a plurality of first test sequences that comprise barcodes, transforming the first plurality7of test sequences into plant cells or tissues, and attempting to initiate transcription from the first plurality of test sequences; cloning at least a portion of candidate sequences upstream of enhancers and promoters to produce a plurality of second test sequences that comprisebarcodes, transforming the second plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the second plurality of test sequences; measuring levels of barcode messenger RNA (mRNA) transcripts of the first plurality of test sequences and the second plurality' of test sequences and measuring levels of barcode DNA of the first plurality of test sequences and the second plurality' of test sequences, and calculating relative transcription levels as ratios of levels of barcode mRNA transcripts to levels of barcode DNA, wherein reduced relative transcription levels of first test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators or silencers, wherein similar relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators, and wherein reduced relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are silencers.

[0011] In embodiments, transcription levels are measured with a sequencing method.

[0012] In embodiments, the sequencing method comprises next-generation sequencing (NGS).

[0013] In embodiments, the sequencing method comprises a reverse-transcription (RT) step.

[0014] In embodiments, the plant genetic environment is a plant genome, or a portion thereof, of a plant cell, a plant tissue, or a plant organism.

[0015] In embodiments, the plant genetic environment corresponds to an agricultural plant organism or an agricultural crop.

[0016] In embodiments, the plant genetic environment comprises a tobacco genetic environment, a maize genetic environment, a rice genetic environment, a sorghum genetic environment, a tomato genetic environment, or an Arabidopsis thaliana genetic environment.

[0017] In embodiments, the enhancer comprises a 35S enhancer and the promoter comprises a 35S minimal promoter.

[0018] In embodiments, one or more candidate sequences are cloned in a forw ard orientation with respect to the plant genetic context, a reverse orientation with respect to the plant genetic context, or both.

[0019] In embodiments, one or more candidate sequences determined to be insulators comprise a higher frequency of guanine and cytosine (GC) nucleobases relative to a random sequence.

[0020] In an aspect, the disclosure provides an insulator comprising a polynucleotide sequence configured for regulation of transcription within one or more plant genetic environments.

[0021] In embodiments, the insulator does not comprise a naturally-occurring plant sequence.

[0022] In embodiments, the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity’, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity’, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1439 (Synthetic insulator 1 (slnsl)).

[0023] In embodiments, the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1440 (Synthetic insulator 2 (slns2)).

[0024] In embodiments, the insulator comprises a polynucleotide sequence having at least 80% identity’, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: l-l,438, SEQ ID NOs: 1,441-1,446, SEQ ID NOs: 1,447-2,361, SEQ ID NOs:2,362- 19,190, SEQ ID NOs: 19, 191 -20,082, SEQ ID NOs:20, 083-20, 523, SEQ ID NOs:20,524- 20,725, and any combination thereof.

[0025] In an aspect, the disclosure provides a plant genetic construct comprising an insulator.

[0026] In an aspect, the disclosure provides a plant cell, plant tissue, or plant comprising a plant genetic construct comprising an insulator, wherein the plant cell, plant tissue, or plant is produced by a genetic engineering method.

[0027] In embodiments, the insulator is stably integrated into a genome of the plant cell, plant tissue, or plant, and the insulator regulates expression of a transgene of the genome by at least partially insulating the transgene from regulatory cross-talk.DESCRIPTION OF THE DRAWINGS

[0028] The foregoing aspects and many of the attendant advantages of this disclosure will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings.

[0029] FIGs 1A-1J show enhancer-blocking insulators can prevent transgene misregulation, according to aspects of the disclosure. FIG. 1A shows enhancers (enh) and promoters (pro) can interact with each other, even over long distances. Such interactions can lead to the mis-regulation of neighboring genes. FIG. IB shows enhancer-blocking insulators (ins) can prevent regulatory crosstalk when placed between enhancers and promoters. FIG. 1C shows an approach for distinguishing between insulator and silencer activity, according to aspects of the disclosure. The activity of an enhancer-blocking insulator can only be detected when it is situated between an enhancer and a promoter. In contrast, a silencer is also active when it resides upstream of both the enhancer and promoter. FIG. ID shows an example high-throughput method to identify enhancerblocking insulators active in plants, according to aspects of the disclosure. FIGs 1 E- 1 J show synthetic insulators block the 35 S enhancer in plants, according to aspects of the disclosure. FIGs IE and 1H show the synthetic insulators slnsl and slns2 were cloned in the forw ard (fwd) or reverse (rev) orientation between the 35S enhancer and 35S minimal promoter or upstream of both elements. The enrichment of the constructs was determined in transiently transformed tobacco leaves (FIG. IE) or maize protoplasts (FIG. 1H), normalized to a control construct without an enhancer and insulator (0, solid line) and compared to a control construct without an insulator (dashed line). FIGs IF and II show a construct with a Luciferase (Luc) gene driven by the constitutive UBQ10 promoter and a NanoLuciferase (NanoLuc) gene controlled by the 35S minimal promoter and 35S enhancer was integrated into the genome oiArabidopsis thaliana. Insulators were cloned between the 35S enhancer and minimal promoter. Leaf discs from transgenic T2 plants were harvested and their proteins extracted. The luminescence of NanoLuc and Luc was measured in these extracts (FIG. IF). The relative expression level of NanoLuc was determined by normalizing itsactivity with that of the internal control Luc [log2(NanoLuc / Luc)]. The relative expression of NanoLuc for constructs with the synthetic insulators is shown alongside that of controls without an enhancer and insulator (noEnh) or with the 35S enhancer but without an insulator (noIns) (FIG. II). FIGs 1G and 1J show 170 bp fragments of the synthetic insulator were cloned in the forward (right-pointing arrows) or reverse (left-pointing arrows) orientation between the 35 S enhancer and 35S minimal promoter or upstream of both elements and the activity of the resulting constructs was determined. The start and end points of the arrows indicate the start and end coordinates of the fragments in the full-length insulator. The enrichment of the constructs was determined in transiently transformed tobacco leaves (FIG. 1G) or maize protoplasts (FIG. 1 J), normalized to a control construct without an enhancer and insulator (0, solid line) and compared to a control construct without an insulator (dashed line).

[0030] FIGs 2A-2F show short fragments exhibit enhancer-blocking insulator activity, according to aspects of the disclosure. FIG. 2A shows known insulators were split into partially overlapping 170-bp fragments. The insulator fragments were cloned in the forward or reverse orientation between a 35S, AB80, or Cab-1 enhancer and a 35S minimal promoter driving the expression of a barcoded GFP reporter gene. Constructs w ithout an enhancer (none) but with insulator fragments were also created. FIG. 2B shows all insulator fragment constructs were pooled and subjected to Plant STARR-seq in tobacco leaves (tobacco) and maize protoplasts (maize). Reporter mRNA enrichment was normalized to a control construct without an enhancer or insulator (noEnh; log2 set to 0). The enrichment of a control construct without an insulator is indicated as a black dot. Violin plots represent the kernel density distribution and the box plots inside represent the median (center line), upper and lower quartiles, and 1.5 x interquartile range (whiskers) for all corresponding constructs. Numbers at the bottom of each violin indicate the number of samples in each group. FIG. 2C shows correlation between the enrichment of insulator fragments in constructs with the 35S enhancer in tobacco leaves and maize protoplasts. FIG. 2D shows enrichment of constructs with insulator fragments cloned between the 35 S enhancer and minimal promoter. The position along the full-length insulator and the orientation (arrow7pointing right, fwd; arrow pointing left, rev) of the fragments is indicated by arrow s. FIG. 2E shows correlation between insulator fragment enrichment and GC content for constructs with the 35 S enhancer. FIG. 2F shows correlation between insulator fragment enrichment in tobacco leaves in constructs with the indicated enhancers. The dashed line represents ay = x line fited through the point corresponding to a control construct without an insulator (black dot). Pearson’s R2, Spearman’s p. and number (n) of constructs are indicated in FIGs 2C, 2E, and 2F.

[0031] FIGs 3A-3K show insulators are active in stable transgenic lines in Arabidopsis, rice, and maize, according to aspects of the disclosure. FIG. 3A shows transgenic Arabidopsis and rice lines were generated with T-DNAs harboring a constitutively expressed luciferase (Luc) gene and a NanoLuciferase (NanoLuc) gene under control of a 35S minimal promoter coupled to the 35S or AB80 enhancer (as indicated above the plots) with insulator candidates inserted between the enhancer and promoter. NanoLuciferase activity’ was measured in at least 4 plants from these lines and normalized to the activity of luciferase. The NanoLuc / Luc ratio was normalized to a control construct without an enhancer or insulator (noEnh; log2 set to 0). FIGs 3B and 3C show the activity of full-length insulators was measured in Arabidopsis lines (FIG. 3B) and compared to the corresponding results from Plant STARR-seq in tobacco leaves (FIG. 3C). FIGs 3D and 3E show the activity of synthetic full-length insulators was measured in rice lines (FIG. 3D) and compared to the corresponding results from Plant STARR-seq in maize protoplasts (FIG. 3E). FIGs 3F and 3G show the activity’ of insulator fragments was measured in Arabidopsis lines (FIG. 3F) and compared to the corresponding results from Plant STARRseq in tobacco leaves (FIG. 3G). FIG. 3H shows for transgenic maize lines, a reporter gene driven by a moderate-strength constitutive promoter (ZrnPro) and an upstream 35S enhancer was created and insulator fragments were inserted between the enhancer and promoter. The reporter gene cassette was inserted in the maize genome by site-directed integration and the expression of the reporter gene was measured in various tissues / developmental stages by ELISA. FIGs 31 and 3J show the activity of insulator fragments was measured in R1 leaves of transgenic maize lines (FIG. 31) and compared to the corresponding results from Plant STARR-seq in maize protoplasts (FIG. 3J). FIG. 3K shows correlation (Pearson’s R2) between the expression of all tested constructs across different tissues and developmental stages. The correlation with Plant STARR-seq results from maize protoplasts is also shown. Box plots in FIGs 3B, 3D, 3F, and 31 represent the median (center line), upper and lower quartiles (box limits), 1.5x interquartile range (whiskers), and outliers (points) for all corresponding samples from two to three independent replicates. Numbers at the botom of each box plot indicate the number of samples in each group. In FIGs 3C, 3E, 3G, and 3J, the dashed line represents a linearregression line and error bars represent the 95% confidence interval. Pearson's R2, Spearman’s p. and number (n) of constructs are indicated.

[0032] FIGs 4A-4G show insulator fragments can be stacked to create very strong enhancer-blocking insulators, according to aspects of the disclosure. FIG. 4A shows one, two, or three 170-bp fragments of known insulators were cloned between a 35S enhancer and a 35S minimal promoter driving the expression of a barcoded GFP reporter gene. FIG. 4B shows all insulator constructs were pooled and subjected to Plant STARR-seq in tobacco leaves (tobacco) and maize protoplasts (maize). Reporter mRNA enrichment was normalized to a control construct without an enhancer or insulator (log2 set to 0). Violin plots are as defined in FIG. 2B. The enrichment of a control construct without an insulator is indicated as dotted line. FIG. 4C shows a linear model was trained to predict the enrichment of stacked insulator constructs based on the activity of individual insulator fragments and their position within the construct. The correlation between the model’s prediction (prediction) and experimentally determined enrichment values (measurement) is shown as a hexbin plot (shade represents the count of points in each hexagon). Pearson’s R2, Spearman’s p, and number (n) of fragments are indicated. FIG. 4D shows coefficients assigned by the linear model to insulator fragments in the indicated positions of the stacked constructs. FIGs 4E and 4F show the activity of insulator fragment combinations in constructs as in FIG. 2H was measured in R1 leaves of transgenic maize lines (FIG. 4E) and compared to the corresponding results from Plant STARR-seq in maize protoplasts (FIG. 4F). Box plots are as defined in FIGs 2A-2F. The enrichment of a control construct without an insulator (noIns) is indicated as a dotted line. In FIG. 4F, the dashed line represents a linear regression line and error bars represent the 95% confidence interval. Pearson’s R2, Spearman’s p, and number (n) of constructs are indicated. FIG. 4G shows correlation (Pearson’s R2) between the expression of all tested constructs across different tissues and developmental stages. The correlation with Plant STARR-seq results from maize protoplasts is also shown.

[0033] FIGs 5A-5F show insulators exhibit silencer activity in at least some contexts, according to aspects of the disclosure. FIG. 5A shows insulator fragments were cloned upstream of an AB80 or Cab-1 enhancer and a 35S minimal promoter driving the expression of a barcoded GFP reporter gene. Half of the constructs also harbored a 35S enhancer upstream of the insulator fragments (with 35S) while the other half lacked an upstream enhancer (without 35 S). FIG. 5B shows all constructs were pooled and subjectedto Plant STARR-seq in tobacco leaves. Reporter mRNA enrichment was normalized to a control construct without an enhancer or insulator (noEnh; log2 set to 0). The enrichment of a control construct without an insulator is indicated as a black dot. FIG. 5C shows correlation between insulator fragment activity in constructs with or without the upstream 35S enhancer. The dashed line represents ay = x line fitted through the point corresponding to a control construct without an insulator (black dot). FIG. 5D shows insulator fragments were cloned in between (insulator construct) or upstream of (silencer construct) a 35S enhancer and a 35S minimal promoter driving the expression of a barcoded GFP reporter gene. FIG. 5E shows all constructs were pooled and subjected to Plant STARR-seq in tobacco leaves (tobacco) or maize protoplasts (maize). Reporter mRNA enrichment was normalized to a control construct without an enhancer or insulator (noEnh; log2 set to 0).The enrichment of a control construct w ithout an insulator is indicated as a black dot. FIG. 5F show s comparison of the enrichment of insulator fragments in insulator or silencer constructs. A linear regression line is shown as a solid line and its slope and goodness-of- fit (R2) is indicated. Violin plots in FIGs 5B and 5E are as defined in FIG. 2B.

[0034] FIGs 6A-6D show silencer activity depends on enhancer strength, according to aspects of the disclosure. FIG. 6A show s selected insulators and insulator fragments were cloned in between (insulator construct) or upstream of (silencer construct) an enhancer and a 35S minimal promoter driving the expression of a barcoded GFP reporter gene. Eight different enhancers were used to build these constructs. All constructs were pooled and subjected to Plant STARR-seq in tobacco leaves (tobacco) or maize protoplasts (maize). FIG. 6B show s strength of the eight enhancers in constructs without an insulator. Reporter mRNA enrichment was normalized to a control construct without an enhancer (none; log2 set to 0). Box plots represent the median (center line), upper and lower quartiles, and 1.5 x interquartile range (whiskers) for all corresponding barcodes from two independent replicates. Numbers at the bottom of the plot indicate the number of samples in each group. FIG. 6C shows comparison of the enrichment of insulators and insulator fragments in insulator or silencer constructs. A linear regression line is shown as a solid line and its slope and goodness-of-fit (R2) is indicated. FIG. 6D show s correlation betw een the slope of the regression lines from FIG. 6C and the strength of the corresponding enhancer from FIG. 6B. Pearson’s R2, Spearman's p, and number (n) of constructs are indicated. A linear regression line is shown as a dashed line.

[0035] FIGs 7A-7B show Plant STARR-seq detects activity of enhancer-blocking insulators, according to aspects of the disclosure. FIG. 7A shows full-length insulators were cloned in the forward (fwd) or reverse (rev) orientation between a 35S enhancer and a 35S minimal promoter driving the expression of a barcoded GFP reporter gene. FIG. 7B shows all insulator constructs were pooled and subjected to Plant STARR-seq in tobacco leaves (tobacco) and maize protoplasts (maize). Reporter mRNA enrichment was normalized to a control construct without an enhancer or insulator (noEnh; log2 set to 0). Box plots represent the median (center line), upper and lower quartiles, and 1.5 x interquartile range (whiskers) for all corresponding barcodes from two independent replicates. Numbers at the bottom of the plot indicate the number of samples in each group. The enrichment of a control construct without an insulator (noIns) is indicated as a dotted line.

[0036] FIGs 8A-8F show Plant STARR-seq yields highly reproducible results, according to aspects of the disclosure. FIGs 8A-8G show correlation between biological replicates of Plant STARR-seq for the full-length insulator library used in FIGs 7A-7B (FIG. 8A). the insulator fragment library used in FIGs 2A-2F (FIG. 8B). the insulator fragment combination library used in FIGs 4A-4G (FIG. 8C), the downstream enhancer library (FIG. 8D) and the insulator / silencer library used in FIGs 5A-5F (FIG. 8E), and the enhancer-insulator combination library used in FIGs 6A-6C (FIG. 8F). Experiments were performed in tobacco leaves (tobacco) or maize protoplasts (maize) as indicated. Pearson's R2, Spearman’s p, and number (n) of constructs are indicated. The shade in the hexbin plots in FIG. 8C represents the count of points in each hexagon.

[0037] FIGs 9A-9B show activity of insulator fragments in different maize tissues, according to aspects of the disclosure. FIGs 9A and 9B show transgenic maize lines were created using constructs as in FIG. 3H. The activity of insulator fragments was measured in the indicated tissues (FIG. 9A) and compared to the corresponding results from Plant STARR-seq in maize protoplasts (FIG. 9B). Box plots in FIG. 9A are as defined in FIGs 3A-3K.

[0038] FIGs 10A-10B show activity of insulator fragment combinations in different maize tissues, according to aspects of the disclosure. FIGs 10A and 10B show transgenic maize lines were created using insulator fragment combinations in constructs as in FIG. 3H. The activity of insulator fragments was measured in the indicated tissues (FIG. 10A) and compared to the corresponding results from Plant STARR-seq in maize protoplasts (FIG. 10B). Box plots in (FIG. 10A) are as defined in FIG. 3.

[0039] FIG. 11 shows enhancers downstream of insulator fragments slightly reduce their activity, according to aspects of the disclosure. Correlation between the activity of insulator fragments cloned between a 35S enhancer and a 35S minimal promoter with or without an additional AB80 or Cab-1 enhancer inserted between the insulator fragment and 35S minimal promoter. The dashed line represents a y = x line fitted through the point corresponding to a control construct without an insulator (black dot). Pearson’s R2. Spearman’s p, and number (n) of constructs are indicated.

[0040] FIGs 12A-12D show enhancer-dependent silencer activity in stable transgenic plants, according to aspects of the disclosure. FIG. 12A shows transgenic Arabidopsis lines were generated with T-DNAs harboring a constitutively expressed luciferase (Luc) gene and a NanoLuciferase (NanoLuc) gene under control of a 35 S minimal promoter coupled to the 35S or AB80 enhancer (as indicated above the plots) with insulator candidates inserted upstream of the enhancer. NanoLuciferase activity was measured in at least 4 plants from these lines and normalized to the activity of luciferase. The NanoLuc / Luc ratio was normalized to a control construct without an enhancer or insulator (noEnh; log2 set to 0). FIGs 12B and 12C show the activity’ of full-length insulators was measured in Arabidopsis lines (FIG. 12B) and compared to the corresponding results from Plant STARR-seq in tobacco leaves (FIG. 12C). Box plots in FIG. 12B are as defined in FIG. 3. In FIG. 12C, the dashed line represents a linear regression line and error bars represent the 95% confidence interval. Pearson’s R2, Spearman’s p, and number (n) of constructs are indicated. FIG. 12D shows comparison of the mean NanoLuc / Luc ratio of full-length insulators in insulator (FIG. 3B) or silencer constructs (FIG. 3B). A linear regression line is shown as a solid line and its slope and goodness-of-fit (R2) is indicated.DETAILED DESCRIPTION

[0041] The present disclosure provides high-throughput methods for characterizing candidate polynucleotide sequences as insulators or silencers on a large scale, as well as methods for positively identifying sequences as insulators for use in methods of plant genetic engineering. Screening methods can be performed in whole or in part, in any order of steps, by a person having ordinary skill in the art assisted by one or more computational devices or systems. Novel insight and the resultant development of a screening platform, as disclosed herein, leverages differences in regulatory crosstalk and gene expressionobserved as a result of the placement of candidate sequences relative to other plant genetic elements. These approaches can be used to identify polynucleotide sequences with insulator and / or silencer activity (FIGs 1A-1D). Insulators can be cloned in combination with one or more transgenes for delivery into and expression by a plant host, for reduced regulatory cross-talk and spurious expression of the one or more transgenes by the plant host. The insulators can comprise one or more plant DNA sequences, one or more nonplant DNA sequences, or both. In at least some embodiments, insulators of the disclosure are synthetic and contain no plant DNA sequences.

[0042] The present disclosure also provides plant insulators identified with such screening methods, as well as plant genetic constructs, plant cells, plant tissues, and plant organisms that stably incorporate one or more plant insulators for tighter regulation of transgenes in transgenic plants and reduced regulatory crosstalk with other genetic elements within the plant genomic environment. Plants that are genetically engineered with one or more insulators of the disclosure exhibit reduced spurious or undesired expression of transgenes. In various aspects, the disclosure provides fundamental and significant improvements in approaches for plant gene regulation that collectively enable further advancement in plant genetic engineering techniques for improved crop stability , resilience, yield, and other desirable or necessary agricultural characteristics for reliable crop production in the face of climate change.

[0043] Accordingly, in an aspect, the disclosure provides a method for determining whether a candidate sequence is an insulator in a plant genetic environment. The method comprises cloning the candidate sequence between an enhancer and a promoter to produce a test sequence and attempting to initiate transcription from the test sequence. The attempt to initiate transcription can include inducing a condition that would be expected to initiate transcription in the absence of the candidate sequence or with a random or control sequence in place of the candidate sequence. Once transcription initiation is attempted, transcription can be measured with any suitable technique, including but not limited to reversetranscription PCR (RT-PCR), RNA sequencing, a next-generation sequencing (NGS) technique, and the like. Reduced transcription relative to a control construct (without the candidate sequence) indicates the candidate sequence, or a portion thereof, is functional as an insulator. In this manner, using a high-throughput approach, a large number of candidate sequences can be tested for insulator activity in plant genetic environments.

[0044] In embodiments, the method further comprises cloning the candidate sequence upstream of the enhancer and the promoter to produce a second test sequence and attempting to initiate transcription from the second test sequence. Transcript levels observed to be at least about the same or similar to that of the control construct indicate the candidate sequence, or the portion thereof, is the insulator, while reduced transcription relative to the control construct indicates the candidate sequence, or the portion thereof, is functional as a silencer.

[0045] In various embodiments, the method comprises testing a large number of candidate sequences as part of a high-throughput screening method. In embodiments, the method comprises cloning a plurality of candidate sequences between a plurality of enhancers and promoters to produce a plurality of first test sequences that comprise barcodes, transforming the first plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the first plurality of test sequences. In embodiments, the method further comprises cloning at least a portion of candidate sequences upstream of enhancers and promoters to produce a plurality of second test sequences that comprise barcodes, transforming the second plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the second plurality of test sequences. Once transcription initiation is attempted, the method proceeds to a step of measuring levels of barcode messenger RNA (mRNA) transcripts of the first plurality of test sequences and the second plurality of test sequences and measuring levels of barcode DNA of the first plurality of test sequences and the second plurality of test sequences, and calculating relative transcription levels as ratios of levels of barcode mRNA transcripts to levels of barcode DNA. With reference to the transcript level results, reduced relative transcription levels of first test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators or silencers; relative transcription levels of second test sequences that are observed to be at least about the same or similar to those of the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators; and reduced relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are silencers.

[0046] In embodiments, transcription levels are measured with a sequencing method, such as a next-generation sequencing (NGS) method; however, alternate methods of transcription level measurement are envisioned without departing from the scope andspirit of the disclosure, including but not limited to quantitative reverse transcription polymerase chain reaction (RT-PCR).

[0047] Any of various plant genetic environments can be used for developing, screening, and validating candidate sequences as insulators, including any suitable plant species, cell type, tissue type, and the like. In embodiments, a plant genetic environment is a plant genome, or a portion thereof, of a plant cell, a plant tissue, or a plant organism. The plant genetic environment can correspond to a commercially valuable species, such as an agricultural plant organism or an agricultural crop. In example embodiments, the plant genetic environment comprises a tobacco genetic environment, a maize genetic environment, a rice genetic environment, a sorghum genetic environment, a tomato genetic environment, or an Arabidopsis thaliana genetic environment, or any combination thereof. In addition, while any of various genetic elements can be used in methods of the disclosure, in example embodiments, an enhancer comprises a 35S enhancer and a promoter comprises a 35S minimal promoter.

[0048] In embodiments, one or more candidate sequences are cloned in a forward orientation with respect to the plant genetic context, a reverse orientation with respect to the plant genetic context, or both. Cloning candidate sequences in either or both orientations can enable a better understanding of the relationship between positioning of sequence elements of candidate sequences and positioning of enhancer and promoter sequences to be regulated by an insulator functionality. In addition, while any of various biophysical characteristics of candidate sequences can contribute to the ability of the candidate sequences to function as insulators, in at least some embodiments, one or more candidate sequences determined to be insulators comprise a higher frequency of guanine and cytosine (GC) nucleobases relative to a random sequence. In embodiments, the higher frequency of GC nucleobases can be expressed relative to a reference sequence (e.g., a reference sequence having about 30%, about 35%, about 40%, about 45%, or about 50% GC content). The higher frequence of GC nucleobases can comprise about n% GC nucleobases, wherein n is an integer selected from the group consisting of 51-99 and the percentage is expressed as percent nucleobases that are G or C out of the total number of nucleobases (z.e., G, C, adenine (A), and thymine (T) nucleobases).

[0049] In an aspect, the disclosure provides an insulator comprising a polynucleotide sequence configured for regulation of transcription within one or more plant genetic environments, including implementations wherein the insulator is positionedbetween distinct gene regulator}’ elements that are desired to be regulated with little or no regulatory cross-talk. In embodiments, the insulator does not comprise a naturally- occurring plant sequence and can be generated at random or as a result of another non-plant polynucleotide sequence, including but not necessarily limited to those described herein.

[0050] In embodiments, the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1439 (Synthetic insulator 1 (slnsl)).

[0051] In embodiments, the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity7, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1440 (Synthetic insulator 2 (slns2)).

[0052] In embodiments, the insulator comprises a polynucleotide sequence having at least 80% identity7, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity7, at least 94% identity, at least 95% identity7, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs:l-l,438, SEQ ID NOs:l, 441-1,446, SEQ ID NOs: 1,447-2,361, SEQ ID NOs:2,362- 19,190, SEQ ID NOs: 19, 191 -20,082, SEQ ID NOs:20, 083-20, 523, SEQ ID NOs:20,524- 20,725, and any combination thereof.

[0053] In an aspect, the disclosure provides a plant genetic construct comprising an insulator. In another aspect, the plant genetic construct can be an element of a kit and can be provided in a format for facilitation of use of the plant genetic construct in a method of generating a plant cell, plant tissue, or plant comprising the plant genetic construct. In a further aspect, the disclosure provides a plant cell, plant tissue, or plant comprising a plant genetic construct comprising an insulator, wherein the plant cell, plant tissue, or plant is produced by a genetic engineering method. In various embodiments, the insulator is stably integrated into a genome of the plant cell, plant tissue, or plant, and the insulator regulates expression of a transgene of the genome by at least partially insulating the transgene from regulatory cross-talk.Terminology

[0054] The complete disclosure of all patents, patent applications, and publications, and electronically available material cited herein are incorporated by reference in their entirety. Supplementary' materials referenced in publications (such as supplementary' tables, supplementary figures, supplementary materials and methods, and / or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The disclosure is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the disclosure defined by the claims.

[0055] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure.

[0056] Specific elements of any foregoing embodiments can be combined or substituted for elements in other embodiments. Moreover, the inclusion of specific elements in at least some of these embodiments can be optional, wherein further embodiments can include one or more embodiments that specifically exclude one or more of these specific elements. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments can also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0057] Unless otherwise specified herein, terms of the disclosure have the same meaning imbued into them by the knowledge of the person having ordinary skill in the art to which the disclosure most closely belongs.

[0058] As used herein, a “candidate sequence” refers to a polynucleotide or DNA sequence that is at least potentially suitable for use as an insulator in one or more types of plants. Candidate sequences can be verified as insulators with screening methods of the disclosure, and if verified, used as insulators in the creation of plant genetic constructs and delivery vectors, transgenic plant cells, transgenic plants and crops, and the like.

[0059] As used herein, an “insulator” in a plant refers to a cis regulatory element that enables plant gene or trans gene regulation and / or chromosomal organization within a plant genetic environment (e.g. , a plant genome, a plant chromosome, or the like), including transgene regulation that results in reduced regulatory cross-talk and / or reduced spurious or uncontrolled expression of the transgene relative to a suitable control.

[0060] As used herein, “percent identity” (e.g., “80% identity”) refers to the number of nucleobases that are the same between polynucleotide sequences that are optimally aligned, expressed as a percentage, with the total number of nucleobases as the denominator. For example, the polynucleotide sequence ATGGCTGGTT has 80% identity with the polynucleotide sequence GCGGCTGGTT (bolded nucleobases differ).

[0061] As used herein, a “kit” can comprise an “instructional material” which includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of one or more elements of the kit for carrying out a testing method, a screening method, a treatment method, or other method of the disclosure, including methods for regulation of expression of a plant transgene as described herein or as known in the art. Optionally, or alternately, the instructional material can describe one or more methods of alleviating diseases or disorders in a cell or a tissue of a plant. The instructional material of the kit can. for example, be affixed to a container which contains an identified compound or can be shipped together with a container which contains the identified compound. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively.

[0062] As used herein, the term “non-transitory machine-readable storage medium,” refers to a computer readable medium or processor readable medium that can store information as data, as well as instructions for performance of logic operations by one or more processors for manipulation of the data. The non-transitor ' machine-readable storage medium can include any type of memory, such as volatile memory like random access memory (RAM), dynamic random-access memory (DRAM), static random-access memory (SRAM), or non-volatile memory like read-only memory (ROM), flash memory, magnetic or optical disks, or compact-disc read-only memory' (CD-ROM), among other devices used to store data or programs on a temporary or permanent basis. The non- transitory machine-readable storage medium can be configured to store instructions. The instructions are executable by the one or more processors to cause the computing device toperform any of the functions or methods described herein. The non-transitory machine- readable storage medium can also be configured to store a computational model. The computational model can take the form of a convolutional neural network or any other type of artificial neural network. The computational model can take other forms as well.

[0063] As used herein, the term “computational device'’ refers to a device, e.g., an electronic device, capable of performing logic operations. Example computational devices include computers, laptops, and tablets, as are known in the art. A computing device includes one or more processors, a non-transitory computer readable medium, a communication interface, a display, and a user interface. Components of the computing device are linked together by a system bus, network, or other connection mechanism. The one or more processors can be any type of processor(s), such as a microprocessor, a digital signal processor, a multi core processor, etc., coupled to the non-transitory computer readable medium. The communication interface can include hardware to enable communication within the computational device and / or between the computational device and one or more other devices. The hardware can include transmitters, receivers, and antennas, for example. The communication interface can be configured to facilitate communication with one or more other devices, in accordance with one or more wired or wireless communication protocols. For example, the communication interface can be configured to facilitate wireless data communication for the computational device according to one or more wireless communication standards, such as one or more Institute of Electrical and Electronics Engineers (IEEE) 801.11 standards, ZigBee standards, Bluetooth standards, etc. As another example, the communication interface can be configured to facilitate wired data communication with one or more other devices. The communication interface can also include analog-to-digital converters (ADCs) or digital- to-analog converters (DACs) that the computational device can use to control various components. The display can be any type of display component configured to display data. As one example, the display can include a touchscreen display. As another example, the display can include a flat-panel display, such as a liquid-crystal display (LCD) or a lightemitting diode (LED) display. A user interface can be included as part of the computational device and can include one or more pieces of hardware used to provide data and control signals to the computing device. For instance, the user interface can include a mouse or a pointing device, a keyboard or a keypad, a microphone, a touchpad, or a touchscreen, among other possible types of user input devices. Generally, the user interface can enablean operator to interact with a graphical user interface (GUI) provided by the computing device (e.g, displayed by the display)

[0064] As used herein, the term “system” refers to one or more computational devices, or one or more elements thereof, configured to perform one or more tasks, methods, or processes. A system of the disclosure can comprise a computing device. The computing device includes one or more processors, a non-transitory computer readable medium, a communication interface, a display, and a user interface. Components of the computing device are linked together by a system bus, network, or other connection mechanism.

[0065] As used herein and unless otherwise indicated, the terms “a” and “an” are taken to mean “one,” “at least one” or “one or more.” Unless otherwise required by context, singular terms used herein shall include pluralities and plural terms shall include the singular.

[0066] Unless the context clearly requires otherwise, throughout the description and the claims, the words “comprise,” “comprising.” and the hke are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to”.

[0067] Unless the context clearly requires otherwise, the phrase “consisting essentially of’ limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claim.

[0068] Unless the context clearly requires otherwise, the phrase “consisting of’ excludes any element, step, or ingredient not specified.

[0069] If an element is described or claimed herein such that it “comprises” a feature, that description or claim also includes embodiments wherein the element “consists essentially of’ and embodiments wherein the element “consists of’ the feature, unless something else is specifically stated to the contrary.

[0070] Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words “herein,” “above,” and “below” and words of similar import, when used in this application, shall refer to this application as a w hole and not to any particular portions of the application.

[0071] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unlessotherwise indicated to the contrary’, the numerical parameters set forth in the specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the present disclosure. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0072] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0073] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

[0074] All of the references cited herein are incorporated by reference. Aspects of the disclosure can be modified, if necessary, to employ the systems, functions, and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description.

[0075] It will be appreciated that, although specific embodiments of the disclosure have been described herein for purposes of illustration, various modifications can be made without deviating from the spirit and scope of the disclosure. Accordingly, the disclosure is not limited except as stated by the claims.Summary of Tables

[0077] Table 2 Insulator fragment combinations tested in stable transgenic maize lines.

[0078] Table 3 Insulators and insulator fragments used in the enhancer-insulator combination library.ExamplesExample 1: High-throughput identification of functional plant insulators and characterization of synthetic insulators.A high-throughput method to identify plant enhancer-blocking insulators

[0079] To detect the activity of enhancer-blocking insulators, they can be cloned between an enhancer and a minimal promoter. Since the insulator will prevent the enhancer from activating the minimal promoter in such a configuration, the expression level of the corresponding reporter gene will be lower than that of a control construct without an insulator. However, a silencer could lead to a similar decrease in expression (FIG. 1C, left). Therefore, to distinguish between true insulators and silencers, a second construct can be implemented. Here, the insulator candidates are cloned upstream of both the enhancer and minimal promoter. In this context, only a silencer can cause decreased expression, while an insulator will not affect the expression level (FIG. 1C, right).

[0080] Based on these considerations, a method for the high-throughput identification of enhancer-blocking insulators active in plants is disclosed. The method is configured to 1) work in plants and 2) enable the detection of insulator and silencer activity.

[0081] Insulator candidates are cloned between the 35S enhancer and 35S minimal promoter, or upstream of both elements to measure insulator or silencer activity, respectively (FIG. ID). The candidate sequences are linked to a barcode located in a reporter gene via next generation sequencing. The pooled library of reporter constructs is then used for transient transformation of tobacco leaves or maize protoplasts. After 1-2 days incubation, the transformed plant tissue is harvested, and the reporter mRNA is extracted. Finally, the abundance of the barcode sequences in the input DNA and the extracted mRNA is determined by next generation sequencing. For each insulator candidate, the enrichment of all linked barcodes in the RNA relative to the DNA is calculated. The difference between the enrichment of an insulator candidate and a control construct without an insulator is a measure of the insulator or silencer activity of the candidate sequence (FIG. ID).Characterization of synthetic insulators

[0082] Using the method described above, two novel, synthetic insulators (named slnsl and slns2) are disclosed and characterized. Both insulators substantially decrease the effect of the very strong 35S enhancer on downstream genes in transiently transformed tobacco and maize cells, as well as in stable Arabidopsis lines. Smaller (170bp) fragments of the synthetic insulators possess similar activity. With the disclosed aspects, characterization of the synthetic insulators in stable rice lines can be performed.Origin and sequence of the synthetic insulators

[0083] The synthetic insulator slnsl is derived from plasmid pZS*l l-yfpO (Addgene #53241) and covers part of the 0-lactamase (AmpR) coding sequence, the AmpR promoter, and the neighboring plasmid backbone sequence. The synthetic insulator slns2 is derived from plasmid pEvolvR-enCas9-PolI3M-TBD (Addgene #113077) and covers part of the enCas9 coding sequence.

[0084] In various aspects, high-throughput insulator screening methods of the disclosure can be used for identification of plant insulators. Using the disclosed methods, plant DNA sequences can be identified as having insulator activity.

[0085] For example, one or more of SEQ ID NOs: 1-1440, or one or more portions thereof, can have insulator activity. One or more of SEQ ID NOs: 1-1440, or one or more portions thereof, can be used as part of a genetic engineering method for reducing regulatory cross-talk and improving expression of transgenes in plants. In particular embodiments, slnsl (SEQ ID NO: 1439), slns2 (SEQ ID NO: 1440), or both, can have insulator activity and / or can be used as part of a genetic engineering method for reducing regulatory cross-talk and improving expression of transgenes in plants.

[0086] slnsl :AGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATC TTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCA TCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAA AAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTAT T GAAGCAT T TAT C AGG GT T AT T GT C T CAT G AGC GG AT AC AT AT T T GAAT GT AT T T AGAAA AATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCCAACAT ATGGCACCGGAGGCTTTCGTCTTCAC (SEQ ID NO: 1439)

[0087] slns2:GCTGAACGCAAAGCTGATCACTCAGCGGAAGTTCGACAATCTCACTAAGGCTGAGAGGGGCGGACTGAGCGAACTGGACAAAGCAGGATTCATTAAACGGCAACTTGTGGAGACTCGGCAGATTACTAAACATGTCGCCCAAATCCTTGACTCACGCATGAATACCAAGTACGACGAAAA CGACAAACTTATCCGCGAGGTGAAGGTGATTACCCTGAAGTCCAAGCTGGTCAGCGATTT CAGAAAGGACTTTCAATTCTACAAAGTGCGGGAGATCAATAACTATCATCATGCTCATGA CGCATATCTGAATGCCGTGGTGGGAACCGCCCTGATCAAGAAGTACCCAGCACTGGAAAG CGAGTTCGTGTACGGAGACTACAAGGTCTACGACGTGCGCAAGATGATTGCCAAATCTGA GCAGGAGATCGGAAAGGCCACCGCAAAGTACTTCTTCTACAGCAACATCATGAATTTCTT CAAGACCGAAATCACCCTTGCAAA (SEQ ID NO: 1440)Example 2: Small DNA elements can act as both insulators and silencers in plants (for additional information, see: Jores. T. et al. Small DNA elements can act as both insulators and silencers in plants. bioRxiv pre-print, September 19, 2024. doi: https: / / doi.org / 10.1101 / 2024.09.13.612883., the contents of which are incorporated by reference herein in their entirety for all purposes.)Abstract

[0088] Plant insulators can act as silencers. Insulators include cis-regulatory elements that separate transcriptional units, whereas silencers include elements that repress transcription regardless of their position. In plants, these elements remain largely uncharacterized. In this example, the massively parallel reporter assay Plant selftranscribing active regulatory region sequencing (STARR-seq) is used with short fragments of eight large insulators to newly characterize more than 100 fragments that unexpectedly block enhancer activity7. The short fragments can be combined to generate more powerful insulators that abolish the capacity of the strong viral 35S enhancer to activate the 35S minimal promoter. Unexpectedly, when tested upstream of weak enhancers, these fragments function as silencers and repress transcription. Thus, these elements are capable of both insulating as well as repressing transcription, dependent upon regulatory context. The findings are validated in stable transgenic Arabidopsis , maize, and rice plants. The short elements identified herein are useful building blocks for plant biotechnology efforts.Introduction

[0089] Precise control of gene expression is crucial for plants to grow and develop in a changing environment, however, genomic approaches to study plant gene regulation have focused mainly on promoters and enhancers. In contrast, repressive elements such as silencers and insulators have received far less attention.

[0090] Insulators compartmentalize genomes into discrete transcriptional units. Insulators have one or both of two principal functions: blocking enhancers from interacting with core promoters (enhancer-blocking insulators) and forming barriers against the spread of repressive heterochromatin (barrier insulators). Enhancer-blocking insulators are defined by their ability' to act when situated between an enhancer and promoter, but not when the order is reversed such that the enhancer is closer to the promoter than the insulator. Insulators can be thought to prevent ectopic gene expression, maintain chromatin accessibility, and enable differentially regulated genes to reside in close proximity to one another.

[0091] To date, most research on insulators has been performed in animal models. In contrast, only a handful of plant sequences have been shown to act as insulators in transient or stable transgenic plant reporter assays. For example, the Transformation Booster Sequence (TBS) from Petunia hybrida, the (3-phaseolin gene from Phaseolis vulgaris, and a gypsy-like sequence from Arabidopsis thaliana function as enhancer blocking insulators in transgenic plants. In addition, a few heterologous sequences show enhancer blocking insulator activity in plants, including Z-EXOB from phage , BEAD-1C from humans, and UASrpg from yeast. In prior studies, insulator activity' was inferred from (3-glucuronidase (GUS) staining or fluorescence of a reporter gene, both measures with limitations of dynamic range, quantification accuracy, and throughput. Because the enhancer-blocking activity of insulators is detected as reduced transcription in prior commonly used reporter assays, care must be taken to distinguish between insulators and silencers, which could also cause reduced transcription in these assays. Silencers recruit repressive transcription factors and, like enhancers, can act in a position-independent manner (z.e., upstream or downstream of an enhancer). This position-independency is thought to be a key difference between silencers and insulators that differentiates between the two element types.

[0092] To date, no general principles are known that typify insulator or silencer function in plants, nor are there high-throughput methods to identify these elements. Short and strong insulators will facilitate synthetic biology applications to ensure predictable expression of transgenes, blocking inappropriate enhancer-promoter interactions and alleviating chromatin position effects. Similarly, silencers can enable fine-tuning of transgene expression and minimize expression noise. Furthermore, understanding thesequence features of functional plant insulators and silencers can enable targeting similar elements in plant genomes to engineer gene expression.

[0093] In this example. Plant STARR-seq, a massively parallel reporter assay, was applied to test the insulator and silencer activity of over 100 short (170 bp) fragments derived from either previously described enhancer-blocking insulators or two novel synthetic insulator sequences (z.e., slnsl, slns2). The disclosed assay distinguishes enhancer-blocking activity from transcriptional repression and reveals that the insulator- derived elements harbor both insulator-like and silencer-like activities. Promising elements were tested and verified in stable transgenic Arabidopsis, rice, and maize plants.ResultsPlant STARR-seq detects the activity of enhancer-blocking insulators

[0094] Plant STARR-seq can identify and characterize cis-regulatory elements. To test whether Plant STARR-seq can identity7enhancer-blocking insulators, a reporter construct that includes a barcoded green fluorescent protein (GFP) gene under the control of a 35 S minimal promoter coupled to a 35S enhancer was created; insulator candidates were placed between this enhancer and promoter (FIG. 7A). Insulator sequences included four heterologous sequences that show insulator activity7in plants (Z-EXOB (SEQ ID NO: 1443), BEAD-1C (SEQ ID NO:1444), UASrpg (SEQ ID NO: 1445), and ^Drosophila gypsy element (SEQ ID NO: 1446)), and two synthetic sequences (slnsl (SEQ ID NO: 1439) and slns2 (SEQ ID NO: 1440)) for which preliminary data suggested they can act as insulators. The synthetic sequences slnsl and slns2 were derived from a plasmid backbone and a human codon-optimized coding sequence of Cas9, respectively, and engineered for insulator activity. The insulator candidate sequences were cloned in the forward or reverse orientation, and their insulator activity was determined by Plant STARR-seq in tobacco (Nicotiana benthamiana) leaves and maize Zea mays') protoplasts. Constructs without the 35S enhancer and without an insulator (noEnh) or with the 35S enhancer and without an insulator (noIns) were included as controls (FIG. 7A).

[0095] Insulator activity was measured as reduced enrichment compared to the enrichment of the no insulator (noIns) control. Except for the gypsy element, the other five tested insulator candidates resulted in reduced enrichment, indicating that they function as enhancer-blocking insulators in this assay (FIG. 7B). The gypsy element shows enhancerblocking and barrier insulator activities in Drosophila however, it lacks enhancer-blocking activity7in plants, consistent with these results. For some of the insulators, orientation-dependent activity was observed (FIG. 7B). Taken together, the results herein demonstrate that Plant STARR-seq reproducibly (FIGs 8A-8F) measures insulator activity.

[0096] The large size of prior know n enhancer-blocking insulators precludes their application in plant biotechnology. To identify and develop short sequences with insulator activity, overlapping 170-bp fragments of each of the six insulators in addition to tw o plant sequences with insulator activity (P-phaseolin and TBS) were array -synthesized, and the enhancer-blocking activity of these fragments measured (FIG. 2A). Many fragments retained partial insulator activity in tobacco and maize (FIG. 2B and SEQ ID NOs: 1,447- 2,361), but their activity varied between the two assay systems, possibly pointing to species-specific differences (FIG. 2C). Overall, seven of the eight insulators, excluding only the gypsy element, harbored clusters of fragments that partially blocked the 35S enhancer (FIG. 2D). Without wishing to be bound by any particular theory, this clustering of active fragments may be driven by local nucleotide composition, because GC content strongly correlated with a fragment’s insulator activity (FIG. 2E). However, GC content does not fully explain insulator activity: Many insulator-derived fragments showed orientation-dependent activity (FIG. 2D). Furthermore, the insulator-derived fragments w ere tested with the AB80 enhancer from Pisum sativum and the Cab-1 enhancer from Triticum aestivum, which drive the expression of chlorophyl a-b binding proteins, and it was found that the activity of these fragments was largely enhancer independent (FIGs 2B and 2F).

[0097] To validate the findings, insulator activity was measured in stable transgenic plants (FIGs 3A-3K). Full-length insulators and fragments thereof showed enhancerblocking insulator activity in Arabidopsis. rice (Oryza sativa), and maize, well correlated with the Plant STARR-seq results (FIG. 3 and FIG. 9). In maize, insulator activity was measured in four tissues (leaf, stalk, silk, and husk) and in two developmental stages (V6 and Rl), and similar results were obtained, indicating that these insulators do not act in a tissue-specific manner (FIG. 3K).Active fragments can be assembled into strong insulators

[0098] It was asked whether insulator activity can be increased by combining up to three fragments. Twenty-six (26) fragments with high insulator activity7(top 25% of all fragments) in tobacco and six (6) fragments with low insulator activity (bottom 25% of all fragments) in tobacco (Table 1) were evaluated. These fragments were used in the forward and reverse orientation to build constructs with both the individual fragments and with theover 2,900 randomly generated two-fragment combinations. Additionally, over 13,000 three-fragment combinations were built that added one of five fragments with very high insulator activity (top 5% of all fragments; Table 1) upstream of the randomly generated two-fragment combinations. Fragments (SEQ ID NOs: 1,447-2,361) and fragment combinations (SEQ ID NOs:2,362-19,190) were cloned between the 35S enhancer and 35S minimal promoter (FIG. 4A). As a trend, increasing the number of insulator fragments increased insulator activity. In tobacco, most constructs with three insulator fragments completely blocked the 35S enhancer (FIG. 4B and SEQ ID NOs: 1-1446). In addition, combinations of fragments derived from different full-length insulators showed a similar activity distribution to combinations of fragments derived from the same full-length insulator. Similarly, the activity distribution of combinations with two copies of the same fragment was largely indistinguishable from that of combinations with two non-identical fragments.

[0099] A linear model was trained based on the insulator activity of the individual fragments and their position in the construct to predict the insulator activity of two- fragment and three-fragment combinations in tobacco and maize (FIG. 4C). Model accuracy was similar for the two-fragment and three-fragment combinations in tobacco (R2of 0.67 and 0.62, respectively). In maize, prediction accuracy was higher for the two- fragment combinations than for the three-fragment combinations (R2of 0.60 and 0.48. respectively). The model coefficients showed that the fragment closest to the minimal promoter contributes the most to the combined insulator activity, while the fragment closest to the enhancer contributes the least (FIG. 4D). Taken together, the insulator activity of the individual fragments appears to be a determinant for the activity of the fragment combinations.

[0100] Next, the activity of one two-fragment combination and nine three-fragment combinations was tested (Table 2) in stable maize plants. Most of these fragment combinations showed insulator activity in the transgenic maize plants (FIG. 4E and FIG. 10A). However, their activity was weaker than observed in the Plant STARR-seq experiments; without wishing to be bound by any particular theory, this may have been because a moderate-strength promoter from maize was used for the transgenic maize reporter constructs instead of the minimal 35S promoter used in Plant STARR-seq (FIG. 4F and FIG. 10B). To further increase insulator activity, the two-fragment combination D2 was cloned downstream of the three-fragment combinations T9, T32, and T27 (Table 2) toyield three constructs of five fragments (T9+D2, T32+D2, and T27+D2). These five- fragment combinations showed similar insulator activity as the corresponding two- or three-fragment combinations (FIG. 4E and FIG. 10A), indicating diminishing returns from stacking increasing numbers of fragments. Because most insulator combinations reached the detection limit in the Plant STARR-seq assay but not in the stable maize plants, the correlation between the ELISA and Plant STARR seq data was low (FIGs 3F and 3G, and FIG. 10B). However, a strong correlation was observed between ELISA results for samples obtained from different plant tissues (leaf, stalk, and root) and developmental stages (V6 and Rl). This observation is consistent with the results for single insulator fragments and indicates that insulator activity is not strongly affected by tissue identity or developmental stage.Insulator-derived fragments also exhibit silencer activity

[0101] Without wishing to be bound by any particular theory7, the comparison of the Plant STARR-seq and stable maize data can suggest that insulator activity may be promoter-dependent. To investigate this hypothesis, constructs with hybrid promoters were built by inserting the AB80 or Cab-1 enhancer between the 35S minimal promoter and the insulator fragments and it was tested whether an additional downstream enhancer affected the ability of the insulator-derived fragments to block an upstream 35S enhancer (FIG. 5A, top). Many fragments showed insulator activity with both downstream enhancers (FIG. 5B. left and SEQ ID NOs: 19, 191 -20,082) and this activity7was only slightly weaker than in constructs without a downstream enhancer (FIGs 12A-12D). Without washing to be bound by any particular theory7, this finding can suggest that the insulator-derived fragments remain active at a greater distance and work with more complex promoters than the short 35 S minimal promoter.

[0102] A set of control constructs without the upstream 35S enhancer (FIG. 5A, bottom) was also tested and it w as found that many insulator fragments resulted in lower enrichment than a control construct without an insulator fragment (FIG. 5B, right and SEQ ID NOs: 19, 191 -20,082), indicating transcriptional repression. The enrichment of reporter constructs with and without the upstream 35S enhancer was well correlated (FIG. 5C). Without wishing to be bound by any particular theory7, these results demonstrate that fragments derived from characterized insulators with enhancer blocking activity in Plant- STARR-seq can also function as transcriptional silencers. To rigorously assess whether the insulator-derived fragments had silencer activity7, anew library with two different constructlayouts was built: (i) in the 'insulator' construct, the fragments were inserted between the 35S enhancer and 35S minimal promoter; and (ii) in the ‘silencer' construct, the fragments were inserted upstream of the 35 S enhancer (FIG. 5D). As with other results in this disclosure, many fragments led to a reduced enrichment of the reporter gene when inserted between the enhancer and promoter (z.e., in the insulator construct). The insulator-derived fragments showed little to no activity in the silencer construct in tobacco; however, some silencer activity was observed in maize (FIG. 5E and SEQ ID NOs:20, 083-20, 523).

[0103] It was reasoned that the activity of fragments in the insulator construct might be a combination of enhancer-blocking activity and silencer activity. To quantify what fraction of the apparent insulator activity could be explained by transcriptional repression rather than insulation, the activities of all fragments in the insulator construct were plotted against their activities in the silencer construct (FIG. 5F). The slope of the regression line in these plots is a proxy for the maximal contribution of transcriptional repression to the apparent insulator activity. Up to 6% and 43% of the observed activity in the insulator construct could be explained by silencer activity in tobacco and maize, respectively (FIG. 5F).Silencer activity depends on enhancer strength

[0104] Because evidence of silencer activity was found in tobacco leaves in constructs containing the AB80 or Cab-1 enhancer (FIGs 5B and 5C), but not in those with the strong 35S enhancer (FIGs 5E and 5F), insulator and silencer constructs with eight different enhancers w ere built (FIGs 6A and 6B). These enhancers showed a wide range of strength in tobacco but were all, apart from the 35S enhancer, weak in maize (FIG. 6B).

[0105] These enhancers were tested with six full-length insulators and six insulator- derived fragments (Table 3). Insulators and insulator fragments showed little activity as silencers with strong enhancers (like the 35S, At-9661, and SI- 12881 enhancers in tobacco and the 35 S enhancer in maize) but much more activity' as silencers with weak enhancers (FIG. 6C and SEQ ID NOs:20, 524-20, 725). This result conclusively demonstrates that these previously identified insulators and their fragments can function as enhancerblocking insulators or as silencers depending on regulatory context.

[0106] As before, the enrichment of fragments in insulator constructs was plotted against their enrichment in silencer constructs. The slope of a linear regression line was used as a proxy to determine how much of the apparent insulator activity could be explained by silencer activity. For constructs with strong enhancers, between 6% and 27% of theapparent insulator activity could be explained by silencer activity’. This proportion increased with weak enhancers, such that silencer activity could explain up to 94% of the observed activity in the insulator construct. Overall, the slopes negatively correlated with the strength of the corresponding enhancer (FIG. 6D). To test whether the insulators showed silencer activity when integrated into the genome, dual-luciferase reporter constructs were used with the insulator residing upstream of the 35S or AB80 enhancer to generate stable transgenic Arabidopsis plants (FIG. 12A). As in the transient Plant STARR- seq experiments, the insulators showed no silencer activity’ with the strong 35S enhancer and partial silencer activity with the somewhat weaker AB80 enhancer in transgenic Arabidopsis plants (FIGs 12B-12D). Taken together, these results are consistent with the observation that previously identified insulators show silencer activity that is inversely correlated w ith the strength of the enhancer with which they are paired.Discussion

[0107] Using the high throughput Plant STARR-seq assay on fragments of insulators known to be functional in plants, more than 100 170-bp fragments with enhancer-blocking activity’ were identified and characterized. These short fragments can be combined to generate stronger insulators, at least some of which are capable of completely blocking the activity of the viral 35S enhancer. The fragments were active as insulators with different enhancers and promoters and across diverse plant tissues. Surprisingly, these insulators and their fragments showed silencer activity' when coupled with weak enhancers.

[0108] This unexpected finding showcases the complexity of regulatory grammar, wherein cis-regulatory elements can have multiple activities that may be observed only in specific conditions or contexts. For example, mesoderm-specific Drosophila silencers often function as enhancers in other cell types. Thus, regulatory elements must be tested systematically in different contexts - e.g., as insulators, silencers, or enhancers, and across species and tissues - to understand the mechanistic underpinnings of their potentially complex functions. The elements developed herein behaved like classical enhancerblocking insulators in combination with strong enhancers, as they reduced reporter expression only when inserted betw een the enhancer and promoter. In contrast, with weak enhancers, the same elements behaved like typical silencers that repressed transcription in a position independent manner. With intermediate strength enhancers, a continuum between these two extremes was observed: The elements reduced transcription when placed either upstream or downstream of the enhancer, but the effect was stronger in thedownstream context. The observed activity can be a combination of distinct insulator and silencer functions or another novel, unknown regulatory mechanism. Interestingly, independent of enhancer strength, the activity of fragments in insulator and silencer constructs is well correlated; without wishing to be bound by any particular theory, this may suggest that the latter might be the case.

[0109] To date, the molecular mechanisms underlying plant insulator function are unknown. In animals, several DNA-binding proteins, including su(Hw), BEAF-32, and Zw5 in Drosophila and CTCF in humans, play a role in insulator function. However, homologs of these proteins have not been identified in plants. The number of fragments with insulator activity tested here may be too small to derive putative protein-binding motifs with confidence. Moreover, there is no evidence that insulation in plants requires protein binding.

[0110] In contrast to enhancer activity', it was found herein that insulator activity was orientation-dependent. In some prior instances, orientation-dependence was a consequence of composite elements with both insulator and enhancer activities. An alternative explanation for orientation dependence is that structural properties of the insulator DNA contribute to insulator function, a hypothesis that is also consistent with the finding that GC content is a contributor to insulator activity.

[0111] Short insulator elements, as disclosed herein, are useful for plant biotechnology to minimize the size of transgene cassettes to ensure efficient transformation. Prior efforts to produce transgene cassettes, including those composed of multiple genes, had unsatisfactory and unpredictable expression patterns, even when regulation of the individual genes was well-characterized. The insulators identified herein are proposed to be building blocks to make expression more predictable and thus plant engineering more economically feasible.

[0112] The insulator activity' as disclosed herein exhibited some specificity' to the tobacco or maize system, which can suggest that insulators can be designed for either dicots or monocots, as well as both dicots and monocots. Although the present disclosure shows that the use of insulators in transgene cassettes can account for both their silencer and insulator activities, existing plant biotechnology' efforts tend to use strong constitutive promoters, such that silencer activity is negligible. Moreover, when used with tissue- or condition-specific enhancers, insulators with enhancer-dependent silencer activity can be beneficial. Such insulator-enhancer combinations as enabled by the present disclosure canrepress leak ’ expression in tissues or conditions in which the enhancer is inactive and insulate expression when the enhancer becomes fully active. Similarly, the dual-function elements disclosed herein can be used to fine-tune transgene expression by repressing overly-active transcription while simultaneously isolating the transgene from other surrounding regulator}' elements.Materials and methodsLibrary design and construction

[0113] The full-length -EXOB. BEAD-1C, UASrpg, and gypsy insulators were ordered as synthesized DNA fragments. The synthetic insulators slnsl (SEQ ID NO: 1439) and slns2 (SEQ ID NO: 1440) were PCR amplified from pZS*l l_4enh (www.addgene.org / 149423 / ) and pEvolvR-enCas9-PolI3M-TBD (Addgene no. 113077; https: / / www.addgene.org / 113077 / ), respectively. Insulator fragments were ordered as an oligonucleotide array from Twist Bioscience® with 15-bp flanking sequences for amplification. The 35S, AB80. and Cab-1 enhancers were PCR amplified from pZS* l l_4enh. The At-9661, Sl-12881. Sb-11289, Zm-23177, and Sl-774 enhancers were ordered as synthesized DNA fragments. The sequences of the full-length insulators and the oligonucleotides used in this example are listed in SEQ ID NOs:l, 439-1, 442 and SEQ ID NOs:20, 726-20, 871, respectively. All libraries used in this example were constructed using pPSm, a shortened version of pPSup (Addgene no. 149416; https: / / www.addgene.org / 149416 / ) lacking the BlpR cassette, as the base plasmid. The plasmid’s T-DNA region harbors a GFP reporter construct terminated by the poly(A) site of the Arabidopsis (Arabidopsis thaliana) ribulose bisphosphate carboxylase small chain 1 A gene. Two versions of pPSm were created to receive insulators in the forward (pPSmF) or reverse (pPSmR) orientation by changing the Bsal scars to ACTC and CTGT or AC AG and GAGT, respectively. The plasmids were deposited at Addgene® (Addgene no. 226912 and 226913; https: / / www.addgene.org / 226912 / ; https: / / www.addgene.org / 226913 / ). Gibson assembly was used to insert enhancers into pPSm plasmids. The 35S minimal promoter followed by the 5' UTR from a maize histone H3 gene (Zm00001d041672), an ATG start codon and a 18-bp random barcode (VNNVNNVNNVNNVNNVNN; wherein V = A, C, or G) was cloned in front of the second codon of GFP by Golden Gate cloning using BbsI-HF (New England Biolabs®; NEB®). To distinguish between sub-libraries, positions 1, 4. 7, 10, 13, and 16 of the barcodes were set to fixed bases. Insulators and insulator fragments were inserted into the pPSm plasmids by Golden Gate cloning usingBsaI-HFv2 (NEB®). The resulting libraries were bottlenecked to yield about 20-50 barcodes per enhancer. The base plasmid for dual-luciferase constructs was derived from pDL (Addgene no. 208978; https: / / www.addgene.org / 208978 / ;) by changing the Bsal scars to ACTC and CTGT. The 35S or AB80 enhancer was inserted into this plasmid upstream or downstream of the Bsal Golden Gate cassette via Gibson assembly. Full-length insulators and insulator fragments were inserted by Golden Gate cloning using BsaI-HFv2 (NEB®). For rice dual-luciferase constructs, the BlpR cassette was replaced by a hygromycin resistance gene under control of the switchgrass polyubiquitin 2 promoter and the 35S terminator derived from plasmid JD633 (Addgene no. 160393; https: / / www.addgene.org / 160393 / ). The expression cassettes for the Agrobacterium- as,Q transformation vectors to generate transgenic com plants included a reporter gene driven by a moderate strength constitutive promoter coupled to a heterologous intron with either the CaMV 35 S enhancer upstream of the promoter (negative control) or no enhancer (positive control). The same terminator was used in cassettes to terminate transcription. The insulators were tested using the expression cassette with the 35S enhancer by inserting them between the 35S enhancer and the promoter.Tobacco cultivation and transformation

[0114] Tobacco (Nicotiana benthamiana) was grown in soil (Sunshine Mix no. 4) at 25°C in a long-day photoperiod (16 h light and 8 h dark; cool-white fluorescent lights [Philips TL-D 58 W / 840]; intensity 300 pmol m-2s-1). Plants were transformed approximately 3 weeks after germination. For transient transformation of tobacco leaves, Plant STARR-seq libraries were introduced into Agrobacterium tumefaciens strain GV3101 (harboring the virulence plasmid pMP90 and the helper plasmid pMisoG) by electroporation. An overnight culture of the transformed A. tumefaciens was diluted into 100 ml YEP medium (1% [w / v] yeast extract and 2% [w / v] peptone) and grown at 28°C for 8 h. A 5-ml input sample of the cells was collected, and plasmids were isolated from it using the QIAprep® Spin Miniprep® Kit (QIAGEN®) according to the manufacturer’s instructions. The remaining cells were harvested and resuspended in 100 ml induction medium (M9 medium [3 g / L KH2PO4, 0.5 g / L NaCl, 6.8 g / L Na2HPO4, and 1 g / L NH4C1] supplemented with 1% [w / v] glucose, 10 mM MES, pH 5.2, 100 pM CaCl2, 2 mM MgSO4, and 100 pM acetosyringone). After overnight growth, the Agrobacteria were harvested, resuspended in infiltration solution (10 mM MES, pH 5.2, 10 mM MgCl2, 150 pM acetosyringone, and 5 pM lipoic acid) to an optical density (OD) of 1 and infiltrated intoleaves 3 and 4 of two (full-length insulator library’) or four (all other libraries) tobacco plants. The plants were further grown for 48 h under normal conditions (16 h light and 8 h dark) or in the dark before mRNA extraction.Maize cultivation and transformation

[0115] For Plant STARR-seq in maize (Zea mays L. cultivar B73), a PEG transformation method was used. Maize seeds were germinated in soil at 25°C in a long- day photoperiod (16 h light and 8 h dark; cool-white fluorescent lights [Philips® TL-D 58 W / 840]; intensity’ 300 pmol tn-2s-1). After 3 days, the seedlings yvere moved to complete darkness at 25°C and grown for 10-11 days. From each seedling, 10 cm sections from the second and third leaf were cut into thin 0.5 mm strips perpendicular to veins and immediately submerged in 10 ml of protoplasting enzyme solution (0.6 M mannitol, 10 mM MES pH 5.7, 15 mg / ml cellulase R10, 3 mg / ml macerozyme, 1 mM CaCL, 0. 1% [yv / v] BSA, and 5 mM beta-mercaptoethanol). The mixture was covered in foil to keep out light, vacuum infiltrated for 3 min, and incubated on a shaker at 40 rpm for 2.5 hours. Protoplasts were released by incubating an extra 10 min at 80 rpm. To quench the reaction. 10 mL ice- cold MMG (0.6 M Mannitol, 4 mM MES pH 5.7, 15 mM MgCl2) was added to the enzyme solution and the whole solution was filtered through a 40 pM cell strainer. To pellet protoplasts, the filtrate was split into equal volumes of no more than 10 mL in chilled round-bottom glass centrifuge vials and centrifuged at 100 x g for 4 min at room temperature (RT). Pellets were resuspended in 1 mL cold MMG each and combined into a single round-bottom vial. To yvash, MMG yvas added to make a total volume of 5 mL and the solution yvas centrifuged at 100 x g for 3 min at RT. This wash step was repeated two more times. The final pellet was resuspended in 1-2 mL of MMG. A sample of the resuspended protoplasts was diluted 1 : 20 in MMG and used to count the number of viable cells using Fluorescein Diacetate as a dye. For each replicate, one to ten million protoplasts were mixed with 15-150 pg of the Plant STARR-seq plasmid library' in a fresh tube, topped with MMG to a volume of 114.4 pL per million protoplasts, and incubated on ice for 30 min. For PEG transformation, 105.6 pL per million protoplasts of PEG solution (0.6 M Mannitol, 0. 1 M CaCl2. 25% [w / v] poly-ethylene glycol MW 4000) was added to reach a final concentration of 12% (w / v) PEG. The mixture yvas incubated for 10 min in the dark at RT. After incubation, the transformation solution was diluted with five volumes incubation solution (0.6 M Mannitol, 4 mM MES pH 5.7, 4 mM KC1), and centrifuged at 100 x g for 4 min at RT. The protoplast pellet yvas washed with 5 mL of incubation solution,centrifuged at 100 x g for 3 min at RT, and resuspended in incubation solution to a concentration of 500 cells / pL. Protoplasts were incubated overnight in the dark at RT to allow for transcription of the plasmid library and then pelleted (4 min, 100 x g, RT). The pellet was washed with 1-5 mL incubation solution and centrifuged (3 min, 100 x g, RT). The pellet was finally resuspended in 1-5 mL incubation solution. An aliquot of the solution was used to check transformation efficiency under a microscope. Cells were pelleted (4 min, 100 x g, RT) and resuspended in 1-2 mL Trizol for subsequent mRNA extraction. An aliquot of the plasmid library used for PEG transformation was used as the input sample for Plant STARR-seq. Stable transgenic maize plants were then generated using an existing method.Arabidopsis cultivation and transformation

[0116] Arabidopsis thaliana Col-0 was grown in soil (Sunshine Mix no. 4) at 20°C in a long-day photoperiod (16 h light and 8 h dark; cool-white fluorescent lights [Sylvania® FO32 / 841 / ECO 32W]; intensity’ 100 pmol m-2s-1). For transformation, dual-luciferase plasmids were introduced into Agrobacterium tumefaciens strain GV3101 (harboring the virulence plasmid pMP90 and the helper plasmid pMisoG) by electroporation. Transgenic Arabidopsis plants were generated by floral dipping and selected for by spraying with a 0.01% (w / v) Glufosinate solution.Rice cultivation and transformation

[0117] The rice (Oryza sativa L. ssp. japonica) cultivar Kitaake was used for genetic transformation following an existing protocol with slight modifications. The mature seeds were sterilized with a 7.5% (w / v) sodium hypochlorite solution for 20 minutes, followed by three sterile water rinses. The seeds were placed on callus induction medium (4.4 g / L MS salts with vitamins, 30 g / L sucrose, 2 mg / L 2,4-dichlorophenoxyacetic acid, 8 g / L agar, pH 5.8) to induce callus cells from scutellum for 10 days. The calli were cocultivated on callus induction medium supplemented with 200 pM of acetosyringone for 3 days with the Agrobacterium strain EHA101 (OD = 0.5) carrying individual insulator constructs. The callus cells were transferred to callus induction medium supplemented with 300 mg / L timentin and 50 mg / L hygromycin for two rounds of selection. The hygromycin resistant callus cells of individual lines were transferred to regeneration medium (4.4 g / L MS salts with vitamins, 30 g / L sucrose, 3 mg / L 6-benzylaminopurine, 0.5 mg / L 1- naphthaleneacetic acid, 8 g / L agar, 25 mg / L hygromycin, 150 mg / L timentin, pH 5.8) for about two rounds to regenerate shoots. The shoots were transferred to rooting medium (4.4g / L MS salts with vitamins, 30 g / L sucrose, 25 mg / L hygromycin, 8 g / L agar, pH 5.8) and were grown till healthy roots were produced before transferring to soil. The plantlets were transferred to a plastic box containing topsoil from the research farm at the University of Missouri flooded with water. The plantlets were grown in a greenhouse with a short-day photoperiod (12 h light and 12 h dark) at 28°C and 24°C during the day and night, respectively.Plant STARR-seq

[0118] For all tobacco Plant STARR-seq experiments, two independent biological replicates were performed. Different plants and fresh Agrobacterium cultures were used for each biological replicate. Tobacco leaves were harvested 2 days after infiltration and partitioned into batches of 4 leaves. The leaf batches were frozen in liquid nitrogen, finely ground with mortar and pestle, and immediately resuspended in 10 mL QIAzol (Qiagen®). The suspensions were cleared by centrifugation (5 min, 4,000 x g, 4°C). The supernatant was transferred to a 15 mL MaXtract High Density tube (Qiagen®) and mixed vx i th 2.5 mL chloroform. After centrifugation (10 min. 1,000 x g, 4°C), the supernatant (approximately 7 mL) was poured into a new tube, and mixed by inversion with 3.5 mL high salt buffer (0.8 M sodium citrate, 1.2 M NaCl) and 3.5 mL isopropanol. The solution was incubated for 15 min at RT to precipitate the RNA and centrifuged (30 min, 4,000 x g, 4°C). The pellet was washed with 10 mL ice-cold 70% ethanol, centrifuged (5 min, 4000 x g, 4°C). and air-dried. The pellet was resuspended in 625 pL of warm (65°C) nuclease-free water and transferred to a new tube. The solution was supplemented with 70 pL 20X DNase I buffer (1 mM CaCl2, 100 mM Tris pH 7.4), 70 pL 200 mM MnCl2, 5 pL DNase I (ThermoFisher Scientific®), and 1 pL RNaseOUT (ThermoFisher Scientific®). After 1 h incubation at 37°C, the reaction was stopped with 50 pL 500 mM EDTA. To precipitate the RNA, 375 pL high salt buffer and 375 pL isopropanol were added. After incubation for 15 min at room temperature (RT), the RNA was pelleted by centrifugation (20 min, 20,000 x g, 4°C). The pellet was washed with 1 mL ice-cold 70% ethanol, centrifuged (5 min, 20,000 x g, 4°C), air-dried, and resuspended in 50 pL nuclease-free water. All batches of the same sample were pooled, and the solution was supplemented with 0.5 pL RNaseOUT™. For cDNA synthesis, two to four reactions with 11 pL RNA solution, 1 pL 10 pM GFP496 specific reverse transcription primer, and 1 pL 10 mM dNTPs were incubated at 65°C for 5 min then immediately placed on ice. The reactions were supplemented with 4 pL 5X SuperScript IV buffer, 1 pL 100 mM DTT, 1 pLRNaseOUT™, and 1 pL SuperScript IV reverse transcriptase (ThermoFisher Scientific®). To ensure that the samples were largely free of DNA contamination, four reactions were used as controls, where the reverse transcriptase and RNaseOUT™ were replaced with water. Reactions were incubated for 10 min at 55°C, followed by 10 min at 80°C. Sets of 4 reactions each were pooled. The cNDA was purified with the Clean&Concentrate-5 kit (Zymo Research®) and eluted in 20 pL 10 mM Tris. The barcode was amplified with 10- 20 cycles of polymerase chain reaction (PCR) and read out by next generation sequencing.

[0119] For Plant STARR-seq in maize protoplasts, the protoplast-containing Trizol solution from PEG transformation was transferred to 2 mb Phasemaker tubes (1 rnL per tube; ThermoFisher Scientific®), mixed thoroughly with 300 pL chloroform, and centrifuged (5 min, 15,000 x g, 4°C). RNA was extracted using the RNeasy Plant Mini Kit (QIAGEN®). The supernatant was transferred to a QIAshredder column (QIAGEN®) and centrifuged (2 min, 20,000 x g, RT). The flow through was transferred to a new 1.5 mb tube and mixed with 300 pL 100% ethanol. Up to 500 pL of the solution was loaded on an RNeasy mini spin column (QIAGEN®). After centrifugation (10 seconds, 16,100 x g, RT) the flowthrough was discarded. This was repeated until the whole solution had been added to the column. The column was washed with 350 pL RW1 buffer followed by centrifugation (30 sec. 16.100 x g, RT). An on-column DNase I digestion was performed with 70 pL RDD buffer and 10 pL DNase I (QIAGEN®) for 15 min at RT. The column was washed once with 350 pL RW1 buffer and twice with 500 pL RPE buffer. After each wash step, the column was centrifuged (30 sec, 16,100 x g, RT) and the flow through was discarded. The column w as dried with an extra centrifugation step (30 sec, 16,100 x g, RT) and transferred to a 1.5 mL collection tube. For elution, 50 pL of RNase-free water was added, and the column was incubated for 1 min, and centrifuged (1 min, 16,100 x g, RT). This elution step was repeated with an additional 40 pL of RNase-free w ater. The eluate was treated with DNase I (5 pL of 20x DNasel buffer, 5 pL 200 mM MnCU, 1 pL RNaseOUT™, and 2 pL DNase I) for 1 h at 37°C. The solution was supplemented with 20 pL 500 mM EDTA, 1 pL 20 mg / mL glycogen, 12 pL ice-cold 8M LiCl, and 300 pL ice- cold 100% ethanol. The solution was incubated 15 min at -80°C, centrifuged (20 min, 20,000 x g, 4°C). The pellet was washed with 500 pL ice-cold 70% ethanol, and centrifuged (3 min, 20.000 x g, 4°C). The pellet was air-dried and resuspended in 100 pL RNase-free water. Reverse transcription, purification, PCR amplification and sequencing were performed as for the tobacco samples.Subassembly and barcode sequencing

[0120] Paired-end sequencing on an Illumina®’ NextSeq™ 550 platform or Illumina® NextSeq™ 2000 platform was used to link insulator fragments to their respective barcodes. The insulator region was sequenced using paired reads (100-150 bp), and two 18-bp indexing reads were used to sequence the barcodes. The paired insulator fragment and barcode reads were assembled using PANDAseq (version 2.11). Insulator fragment-barcode pairs with less than 5 reads and insulator fragments with a mutation or truncation were discarded. For each Plant STARR-seq experiment, barcodes were sequenced using paired-end reads on an Illumina® NextSeq™ 550 platform or Illumina® NextSeq™ 2000 platform. The paired barcode reads were assembled using PANDAseq.Non-Limiting Embodiments

[0121] While general features of the disclosure are described and shown and particular features of the disclosure are set forth in the claims, the following non-limiting embodiments relate to features, and combinations of features, that are explicitly envisioned as being part of the disclosure. The following non-limiting Embodiments contain elements that are modular and can be combined with each other in any number, order, or combination to form a new non-limiting Embodiment, which can itself be further combined with other non-limiting Embodiments.

[0122] Embodiment 1 . A method for determining whether a candidate sequence is an insulator in a plant genetic environment, the method comprising: cloning the candidate sequence betw een an enhancer and a promoter to produce a test sequence; and attempting to initiate transcription from the test sequence, wherein reduced transcription relative to a control construct without the candidate sequence indicates the candidate sequence or a portion thereof is the insulator.

[0123] Embodiment 2. The method of Embodiment 1 or any other Embodiment, further comprising: cloning the candidate sequence upstream of the enhancer and the promoter to produce a second test sequence and attempting to initiate transcription from the second test sequence, wherein transcript levels similar to that of the control construct indicate the candidate sequence or the portion thereof is the insulator, and wherein reduced transcription relative to the control construct indicates the candidate sequence or the portion thereof is a silencer.

[0124] Embodiment 3. The method of any one of Embodiments 1-2 or any other Embodiment, further comprising: cloning a plurality of candidate sequences between a plurality of enhancers and promoters to produce a plurality of first test sequences that comprise barcodes, transforming the first plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the first plurality of test sequences; cloning at least a portion of candidate sequences upstream of enhancers and promoters to produce a plurality of second test sequences that comprise barcodes, transforming the second plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the second plurality of test sequences; measuring levels of barcode messenger RNA (mRNA) transcripts of the first plurality of test sequences and the second plurality of test sequences and measuring levels of barcode DNA of the first plurality of test sequences and the second plurality of test sequences, and calculating relative transcription levels as ratios of levels of barcode mRNA transcripts to levels of barcode DNA, wherein reduced relative transcription levels of first test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators or silencers, wherein similar relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators, and wherein reduced relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are silencers.

[0125] Embodiment 4. The method of any one of Embodiments 1 -3 or any other Embodiment, wherein transcription levels are measured with a sequencing method.

[0126] Embodiment 5. The method of any one of Embodiments 1-4 or any other Embodiment, wherein the sequencing method comprises next-generation sequencing (NGS).

[0127] Embodiment 6. The method of any one of Embodiments 1-5 or any other Embodiment, wherein the sequencing method comprises a reverse-transcription (RT) step.

[0128] Embodiment 7. The method of any one of Embodiments 1-6 or any other Embodiment, wherein the plant genetic environment is a plant genome, or a portion thereof, of a plant cell, a plant tissue, or a plant organism.

[0129] Embodiment 8. The method of any one of Embodiments 1-7 or any other Embodiment, wherein the plant genetic environment corresponds to an agricultural plant organism or an agricultural crop.

[0130] Embodiment 9. The method of any one of Embodiments 1-8 or any other Embodiment, wherein the plant genetic environment comprises a tobacco genetic environment, a maize genetic environment, a rice genetic environment, a sorghum genetic environment, a tomato genetic environment, or an Arabidopsis thaliana genetic environment.

[0131] Embodiment 10. The method of any one of Embodiments 1-9 or any other Embodiment, wherein the enhancer comprises a 35S enhancer and the promoter comprises a 35S minimal promoter.

[0132] Embodiment 11. The method of any one of Embodiments 1-10 or any other Embodiment, wherein one or more candidate sequences are cloned in a forward orientation with respect to the plant genetic context, a reverse orientation with respect to the plant genetic context, or both.

[0133] Embodiment 12. The method of any one of Embodiments 1-11 or any other Embodiment, wherein one or more candidate sequences determined to be insulators comprise a higher frequency of guanine and cytosine (GC) nucleobases relative to a random sequence.

[0134] Embodiment 13. An insulator comprising a polynucleotide sequence configured for regulation of transcription within one or more plant genetic environments.

[0135] Embodiment 14. The insulator of Embodiment 13 or any other Embodiment, wherein the insulator does not comprise a naturally-occurring plant sequence.

[0136] Embodiment 15. The insulator of any one of Embodiments 13-14 or any other Embodiment, wherein the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity7, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1439 (Synthetic insulator 1 (slnsl)).

[0137] Embodiment 16. The insulator of any one of Embodiments 13-14 or any other Embodiment, wherein the insulator comprises a polynucleotide sequence having at least 80% identity’, at least 85% identity, at least 90% identity, at least 91% identity, atleast 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1440 (Synthetic insulator 2 (slns2)).

[0138] Embodiment 17. The insulator of Embodiment 13 or any other Embodiment, wherein the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 1-1,438, SEQ ID NOs: 1,441-1,446. SEQ ID NOs: 1,447-2,361. SEQ ID NOs:2, 362-19, 190, SEQ ID NOs: 19,191-20,082, SEQ ID N0s:20,083-20,523, SEQ ID NOs:20,524-20,725, and any combination thereof.

[0139] Embodiment 18. A plant genetic construct comprising the insulator of any one of Embodiments 13-17 or any other Embodiment.

[0140] Embodiment 19. A plant cell, plant tissue, or plant comprising the plant genetic construct of Embodiment 18 or any other Embodiment, wherein the plant cell, plant tissue, or plant is produced by a genetic engineering method.

[0141] Embodiment 20. The plant cell, plant tissue, or plant of Embodiment 19 or any other Embodiment, wherein the insulator is stably integrated into a genome of the plant cell, plant tissue, or plant, and wherein the insulator regulates expression of a transgene of the genome by at least partially insulating the transgene from regulatory crosstalk.

[0142] While illustrative embodiments have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the disclosure.

Claims

CLAIMSThe embodiments of the invention in which an exclusive property- or privilege is claimed are defined as follows:

1. A method for determining whether a candidate sequence is an insulator in a plant genetic environment, the method comprising: cloning the candidate sequence between an enhancer and a promoter to produce a test sequence; and attempting to initiate transcription from the test sequence, wherein reduced transcription relative to a control construct without the candidate sequence indicates the candidate sequence or a portion thereof is the insulator.

2. The method of claim 1, further comprising: cloning the candidate sequence upstream of the enhancer and the promoter to produce a second test sequence and attempting to initiate transcription from the second test sequence, wherein transcript levels similar to that of the control construct indicate the candidate sequence or the portion thereof is the insulator, and wherein reduced transcription relative to the control construct indicates the candidate sequence or the portion thereof is a silencer.

3. The method of claim 1, further comprising: cloning a plurality of candidate sequences between a plurality of enhancers and promoters to produce a plurality- of first test sequences that comprise barcodes, transforming the first plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the first plurality- of test sequences; cloning at least a portion of candidate sequences upstream of enhancers and promoters to produce a plurality of second test sequences that comprise barcodes, transforming the second plurality of test sequences into plant cells or tissues, and attempting to initiate transcription from the second plurality' of test sequences; measuring levels of barcode messenger RNA (mRNA) transcripts of the first plurality of test sequences and the second plurality of test sequences and measuring levels of barcode DNA of the first plurality' of test sequences and the second plurality- of test sequences, and calculating relative transcription levels as ratios of levels of barcode mRNA transcripts to levels of barcode DNA,wherein reduced relative transcription levels of first test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators or silencers, wherein similar relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are insulators, and wherein reduced relative transcription levels of second test sequences relative to the control construct indicates one or more candidate sequences thereof, or portions thereof, are silencers.

4. The method of claim 1, wherein transcription levels are measured with a sequencing method.

5. The method of claim 4, wherein the sequencing method comprises nextgeneration sequencing (NGS).

6. The method of claim 4, wherein the sequencing method comprises a reverse-transcription (RT) step.

7. The method of claim 1, wherein the plant genetic environment is a plant genome, or a portion thereof, of a plant cell, a plant tissue, or a plant organism.

8. The method of claim 1 , wherein the plant genetic environment corresponds to an agricultural plant organism or an agricultural crop.

9. The method of claim 8, wherein the plant genetic environment comprises a tobacco genetic environment, a maize genetic environment, a rice genetic environment, a sorghum genetic environment, a tomato genetic environment, or an Arcibidopsis thaliana genetic environment.

10. The method of claim 1, wherein the enhancer comprises a 35S enhancer and the promoter comprises a 35S minimal promoter.

11. The method of claim 1. wherein one or more candidate sequences are cloned in a forward orientation with respect to the plant genetic context, a reverse orientation with respect to the plant genetic context, or both.

12. The method of claim I . wherein one or more candidate sequences determined to be insulators comprise a higher frequency of guanine and cytosine (GC) nucleobases relative to a random sequence.

13. An insulator comprising a polynucleotide sequence configured for regulation of transcription within one or more plant genetic environments.

14. The insulator of claim 13, wherein the insulator does not comprise a naturally-occurring plant sequence.

15. The insulator of claim 14, wherein the insulator comprises a polynucleotide sequence having at least 80% identity7, at least 85% identity, at least 90% identity7, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1439 (Synthetic insulator 1 (slnsl)).

16. The insulator of claim 14, wherein the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity7, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence of SEQ ID NO: 1440 (Synthetic insulator 2 (slns2)).

17. The insulator of claim 13, wherein the insulator comprises a polynucleotide sequence having at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity7, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity7to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 1-1,438, SEQ ID NOs: 1,441-1,446. SEQ ID NOs: 1,447-2.361, SEQ ID NOs:2,362-19,190, SEQ ID N0s: 19,191-20,082, SEQ ID N0s:20,083-20,523, SEQ ID NOs:20, 524-20, 725, and any combination thereof.

18. A plant genetic construct comprising the insulator of claim 13.

19. A plant cell, plant tissue, or plant comprising the plant genetic construct of claim 18, wherein the plant cell, plant tissue, or plant is produced by a genetic engineering method.

20. The plant cell, plant tissue, or plant of claim 19. wherein the insulator is stably integrated into a genome of the plant cell, plant tissue, or plant, and wherein the insulator regulates expression of a transgene of the genome by at least partially insulating the transgene from regulatory cross-talk.

Citation Information

Patent Citations

  • Gene Expression Modulating Element

    US20100083408A1

  • High-throughput screening of regulatory element function with epigenome editing technologies

    US20180291370A1

  • Multiplexing regulatory elements to identify cell-type specific regulatory elements

    US20220170910A1