CLDN18.2-expressing gastric cancer cell line for evaluating efficacy and safety of CLDN18.2 target drugs, and animal model comprising same

Abstract

The present invention relates to a CLDN18.2-expressing gastric cancer cell line for evaluating the efficacy and safety of CLDN18.2 target drugs, a gastric cancer animal model comprising same, and methods for preparing the cell line and animal model. A gastric cancer cell line and a gastric cancer animal model which naturally overexpress CLDN18.2 according to the present invention can be used to evaluate the efficacy and stability of CLDN18.2 target drugs with greater accuracy than a gastric cancer cell line and a gastric cancer animal model which artificially overexpress CLDN18.2.

Description

CLDN18.2-expressing gastric cancer cell line and animal model containing the same for evaluating the efficacy and safety of CLDN18.2 target drugs

[0001] The present invention relates to a CLDN18.2-expressing gastric cancer cell line for evaluating the efficacy and safety of a CLDN18.2 target drug, a gastric cancer animal model including the same, and a method for producing the same.

[0002] The present invention is a technology developed with the support of the Ministry of Health and Welfare's 2024 "Clinical Development of Neoantigen Targeted T-Cell Therapy (Project No. 24H1660)" and the Ministry of Health and Welfare's 2024 "CAR-T Researcher-Initiated Clinical Trial Using Own Production Facilities (Project No. 24H1710)" support project.

[0003] Gastric cancer is the fourth most common cause of cancer death worldwide (CA Cancer J Clin. 2021; 71:209-249), and few synthetic mouse cell line models for gastric cancer are available, including the previously reported NCC-S1M (Mol. Carcinog. 2015; 54:1521-1527). Therefore, novel synthetic mouse gastric cancer cell lines with well-defined genetic backgrounds are urgently needed in the scientific community, and CLDN18.2-expressing gastric cancer mouse cell lines are particularly important for immunotherapy studies on gastric cancer, such as CAR-T targeting CLDN18.2, which is specifically expressed in the foregut epithelium. CLDN18.2 is present in 38% of human gastric adenocarcinomas (Lancet. 2023;401:1655-1668) and is an important therapeutic target for gastric and pancreatic cancers, for which CAR-T and antibody-drug conjugates are actively being developed. However, there is no synthetic gastric cancer cell line model expressing mouse CLDN18.2 in the scientific community.

[0004] Meanwhile, CLDN18.2 can be artificially overexpressed using CMV and CAG promoters, but in the case of these gastric cancer cell lines, the amount of CLDN18.2 expression is not a natural overexpression, so if the efficacy of a CLDN18.2 target drug (e.g., CAR-T cell) is confirmed with these gastric cancer cell lines, there is a problem that a CLDN18.2 target drug that is not effective in actual clinical practice may be incorrectly evaluated as being effective.

[0005] Accordingly, the present inventors have made extensive efforts to develop an animal syngeneic gastric cancer cell line model that naturally overexpresses CLDN18.2, and as a result, an animal gastric cancer cell line and an animal gastric cancer model that naturally overexpresses CLDN18.2 were developed from a spontaneously generated gastric cancer formed on a mouse that had TP53, Smad4, and Cdh1 knockout under the Pdx-1-Cre promoter.

[0006] One object of the present invention is to provide a Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F The present invention provides an animal gastric cancer cell line having a genotype and naturally overexpressing CLDN18.2.

[0007] Another object of the present invention is to provide an animal model of gastric cancer having the animal gastric cancer cell line.

[0008] Another object of the present invention is to provide a method for producing a gastric cancer animal model.

[0009] Another object of the present invention is to provide a method for producing an animal gastric cancer cell line.

[0010] Another object of the present invention is to provide a method for evaluating the efficacy of a CLDN18.2 target drug.

[0011] Another object of the present invention is to provide a method for evaluating the safety of a CLDN18.2 target drug.

[0012] One aspect of the present invention is Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F It is an animal gastric cancer cell line that has a genotype and naturally overexpresses CLDN18.2.

[0013] In the case of gastric cancer cell lines that artificially overexpress CLDN18.2, since the amount of CLDN18.2 expression is not a natural overexpression, there is a problem that when the efficacy of a CLDN18.2 target drug (e.g., CAR-T cell) is confirmed with such cell lines, a drug that is not effective in actual clinical practice may be incorrectly evaluated as having efficacy. However, the animal gastric cancer cell line according to the present invention has the advantage of being able to more accurately evaluate the efficacy of a CLDN18.2 target drug (e.g., CAR-T cell) compared to a gastric cancer cell line that artificially overexpresses CLDN18.2 because CLDN18.2 is naturally overexpressed.

[0014] In one embodiment, the animal gastric cancer cell line of the present invention is Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F It may be a cell line derived (primary culture) from a gastric cancer that developed spontaneously in an animal with a genetically identical mutation. In this case, the animal is not immunodeficient. In animal models where gastric cancer cells are transplanted into immunodeficient animals, the immunodeficiency makes it difficult to accurately evaluate the efficacy of drugs (e.g., immunotherapy drugs).

[0015] In the present invention, "naturally overexpressing CLDN18.2" means that the expression of CLDN18.2 is increased compared to other animal gastric cancer cells (e.g., natural gastric cancer cells) without artificially manipulating a gene related to the expression of CLDN18.2 to increase the expression of CLDN18.2. For example, it may mean that the expression of CLDN18.2 is increased compared to other animal gastric cancer cells (e.g., natural gastric cancer cells) without genetic manipulation such as modifying the promoter thereof, introducing the gene of CLDN18.2, or mutating the gene of CLDN18.2 to increase the expression of CLDN18.2, but is not limited thereto. Specifically, in the present invention, "naturally overexpressing CLDN18.2" means Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F Naturally occurring gastric cancer cells in mice having a genotype that expresses CLDN18.2, including but not limited to.

[0016] In one embodiment, the animal gastric cancer cell line of the present invention is Villin-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F CLDN18.2 can be naturally overexpressed in animal gastric cancer metastatic cell lines (NCC-S1, NCC-S1M) with the genotype Villin-cre. At this time, the overexpression level of CLDN18.2 is + , Smad4 F / F , Cdh1 F / + , and Trp53 F / FCLDN18.2 expression may be at least 3-fold, at least 5-fold, at least 6-fold, or at least 8-fold higher than that of an animal gastric cancer metastatic cell line having the genotype (e.g., NCC-S1, NCC-S1M) and / or at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold higher than that of a negative control cell line in which CLDN18.2 is hardly expressed (e.g., a human lung cell line (H226 cell line)).

[0017] In the present invention, the animal is Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F The subject may be a rodent, but is not limited to a rodent capable of naturally overexpressing CLDN18.2 due to its genotype. The rodent may include, but is not limited to, a mouse, a rat, or a hamster.

[0018] In one embodiment, the animal gastric cancer cell line of the present invention is H2-K bb , H-2D qq , and IA qq May have haplotypes, but is not limited to them.

[0019] As one embodiment, the animal gastric cancer cell line of the present invention may be, but is not limited to, the NCC-S6M cell line deposited with the Korea Cell Line Bank (KCLB) on December 5, 2023 under the deposit number KCLRF-BP-00529.

[0020]

[0021] Another aspect of the present invention is a gastric cancer animal model having an animal gastric cancer cell line according to the present invention. Specifically, the gastric cancer animal model comprises Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F Have a genotype.

[0022] In the present invention, the Smad4, p53, and Cdh1 genes may be specifically deleted in gastrointestinal epithelial cells, but are not limited thereto.

[0023] Immunodeficient animals are excluded from the gastric cancer animal models of the present invention. In animal models where gastric cancer cells are transplanted into immunodeficient animals, the precise efficacy of drugs (e.g., immunotherapy drugs) cannot be evaluated due to immunodeficiency.

[0024]

[0025] Another aspect of the present invention is a method for producing a gastric cancer animal model comprising the following steps:

[0026] (a) Smad4 F / F Animals with genotype Cdh1 F / F Animals with genotypes, and Trp53 F / F Each animal with the genotype Pdx-Cre + By mating with animals having the genotype Pdx-Cre + and Smad4 F / + Genotype, Pdx-Cre + and Cdh1 F / + Genotype, and Pdx-Cre + and Trp53 F / + A step of obtaining animals having each genotype; and

[0027] (b) Randomly mating and selecting the obtained animals, Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F A step of obtaining an animal having a genotype.

[0028] In the present invention, the method for selecting, i.e., confirming whether the target gene is knocked out, can utilize a method known in the art, such as genotyping PCR. In addition, the method for confirming whether the target gene is knocked out in the present invention can be confirmed at the protein or RNA level. When confirming at the RNA level, RT-PCR and DNA chip methods can be used, and when confirming at the protein level, a method selected from the group consisting of immunofluorescence, mass spectrometry, protein chip, Western blot, and ELISA can be used, but is not limited thereto.

[0029]

[0030] Another aspect of the present invention is a method for producing an animal gastric cancer cell line, comprising the following steps:

[0031] (a) a step of isolating cells or fragments from a tumor of the stomach of a gastric cancer animal model manufactured according to the method for manufacturing a gastric cancer animal model of the present invention; and

[0032] (b) A step of culturing the above cells or fragments.

[0033] The above separation and cultivation can be carried out by any method known in the art.

[0034]

[0035] Another aspect of the present invention is an animal gastric cancer cell line isolated from an animal gastric cancer model according to the present invention. Specifically, the gastric cancer cell line may be an animal gastric cancer cell line produced according to the method for producing an animal gastric cancer cell line according to the present invention. The "animal gastric cancer cell line" and "animal gastric cancer model" are as described above.

[0036]

[0037] Another aspect of the present invention is a method for evaluating the efficacy of a CLDN18.2 target drug, comprising the following steps:

[0038] (a) a step of treating an animal gastric cancer cell line according to the present invention; or an animal gastric cancer model having the animal gastric cancer cell line with a CLDN18.2 target drug; and

[0039] (b) A step of measuring the degree to which the above CLDN18.2 target drug inhibits gastric cancer cells.

[0040] The above drug is not limited to a drug targeting CLDN18.2, but may specifically include a CLDN18.2-targeting CAR-T cell or a CLDN18.2-targeting antibody.

[0041] The above efficacy may include, but is not limited to, one or more of the following: treatment efficacy for gastric cancer, inhibition of gastric cancer cell metastasis, inhibition of gastric cancer recurrence, and prolongation of survival in animal models. The term "treatment" refers to any action that improves or completely cures symptoms of gastric cancer by administering a CLDN18.2-targeting drug.

[0042] Measuring the degree of inhibition of the above gastric cancer cells may include, but is not limited to, measuring one or more of inhibition of gastric cancer cell growth, inhibition of gastric cancer cell metastasis, inhibition of gastric cancer recurrence, and extension of survival period in an animal model compared to a control group (e.g., an untreated group).

[0043] In one embodiment, the evaluation method according to the present invention can be used to determine a pharmaceutically effective amount of a CLDN18.2 target drug. The term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, without causing adverse effects.

[0044] In the present invention, the CLDN18.2 target drug can be treated as an individual drug or in combination with other drugs in an animal gastric cancer cell line or gastric cancer animal model according to the present invention, and can be treated singly or in multiple doses.

[0045] In one embodiment, to evaluate the efficacy of a combination of a CLDN18.2 target drug and another drug, a gastric cancer cell line or gastric cancer animal model according to the present invention may be administered with the CLDN18.2 target drug and another drug. In this case, the CLDN18.2 target drug and the other drug may be administered sequentially, in reverse order, or simultaneously, and may be administered singly or in multiple doses.

[0046]

[0047] Another aspect of the present invention is a method for evaluating the safety of a LDN18.2 target drug, comprising the following steps:

[0048] (a) a step of treating a gastric cancer animal model according to the present invention with a CLDN18.2 target drug; and

[0049] (b) A step of measuring the safety of the CLDN18.2 target drug in the above animal model.

[0050] The above drug is not limited to a drug targeting CLDN18.2, but may specifically include a CLDN18.2-targeting CAR-T cell or a CLDN18.2-targeting antibody.

[0051] Measuring the above safety means measuring the safety indicators of drugs commonly used in the art, and may specifically include, but is not limited to, measuring the degree of side effects of drugs targeting CLDN18.2 (e.g., nausea, vomiting, diarrhea, hives, rash, hair loss, numbness in the hands and feet, anaphylactic shock, difficulty breathing, worsening of renal function, worsening of liver function, etc.).

[0052] In one embodiment, to evaluate the safety of combination therapy with a CLDN18.2 target drug and another drug, a gastric cancer animal model according to the present invention may be administered with the CLDN18.2 target drug and another drug. The CLDN18.2 target drug and the other drug may be administered sequentially, in reverse order, or simultaneously, and may be administered singly or in multiple doses.

[0053] By using a gastric cancer cell line and a gastric cancer animal model that naturally overexpress CLDN18.2 according to the present invention, the efficacy and safety of a CLDN18.2 target drug can be accurately evaluated compared to a gastric cancer cell line and a gastric cancer animal model that artificially overexpress CLDN18.2.

[0054] Figures 1 to 4 are diagrams showing the genetic characteristics of NCC-S6M and tumor development according to the MHC genetic characteristics of mice:

[0055] Figure 1 shows the results of genotype analysis.

[0056] Figure 2 is a schematic diagram of genotype generation by Pdx-Cre recombination in NCC-S6M.

[0057] Figure 3 is a diagram showing the haplotype of NCC-S6M.

[0058] Figure 4 is a diagram showing the tumor occurrence and tumor growth of NCC-S6M.

[0059] Figures 5 to 7 are diagrams analyzing the morphology and protein genome of the NCC-S6M cell line:

[0060] Figure 5 shows the shape of the NCC-S6M cell line at 200x magnification (left) and the tumor development in the orthotopic model (right).

[0061] Figure 6 is a copy number profile using whole exome sequencing.

[0062] Figure 7 shows the CLDN18.2 protein expression level of NCC-S6M as determined by global proteomic profiling.

[0063] Figure 8 is a diagram analyzing the global proteomic profiling of NCC-S6M.

[0064] Figure 9 is a diagram evaluating the efficacy of mouse CLDN18.2 CAR-T cells against NCC-S6M cells: (A) In vitro cytolysis assay analysis results: co-culture of NCC-S6M and CLDN18.2 CAR-T cells and co-culture of NCC-S6M and unmodified T cells, (B) 1 Х 10 syngeneic mice bearing heterotopic NCC-S6M model 6 Tumor growth (top) and survival (bottom) graphs of the group treated with CLDN18.2 CAR-T cells via tail vein (n=4) versus the untreated group (n=4).

[0065] Figure 10 shows CLDN18.2 CAR-T cells (GFP positive) confirmed in the spleen (A) and tumor (B) of mice injected with CLDN18.2 CAR-T into the tail vein.

[0066] Hereinafter, the present invention will be described in more detail through examples. These examples are intended merely to illustrate the present invention and are not to be construed as limiting the scope of the present invention.

[0067]

[0068] <Example 1> Production of spontaneous gastric cancer mice

[0069]

[0070] <Example 1-1> Breeding for spontaneous gastric cancer mice

[0071] In order to produce a mouse gastric cancer cell line model of the present invention, a mouse model in which gastric cancer was induced was produced by specifically deleting the tumor suppressor genes Smad4, p53, and Cdh1 genes in gastrointestinal epithelial cells using a conditional gene knockout method.

[0072] Specifically, Smad4 having the loxP gene previously owned through a previous patent (Korean Patent No. 10-1456627) f / f (Provided by Dr. Chuxia Deng, NIH, USA), p53 f / f (NCI Mouse Repository, USA), Cdh1 f / f (Jackson Laboratory, USA) Mice were crossed with Pdx-Cre mice (NCI Mouse Repository, USA) to perform Cre-loxP site-specific recombination. Cre + ;Smad4 f / + , Cre + ; p53 f / + and Cre + ;Cdh1 f / + Hetero mice were produced. Random mating of the three types of hetero mice was performed, and finally Pdx-Cre + ;Smad4 f / f ;Cdh1 f / + ;p53 f / f A mouse having a pseudo-genotype was obtained. To confirm the genotype of the mouse manufactured above, genotyping PCR was performed. Specifically, genomic DNA was extracted using a method widely known in the art, and a mixture of 0.45 μl of gDNA (50 to 100 ng / μl DNA), PCR MasterMix (Elpis Biotech, Korea), and up to 20 μl of distilled water was prepared, and genotyping PCR [95℃ 3 min, (95℃ 30 sec, 65℃ 30 sec, 72℃ 15 sec) X 10 cycles, (95℃ 30 sec, 55℃ 30 sec, 72℃ 15 sec) X 30 cycles, 72℃ 3 min] was performed.

[0073] The sequences of the primers used in the above genotyping PCR are as follows:

[0074] Pdx-Cre-F: 5'-CTGGACTACATCTTGAGTTGC-3' (SEQ ID NO: 1)

[0075] Pdx-Cre-R: 5'-CAGATTACGTATATCCTGGCAG-3' (SEQ ID NO: 2)

[0076] mCdh1-Genotyping-F: CGTTCATGGATCAGAAGATCAC (SEQ ID NO: 3)

[0077] mCdh1-Genotyping-R: GAACTAGGGAGGTAGAAGGAGC (SEQ ID NO: 4)

[0078] mSmad4-Genotyping-F: GGGCAGGCGTAGCATATAAGA (SEQ ID NO: 5)

[0079] mSmad4-Genotyping-R: GACCCAAACGTCACCTTCAC (SEQ ID NO: 6)

[0080] mP53-Genotyping-F: TGGAGATATGGCTTGGAGTAG (SEQ ID NO: 7)

[0081] mP53-Genotyping-R: CAACTTACTTCGAGGCTTGTC (SEQ ID NO: 8)

[0082]

[0083] Meanwhile, in the above manufacturing method, Cre + Cdh1 in mouse f / f If Cre is embryo-lethal, it is + ;Cdh1 f / f Mice with the trait are not born with Cdh1 f / + was used.

[0084]

[0085] <Example 1-2> Macroscopic observation and primary culture of primary tumors

[0086] Pdx-Cre produced in the above <Example 1-1> + ;Smad4 f / f ;Cdh1 f / +;p53 f / f In order to confirm the occurrence of primary tumors in mice with the genotype, after autopsy, the area thought to be the primary tumor site was subjected to primary culture through visual observation. Specifically, mice that had fasted overnight were euthanized using isoflurane, and the gastrointestinal tract was immediately removed. The stomach was observed as a whole, and the area judged to be a tumor when compared to the stomach of a normal mouse was cut out through visual observation, washed with cold PBS, and the washed tumor was transferred to a tissue culture dish containing a small amount of RPMI1640 medium. The tumor was then minced into small pieces with a surgical blade and pipetted several times to make even smaller pieces. The fragments were treated with 0.25% trypsin-EDTA, incubated at 37°C for 1 hour, centrifuged at 1500 rpm for 5 minutes, and then added to RPMI-1640 (Wellgene, Korea) + FBS (Wellgene, Korea) + ZellShield. ® (Minerva Biolabs, Germany) 100 mm containing medium 2 The cells were cultured in a culture dish. As a result, it was confirmed that a cancer cell population was growing, and the cell line was named NCC-S6M.

[0087]

[0088] <Example 2> Establishment of mouse gastric cancer cell lines

[0089]

[0090] <Example 2-1> Confirmation of NCC-S6M cell line

[0091] In order to confirm that the cell line manufactured in the above <Example 1-2> is a gastric cancer cell line derived from the mouse model of <Example 1-1>, the expression of Smad4 and p53 was confirmed by genotyping. Genotyping is the same as the above genotyping method. As a result, it was confirmed that Smad4 and p53 were not expressed in the NCC-S6M cell line, thereby confirming that the cell line was a gastric cancer cell line derived from the mouse model of <Example 1-1>. In the syngeneic mouse of NCC-S6M, the primary culture was performed as in <Example 1-2> on the tumour site where metastasis occurred, and genomic DNA was extracted using a method generally known to the cell line, and genotyping analysis was performed as described in <Example 1-1> to confirm the genotype. The genomic DNA was subjected to Sanger's sequencing by Macrogen (Seoul, Republic of Korea) to confirm the HLA type, and copy number profiling was performed by requesting Whole Exome Sequencing by Teragen Bio (Seongnam, Republic of Korea), thereby confirming the genetic characteristics and tumorigenic characteristics of NCC-S6M (Figs. 1 to 7).

[0092] The sequences of the sequencing primers used for the above HLA typing are as follows.

[0093] H2K: GGAACTCAGAAGTCTCGAATCG (SEQ ID NO: 9)

[0094] H2D: ACACCCGGGATCCCAGATG (SEQ ID NO: 10)

[0095] IA: CCTGGTTTCAGATGTGAAGTTC (SEQ ID NO: 11)

[0096]

[0097] As a result, the following contents were confirmed in Figures 1 to 4:

[0098] Genotype analysis showed that the genotype of NCC-S6M was Pdx-1-Cre; Smad4 F / F ; Trp53 F / F ; Cdh1 F / + It was confirmed that (Fig. 1). A schematic diagram of genotype generation by Pdx-Cre recombination in NCC-S6M is shown, and the final genotype expression process in each allele is depicted in a figure (Fig. 2). A schematic diagram showing the location of MHC genes on chromosome 17 (Fig. 3) and H-2D through NCC-S6M haplotype analysis. qq , IA qq Haplotypes for MHC class I and MHC class II are H2-K bb , H-2D qq , IA qq When the tumor occurrence and tumor growth of NCC-S6M by mouse strain with each MHC haplotype were confirmed, the MHC haplotype with the same H2-K bb , H-2D qq , IA qq showed high tumor incidence and tumor growth (Fig. 4).

[0099] In addition, in the gene sequence through NCC-S6M haplotype analysis, the sequence of H2K of NCC-S6M is H2-K bb It is the same as C57BL / 6, and the sequences of H-2D and IA are H-2D qq , IA qq It was confirmed that the NCC-S6M haplotype was the same as the H2-K haplotype, as shown in Fig. 3. bb , H-2D qq , IA qq It was confirmed that.

[0100] The sequences compared above are as follows.

[0101] - H2-K sequence of NCC-S6M: SEQ ID NO: 12

[0102] - H2-K sequence of C57BL / 6: SEQ ID NO: 13

[0103] - H2-K sequence of FVB: SEQ ID NO: 14

[0104] - H2-D sequence of NCC-S6M: SEQ ID NO: 15

[0105] - H2-D sequence of C57BL / 6: SEQ ID NO: 16

[0106] - H2-D sequence of FVB: SEQ ID NO: 17

[0107] - IA sequence of NCC-S6M: SEQ ID NO: 18

[0108] - IA sequence of C57BL / 6: Sequence number 19

[0109] - IA sequence of FVB: SEQ ID NO: 20

[0110]

[0111] Additionally, the following was confirmed in Figures 5 to 7:

[0112] The morphology of the NCC-S6M cell line at 200x magnification confirmed that it had the morphology of a typical epithelial tissue cell. The stomach photograph of the tumor-inducing site in the orthotopic model and H&E staining confirmed that the tumor had developed in the corresponding site, confirming that the NCC-S6M gastric cancer model developed tumorigenesis in the stomach environment (Fig. 5). Copy number profiling using whole exome sequencing confirmed that the arm level (chr19, chr17, and chr15) and focal (Erbb2) copy numbers increased, which is presumed to be due to genomic instability caused by Trp53 deletion (Fig. 6).

[0113]

[0114] <Example 3> Confirmation of CLDN18.2 overexpression in NCC-S6M cell line

[0115] In the above NCC-S6M cell line, proteomic analysis using LC-MS / MS confirmed that the NCC-S6M cell line overexpressed CLDN18.2, one of the cancer cell-specific genes. The proteomic analysis was performed using global proteomic profiling analysis. Specifically, the cell line was lysed in 100 mM Tris-HCl buffer (pH 7.6) containing 4% SDS and protease inhibitor cocktail tablets (Roche, (Basel, Switzerland)), and then subjected to a universally known global 10-plex TMT LC-MS / MS analysis. All MS-GF+ spectral identification files were converted to IDPicker 3 index files for protein assembly. At least two unique peptides are required to identify a specific protein, and the abundance of a protein group was determined based on the value of the TMT reporter ion intensity of a given tumor divided by the intensity of the universal reference included in the experiment of the corresponding 10-plex set.

[0116]

[0117] As a result, through global proteomic profiling, it was confirmed that the CLDN18.2 protein expression level of NCC-S6M was over 6 times (NCC-S1: 8.4 times, NCC-S1M: 6.4 times) compared to other gastric cancer cell lines (NCC-S1 and NCC-S1M) reported in the previous patent (Korean Patent No. 10-1456627), and over 20 times compared to the negative control cell line H226 cells (purchased from ATCC, https: / www.atcc.org / products / crl-5826) in which CLDN18.2 is hardly expressed in the human lung cell line (Fig. 7). Additionally, analysis of global proteomic profiling of NCC-S6M confirmed that NCC-S6M had high CK7 and low CK20 protein expression (Fig. 8), which is similar to human gastric cancer.

[0118]

[0119]

[0120] <Example 4> Evaluation of the efficacy of mouse CLDN18.2 CAR-T cells against NCC-S6M cells

[0121] To confirm whether NCC-S6M cell line is targeted by CLDN18.2 CAR-T cells, anti-mouse CLDN18.2 CAR-T vector (Anti-Mouse CLDN18.2 scFv(XW-277) CD28 / 41BB-CD3ζ CAR with CD8 hinge) was purchased from Creative Biolab (New York, USA), and the CLDN18.2 CAR-T construct was inserted into the MSCV retroviral vector (http: / vectorbuilder.kr). The final generated vector is a GFP-positive retroviral plasmid. Afterwards, retrovirus packaging was performed using the commonly known platinum-E packaging cell, and the generated virus was infected into mouse T cells isolated from the mouse spleen using a mouse T cell isolation kit (Stemcell Technologies Inc. (Vancouver, Canada)). Then, in vitro cytolysis assay and in vivo assay in syngeneic mice bearing heterotopic NCC-S6M model were performed using the generated CLDN18.2 CAR-T cells.

[0122] In vitroCytolysis assay was first performed by using CellTrace, which is a target cell type NCC-S6M. TM After staining with Violet (Thermo Fisher Scientific Inc.), the cells were co-cultured with CLDN18.2 CAR-T cells at various ratios for 48 hours, and cytolysis was confirmed in NCC-S6M through FACs analysis. The ratios of CLDN18.2 CAR-T cells to NCC-S6M were 1:1, 5:1, and 10:1.

[0123] In vivo assay, 1 Х 10 syngeneic mice bearing heterotopic NCC-S6M model 6 After analyzing the tumor growth and survival period of the group that received CLDN18.2 CAR-T cells via tail vein (n=4) and the group that did not receive CAR-T cells (n=4), the presence of CLDN18.2 CAR-T cells in the spleen and tumor of the group that received CLDN18.2 CAR-T cells was analyzed using FACs analysis to determine whether CLDN18.2 CAR-T cells were effective in NCC-S6M tumor-targeting therapy.

[0124]

[0125] As a result of co-culture for 48 hours at various E / T (effector to target) ratios in an in vitro cytolysis assay, co-culture of CLDN18.2 CAR-T cells and NCC-S6M (red) showed significant cytolysis compared to co-culture with unmodified T cells (blue) (Fig. 9A).

[0126] 1 Х 10 on syngeneic mice bearing heterotopic NCC-S6M model as in vivo assay 6 As a result of tail vein administration of CLDN18.2 CAR-T cells, tumor growth was significantly suppressed and survival period was prolonged compared to the group that was not administered CAR-T cells (Fig. 9B). CLDN18.2 CAR-T cells were confirmed in the spleen and tumors of mice that received tail vein injection of CLDN18.2 CAR-T cells (Fig. 10).

[0127]

[0128]

[0129] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

[0130]

[0131] [Accession number]

[0132] Name of depositor: Korea Cell Line Research Foundation (KCLRF)

[0133] Accession number: KCLRFBP00529

[0134] Date of acceptance: 20231205

[0135]

Claims

1. Pdx-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F An animal gastric cancer cell line that has a genotype and naturally overexpresses CLDN18.

2.

2. In the first paragraph, the animal gastric cancer cell line is Villin-cre + , Smad4 F / F , Cdh1 F / + , and Trp53 F / F An animal gastric cancer cell line that naturally overexpresses CLDN18.2 compared to an animal gastric cancer cell line having the genotype.

3. An animal gastric cancer cell line according to claim 1, wherein the animal is a rodent.

4. In the third paragraph, the animal gastric cancer cell line is H2-K bb , H-2D qq , and IA qq Animal gastric cancer cell lines with haplotypes.

5. An animal gastric cancer cell line deposited under the deposit number KCLRF-BP-00529 in paragraph 1.

6. An animal model of gastric cancer having an animal gastric cancer cell line according to any one of claims 1 to 5. 7.(a) a step of treating a CLDN18.2 target drug to an animal gastric cancer cell line according to any one of claims 1 to 5; or an animal gastric cancer model having the animal gastric cancer cell line; and (b) A method for evaluating the efficacy of a CLDN18.2 target drug, comprising a step of measuring the degree to which the CLDN18.2 target drug inhibits gastric cancer cells. 8.(a) Step of treating the CLDN18.2 target drug to the gastric cancer animal model of Article 6; and (b) A method for evaluating the safety of a CLDN18.2 target drug, comprising a step of measuring the safety of the CLDN18.2 target drug in the animal model.

9. A method according to claim 7 or 8, wherein the drug comprises a CLDN18.2 target CAR-T cell or a CLDN18.2 target antibody.

10. A method in claim 7, wherein the efficacy includes at least one of efficacy in inhibiting metastasis of gastric cancer cells, efficacy in inhibiting recurrence of gastric cancer, and efficacy in extending the survival period of an animal model.

Images