Active biointegrated living electronics for managing inflammation

The ABLE platform integrates a living hydrogel with Staphylococcus epidermidis to address the integration challenges of bioelectronics, achieving effective inflammation management and therapeutic benefits by regulating the skin's immune response and reducing psoriasis symptoms.

WO2025151767A1PCT designated stage expired Publication Date: 2025-07-17UNIVERSITY OF CHICAGO +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/011167
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-10
Filing Date
2025-01-10
Publication Date
2025-07-17

AI Technical Summary

Technical Problem

Current bioelectronics systems struggle with integrating biogenic, biomechanical, and bioelectrical functionalities to effectively manage mammalian skin inflammation due to disparities in mechanical, chemical, and biological attributes, lacking the ability to regulate inflammation and promote skin regeneration.

Method used

The Active Biointegrated Living Electronics (ABLE) platform uses a living hydrogel matrix with Staphylococcus epidermidis to create a biointerface that combines biogenic, biomechanical, and bioelectrical capabilities, enabling wireless sensing, therapeutic intervention, and biosafety control, facilitating long-term bacterial storage and skin interaction.

Benefits of technology

ABLE effectively manages inflammation by inhibiting dendritic cell activation, reducing symptoms of psoriasis, and modulating the skin's immune environment, demonstrating improved diagnostic and therapeutic capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000046_0001
    Figure IMGF000046_0001
  • Figure IMGF000032_0001
    Figure IMGF000032_0001
  • Figure IMGF000038_0001
    Figure IMGF000038_0001
Patent Text Reader

Abstract

The present disclosure relates to a biomaterial matrix having a live bacteria impregnated hydrogel, using the biomaterial matrix to treat epidermal inflammation of an animal, and wearable electronic devices having the biomaterial matrix installed thereon.
Need to check novelty before this filing date? Find Prior Art

Description

ACTIVE BIOINTEGRATED LIVING ELECTRONICS FOR MANAGING INFLAMMATIONGOVERNMENT FUNDING STATEMENT

[0001] This invention was made with government support under W91 INF-21-1-0090 awarded by the Army Research Office, 2121044 awarded by the National Science Foundation, and FA9550-20-1-0387 awarded by the Air Force Office of Scientific Research. The government has certain rights in the invention.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 619,641, filed January 10, 2024, the disclosure of which is hereby incorporated by reference in its entirety.SEQUENCE LISTING

[0003] A computer readable form of the Sequence Listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The Sequence Listing is contained in the file created on January 10, 2025, having the file name “24-0067-WO_SEQLIST.xml” and is 8.96 kb in size.BACKGROUND OF THE DISCLOSURE

[0004] Mammalian skin and / or tissue inflammation, also known as dermatitis, is a condition where the skin of the mammal becomes irritated or swollen due to an immune response, often manifesting as redness, itching, pain, or rashes. Inflammation can be triggered by allergens, irritants, infections, or even stress, and inflammation can be the reaction of the mammal to a perceived threat on the skin and / or tissue that sends inflammatory cells to the area to heal it. The inflammation can be acute or chronic, and the irritation can include eczema, scleroderma, psoriasis, and the like. New innovative approaches to treat tissue inflammation are needed.SUMMARY OF THE DISCLOSURE

[0005] As shown and described herein, the present disclosure relates to a biomaterial matrix having a live bacteria impregnated hydrogel, using the biomaterial matrix to treattissue inflammation, such as dermatitis, and wearable electronic devices having the biomaterial matrix installed thereon.

[0006] In an embodiment of the present disclosure, a method of using Staphylococcus epidermidis to treat inflammation in an epidermis of an animal is disclosed. The method includes administering a substance containing a population of Staphylococcus epidermidis to a particular region of the animal. The method also includes reducing inflammation in the region.

[0007] In various such embodiments, the substance is a topical ointment.

[0008] In various such embodiments, the substance is a lotion.

[0009] In various such embodiments, the substance is a cream.

[0010] In various such embodiments, the substance is contained in a patch that is wearable by the animal.

[0011] In various such embodiments, the animal is a mammal.

[0012] In another embodiment of the present disclosure, a biomaterial matrix is disclosed. The biomaterial matrix includes a hydrogel and a population of living bacteria such that the population of living bacteria is contained within in the hydrogel.

[0013] In various such embodiments, the hydrogel includes a main protein substance and a polysaccharide component.

[0014] In various such embodiments, the main protein substance and the polysaccharide component are each a biocompatible material.

[0015] In various such embodiments, the main protein substance comprises gelatin, collagen, and / or casein and the polysaccharide component comprises tapioca starch, cellulose, pectin, kappa-carrageenan, and / or glucan from Euglena gracilis.

[0016] In various such embodiments, the population of living bacteria comprises Staphylococcus epidermidis.

[0017] In a further embodiment of the present disclosure, a method of sustaining a population of living bacteria in a hydrogel is disclosed. The method includes forming a viscoelastic polysaccharide component, mixing the viscoelastic polysaccharide with a main protein substance to create the hydrogel, and encapsulating the living bacteria in the hydrogel to create a biomaterial matrix.

[0018] In various such embodiments, the viscoelastic polysaccharide component is formed by boiling granules of a polysaccharide in an aqueous solution.

[0019] In various such embodiments, the aqueous solution comprises water.

[0020] In various such embodiments, the method further includes freezing the biomaterial matrix and optionally storing the frozen biomaterial matrix.

[0021] In various such embodiments, the method includes removing the frozen biomaterial matrix from storage, adding the frozen biomaterial matrix to water, and reheating the frozen biomaterial matrix and water to restore the biomaterial matrix such that the population of living bacteria is still alive in the biomaterial matrix.

[0022] In various such embodiments, the main protein substance comprises gelatin, the polysaccharide component comprises tapioca starch, and the population of living bacteria comprises Staphylococcus epidermidis.

[0023] In another embodiment of the present disclosure, a wearable electronic device is disclosed. The wearable electronic device includes a first layer such that the first layer is a sensor layer. The wearable electronic device also includes a second layer such that the second layer is applied to an interfacing side of the sensor layer, the second layer is configured to be applied to a mammalian epidermis, and the second layer is a biomaterial matrix layer. The biomaterial matrix layer includes a hydrogel and a population of living bacteria such that the population of living bacteria is encapsulated in the hydrogel. The wearable electronic device further includes one or more probes such that the one or more probes extends from a sensor in the sensor layer, through the biomaterial matrix layer, and contacts the mammalian epidermis directly.

[0024] In various such embodiments, further including a stimulator.

[0025] In various such embodiments, the stimulator is capable of regulating bacterial activities.

[0026] In various such embodiments, the stimulator is capable of killing the population of living bacteria.

[0027] In various such embodiments, the first layer and the second layer are laminated together.

[0028] In various such embodiments, the sensor layer includes at least one of an electrical impedance sensor, a humidity sensor, and a temperature sensor.

[0029] In various such embodiments, the sensor of the sensor layer is drafted onto a planar sheet.

[0030] In various such embodiments, the hydrogel includes a main protein substance and a polysaccharide component.

[0031] In various such embodiments, the main protein substance comprises gelatin, the polysaccharide component comprises tapioca starch, and the population of living bacteria comprises Staphylococcus epidermidis.BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figures 1 A-1E depict a living bioelectronics device with bioactive interface enable wireless skin disease diagnosis and therapy. For example, Figure 1 A depicts a schematic of a human arm with a living bioelectronics device attached, through which living bioelectronics enable information collection, disease diagnosis, and therapy delivery. Figure IB illustrates the interplay across the three key dimensions through bioelectronics, hydrogel, and bacteria that is crucial for biointegrated living electronics functionality. (1) Biopolymer enhances bacterial viability. (2) Bacteria modulate the skin immune environment. (3) Bioelectronics collects information from skin through electrical sensing (e-sensing). (4) Bioelectronics manages the biosafety of bacteria through electrical stimulation (e-stimulation). (5) Hydrogel encapsulation promotes long-term storage and viability of bacteria. (6) Viscoelasticity of the living hydrogel ensures a stable interaction with skin tissue. (7) Viscoelasticity of the hydrogel facilitates information collection from skin. (8) Biomechanical properties of the hydrogel assist biohazard management. (9) Skin-adhesion property of the hydrogel improves long-term information collection. Figure 1C illustrates that, when compared to conventional bioelectronics interfaces, ABLE combines functionalities across the bioelectrical, biomechanical, and biogenic domains using the principals illustrated above in Figure IB. Figure ID illustrates sample ABLE device configurations. Scale bars: (i) 2 mm; (ii), (iii) 4 mm; (iv), (v), (vi) 3 mm. Figure IE illustrates sample ABLE bioelectrical interfaces. Scale bars: (i) 15 mm; (ii) 3 mm; (iii) 5 mm.

[0033] Figures 2A-2J depict a rational design of living biointerface for bioelectronics with biogenic, biomechanical, and bioelectrical functionality. Figure 2A depicts a natural biofilm (on the top) and a biofilm-inspired hydrogel (on the bottom) designed to mimick the natural composition of biofilm. In the biofilm-inspired hydrogel, gelatin and starch are used as theprotein and polysaccharide polymer in constructing the interpenetrated double network hydrogel, i.e., the living biointerface. Figure 2B depicts starch materials measured in fold change in viability versus a control, showing that, of the starches tested, tapioca starch best sustains bacteria viability among various polysaccharides. Data in Figure 2B is presented as mean values ± SD. n=5 for each group. Figure 2C illustrates that, during gelatinization, amylose leaks from the amorphous lamella inside the starch granules and enhances bacteria viability. Data are presented as mean values ± SD. n=5 for each group. Figure 2D is a series of fluorescent images indicating the structural transformation of starch granules after thermal treatment at different temperatures. The scale bar in the images in Figure 2D is 10 pm. Figure 2E is representative of a confocal microscope imaging that shows the distribution of Staphylococcus epidermidis inside the living hydrogel matrix. Bacteria are stained with FM1- 43 (turning it red) and starch is stained with APTS (turning it blue). The scale bar in the depiction of Figure 2E is 15 pm. Figure 2F depicts the gelatinization of starch that promotes bacteria viability in the living hydrogel matrix for at least 4 days. Data are presented as mean values ± SD. n=5 for each of the gelatinized and granular group. Figure 2G illustrates that bacteria can be stored within the hydrogel matrix over a long-term period and rejuvenated with an overnight culture. The scale bar in Figure 2G is 20 pm. Data are presented as mean values ± SD. n=5 for each group. Figure 2H depicts a schematic diagram and photograph that show an example structural configuration of the living hydrogel hybrid mesh electronics device for surface electromyography (sEMG) recording. The scale bar in Figure 2H is 3 mm. Figure 21 illustrates a spatial intensity map that reveals the sEMG activity across 15 electrical channels at the rat leg. The size of region tested in Figure 21 is 16 mm (horizontal) x 12.8 mm (vertical). Figure 2J illustrates a comparison of signal -to-noise ratio (SNR) in gold bioelectronics biointerface versus living hydrogel coating indicated that living hydrogels- coated bioelectronics indicates that living hydrogels facilitate electrophysiological recording. Data are presented as mean values ± SD. n=15 for each group.

[0034] Figures 3 A-3I depict an ABLE platform that enables electrophysiological signal recording, diagnosis of psoriasis, and treatment of psoriasis. Figure 3 A, for instance, depicts a schematic showing ABLE functionality in diagnosis and treatment of psoriasis by displaying a wireless wearable electronic device, being paired with the living hydrogel, being installed on the skin of a rat. Figure 3B depicts a schematic diagram and photograph that show an example structural configuration of the living hydrogel hybrid mesh electronics device for sECG recording. The scale bar in Figure 3B is 5 mm. Figure 3C depicts representative 6-lead electrocardiogram signals that reveal heart rhythm in I, II, III, aVL, aVR, and aVF leads.Figure 3D depict living bioelectronics device reports have a lower SNR in ECG recording in psoriasiform skin compared to controls. Data are presented as mean values ± SD. n=6 for each group. Figure 3E depicts a schematic diagram that shows the structural configuration of flexible printed circuit board (FPCB)-based ABLE. The schematic diagram in Figure 3E includes a Tegaderm layer, and electronics elements layer, an at least one sensor, a disinfection electrode, and a living hydrogel. More or less layers are also considered. Figure 3F depicts a representative circuit diagram of wireless bioelectronics for skin monitoring and living hydrogel modulation. Figure 3G is a series of representative photographs at Day 0 and Day 4 showing that the living bioelectronics treats psoriasis as compared to the control group. Psoriasiform features including erythema, induration, and desquamation, are all significantly diminished. The scale bar for the photographs in Figure 3G is 5 mm. Figure 3H depicts impedance of psoriasis skin lesions, as measured using living bioelectronics, that indicates the recovery progress. Results align with the psoriasis severity index (PSI). Data are presented as mean values ± SD. n=5 for each group. Figure 31 depicts disinfection electrodes on the living bioelectronics that disinfect the living hydrogel through 3.5 V direct voltage within 30 minutes. The inner panel shows confocal images of living hydrogel before and after disinfection. Bacteria were stained with Baclight Live / Dead kit containing SYTO9 / PI. The scale bar in Figure 31 is 20 pm. Data are presented as mean values ± SD. n=5 for each group. Control: mice with imiquimod (IMQ)-induced psoriasis, no treatment. ABLE: mice with IMQ-induced psoriasis, treated with active biointegrated living electronics. P values are determined by paired t-test, two tailed.

[0035] Figures 4A-4J depict an ABLE platform for studying living biointerface-tissue interaction in disease treatment. Figure 4A depicts representative images of hematoxylin and eosin (H&E) staining show significantly reduced pathological damage in psoriatic skin lesions of ABLE-treated mice, specifically psoriasiform hyperplasia, parakeratosis, and cutaneous immune cell infiltration. The scale bar for Figure 4A is 50 pm. Histological score analysis shows a lower level of histological inflammation and tissue damage in ABLE-treated mice. Data are presented as mean values ± SD. n=5 for each group. Figure 4B depicts representative dual-immunohistochemical images of Cytokeratin 14 and F4 / 80 staining indicate significantly decreased dendritic cells and macrophages in psoriatic skin lesions of ABLE-treated mice. The scale bar for Figure 4B is 50 pm. Data are presented as mean values ± SD. n=10 for each group. Figure 4C depicts representative immunofluorescent images of CD31 staining indicate significantly decreased blood vessel formation in skin lesions ofABLE-treated mice. False positive signals in the ABLE image are due to unspecified staining in the stratum comeum. The scale bar for Figure 4C is 50 pm. Data are presented as mean values ± SD. n=10 for each group. Figure 4D depicts cytokine analysis of the skin lesion indicates significant down regulation of IFN- y and IL- 17, which play an important role in inflammatory cell recruitment and regulate keratinocyte proliferation. Data are presented as mean values ± SD. n=8 for each group. Figure 4E depicts linear discriminant analysis Effect Size (LEfSe) taxa analysis indicates altered bacterial diversity following ABLE treatment. Figure 4F depicts S. epidermidis that is barely detected on skin during ABLE treatment. Relative abundance of Staphylococcus aureus is reduced after ABLE treatment. Data are presented as mean values ± SD. n>4 for each group. Figure 4G depicts a heatmap that shows an expression profile of psoriasis-related genes. Figure 4H depicts a gene ontology (GO) chord plot shows that several important psoriasis-related genes are categorized into different clusters. Figure 41 depicts the GO enrichment analysis of significantly differentially expressed genes between ABLE-treated and control groups shows that ABLE regulates biological processes related to immune response and keratinocytes. Figure 4J depicts a proposed mechanism for ABLE-regulation of the inflammatory skin environment and therapeutic effect in IMQ-induced psoriasis. Control: mice with IMQ-induced psoriasis, no treatment. ABLE: mice with IMQ-induced psoriasis, treated with active biointegrated living electronics. P values are determined by t-test, two tailed.

[0036] Figure 5 demonstrates that a gelatin matrix has better a capability to support Staphylococcus epidermidis viability and growth compared to a synthetic hydrogel matrix such as polyacrylamide (PAAm). After 24h of growth at room temperature, gelatin encapsulated Staphylococcus epidermidis shows larger colony area and viability from LI VE / DEAD assay compared to PAAm encapsulated Staphylococcus epidermidis, demonstrating compatibility of protein matrix in supporting microbial viability compared to the synthetic matrix. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=3 for each group.

[0037] Figure 6 demonstrates that Tapioca starch best sustains bacteria compared to various synthetic polymer and nano clay-based materials. Data are presented as mean values ± SD. n=3 for each group.

[0038] Figures 7A-7B demonstrates that thermal treatment that triggers morphology changes of starch granules. Figure 7A depicts in-situ monitoring the glass transition process of starch from 25 °C to 100 °C by small angle X-ray scattering (SAXS) measurement. SAXSpeak relating to the crystalline structure of starch granules at around 0.06 disappears at high temperature. Figure 7B depicts differential scanning calorimetry (DSC) measurement reveals the transition of the crystalline structure in starch granules.

[0039] Figure 8 depicts that partially gelatinized starch enhances the bacterial attachments on collapsed granules. Bacteria are shown in green signals through SYTO9 staining. P values are determined by t-test, two-tailed. The scale bar for Figure 8 is 3 pm. Data are presented as mean values ± SD. n=4 for each group.

[0040] Figure 9 depicts that hydrogel immobilizes the motion of encapsulated bacteria. Bacteria display significantly reduced motion speed within the hydrogel matrix compared to the culture medium, suggesting that the living hydrogel effectively restricts the movement of bacteria within the matrix. The scale bar for Figure 9 is 10 pm. Data are presented as mean ± standard error of mean. (n=3).

[0041] Figure 10 shows SEM and TEM images of encapsulated bacteria within the hydrogel matrix. The scale bar in Figure 10 is 1 pm (SEM); 500 nm (TEM).

[0042] Figures 11 A-l IB demonstrate that living bioelectronics can be processed with liquid nitrogen for storage and can be stored at a different temperature. Figure 11 A depicts wireless readout data demonstrate the stability of living bioelectronics after being processed in liquid nitrogen or stored at various temperatures. n=5 for each group. Figure 1 IB depicts bacteria that can be stored within a hydrogel matrix for long-term periods across various storage temperatures and rejuvenated by leaving overnight at an ambient temperature. Data are presented as mean values ± SD. n=3 for each group.

[0043] Figures 12A-12B depict an electrochemical analysis that shows electrical properties of a living hydrogel. Figure 12A depicts an electrical impedance spectroscopy analysis that indicates the conductivity of the living hydrogel. Figure 12B illustrates cyclic voltammetry that shows high electrochemical stability of living hydrogel after 1000 cycles of repetitive scans.

[0044] Figures 13A-13D depict mechanical test results that demonstrate the living hydrogel is soft and viscoelastic. Figure 13 A depicts that Storage modulus (G’; left axis), Loss modulus (G”; left axis), and tan 5 (G’7G’; right axis) are shown as a function of frequency at 1% of strain. Figure 13B depicts that Storage modulus (G’; left axis), Loss modulus (G”; left axis), and tan 5 (G’7G’; right axis) are shown as a function of strain at 1Hz frequency. Figure 13C depicts that the stress relaxation test shows the living hydrogel has fast relaxationbehaviors. Figure 13D depicts that the strain-stress curve illustrates that the living hydrogel undergoes energy dissipation during the cyclic mechanical loading. n=5 for each test.

[0045] Figures 14A-14B depicts mechanical test results that demonstrate the stability of living hydrogels in response to temperature shifts (14B) and humidity alterations (14A). Storage modulus (G’), loss modulus (G”), and tan 5 (G’7G’) are shown as functions of frequency at 1% strain in frequency sweeps, or as functions of strain at 1Hz in amplitude sweeps. Data are presented as mean values. n=3 for each group.

[0046] Figure 15 depicts mechanical test results that demonstrate the stability of living hydrogels in response to pH changes. Storage modulus (G’), loss modulus (G”), and tan 5 (G’7G’) are shown as functions of frequency at 1% strain in frequency sweeps, or as functions of strain at 1Hz in amplitude sweeps. Data are presented as mean values. n=3 for each group.

[0047] Figure 16 depicts Fourier-transform infrared spectroscopy (FTIR) results that provide evidence of polymer interactions between gelatin and starch. The existence of starch macromolecules influences the amide I (C=O stretching) and amide II (N-H bending and C-N stretching) peaks of the gelatin hydrogels. n=5 for each test.

[0048] Figure 17 depicts SEM images of starch gelatin hydrogel and Au / Polyimide film attached on porcine skin. Viscoelasticity enables conformal attachment of star ch-gelatin hydrogel on the rugged skin surface. The scale bar for Figure 17 is 200 pm.

[0049] Figure 18 depicts that the living hydrogels have tunable mechanical properties. Data are presented as mean values ± SD. (n=5).

[0050] Figure 19 depicts that the hydrogels show long-term stability in both mechanical and electrochemical properties. After four days, the physical and electrochemical properties of hydrogels remain stable. Furthermore, hydrogels after four days exhibit similar SNR in EMG signal recording compared to fresh hydrogels. P values are determined by t-test, two- tailed. Data are presented as mean values. n=3 for each group.

[0051] Figure 20 depicts tensile adhesion test results that reveal that the living hydrogels are adhesive to various substrates. Data are presented as mean values ± SD. n=4 for each group.

[0052] Figure 21 depicts a side-view schematic that illustrates the fabrication process for living hydrogel hybrid mesh electronic devices.

[0053] Figure 22 depicts a top-view schematic that illustrates the fabrication process for living hydrogel hybrid mesh electronic devices.

[0054] Figures 23 A-23B depicts mesh electronic designs for EMG (23 A) and ECG (23B) recording. Layer 1 : Bottom polyimide as the supportive layer for the mesh device. Layer 2: Metal electrode layers for signal transduction. Layer 3: Top SU-8 as the encapsulation layer.

[0055] Figures 24A-24B depict that the thickness of a hydrogel influences the signal-to- noise ratio (SNR) in EMG recording. Figure 24A depicts the thickness of hydrogels can be controlled through molding or spin coating. n=3 for each group. Data are presented as mean values ± SD. Figure 24B depicts the thinner hydrogels formed by spin coating method show better SNR compared to the thicker hydrogels. P values are determined by ordinary one-way ANOVA with Tukey’s multiple comparisons test. Data are presented as mean values ± SD. n=15 for each group.

[0056] Figures 25A-25B depict the electrical signals (25B) collected by each electrode in the hybrid electronics device (25 A) with the living biointerface. The electrical signals in 15 channels (Ch) show the Electromyography (EMG) information at the surface of leg skin.

[0057] Figures 26A-26C depict conventional bioelectronics scaffolds, including planar and needle electrodes, that show lower efficiency in EMG signal recording. Figure 26A depicts photographs that show the fabricated planar multichannel electrodes and needle multichannel electrodes. Figure 26B depicts planar electrodes and needle electrodes (working without skin insertion) show significantly lower SNR compared to the hydrogel biointerfaces. Figure 26C depicts needle electrodes (working with skin insertion) cause skin wounds, indicating that the method is invasive. P values are determined by ordinary one-way ANOVA with Tukey’s multiple comparisons test. Data are presented as mean values ± SD. n=15 for each group.

[0058] Figure 27 demonstrates that conventional bioelectronics scaffolds show movement artifacts when recording an EMG signal. Planar electrodes and needle electrodes (working with skin insertion) shows the movement artifact after the evoked signals.

[0059] Figure 28 shows that based on the signal-to-noise ratio (SNR), living mesh electronics could stably record the surface EMG signal for 240 minutes. P values are determined by paired t-test, two tailed. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=3 for each group.

[0060] Figure 29 depicts that the 6-lead ECG signals acquired from each individual channel demonstrate a significant enhancement in signal-to-noise ratio (SNR) following a 4-dayABLE treatment period. P values are determined by paired t-test, two tailed. Data are presented as mean values ± SD. n=6 for each group.

[0061] Figures 30A-30C illustrate bacterial debris and fragments that are released from the living hydrogels compared to control as measured by FM1-32 fluorescence. All samples were collected from the supernatant solution in contact with the ABLE device which was filtered with 0.22 pm syringe filter to remove bacterial cells before measurement and imaging. Figure 30A depicts the FM1-43 membrane probe shows increased fluorescence over time, indicating the release of non-viable bacterial remnants from the living hydrogels. Figure 30B depicts confocal microscope images reveal the presence of lipoteichoic acid (LTA; green), a bioactive compound potentially related to the therapeutic effect, in the supernatant. Scale bar, 5 pm. Figure 30C depicts dSTORM imaging provides a super-resolution image of LTA- labelled bacteria debris. Scale bar, 100 nm. Data are presented as mean values ± SD. (n=3).

[0062] Figure 31 depicts data from a flexible printed circuit board (FPCB) that demonstrates the ability in wireless energy and data transition. Measured RF -harvested voltage is dependent on antenna-reader distance. Wireless communication functions well and stably when FPCB is 10 cm away from the external reader.

[0063] Figure 32 depicts that the voltage output in the impedance sensor, after passing through a high-pass filter, reveals a reduction in AC components for the higher impedance resistors. The DC components of the signals remain constant for all different impedance resistors.

[0064] Figures 33 A-33B depict validation experiments that prove the FPCB has fast response to the environmental temperature and humidity variations. The FPCB detects environmental changes when it is placed inside a humidity chamber or brought into proximity with a hot plate. The FPCB with living interface can readily record the temperature and humidity information on the mice skin.

[0065] Figure 34 depicts DCFDA / H2DCFDA staining of living material that shows intracellular ROS levels increase upon electrical field (EF) stimulation. Gelatin-encapsulated Staphylococcus epidermidis treated for 3.5V, 10 min shows about 4x higher intracellular ROS fluorescence intensity compared to unstimulated control, when normalized with % viability from LIVE / DEAD assay. Data are presented as mean values ± SD. n=3 for each group.

[0066] Figure 35 depicts that the electrically disinfected samples with Staphylococcus epidermidis displayed neither proliferation nor any increase in viability after 96 hours. After 96 hours of growth at room temperature, disinfected bacteria showed low viability, which indicates that the bacteria were thoroughly deactivated. Bacteria are stained with SYTO9 (green) / PI (red). Data are presented as mean values ± SD. n=3 for each group.

[0067] Figure 36 depicts H&E histology and immunohistochemistry (IHC) that reveal changes in skin composition and immune cell infiltration after long-term exposure of healthy skin to ABLE. Long-term exposure (15 days) of ABLE to healthy skin increased the number of hair follicles (in the H&E image) and induced the local recruitment of F4 / 80 positive macrophages. However, there was no apparent increase in CD4 positive and CD8 positive lymphocytes. The scale bar for Figure 36 is 50 pm. Images are representative of n = 5 different mice.

[0068] Figure 37 depicts H&E histology and immunohistochemistry (IHC) that reveal changes in skin composition and immune cell infiltration after long-term exposure of psoriatic (top) and damaged (bottom) skin to ABLE. (Top) Long-term exposure (15 days) of ABLE to psoriatic lesions skin increased the number of hair follicles. Furthermore, it led to the local recruitment of F4 / 80 positive macrophages. However, there was no apparent increase in CD4 positive and CD8 positive lymphocytes. (Bottom) The long-term exposure of ABLE to the surgically damaged skin wound lesions also led to the recruitment of F4 / 80 positive macrophages at the dermal wound bed, indicating that the skin is still going through remodeling phase which is the last phase of skin wound healing processes. However, there was also no significant accumulation of CD4 positive and CD8 positive lymphocytes locally. The scale bar for Figure 37 is 50 pm. Images are representative of n = 5 different mice.

[0069] Figure 38 depicts different bacterial species that can be incorporated into the ABLE design. (Left) Skin bacterial species, including Staphylococcus capitis and Staphylococcus saprophyticus, along with an engineered bacterial strain such as Escherichia coli DH5a, demonstrate high viability within the hydrogel after 96 hours. (Right) Additionally, all these bacteria can be electrochemically disinfected through the ABLE control system using 3.5 V for 30 minutes. Data are presented as mean values ± SD. (n=3).

[0070] Figure 39 depicts living bioelectronics that are lightweight and untethered with cable. (Left) The photograph shows the mice wearing living bioelectronics. (Middle) Representative moving trajectories of mice between the with device and without devicegroup. (Right) The travel distance comparison indicates the living bioelectronics will not interfere with the motion of mice in the cage. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=4 for each group.

[0071] Figure 40 demonstrates that living bioelectronics can monitor multiple aspects of altered skin physiology and record impedance information when the skin is damaged, sweaty, or cold. Warm PBS solution was applied to the skin to mimic the scenario of sweating during exercise. Data are presented as mean values ± SD. (n=4).

[0072] Figure 41 depicts data taken from temperature and humidity sensors that monitor skin information during disease treatment. Data are presented as mean values ± SD. n=5 for each group.

[0073] Figure 42 shows that a higher voltage output leads to a faster disinfection efficiency for living bioelectronics. The disinfection time is set for 10 minutes. Data are presented as mean values ± SD. (n=3).

[0074] Figure 43 depicts that disinfection electrodes can disinfect a bacteria culture solution through 3.5V direct voltage within 30 minutes. Data are presented as mean values ± SD. (n=3).

[0075] Figures 44A-44E depict that ABLE treatment can be effectively combined with other psoriasis treatments to improve therapeutic outcomes. Figure 44A depicts ac hemical structure of methotrexate (MTX). Figure 44B depicts, on Day 4, the combined use of methotrexate and ABLE (MTX+ABLE) demonstrates a promising therapeutic effect in treating psoriasis, (c-e) PSI scores, representative H&E histology images and analysis further confirm that the combined use of ABLE and methotrexate is more effective than methotrexate (MTX) alone in treating psoriasis. Scale bar, 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0076] Figures 45A-45B depict immunohistological analyses of CD4+ T cells (45A) and CD8+ T cells (45B) that reveal a better therapeutic outcome in treating psoriasis in the MTX+ABLE group compared to the MTX group. The scale bar for Figures 45A-45B is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=5 for each group. Images are representative of n = 5 different mice.

[0077] Figure 46 demonstrates that living bioelectronics treatment can be used to reduce splenomegaly in psoriatic mice. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=4 for each group.

[0078] Figure 47 depicts that the therapeutic effects of the living hydrogel extends beyond the directly treated area to adjacent psoriatic skin. The psoriatic tissues distant from the treated site show less improvement in terms of psoriasis symptoms, including epidermal thickness and dermal immune cell infiltration. The large histology image is assembled from eight serial individual histology images. The scale bar for Figure 47 is 1 mm. The zoomed-in images demonstrate the different therapeutic outcomes at different tissue regions. The scale bar for Figure 47 zoomed is 50 pm.

[0079] Figure 48 depicts a histological assessment that indicates that ABLE treatment significantly alleviated psoriatic features compared to the control group. The psoriatic feature includes 1, parakeratosis; 2, loss of granular layer; 3, psoriasiform hyperplasia; 4, dilated blood vessels; 5, inflammation. Scale bar, 50 pm. Images are representative of n = 5 different mice.

[0080] Figure 49 depicts that hydrogel as the vehicle interface has limited therapeutic effect in treating psoriasis. Bioelectronics with non-living hydrogel matrix does not reduce the skin psoriasiform symptoms as indicated by psoriasis severity index (PSI). Besides, the symptoms regarding splenomegaly and psoriasiform hyperplasia still exist. The scale bar for Figure 49 is 100 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0081] Figure 50 depicts CD4 immunohistology images of skin tissue after ABLE treatment that show that the ABLE treatment decreased the number of cutaneous CD4+T helper cells during the recovery process. The scale bar for Figure 50 is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0082] Figure 51 depicts CD8 immunohistology images of skin tissue after ABLE treatment that show that the ABLE treatment decreased the number of cutaneous CD8+cytotoxic T cells during the recovery process. The scale bar for Figure 51 is 100 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0083] Figure 52 depicts representative flow cytometry analysis plots that show CD4 positive immune cell populations in psoriatic skin tissues and ABLE-treated skin. There is a significant decrease in the percentage of CD4 positive cells after ABLE treatment. Representative gating strategies were shown for the ABLE-1 samples. Control: mice with imiquimod (IMQ)-induced psoriasis, no treatment. ABLE: mice with IMQ-induced psoriasis, treated with active biointegrated living electronics. P values are determined by t-test, two- tailed. Data are presented as mean values ± SD. n=3 for each group.

[0084] Figure 53 depicts Ki-67 immunohistology images of skin tissue after ABLE treatment that show that the ABLE treatment downregulated the expression of Ki67 antigen in the basal layer of epidermis. The scale bar for Figure 53 is 100 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0085] Figure 54 depicts CD31 immunohistology images of skin tissue after ABLE treatment that show that the ABLE treatment suppressed the occurrence of dilated CD31+micro blood vessels. The scale bar for Figure 54 is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0086] Figure 55 shows a cytokine analysis in psoriatic skin lesions which reveals that the inflammation-related cytokines (IL family) are mostly down-regulated by Day 4 after ABLE treatment. Data are presented as mean values ± SD. n=8 for each group.

[0087] Figure 56 shows a cytokine analysis in psoriatic skin lesions that reveals that the inflammation-related cytokines and certain chemokines are mostly down-regulated after ABLE treatment by Day 4. Data are presented as mean values ± SD. n=8 for each group.

[0088] Figures 57A-57B demonstrate by 16S rRA sequencing that ABLE could remodulate the skin microbiota towards healthy conditions. Figure 57A depicts Taxa composition plots illustrate the skin microbial compositions at different taxonomy levels from phylum to class. Figure 57B depicts a Principal Coordinates Analysis (PCoA) plot of beta diversity revealed that ABLE-treated mice had distinct skin microbiota profiles from control group, but quite similar to healthy mice.

[0089] Figure 58 demonstrates that the living bioelectronics healthcare system can modulate the relative abundance of various bacterial species in skin microbiota. Analysis of six bacteria species with high relative abundance shows that the skin microbiota of the ABLEgroup is closer to that of the healthy group when compared to the control group. Data are presented as mean values ± SD. n=4 for both the healthy and control group; n=5 for the ABLE group.

[0090] Figure 59 shows the results of an RT-qPCR analysis searching for skin microbes in the device, which suggest that skin microbes are unlikely to enter and colonize the device. Amplification plots show that only 16S rRNA genes from S. epidermidis, not from Staphylococcus aureus, Rhodococcus erythropolis, Delftia acidovorans, Microbacterium aerolatum, were amplified by RT-qPCR from the devices after applying the ABLE treatment. Melt curve plots indicate the specificity of the successful amplification of 16S rRNA gene from S. epidermidis. n=4 for each group.

[0091] Figure 60 shows that ABLE treatment was ineffective on psoriatic skin of TLR2 knockout (TLR2 KO) mice. (Left) schematic of the experimental design. (Middle) on Day 4 post ABLE treatment (ABLE), the psoriatic skin looks similar to the untreated control group (Control), in terms of the severity of psoriatic symptoms. This indicates no obvious therapeutic effects by ABLE. (Right) PSI score indicates that ABLE treatment didn’t significantly alleviate psoriatic symptoms on Day 4. The scale bar for Figure 60 is 5 mm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=5 for each group.

[0092] Figure 61 depicts H&E histological analysis of psoriatic TLR2 KO skin. Neither histology and epidermal thickness didn’t show significant difference between ABLE-treated (ABLE) and untreated psoriatic skin tissue (control) of TLR2 KO mice. The scale bar in Figure 61 is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0093] Figure 62 depicts that immunohistological analysis of CD4+T cells and CD31+blood vessels did not show significant differences between ABLE treated and untreated psoriatic skin of TLR2 KO mice. The scale bar for Figure 62 is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0094] Figure 63 A-63D depict that ABLE treatment shows therapeutic effects on psoriatic skin of toll-like receptor 4 knockout (TLR4 KO) mice. Figure 63 A depicts a schematic of the TLR4 KO mice. Figure 63B depicts, on Day 4, post-ABLE treatment (ABLE) shows that psoriatic skin symptoms have recovered compared to the untreated control group (Control).This suggests that the deficiency of TLR4 does not affect the therapeutic efficacy of ABLE. Figures 63C-63D depict PSI scores and H&E histology analysis show that the ABLE exhibits therapeutic effects in treating psoriasis in TLR4 KO mice. The scale bar in Figure 63 A-63D is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0095] Figures 64A-64B depict immunohistological analysis of CD4+T cells (64A) and CD8+T cells (64B) that show significant differences between ABLE-treated and untreated psoriatic skin of TLR4 KO mice. The scale bar in Figure 64A-64B is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0096] Figure 65 shows that lipoteichoic acid (LTA) and peptidoglycan (PGN) from Staphylococcus epidermidis can downregulate the psoriasis-related cytokines in plasmacytoid dendritic cells. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=3 for each group.

[0097] Figure 66 shows that lipoteichoic acid (LTA) and peptidoglycan (PGN) from Staphylococcus epidermidis can downregulate the psoriasis-related cytokine in epidermal cells. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. n=3 for each group.

[0098] Figure 67 depicts H&E histological analysis (epidermal thickness) that reveals that different TLR2 ligands derived from Staphylococcus epidermidis show therapeutic effects on psoriatic skin. Lig-Control, psoriasis treated with LtaS-IN-1 and proteinase K; LTA, psoriasis treated with lipoteichoic acid derived from Staphylococcus epidermidis,' LTAinh, psoriasis treated with LTA synthesis inhibitor LtaS-IN-1 -treated Staphylococcus epidermidis,' PGN, psoriasis treated with peptidoglycan derived from Staphylococcus epidermidis,' ProK, psoriasis treated with proteinase K to digest proteins and peptides. All groups used the hydrogel matrix as the vehicle. The scale bar for Figure 67 is 50 pm. P values are determined by ordinary one-way ANOVA with Tukey’s multiple comparisons test. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0099] Figure 68 depicts immunohistological analysis of CD4+T cells that reveals that different TLR2 ligands derived from Staphylococcus epidermidis show therapeutic effects on psoriatic skin. Lig-Control, psoriasis treated with LtaS-IN-1 and proteinase K; LTA, psoriasis treated with lipoteichoic acid derived from Staphylococcus epidermidis,' LTAinh, psoriasistreated with LTA synthesis inhibitor LtaS-IN-1 -treated Staphylococcus epidermidis,' PGN, psoriasis treated with peptidoglycan derived from Staphylococcus epidermidis ProK, psoriasis treated with proteinase K to digest proteins and peptides. All groups used the hydrogel matrix as the vehicle. The scale bar in Figure 68 is 50 pm. P values are determined by ordinary one-way ANOVA with Tukey’s multiple comparisons test. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0100] Figure 69 depicts immunohistological analysis of CD8+T cells that reveals that different TLR2 ligands derived from Staphylococcus epidermidis show therapeutic effects on psoriatic skin. Lig-Control, psoriasis treated with LtaS-IN-1 and proteinase K; LTA, psoriasis treated with lipoteichoic acid derived from Staphylococcus epidermidis,' LTAinh, psoriasis treated with LTA synthesis inhibitor LtaS-IN-1 -treated Staphylococcus epidermidis,' PGN, psoriasis treated with peptidoglycan derived from Staphylococcus epidermidis,' ProK, psoriasis treated with proteinase K to digest proteins and peptides. All groups used the hydrogel matrix as the vehicle. The scale bar in Figure 69 is 50 pm. P values are determined by ordinary one-way ANOVA with Tukey’s multiple comparisons test. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0101] Figure 70 depicts immunohistological analysis of F4 / 80+macrophages that reveals that different TLR2 ligands derived from Staphylococcus epidermidis show therapeutic effects on psoriatic skin. Lig-Control, psoriasis treated with LtaS-IN-1 and proteinase K; LTA, psoriasis treated with lipoteichoic acid derived from Staphylococcus epidermidis,' LTAinh, psoriasis treated with LTA synthesis inhibitor LtaS-IN-1 -treated Staphylococcus epidermidis,' PGN, psoriasis treated with peptidoglycan derived from Staphylococcus epidermidis,' ProK, psoriasis treated with proteinase K to digest proteins and peptides. All groups used the hydrogel matrix as the vehicle. The scale bar for Figure 70 is 50 pm. P values are determined by ordinary one-way ANOVA with Tukey’s multiple comparisons test. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0102] Figure 71 shows that psoriasis treated with lipoteichoic acid derived from Staphylococcus epidermidis (LTA) alone has less therapeutic efficacy compared with ABLE treatment. LTA, psoriasis treated with lipoteichoic acid derived from Staphylococcus epidermidis,' ABLE, psoriasis, treated with active biointegrated living electronics. The scale bar for Figure 71 is 50 pm. P values are determined by t-test, two-tailed. Data are presented as mean values ± SD. Images are representative of n = 5 different mice.

[0103] Figure 72 depicts a transcriptome comparison between control group and ABLE group that indicates distinct transcriptome profiles. Volcano plot displays the gene expression profiles when comparing the control group with ABLE group. A bi-clustering heatmap was employed to visualize the expression profile of the top 30 differentially expressed genes. These genes were sorted based on their adjusted p-values, and their log2 transformed expression values.

[0104] Figure 73 depicts a transcriptome comparison between vehicle group and ABLE group that indicates distinct transcriptome profiles. Volcano plot displays the gene expression profiles when comparing the vehicle group with ABLE group. A bi-clustering heatmap was employed to visualize the expression profile of the top 30 differentially expressed genes. These genes were sorted based on their adjusted p-values, and their log2 transformed expression values. Gene ontology analysis reveals the regulatory impact of ABLE treatment on psoriasis-related processes, including immune response and keratinization.

[0105] Figure 74 depicts a transcriptome comparison between control group and vehicle group that indicates similar transcriptome profiles. Volcano plot displays the gene expression profiles when comparing the control group with vehicle group. A bi-clustering heatmap was employed to visualize the expression profile of the top 30 differentially expressed genes. These genes were sorted based on their adjusted p-values, and their log2 transformed expression values. Gene ontology analysis reveals vehicle group without living components cannot regulate inflammation and immune process.DETAILED DESCRIPTION

[0106] All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as though set forth in their entirety in the present application.

[0107] As utilized in accordance with the present disclosure, unless otherwise indicated, all technical and scientific terms shall be understood to have the meaning commonly understood by one of ordinary skill in the art. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular.

[0108] Throughout this specification, unless the context specifically indicates otherwise, the terms “comprise” and “include” and variations thereof (e.g., “comprises,” “comprising,” “includes,” and “including”) will be understood to indicate the inclusion of a statedcomponent, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other component, feature, element, or step or group of components, features, elements, or steps. Any of the terms “comprising,” “consisting essentially of,” and “consisting of’ may be replaced with either of the other two terms, while retaining their ordinary meanings.

[0109] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise.

[0110] In some embodiments, percentages disclosed herein can vary in amount by ±10, 20, or 30% from values disclosed and remain within the scope of the contemplated disclosure.[OHl] Unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values herein that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0112] As used herein, ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. For example, “about 5%” means “about 5%” and also “5% .” The term “about” can also refer to ± 10% of a given value or range of values. Therefore, about 5% also means 4.5% - 5.5%, for example.

[0113] As used herein, the terms “or” and “and / or” are utilized to describe multiple components in combination or exclusive of one another. For example, “x, y, and / or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.”I. OVERVIEW

[0114] In general, the present disclosure relates to a biomaterial matrix having a live bacteria impregnated hydrogel, using the biomaterial matrix to treat mammalian inflammation, and wearable electronic devices having the biomaterial matrix installed thereon. With biogenic, bioelectrical, and biomechanical functions, living bioelectronics assist in both monitoring and therapeutic intervention for skin inflammation conditions.

[0115] Life-like and seamless interfaces between electronic devices and biological tissues stand to revolutionize disease diagnosis and treatment. However, biological and biomechanical disparities between synthetic materials and living tissues present challenges atbioelectrical signal transduction interfaces. Here, an active biointegrated living electronics (ABLE) platform is introduced, encompassing capabilities across the biogenic, biomechanical, and bioelectrical dimensions simultaneously. The living biointerface, comprising a bioelectronics layout and a Staphylococcus epidermidisA&A n hydrogel composite, enables multi-modal signal transduction at the microbial-mammalian nexus. The extracellular components of the living hydrogels, prepared through thermal release of naturally occurring amylose polymer chains, are viscoelastic, capable of sustaining the bacteria with high viability, and facilitate freeze-storage of the ABLE device. Through electrophysiological recordings, and wireless probing of skin electrical impedance, body temperature, and humidity, ABLE monitors microbial-driven intervention in psoriasis (an intricate autoimmune skin disease) through the innate microbial activities. Comprehensive mechanistic studies show that Staphylococcus epidermidis from the living bioelectronics impedes activation of initiating dendritic cells and subsequent inflammatory phases of psoriasis pathogenesis. The ABLE platform offers a multifunctional and life-like biointerface solution for addressing intricate biomedical challenges, including autoimmune diseases and rehabilitation needs.

[0116] Biomaterials that synergistically incorporate biomechanical1'3, biogenic4'6, and bioelectrical7’8dimensions offer the potential to establish life-like, seamless, and multifaceted biointerfaces with mammalian skin and / or tissues (shown in Figures 1 A and IB). Bioelectronics, in particular, have become indispensable for capturing physiological signals9'12, monitoring inflammation as a diagnostic tool13, 14, and executing biological modulation for targeted treatments15, 16. However, the primary challenge with traditional bioelectronics (shown in Figure 1C) is the integration with biological tissues, which arises from disparities in mechanical, chemical, and biological attributes17, 18. The mechanical discrepancies in bioelectronics can lead to interfacial discontinuities, compromising signal fidelity19, 20. While hydrogels act as an intermediary layer to bridge the mechanical gap between electronics and biological systems, traditional hydrogels may fall short in providing the necessary cellular functions for tissue modulation (shown in Figure 1C)21, 22. Consequently, contemporary bioelectronics, when used to monitor inflammatory conditions, lack the biogenic capacity for concurrent immunoregulation13. This limitation restricts the versatility of bioelectronics in addressing the complexities of various diseases. To expand the role of bioelectronics in tissue restoration and monitoring, there is a pressing need to design interface with enhanced bioactivity. Intriguingly, inherent biological systems such as bacteria and mammalian cellsnaturally exhibit cellular signal generation and transmission, which may be leveraged for inflammation management23. However, the integration of these living entities into bioelectronics remains a challenge, mainly due to the absence of precise control mechanisms and a thorough understanding of the dynamics between foreign cells and host diseases.

[0117] The Active Biointegrated Living Electronics (ABLE) platform (shown in Figures ID and IE). The ABLE platform introduces a living hydrogel at the tissue-electronics interface to impart essential biogenic properties for skin immunoregulation. The skin commensal bacteria Staphylococcus epidermidis from human skin flora was chosen as the living component in example biointerfaces, which provides bioelectronics with capabilities to regulate inflammation and promote skin regeneration. While S. epidermidis was used to demonstrate proof of principle, other microbes (and combinations thereof) can also be used (e.g., the lactobacillus species, Cutibacterium acnes. Bacillus sublilis. Pseudomonas fluorescens. the Corynebacterium species, and non-pathogenic strains of Escherichia coli). The ABLE platform has multifunctionality arising from synergistic interaction between the biogenic, biomechanical, and bioelectrical realms (shown in Figure IB). This platform is characterized by its biocompatibility, ability to conform to biological tissues, and provision of therapeutic benefits. It employs wireless bioelectrical sensing, fortified by a stringent safety control mechanism. Specifically, the biogenic polymers enhance bacterial viability (shown in Figure IB, 1), and the bacteria themselves modulate the skin's immune environment (also shown in Figure IB, 2). The bioelectronics within the system facilitate electrical sensing (e- sensing) to gather information from the skin (shown in Figure IB, 3) and utilize electrical stimulation (e-stimulation) to manage the biosafety of bacteria (also shown in Figure IB, 4), addressing long-standing biohazard concerns of handling synthetic living materials with opportunistic pathogens24, 25. The living hydrogel plays multiple roles: its encapsulation fosters prolonged bacterial storage and viability (shown in Figure IB, 5), its viscoelastic properties ensure stable skin interaction (also shown in Figure IB, 6), aid in information collection from the skin (shown in Figure IB, 7), and assist in biohazard management (also shown in Figure IB, 8). Lastly, the hydrogel's skin-adhesion property augments long-term data acquisition (shown in Figure IB, 9).

[0118] Taken together, integration of a living biointerface with bioelectronics provides a controlled platform to delve into interactions and mechanisms at the bacteria-mammalian nexus. Using this platform, the role of Staphylococcus epidermidis in skin inflammation management and skin microbiota modulation was explored. The discoveries indicate that theABLE manages inflammation by inhibiting the activation of initial dendritic cells, leading to a reduction in inflammation typically linked to psoriatic development, which underscores the practical effectiveness of the ABLE platform in diagnosing and treating intricate autoimmune diseases such as psoriasis.II. THE BIOMATERIAL MATRIX AND ASSOCIATED METHODS

[0119] In some embodiments, a biomaterial matrix 100 is disclosed (shown in Figure 1C, for example). The biomaterial matrix 100 comprises a hydrogel 102 and a population of living bacteria 104 within or encapsulated by the hydrogel 102. In this context, the population of bacteria resides within the hydrogel in such a way that it can interact directly or indirectly with tissue upon which the hydrogel is placed.

[0120] In some embodiments, such as is shown in Figure 2A, the hydrogel 102 comprises a main protein substance 106, such as gelatin, and a polysaccharide component 108, such as tapioca starch. Further, in some embodiments, each of the main protein substance 106 and the polysaccharide component 108 are a biocompatible material.

[0121] In some embodiments, the living bacteria 104 is Staphylococcus epidermidis. and the biomaterial matrix 100 is used to treat epidermal and / or tissue inflammation on an animal, such as a mammal. In other embodiments, other microbes can be used. For instance, Lactobacillus species may be used to treat certain skin conditions (eczema, psoriasis, etc.), as Lactobacillus are probiotics known for their anti-inflammatory properties and potential to modulate skin microbiota. Cutibacterium acnes. often associated with acne, may be used in its engineered strain form to produce anti-inflammatory compounds or modulate sebum production for therapeutic benefit. Bacillus subtilis could be used to secrete antimicrobial peptides or other beneficial molecules for skin repair or disease prevention. Pseudomonas fluorescens, known for its ability to produce bioactive compounds, could be utilized for wound healing or antimicrobial applications on the skin. Corynebacterium species could be utilized, as some strains from the skin microbiota have been associated with positive interactions with the immune system. Escherichia coli (non-pathogenic strains), being frequently used in synthetic biology, could be engineered to deliver therapeutic agents to the skin when encapsulated or safely integrated into biointerfaces. Various combinations of these species could also be used.

[0122] Further, in some embodiments, the biomaterial matrix 100 can have a particular composition that can be varied. For instance, the amount of the main protein substance 106included could be chosen from a range, such as between about 5 wt% and about 25 wt%, the amount of the polysaccharide component 108 could also be chosen from a range, such as between about 5 wt% and about 20 wt%, and the amount of living bacteria 104 included could make up about 2% to about 20% of the biomaterial matrix 100. The exact percentages of each of the main protein substance 106, the polysaccharide component 108, and the living bacteria 104 can vary and can be chosen to achieve specific desired mechanical, biomechanical, and / or biological / therapeutic properties when combined in specific ratios.

[0123] In some embodiments, the main protein substance 106 can be a gelatin, a collagen, and / or a casein. Also, in some embodiments, the polysaccharide component 108 can be a starch, a cellulose, a pectin, a kappa-carrageenan, and / or a glucan from Euglena gracilis.Method of Sustaining a Living Bacteria in a Hydrogel and Method of Using the Living Bacteria Staphylococcus epidermidis to Treat Inflammation in Mammalian Epidermis

[0124] In using this method, in some embodiments, a living bacteria 104, such as the living bacteria Staphylococcus epidermidis, can be suspended in a hydrogel 102 of a biomaterial matrix 100. In various embodiments, the living component may be suspended in the hydrogel, the living component may be contained in the hydrogel, the living component may be encapsulated by the hydrogel, the hydrogel may be impregnated with the living component, and / or the like.

[0125] In some embodiments, the method includes boiling granules of a polysaccharide component in an aqueous solution, such as water, to form a viscoelastic polysaccharide, mixing the viscoelastic polysaccharide with a main protein substance to create the hydrogel 102, and encapsulating the living bacteria 104 in the hydrogel 102 to create a biomaterial matrix 100.

[0126] In one embodiment, the main protein substance comprises gelatin, the polysaccharide component comprises tapioca starch, and the living bacteria comprises Staphylococcus epidermidis, as shown in some of the examples below, as well as in Figure 2A.

[0127] In some embodiments, for long-term storage, the method also includes freezing the biomaterial matrix 100 and storing the frozen biomaterial matrix. In such embodiments, the method further includes removing the frozen biomaterial matrix from storage, adding the frozen biomaterial matrix to water, and reheating the frozen biomaterial matrix and water to restore the biomaterial matrix 100 such that the living bacteria 104 is still alive in the biomaterial matrix 100.

[0128] In some embodiments, a method of using Staphylococcus epidermidis to treat inflammation in an epidermis of an animal (e.g., a mammal) includes administering a substance containing a population of Staphylococcus epidermidis to a particular region of the animal. The method also includes reducing inflammation in the region.

[0129] In some embodiments, the substance can be a topical ointment, a lotion, and / or a cream. Further, in some embodiments, the substance is contained in a dosage delivery device, such as a patch or other similar object that is wearable by the mammal.Wearable Electronic Device for Treating and / or Diagnosing Inflammation

[0130] In some embodiments, a wearable electronic device 200 is disclosed, such as is shown in Figure 3E. In some embodiments, the wearable electronic device 200 includes a first layer 202, being a sensor layer; and a second layer 204 that is applied to an interfacing side of the sensor layer. The second layer 204 is configured to be applied to an animal (e.g., mammalian) epidermis, and the second layer 204 is a biomaterial matrix layer, which can include any component described with the biomaterial matrix 100. The biomaterial matrix layer includes a hydrogel and a living bacteria encapsulated in the hydrogel. The wearable electronic device 200 also includes one or more probe 206 that extends from a sensor 208 in the sensor layer, through the biomaterial matrix layer, and contacts the mammalian epidermis directly. In some embodiments, the probe 206 is configured to retrieve information from the mammalian epidermis and transfer it to the sensor 208 in the sensor layer to which it is affixed.

[0131] In some embodiments, the first layer 202 and the second layer 204 are coupled together. For instance, in some embodiments, the first layer 202 and the second layer 204 are laminated together. Other coupling methods are also possible.

[0132] Further, in some embodiments, the sensor layer includes a plurality of sensors 208, such as at least one of an electrical impedance sensor, a humidity sensor, and a temperature sensor. Each sensor of the plurality of sensors may include one or more probes 206 to gather data from the mammalian epidermis to which the wearable electronic device is applied.

[0133] In some embodiments, each sensor 208 of the sensor layer is placed onto a planar sheet such that all of the sensors combine to form a single first layer of the wearable device.

[0134] Further, in some embodiments, the sensor layer includes one or more stimulators 210. In such embodiments, the stimulators 210 are capable of regulating bacterial activities,such as killing living bacteria within the hydrogel (e.g., a population of bacteria added to the hydrogel and / or other bacteria that may grow on / in the hydrogel).

[0135] In some embodiments, the hydrogel includes a main protein substance and a polysaccharide component. Further, in some embodiments, the main protein substance comprises gelatin and the polysaccharide component comprises tapioca starch. In some embodiments, the living bacteria comprises Staphylococcus epidermidis.III. DEVELOPMENT OF THE BIOMATERIAL MATRIX AND ASSOCIATED METHODSDesign and Evaluation of the Biogenic Matrix in ABLE

[0136] In some embodiments, a hydrogel composite was chosen as the primary matrix for the living ABLE biointerface due to its biomechanical and structural resemblance to biological tissues18. S. epidermidis was incorporated as the living component, as this species is part of the human skin flora and can modulate biological activity in skin cells26. In such embodiments, the living component was incorporated into the hydrogel during its preparation. For instance, in one embodiment, the quantity of bacteria was controlled by culturing S. epidermidis in or tryptic soy broth (TSB) medium at 37°C until the optical density at 600 nm (OD600) reached a range of 2.80 to 3.00. Subsequently, 10% (by weight relative to the hydrogel precursor solutions) of the cultured bacteria solution was aseptically added and thoroughly mixed with the starch-gelatin hydrogel at 42°C in a water bath. Further, to ensure the functionality of the living biointerface, the hydrogel matrix must support bacterial viability, with bioelectrical and biomechanical capabilities for interfacing with electronics and biological tissue.

[0137] In designing a hydrogel matrix conducive to the long-term viability of S. epidermidis (shown in Figure IB, 1), inspiration was drawn from natural biofilms that promote bacterial survival and community regulation27. To emulate the major biofilm components of proteinaceous matrices and exopolysaccharides, a biocompatible hydrogel matrix was created using a dual network of protein and polysaccharide polymers (shown in Figure 2A).

[0138] Gelatin was selected as the main protein matrix given its natural origin and superior hydrogel-forming properties28. Compared with synthetic hydrogels like polyacrylamide, gelatin exhibited superior biocompatibility with the bacteria, while also providing a natural environment for bacterial growth (shown in Figure 5). To identify a candidate polysaccharidecomponent, a library of materials was screened including various biogenic and synthetic polymers, and nano clay-based materials. Tapioca starch best supported S. epidermidis viability and was selected as the polysaccharide (shown in Figures 2B-2C and Figure 6). A gelatinization and retrogradation process was then applied via a heating-cooling cycle. This process diminished the crystallinity of the starch, altering the granular morphology and diffusing out the granule-enclosed amylose (shown in Figure 2D and Figure 7). The hydrated starch with exposed amylose content formed a biocompatible network with which bacteria interact (shown in Figure 2C, Figure 2E, and Figure 8). In line with this, it was noted that gelatinization of starch prolongs bacterial viability inside the hydrogel matrix (shown in Figure 2F).

[0139] Altogether, a protein-polysaccharide hydrogel was crafted for bacterial encapsulation and immobilization (shown in Figure 2E and Figures 9 and 10), which promoted prolonged bacterial viability of at least 4 days (as shown in Figure 2F). Additionally, the freeze-dried living hydrogel can be preserved for 30 days at -80 °C. Due to the hydrogel’s ability to support bacterial growth, any loss of bacterial viability during storage can be recovered beyond its initial level by allowing the rehydrated hydrogel to sit at room temperature overnight. This feature indicates potential for industrialization and distribution (shown in Figure IB, 5, and in Figure 2G).

[0140] For instance, in one embodiment, a protein-polysaccharide hydrogel was prepared by mixing tapioca starch (15 wt%), gelatin (10 wt%), and deionized water or tryptic soy broth (TSB) medium. The mixture was then heated in an oil bath at 80°C for 30 minutes to facilitate the gelatinization of starch. Subsequently, the hydrogel was transferred to a 4°C refrigerator for gelation. Other combinations and compositions are also possible.

[0141] The living hydrogels display favorable bioelectrical and biomechanical characteristics, facilitating integration of bioelectronic devices with biological tissues (shown in Figure IB, 7 and 9). The high ionic electrical conductivity of the living hydrogels was observed, <500 Q at physiologically relevant frequencies of 102-105 Hz, using electrochemical impedance spectroscopy (EIS) (shown in Figure 11). The living hydrogels have a high water content (>75%) and tissue-compliant ultra-softness (shear modulus of 4 kPa) (shown in Figure 12). Further, the gelatinization process increases polymer chain mobility and enhances molecular interactions between the starch and gelatin polymers, as indicated by Fourier transform infrared analysis, which showed a shift of spectral features in the amide I region from 1600 cm-1 to 1700 cm-1 (shown in Figure 13). Intermolecularinteractions enable more energy dissipation during mechanical deformation and thereby endow the living hydrogel with tissue-like viscoelasticity. The strain- and frequencydependent modulus, fast stress relaxation, and mechanical hysteresis further confirmed the viscoelasticity (shown in Figure 12). Such tissue-mimicking biomechanical properties promote a conformal biointerface with tissues, for seamless integration of bioelectronics (shown in Figure 14). The biomechanical properties of the hydrogel are also adjustable for various tissue applications (shown in Figure 15). Furthermore, the abundance of hydroxyl groups in the starch polymer endows the living hydrogel with adhesive properties, enhancing the stability of the bioelectronic devices on the tissue (shown in Figure 16).

[0142] To demonstrate that the biomechanical and bioelectrical properties of living hydrogel enable efficient ABLE functions, a 15-channel mesh electronics array for surface electromyography (sEMG) intensity mapping was constructed (as is shown in Figure 2H and Figures 17-19). The living hydrogel was integrated with the multichannel array through spincoating gel-casting techniques (shown in Figure 17). The electrophysiology -based ABLE device was interfaced with the skin on a rat's leg and recorded the EMG signals evoked by sciatic nerve stimulation (shown in Figure 20). Notably, the ABLE device formed conformal and adhesive interfaces with the skin on the rat leg and recorded the EMG signals with an average signal -to-noise ratio (SNR) of 26.76 dB (as is shown in Figure 20). Furthermore, given the stable and conformal biointerface, the ABLE device resolved high sEMG spatiotemporal intensity dynamics over an area of 16 x 12.8 mm2(shown in Figure 21). Instead, a gold biointerface (electronics without living hydrogel) recorded EMG signals with an SNR of 12.00 dB, indicating that the conformal nature of the ABLE facilitates electrophysiological signal transmission (shown in Figure 2 J). The living biointerface also promoted the long-term stability of the bioelectronics in EMG signal recording over a 4 hour duration without significant SNR loss (as is shown in Figure 21).Skin Disease Monitoring and Therapy with ABLE

[0143] To demonstrate the utility of ABLE in complex disease, the ABLE devices were applied to a psoriasis mouse model (shown in Figure 3 A). Psoriasis is a chronic inflammatory disease that impacts approximately 125 million people worldwide, with no complete cure29. Current treatment options often involve small-molecule drugs with potential systemic side effects. Here, we conducted a series of pre-clinical evaluations using ABLE in the imiquimod (IMQ)-induced psoriasis model30. This model is widely utilized in in vivo research due to its clinical and histological similarities to human psoriasis, including characteristic symptomssuch as desquamation, thickening of the epithelial structure, skin inflammation, and dysregulated host skin microbiota31.

[0144] To demonstrate the potential of ABLE in the skin inflammation diagnosis and treatment, a mesh electronics device with a spin-coated living interface for 6-lead surface electrocardiogram (sECG) recording was first fabricated (shown in Figure IB, 3, and in Figures 3B and 17). Upon attachment to the chest area of healthy mice, the ABLE stably recorded the 6-lead ECG (I, II, III, aVL, aVR, and aVF) with an average SNR of 18.97 dB (as is shown in Figure 3C). In contrast, the ABLE recorded a significantly lower SNR of 7.96 dB in mice with psoriasis symptoms (shown in Figure 3D), mainly attributed to the thickening of the psoriasiform skin. Hence, alterations in recorded electrophysiological signals offer qualitative information in the detection of skin diseases. More importantly, ABLE will not induce undesired inflammatory skin responses but will treat psoriasis inflammation. When the ABLE device was applied to psoriatic skin for 4 days, it was found that the SNR of recorded ECG was largely enhanced (Day 0 vs Day 4 recording), indicating reduced psoriasis symptoms in the mouse skin (as is shown in Figure 22). These results demonstrate how the ABLE system may be used to record electrophysiological signals while concurrently providing biogenic cues to regulate inflammatory skin diseases.

[0145] To investigate the potential of ABLE in real-time monitoring and therapy and active circuit control, we created a battery-free, wireless flexible printed circuit board (FPCB). The FPCB-based ABLE can achieve comprehensive interplay between the three components (i.e., hydrogel, bacteria, and electronics) (shown in Figure IB, 3, and in Figure 3E). It is capable of (1) wireless energy harvesting and data transfer; (2) real-time disease progress monitoring via skin impedance, humidity, and temperature sensing; and (3) on-demand bacterial disinfection. The FPCB is highly flexible and functions effectively as it bends to conform to the skin tissue (as is shown in Figure 3F). It integrates a near-field communication (NFC) transponder (RF430FRL152H) for radiofrequency (RF) energy harvesting and wireless data transfer following the ISO 15693 protocol (shown in Figure 23). For comprehensive monitoring of inflammatory skin conditions, the FPCB incorporates an impedance sensor circuit along with a commercialized temperature and humidity digital sensor (SHT40) (as is shown in Figures 24 and 25). The SHT40 sensor was chosen here because of its noise robustness, measurement repeatability, and low-power consumption (3.3 pW) due to its digital nature. The SHT40 sensor was connected to the NFC transponder through the I2C protocol (shown in Figure 3F). The acquired sensing data can be wirelessly transferred andremotely analyzed to monitor disease recovery progress and provide information for bacterial modulation32.

[0146] While application of living hydrogel in bioelectronics interfaces improved bioactivity for disease management, it presents practical challenges24. One major concern is that the S. epidermidis can proliferate and colonize on skin, leading to infections and the development of virulence factors33. Besides, current households are not equipped with proper biohazard containers to safely discard bacteria-laden materials. Thus, our FPCB included two modulation electrodes with triggers for delivering electrical current in terminal disinfection (shown in Figure IB, 4 and 8). To maximize disinfection efficiency, a thin Au film to the back of the FPCB was added, which promotes reactive oxygen species (ROS) generation in the hydrogels-electronics interface (as is shown in Figure 26). Using bioelectronics for disinfection management, opportunistic pathogens (e.g., commensal bacteria) can be applied to the skin. In preclinical assessments, open-field movement tests confirmed that the lightweight and wireless ABLE does not hinder mouse mobility (shown in Figure 27). Furthermore, the functionality of sensors attached to mouse dorsal skin during movement was validated, confirming sensor reliability for research and data collection (shown in Figure 25).

[0147] By incorporating the FPCB circuit in the ABLE design, we can integrate disease monitoring with drug-free skin cellular modulation for disease treatment (shown in Figure 3G). The constant decrease in impedance recorded by ABLE during the recovery process aligns well with the psoriasis severity index (PSI) of the mice skin over 4 days (shown in Figure 3H). Characteristic clinical symptoms of psoriasiform skin, including erythema, induration, and desquamation were all largely reduced after ABLE treatment, indicating how living biointerfaces can regulate the immune system. Humidity and temperature information over 4 days of treatment also provides essential information on the changing skin environments (as is shown in Figure 28). Moreover, upon treatment completion, two disinfection electrodes positioned in the ABLE deliver direct current (DC) to the living hydrogel interface for 30 minutes of disinfection (shown in Figure 31 and Figure 29). This process effectively disinfects the bacteria present within the living interface, as supported by the confocal microscope imaging (as is shown in Figure 31). This feature significantly reduces the biohazard risk associated with the living hydrogel, ensuring biosafety for both humans and the environment.Mechanistic Investigations of ABLE-based Therapy

[0148] How the ABLE modulates the cellular environment in inflammatory skin conditions through biogenic cues was studied (as shown in Figure IB, 2 and 6). Although the role of S. epidermidis in mediating skin homeostasis is widely known26, 34, there is minimal literature on its therapeutic effects in psoriasis, let alone translation to clinic. This gap in knowledge may be attributed to the scarcity of suitable housing matrices and accessible monitoring systems for systematic investigation of interactions between commensal bacteria and skin tissue24. The ABLE provides a regulatory platform for delving into these interaction mechanisms.

[0149] A reduction in spleen weight on Day 4 indicated that the ABLE can modulate whole-body immune system (as shown in Figure 30). Hematoxylin and eosin (H&E) staining showed significant reduction of epidermal thickening (hyperplasia), parakeratosis and cutaneous inflammation in skin lesions following ABLE treatment (as shown in Figure 4A, Figure 31, and the Table 1).

[0150] Table 1. Histopathological summary of mouse skin after ABLE treatment.

[0151] Note that the hydrogel matrix alone in combination with the bioelectronics device, i.e., vehicle without bacterial component, showed limited therapeutic effect on psoriasis (shown in Figure 32). Immunohistochemistry analysis (IHC) of Cytokeratin 14 and F4 / 80 demonstrated a notable decrease in dendritic cells and macrophages activities following ABLE treatment (shown in Figure 4B). IHC of CD4 and CD8 indicated a significant reduction of T helper cells and T cytotoxic cells (shown in Figures 33-34). Additionally,immunostaining with Ki-67 indicated a reduction in epidermal proliferation (shown in Figure 35). CD31 immunofluorescence staining revealed fewer dilated blood vessels in ABLE- treated samples after 4 days compared to controls (mice with IMQ-induced psoriasis, no treatment) (shown in Figure 4C and Figure 36). Cytokine analysis showed reduced levels of inflammatory cytokines, with notable reductions in IL- 17, IFN-y, TNF-a, and IL-1, which play a crucial role in promoting recruitment of inflammatory cells to psoriatic plaque lesions, regulating keratinocyte proliferation, and disease development (shown in Figure 4D and Figures 37-38). These findings collectively highlight the potential of living bioelectronics in modulating the inflammatory microenvironment and key aspects of psoriasis pathogenesis, including immune dysregulation, cellular proliferation, neovascularization, and cytokine- mediated inflammation.

[0152] To gain further insight into ABLE modulation of skin microbiota, 16S ribosomal RNA gene sequencing analysis was conducted of the treated skin samples. Linear discriminant analysis Effect Size (LEfSe) results indicated that the ABLE effectively modulated the skin microbiota, inducing a transition from a psoriatic state to a healthier state (as is shown in Figure 4E). A Principal Coordinates Analysis (PCoA) plot of beta diversity showed that skin microbiota profiles in ABLE-treated mice were distinct from those in the control group, but quite close to those in healthy mice (shown in Figure 39). At the species level, a low abundance of S. epidermidis on the skin was observed (as is shown in Figure 4F), indicating low S. epidermidis related safety concern under the bioelectronics control. Furthermore, the abundance of Staphylococcus aureus, a species known to be associated with psoriasis progression35, was also significantly reduced (as is shown in Figure 4F). We noticed that the abundance of other skin microbes, such as Rhodococcus erythropolis and Delftia acidovorans, was also significantly modulated by ABLE (as is shown in Figure 40). The findings require further systematic investigation given the limited studies in past literature. Altogether, changes in bacterial abundance may be attributed to the mutual interactions between different bacterial species and Staphylococcus epidermidis6.

[0153] The molecular mechanisms underlying ABLE-based regulation of the immune system and skin microbiota were investigated next. Previous research has reported the inverse relationship between S. epidermidis and S. aureus, wherein S. epidermidis activates the host innate and adaptive immune system against S. aureus by the toll-like receptor 2 (TLR2) channel on dendritic cells26. This knowledge prompted the exploration of the therapeutic effect of ABLE in the TLR2 -knockout mouse strain B6.129-Tlr2tmlKir / J. It was found thatABLE treatment in TLR2-knockout mice did not result in the same therapeutic effects observed for wildtype mice (as is shown in Figure 41), as determined by PSI and H&E analyses (shown in Figure 42). Additionally, CD4 and CD8 IHC showed the continued accumulation of T helper cells and T cytotoxic cells in the skin lesion (shown in Figure 43). These results suggest that the efficacy of living bioelectronics in treating psoriasis may be dependent on the functionality of the TLR2 channel in immune cells. However, further investigations are needed to understand the underlying mechanisms.

[0154] Bulk RNA-sequencing was conducted after 4 days of ABLE treatment. When comparing control treatment with ABLE treatment, 1100 significantly altered genes were identified, of which 695 were downregulated (as is shown in Figure 44). Notably, ABLE exerted substantial regulatory effects on genes associated with psoriasis progression and pathogenesis (as is shown in Figure 4G and Figure 44), including genes pertinent to the innate immune response (e.g., Tlr2, Syk, Nod2), infiltration by adaptive lymphocytes (e.g., Syk, Nlrp3), psoriatic epidermal hyperplasia (e.g., Epgn, Hbegf, JunB, Gpldl), skin inflammation (e.g., Ccl3, Cxcl2, S100a8), and angiogenesis (e.g., Hifla, Ptgsl). Most of these psoriasis-related genes could be categorized into different gene ontology groups associated with immune and inflammatory processes (shown in Figure 4H). Furthermore, a top 30 enriched gene ontology analysis of all significantly differentially expressed genes revealed enrichments in processes related to keratinization, keratinocyte differentiation, immune system functions, and inflammatory responses (shown in Figure 41). Treatment with vehicle alone (ABLE without S. epidermidis) resulted in a substantially lower number of significantly modified genes (as is shown in Figure 45- Figure 46). Additionally, both gene expression and gene ontology analysis indicated that vehicle treatment lacked involvement of gene related to inflammation and immune response. This observation underscores the pivotal role of the living components in the ABLE system in managing skin inflammation and facilitating therapeutic intervention via bioelectronic interfaces.

[0155] Collectively, ABLE was found to significantly modulate the inflammatory environment in psoriasis (as is shown in Figure 4J). First, ABLE mitigates the expression of the Tlr2 gene, along with other genes pivotal to initiation of the innate immune response (e.g., Syk, Nod2). The importance of TLR2 in the therapeutic effect of ABLE in IMQ- induced psoriasis echoed across our transcriptome-level analysis and in TLR2-KO mice experiments. This result strongly suggests that ABLE inhibits activation of dendritic cells and macrophages through biological signals. Second, ABLE treatment substantially mitigatesinfiltration of adaptive lymphocytes to skin lesions, as indicated by histological analysis and reduced expression levels of genes associated with lymphocyte infiltration (e.g., Syk, Nlrp3). Third, both mRNA and protein levels of key cytokines, including IL-17, TNF-a, and IL-1, were markedly diminished following ABLE treatment. Finally, genes associated with psoriatic epidermal hyperplasia (e.g., Epgn, Hbegf, JunB, Gpldl) and papillary vessel dilation and angiogenesis (e.g., Hifla, Ptgsl) exhibited downregulation following ABLE treatment. These findings are in harmony with the therapeutic effects observed at the histological tissue level. In summary, ABLE treatment demonstrates potent therapeutic effects on IMQ-induced murine psoriasis by impeding the activation of initiating dendritic cells and subsequently curbing the inflammatory phases intrinsic to psoriatic pathogenesis.Outlook

[0156] In this disclosure, the efficacy of an integrated living biointerface-bioelectronics device, the ABLE, was validated in the context of biomedical applications. Using the IMQ- induced psoriasis model, the potential for clinical adaptation of living bioelectronics devices that promote therapeutic effects via a living interface was demonstrated. The ABLE platform will advance telemedicine capabilities, furnishing healthcare professionals with enriched data for clinical diagnostics and prognosis. The commercial and therapeutic prospects of the ABLE platform for diverse inflammatory conditions are substantial.

[0157] The nexus between living materials and electrical systems presents new opportunities to explore the interplay between biological and nonbiological systems. While Helminthic therapy offers apparent benefits in some autoimmune diseases, the lack of exhaustive studies has led to regulatory constraints. The advent of living bioelectronics paves the way for controlled studies into the dynamics between potentially deleterious organisms and human tissues. Future investigations must explore electrical modulation of cellular metabolic pathways within the living hydrogel. Such investigation can cultivate precision in managing living entities during disease intervention, optimizing the benefits of living components while curtailing associated risks. More broadly, the potential of the ABLE platform extends beyond autoimmune diseases, offering promising avenues for tissue repair, regeneration, functional restoration, and rehabilitation medicine. Envisioning the broader spectrum, the ABLE platform has promising potential to amalgamate diverse bioelectronics, steering the trajectory of bioelectronic medicine.

[0158] The Examples that follow are further illustrations of specific embodiments of the disclosure, and various uses thereof. They are set forth for explanatory purposes only and should not be construed as limiting the scope of the disclosure in any way.SPECIFIC EXAMPLESExample 1: Materials and Methods

[0159] In some examples, the chemicals chosen were starch that can be purchased from the local market. For experimentation, unless otherwise stated, all other chemicals were purchased from Sigma Aldrich without further purification.

[0160] In some embodiments, a synthesis of hydrogel composite was established. In such embodiments, a starch gelatin hydrogel was prepared by mixing tapioca starch (15 wt%), gelatin (10 wt%), and deionized water or tryptic soy broth (TSB) medium (cat. no. 22092). The mixture was then heated in an oil bath at 80 °C for 30 minutes to facilitate the gelatinization of starch. Subsequently, the hydrogel was transferred to a 4 °C refrigerator for gelation. To create a living hydrogel, Staphylococcus epidermidis (S. epidermidis strain NIHLM087, kindly provided by Dr. Julia Segre at NIH, NCBI taxonomy ID: NCBI:txid979201) was cultured in TSB medium at 37 °C until the optical density at 600 nm (OD600) reached a range of 2.80 to 3.00. Then, 1 mL of cultured bacteria solution was aseptically added and vigorously mixed with the starch-gelatin hydrogel at 42 °C water bath. Identical protocol was used for synthesis of living hydrogel containing Staphylococcus capitis (ATCC #35661), Staphylococcus saprophyticus (ATCC #15305) o Escherichia coli DH5a (Thermo Fisher Scientific #18265017). For the synthesis of granular starch-gelatin hydrogel, gelatin and TSB medium were mixed and heated at 80°C for 30 minutes. After cooling the mixture in a 42 °C water bath, tapioca starch was aseptically added. To synthesize polyacrylamide hydrogel, AA (3.5 wt%), APS (0.1 wt%) and MBAA (0.01 wt%) were mixed vigorously in deionized water. After 30 minutes, the accelerator TEMED (0.02 wt%) was added into the mixture and quickly mixed before pouring into acrylic molds for subsequent polymerization at room temperature.

[0161] In some embodiments, confocal laser scanning microscopy was used to assess living component viability. In such embodiments, Staphylococcus epidermidis was subjected to staining using the LIVE / DEAD BacLight Bacterial Viability Kit (Molecular Probes), following the guidelines provided by the manufacturer. The stained samples were then visualized using a Stellaris8 falcon WLL confocal microscope, equipped with a 63xobjective. In the microscope images, live cells exhibited a green fluorescence (SYTO9), while dead cells appeared red (PI). To determine the percentage of viability, individual cells or colonies were threshold and counted using Imaged software, as the individual cells or colonies were labeled using live-dead staining assays and subsequently quantified through threshold-based analysis. For the reconstruction of Z-stack images, Imaris from Oxford Instruments was employed. To visualize the process of starch gelatinization, the reducing ends of tapioca starch were marked with 8-amino-l,3,6-pyrenetrisulfonic acid (APTS). The hydrogel was soaked in an APTS solution (20 mM, mixed in 15% acetic acid), followed by the addition of 500 mM sodium cyanoborohydride. This blend was incubated at 25 °C for 15 hours, then rinsed five times with deionized water to remove any unattached dye. It was later suspended in 50% glycerol to deter water evaporation. Visualization was done using a Stellaris8 Falcon WLL confocal microscope with a lOOx objective lens. The excitation was set at 488 nm with a detection range of 500 to 580 nm. To visualize bacterial distribution within the hydrogel matrix, the APTS-marked hydrogel was heated to 42 °C, and Staphylococcus epidermidis. stained with FM1-43 (5 pM), was introduced. Postsolidification, image was captured on two separate channels. Acquired images were processed using Imaged software and then reconstructed using Imaris by Oxford Instruments.

[0162] In some embodiments, polymer screening was performed. To conduct the polymer biocompatibility test, a mixture was prepared by combining 3 mL of TSB containing Staphylococcus epidermidis with an OD600 of 0.25-0.30 and 1% w / v of polymers as outlined in Table 2.

[0163] Table 2. Chemicals used for compatibility testing with S. epidermis.

[0164] Tragacanth and glucomannan (0.5%) was used at lower w / v percentages as the polymer formed gel which could not be pipetted at 1%. The resulting polymer-bacteria suspension was then placed inside an orbital shaker and incubated at 37 °C, shaking at a speed of 200 rpm for a duration of 3 hours. Before and after the incubation period, 100 pL of the suspension was sampled and mixed in a 1 : 1 ratio with the BacTiter-Glo™ Microbial Cell Viability Assay kit (Promega). The luminescence emitted by the samples was measured using a Synergy Neo HTS Plate Reader. The fold change in viability was determined by dividing the luminescence reading obtained after 3 hours of incubation by the luminescence reading obtained at 0 hour and further normalized by the control group without any polymers.

[0165] In some embodiments, a long-term viability test was completed. To monitor the long-term viability of S. epidermidis, S. capitis, S. saprophyticus, andE.coli DH5a within the hydrogel phase, samples of starch gelatin hydrogel (granular and gelatinized) were collected at 0 hour, 24 hours, and 96 hours. These samples were placed in glass vials and weighed. To dissolve the sampled hydrogel, 10 mL of PBS was added, and the vials were incubated at 42 °C for 10 minutes. The resulting solution, containing the released bacteria, was mixed with the BacTiter-Glo™ Microbial Cell Viability Assay kit (Promega #G8230) in a 1 : 1 ratio. The luminescence emitted by the samples was recorded using a Synergy Neo HTS Plate Reader.To obtain normalized viability measurements, the raw luminescence values were divided by the sampled mass of the hydrogel and further normalized by the viability measurement obtained at 0 hour, serving as the reference point.

[0166] In some embodiments, the long-term storage of the living hydrogel was also demonstrated. For freeze-drying storage, an Eppendorf tube filled with a starch-gelatin hydrogel with live S. epidermidis was frozen in a dry ice / ethanol bath for 20 minutes. It was then subjected to freeze-drying in a FreeZone 4.5 Liter Benchtop Freeze Dryer at -43 °C for a day, and later stored in a freezer set at -80 °C. After 30 days, the dried hydrogel was rehydrated with 10 mL of deionized water, left at room temperature for two hours, and a sample was taken for viability measurements. This rehydrated mixture was allowed to sit at room temperature overnight for rejuvenation, and another sample was taken for viability measurements at 31 days. To dissolve the sampled hydrogel, 10 mL of PBS was added, followed by heating at 42°C for 10 minutes. The ensuing liquid, which contained the liberated bacteria, was combined at an equal ratio with the BacTiter-Glo™ Microbial Cell Viability Assay kit (Promega #G8230). Using a Synergy Neo HTS Plate Reader, the luminescence from the samples was measured. To obtain normalized viability measurements, the raw luminescence values were divided by the sampled mass of the hydrogel and further normalized by the viability measurement obtained at 0 hour, serving as the reference point. Identical protocol was followed for living hydrogel stored in 4 °C, -20 °C and -80 °C, except that freeze-drying was not performed.

[0167] In some embodiments, an intracellular reactive oxygen species (ROS) assay was completed. In such embodiments, a 2 mm thick living hydrogel was placed onto the patterned disinfection electrodes. Subsequently, electrical stimulation was applied to the living hydrogel at a condition of 3.5 V for a duration of 10 minutes. Following the electrical stimulation, the samples were liquefied and then diluted 10-fold with phosphate-buffered saline (PBS) to ensure the complete release of bacterial cells. The released cells were washed once with PBS and resuspended in a staining solution obtained from the DCFDA / H2DCFDA - Cellular ROS Assay Kit (abl 13851). The intracellular ROS level was measured using a Synergy Neo HTS Plate Reader. To standardize the raw fluorescence intensity, it was divided by the percentage viability determined using the LIVE / DEAD BacLight Bacterial Viability Kit.

[0168] In some embodiments, a scanning electron microscope was employed. In such embodiments, a scanning electron microscope (SEM; Carl Zeiss, Merlin) was used to imagethe morphology of multiple samples, including S. epidermidis-encapsulated living hydrogels, porcine skin attached to living hydrogels and Au / PI film. Samples were fixed in 3% glutaraldehyde, followed by washing in DI water and dehydration with an increasing ethanol gradient. Samples were dried in a critical point dryer (Leica EM CPD300) and 8 nm Pt / Pd coating was applied before imaging with the SEM at lOkV.

[0169] In some embodiments, transmission electron microscopy was performed. S. epidermidis-encapsulated living hydrogel underwent freezing in a high-pressure freezer (Baltec HPM 010, Technotrade). Freeze substitution was employed for preservation, involving a gradual temperature change from -180 °C to -50 °C over a span of five days. This process utilized a solution of 0.25% glutaraldehyde and 0.1% urinal acetate (GA-UA) dissolved in acetone. Upon reaching -50°C, the specimens were rinsed thrice with anhydrous acetone and gradually permeated with increasing concentrations of Hm20 Lowicryl resin over a period of four days (25%, 50%, 75%, and finally 100%, each for 24 hours). Following this, the specimens were rinsed with fresh 100% Hm20 solution and dislodged from their holders. Polymerization of the resins took place under UV radiation for 24 hours at room temperature. The Leica AFS system was employed to control temperatures throughout the processes of freeze substitution, Lowicryl embedding, and resin polymerization. Using an ultramicrotome (Leica UC6), the resin blocks were affixed and sliced. The slices were then moved onto copper slot grids coated with formvar. Imaging was carried out with the aid of a 300kv FEI Tecnai G2 F30 Super Twin Transmission Electron Microscope.

[0170] In some embodiments, a living hydrogel disinfection demonstration was completed. The living hydrogel with S. epidermidis was first put onto disinfection electrodes and then the electrical potential was applied for the desired duration. Subsequently, a sample of the treated hydrogel was collected and measured inside a glass vial. The sampled hydrogel was dissolved by adding 10 mL of PBS and incubating the mixture at 42 °C for 15 minutes. The resulting solution, containing the released bacteria, was combined with the BacTiter-Glo™ Microbial Cell Viability Assay kit (Promega #G8230) in a 1 : 1 ratio. Luminescence was measured using a Synergy Neo HTS Plate Reader. Concurrently, a control group sample was run in parallel, following an identical procedure, except without electric stimulation. The raw luminescence data obtained was normalized by the sampled mass, and the differences between the control and treated groups were calculated to determine the normalized viability. Identical protocol was used for disinfection of living hydrogel containing S. capitis, S. saprophyticus, or E. coli DH5a.

[0171] For demonstrating thoroughness of disinfection, living hydrogel containing S. epidermidis was disinfected at 3.5V for 30 min. The disinfected and untreated control samples were drop casted on separate glass bottom dishes and left at room temperature. At 0 hours and 96 hours, the samples in the glass bottom dishes were treated with SYTO9 / PI and imaged on Leica Stellaris8 Falcon WLL confocal microscope with a 63x objective lens. Percentage viability in stained area was quantified using ImageJ.

[0172] For disinfection of bacteria in liquid culture, overnight-cultured S. epidermidis was diluted in a 1 : 10 ratio in TSB medium. 400 pl of the diluted bacterial solution was drop casted the disinfection electrode contained by a PDMS mold and the electrical potential was applied for the desired duration. The resulting suspension was mixed with BacTiter-Glo™ Microbial Cell Viability Assay kit (Promega #G8230) in 1 : 1 ratio and the viability were quantified identical to the disinfection of living hydrogel.

[0173] In some embodiments, a bacterial motility test was completed. To prepare the solution phase sample, SYTO9-stained S. epidermidis was resuspended in fresh TSB medium (OD600=1.0). For the gel phase sample, SYTO9-stained S. epidermidis was enclosed within a starch-gelatin hydrogel. A volume of 10 pL from either the liquid suspension or the starch- gelatin hydrogel was then added to a 50 mm glass-bottom dish and covered with a glass coverslip. To facilitate imaging, the glass-bottom dish was placed on an INUB-ONICS TOKAI HIT Standard Heating Stage Top Incubator (UNIV-D56) set to a temperature of 25 °C. Using a Nikon Ti2 microscope with 488 nm excitation, a video of S. epidermidis was recorded. Subsequently, the video was analyzed using the TrackMate plugin in ImageJ. The average speed of individual cells was calculated by dividing the total displacement by the tracking time.

[0174] In some embodiments, quantification & characterization of released components were completed. For quantification of released bacteria, 10 mL of PBS was added to the starch-gelatin hydrogel contained in a glass vial. During incubation at room temperature, aliquots of PBS were collected at 0, 1, 3, 5, and 6 hours. After 6 hours, the vials were heated to 42 °C for 10 minutes to completely release bacteria into the PBS solution. The samples were mixed with the BacTiter-Glo™ Microbial Cell Viability Assay kit (Promega, G8230) in a 1 : 1 ratio, and luminescence was measured using a Synergy Neo HTS Plate Reader. The percentage of released bacteria was quantified by comparing the luminescence of the PBS aliquots with that of the totally released fractions.

[0175] For the quantification of released bacterial debris and fragments, the living hydrogel was synthesized as described earlier, except that Tris-buffered LB was used instead of TSB. Five milliliters of Tris-buffered LB were added on top of the starch-gelatin hydrogel, and aliquots were collected at 0 hour, 24 hours, and 48 hours at room temperature. Aliquots were centrifuged for 5 min at 5000 rpm and filtered with a 0.22 pm syringe filter to remove impurities. The solution was plated on tryptic soy broth agar to confirm the absence of viable bacteria. The resulting solution containing released bacterial fragments was stained with 5 pM FM1-43 (Invitrogen, T3163). The fluorescence was measured with a Synergy Neo HTS Plate Reader.

[0176] In some embodiments, visualizing lipoteichoic acid (LTA) in released debris was performed. To visualize lipoteichoic acid (LTA), the solution containing the released bacterial debris was drop-cast onto a poly-L-lysine-coated glass bottom dish and left to attach overnight at room temperature. After attachment, the glass bottom dish was washed three times with PBS, and the attached cell fragments were fixed with 4% (v / v) formaldehyde for 15 minutes. Following fixation, any unreacted aldehyde groups were neutralized with 0.2% NaBH4, followed by additional washing with PBS. The LTA antibody mAB 55 (#HM2048, Hycult Biotech) was diluted 1 : 100 in a blocking buffer (3% BSA in PBS) and applied to the glass bottom dish. After incubating for 1 hour at room temperature, the buffer was removed, and the dish was washed three times with PBS. The samples were then stained with Goat anti-Mouse IgG (H+L) Secondary Antibody - Alexa Fluor™ 488 (Invitrogen, A-l 1001) at a 1 : 100 dilution for 1 hour at room temperature.

[0177] For confocal microscopy imaging, the washed samples were submerged in PBS and imaged using a Stellaris8 Falcon WLL confocal microscope with a lOOx objective lens. A negative control sample, subjected to the same staining procedure but with PBS replacing the bacterial debris solution, showed no signal under identical imaging conditions.

[0178] For dSTORM imaging, the washed samples were initially submerged in STORM buffer, comprising 100 mM cysteamine, 5% glucose (w / v), 0.5 mg / mL glucose oxidase, and 38 pg / mL catalase in PBS. Imaging was conducted using an ONI Nanoimager with 140 mw laser power (488 nm). Localization filters from the Nanoimager software were applied to visualize the reconstructed images.

[0179] In some embodiments, electrical analysis was performed. For electrical characterization of starch-gelatin hydrogel, two Pt wire electrodes (Sigma- Aldrich,BASMW1032) were inserted into starch-gelatin hydrogel contained in a glass vial. Potentiostatic electrochemical impedance spectroscopy (PEIS) and cyclic voltammetry (CV) measurements were conducted using the electrochemical workstation (Biologic SP-200). The impedance measurement spanned a frequency range of 100 kHz to 1 Hz, utilizing a sinusoidal amplitude of 20 mV. Cyclic voltammetry was performed at the scan rate of 100 mV / s.

[0180] In some embodiments, mechanical analysis was performed. A rotational ARES rheometer (TA Instruments) equipped with parallel plates was employed to evaluate the viscoelastic properties of the living hydrogel. To preserve the hydration of the hydrogel, the samples were surrounded with water throughout the experiments. Prior to each measurement, a slight contact force was applied to ensure proper contact between the plates and samples. The samples were allowed to soak for 100 seconds, enabling relaxation and rebalancing within the surrounding environment. The shear modulus was determined by subjecting the samples to an oscillatory shear strain of 1% at a frequency of 1 Hz, unless stated otherwise. To explore the effects of humidity and temperature on the mechanical properties of living hydrogels, a Discovery HR-30 shear rheometer (TA Instruments) equipped with a relative humidity accessory was used, following the same procedure. The adhesion strength was tested using the standard tensile test (ASTM F2258) at the Zwick-Roell ZwickiLine Z0.5. All tests were conducted at a constant tensile speed of 50 mm / min.

[0181] In some embodiments, Fourier-Transform Infrared Spectroscopy (FTIR) was completed. To investigate the molecular interaction between starch and gelatin macromolecules, the different hydrogel samples with D2O (Sigma Aldrich) were measured by the Shimadzu IRTracer-100 Fourier transform infrared spectrophotometer.

[0182] In some embodiments fabrication of the flexible printed circuit board was completed. Custom-designed flexible printed circuit boards were manufactured by commercial vendors, such as PCBWay, in compliance with the ISO 9001 certificate. The electronic components integrated into the circuit boards included passive elements like capacitors, resistors, and diodes. Additionally, the boards had a temperature and humidity sensor (Sensirion, model no. SHT40-AD1F-R2 or SHT45-AD1F-R2), an ISO 15693 sensor transponder with a programmable low-power microcontroller (Texas Instruments, model no. RF430FRL152H), a crystal oscillator (Epson Timing, model no. SG-3030LC 32.7680KB6:PURE SN), and two operational amplifiers (STMicroelectronics, model no. TSV620AILT). All circuit components were soldered using lead-free no-clean solder (ChipQuik Inc., model no. Sn96.5Ag3Cu0.5 (96.5 / 3 / 0.5), melting point range of 217-220 °C)) through hot-air blowing. To optimize bacterial electrical modulation efficiency, two stimulation electrodes were patterned with 100 nm Au metal layers for bacterial disinfection electrode geometry or bacteria stimulation electrode geometry using an electron-beam evaporator (EvoVac, Angstrom Engineering). To prevent chronic electrochemical corrosion of the electrodes, silver / silver chloride (Ag / AgCl) conducting paste (Nagase ChemteX, model no. CI-4040) was applied and printed onto electrode area, followed by curing on a hot plate at 70 °C for 30 minutes. The original electrode area was subsequently encapsulated with an elastomeric polyurethane coating (Smooth-On, model no. Clear Flex 50) and cured at 70 °C for 30 minutes. The living hydrogel interface was positioned between the two disinfection electrodes, while the non-living hydrogel interface was placed separately on the two sensing electrodes. For the sterilization procedure, once users have finished using the ABLE device, or in any emergency, they can activate the disinfection electrode by closing its trigger. A complete disinfection typically requires 30 minutes. Extending this waiting period slightly is recommended for optimal results. After the disinfection process, the user can dispose of the used living bioelectronics.

[0183] In some embodiments, fabrication of mesh electronics and hydrogel hybrid was completed. The initial cleaning of a P-type wet oxide silicon wafer (#HS39626-WO, NOVA Electronic Materials) was performed, which involves immersion in acetone and isopropyl alcohol (IP A) for 3 minutes each within an ultrasonic bath. Following this, hexamethyldisilazane (HDMS) is applied to the wafer as a treatment. A solution of poly (pyromellitic dianhydride-co-4,4'-oxy dianiline) (Sigma Aldrich, 575801-1L) was then added to the treated wafer using a spin-coating method at a speed of 1500 rpm. To cure the applied solution, the wafer was then heated in a resist oven at a temperature of 300 degrees Celsius for a span of 3 hours, after which it was allowed to cool down naturally to room temperature. The end result is a polyimide (PI) film of approximately 5 micrometers in thickness. The PI- coated wafer then undergoes another round of spin-coating, this time with AZ nlof 2020, followed by an exposure process to develop patterns. The wafer was then subjected to an evaporation process with 5 nm Titanium and 200 nm Gold, which was followed by a lift-off in AZ NMP to get rid of the photoresist. Subsequently, the wafer was patterned with AZ 40XT-1 ID, which serves as a protective mask against etching. The patterned PI layer was achieved via Reactive Ion Etching (RIE) in a Plasma- Therm Inductively Coupled Plasma (ICP) Fluoride Etch. Post-etching, the photoresist was removed by soaking in N-Methyl-2-pyrrolidone (NMP) within an 80-degree Celsius bath for 10 minutes. The encapsulation layer, composed of SU-8 3005 (Mi croChem Corp), was patterned to cover the metal interconnects while leaving the sensing pads and bottom pads exposed to interface with cardiac tissues. Finally, to retrieve the mesh electrode, it can be detached using a water-soluble transfer tape. Alternatively, manual peeling is an option, provided it does not cause any damage to the devices. Hydrogel hybridization was made by attaching mesh electronics to the hydrogel- coated PDMS. The hydrogel layer was formed by spin-coating hydrogel precursor solution with different revolutions per minute (rpm). After cooling down and trimming, the hydrogelhybrid devices were carefully peeled off from the PDMS substrate.

[0184] In some embodiments, fabrication of conventional bioelectronics was completed. The fabrication of microneedle bioelectronics involved assembling disposable hypodermic needles (22 G x 1 ’A", Air-Tite Products) in the same pattern as the flexible mesh electrodes. This process began with the patterning of acrylic plates using a laser cutter (VLS 4.60), creating an array of holes tailored for needle insertion. After inserting the needles into these holes, they were secured in place using epoxy glue (MG Chemicals). Subsequently, the needles were soldered to a 36-pin wire adapter (Intan Technologies) to complete the assembly.

[0185] The fabrication of planar multichannel electrode arrays adopts a similar procedure to that of the flexible mesh designs, allowing for patterning on silicon wafers, glasses, and polyimides. This procedure is similar to that of flexible mesh fabrication, except it does not involve polyimide substrate curing, reactive ion etching, or peel-off.

[0186] In some embodiments, the device can be used with animals. During experimentation, the care of animals, including mice and rats, adhered to federal, state, and local guidelines. All animal experiments were conducted in compliance with the regulations and were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Chicago. The animals including C57BL / 6J mice (J AX #000664), B6.129- Tlr2tmlKir / J (TLR2 KO) mice (JAX #004650), B6(Cg)-Tlr4tml.2Karp / J (TLR4 KO) mice (J AX #029015), and Sprague Dawley rats were either obtained through mating or purchased from commercial vendors such as Jackson Lab (JAX) and Charles River. The animal room was maintained in an environment with humidity of 40-60 % and the temperature of 18-23 °C under a 12-h light / 12-h dark cycle. The animals were allowed free access to food and water. All animal procedures were approved by the IACUC in protocols # 72378 (rat) and 72621 (mice).

[0187] In some embodiments, an open-field movement test was performed. The open-field test was conducted to evaluate the moving behavior of mice with and without the living bioelectronics in a 30 * 18 cm2open cage. Each group consisted of four mice, which were given the freedom to explore the area for a duration of 30 minutes. Throughout the test, the mice's moving activities were recorded using an overhead camera. The recorded videos were subsequently analyzed using a deep learning architecture (DeepLabCut, v2.3.5) to measure the total distances traveled by each group.

[0188] In some embodiments, a rat in vivo electromyography (EMG) recording was completed. An adult rat ranging between 12 and 24 weeks and inclusive of both genders, was deeply anesthetized using 2-4% isoflurane. Fur from the animal's hindquarters was removed using surgical clippers and depilatory cream. A midline incision was made in the skin, following which the fascial plane between the gluteus maximus and the anterior head of the biceps femoris was opened, thereby exposing the sciatic nerve. The nerve was gently drawn- out using sutures, and a flexible Ti-Au / Polyimide electrode (thickness 10 nm / 200 nm / 5 pm) was coiled around the nerve bundle for the purpose of electrical stimulation. Then the hydrogel-coated mesh electrode was adhered to the rat's leg to facilitate multi-channel EMG recordings in response to sciatic nerve stimulation. Electrical stimulation was performed using a 2 ms biphasic electrical current ranging from 100 to 800 A, which elicited muscle movement. For the recording process, an Intantech RHD USB interface board and an RHD 16-channel bipolar-input recording headstage were employed. Signals were recorded at a rate of 20 kS s-1 within the 100-1000 Hz bandwidth. All signal-to-noise ratio (SNR) in this paper is defined as:

[0189] In some embodiments, a psoriasis model was established. Eight-week-old male C57BL / 6J mice (J AX #000664), B6.129-Tlr2tmlKir / J (TLR2 KO) mice (J AX #004650), and B6(Cg)-Tlr4tml.2Karp / J (TLR4 KO) mice (J AX #029015) were housed in groups of five mice per cage and acclimatized for 3 days before inclusion in the investigation. To induce psoriasiform dermatitis, the mice were shaved and topically applied with 5% IMQ cream (Perrigo Pharmaceutical) for 7 consecutive days unless otherwise noted. The IMQ induced mice were either treated with ABLE system, methotrexate, or the hydrogels containing lipoteichoic acid (LTA) or peptidoglycan (PGN) extracted from S. epidermidis, LTA inhibitor LtaS-IN-1 (Med Chem Express #HY-135813) treated S. epidermidis or Proteinase K(Sigma #3115836001) for 4 days. For the therapeutic experiments, living bioelectronics with or without living components were topically applied to mouse dorsal skin for skin sensing and therapy. Methotrexate (MTX) was orally administered daily at a dose of 1 mg / mL in a 0.5% carboxymethyl cellulose (CMC) solution. Proteinase K was used at a concentration of 1 mg / mL. The quantity of lipoteichoic acid (LTA) and peptidoglycan (PGN) used is equivalent to their respective purification yields from the bacteria in living hydrogel systems. LtaS-IN-1 was co-cultured with bacteria at a concentration of 10 pmol / L overnight. Tegaderm (3 M™) or band-aid were then used to fix the position of bioelectronics. Dressings were changed every day. During the experiment, changes in skin psoriasiform information including erythema, induration, and desquamation were recorded daily. The mice were euthanized on the last day of the experiment and their skin and spleen were harvested for histological evaluation and other assays, such as cytokine profiling and flow cytometry analysis. The general psoriasis symptoms, including the redness, scaling, and thickness (induction) of murine skin, were evaluated to score the “Psoriasis severity index (PSI)”, which assesses the severity of the induced erythema, desquamation, and induration of the psoriasis. Each parameter was measured on a scale of 0-4 (from none to the maximum damage). The sum of these four values was the value of the PSI index, with the maximum value of 12.

[0190] In some embodiments, lipid teichoic acid (LTA) extraction was performed. In a typical experiment, the S. epidermidis bacterial pellets from a 10 mL overnight culture were resuspended in 50 mL of 0.1 M sodium citrate buffer (pH 4.7) and sonicated for 30 minutes in an ice-cold bath. Then, the suspension was mixed with 50 mL of n-butyl alcohol and stirred for 2 hours using a magnetic stirrer. After phase separation by centrifugation, the LTA-containing aqueous phase was collected, dialyzed against pure water overnight, and then lyophilized. The crude extract was purified using octyl agarose gel CL-4B, which was pre-equilibrated with 15% n-propanol in 0.1 M ammonium acetate solution (pH 4.7), and then eluted with a linear gradient of 15-60% n-propanol in 0.1 M ammonium acetate buffer. The eluent containing LTA was dialyzed overnight and aliquoted into 10 tubes for further use.

[0191] In some embodiments, peptidoglycan (PGN) extraction was performed. In a typical experiment, the S. epidermidis bacterial pellets from a 10 mL overnight culture were resuspended in 5 mL of 1 M sodium chloride and boiled at 100°C for 20 minutes. After centrifugation at 10,000 rpm for 5 minutes, the pellets were washed with ddH2O and resuspended in 5 mL of ddH2O for incubation in a sonicated water bath for 30 minutes. Then,2.5 mL of digestion solution I (15 pg / mL DNase and 60 pg / mL RNase in 0.1 M TRIS / HC1, pH 6.8) was added, followed by incubation at 37°C on a shaker for 60 minutes. Next, 500 pl of digestion solution II (50 pg / mL trypsin in ddH2O) was added, with incubation for an additional 60 minutes under the same conditions. The enzymes were inactivated by heating at 100°C for 3 minutes, then the pellets were collected (5 min at 10,000 rpm). After washing with 2.5 mL of ddH2O, the pellets were resuspended in 2.5 mL of 1 M HC1 and incubated for 4 hours at 37°C on a shaker. The samples were centrifuged and washed with ddH2O until the pH reached 5-6. Subsequently, the pellet was resuspended in 1.25 mL of digestion buffer (12.5 mM sodium dihydrogen phosphate, pH 5.5) to an OD578 of 3.0, and 1 / 10 volume of mutanolysin solution (5,000 U / mL of mutanolysin in ddH2O) was added. The mixture was incubated for 16 hours at 37°C with shaking at 150 rpm. Mutanolysin was inactivated by boiling for 3 minutes at 100°C, followed by centrifugation, and the supernatant containing peptidoglycan was aliquoted into 10 tubes for further use.

[0192] In some embodiments, cells isolation and cytokine analysis were performed. Psoriatic mouse skin was harvested after euthanasia and incubated at room temperature in a Dispase solution (5 mg / mL in DMEM / F12 medium) for 2 hours. The epidermis was then physically separated from the dermis and cultured on polycarbonate cell culture inserts (pore size 0.4 pm) with complete DMEM medium (4.5 g / L glucose, 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 units / mL penicillin G, 100 pg / mL streptomycin). Equally distribute 100 pL of the purified LTA or peptidoglycan solution on top of the isolated psoriatic epidermis and collect 0.5 mL culture medium in 24 hours for mouse cytokine profiling. The separated dermis was used for dendritic cell extraction. Briefly, the dermal tissues were digested in IX triple enzyme digestion solution (0.1 g collagenase type IV (Sigma Cat. C5318), 2000 Units DNase Type IV (Sigma Cat. D5025), 10 mg Hyaluronidase Type V (Sigma Cat. H6254) in 100 mL HBSS without calcium or magnesium) at 37°C for 30 minutes to 1 hour. The digested tissues were filtered through a 70 pm nylon mesh, the dissociated cells were spun down and then resuspended, and the resuspended cells were seeded in 5 mL of density gradient medium Lymphoprep (StemCell Technologies Cat.07801) to enrich mononuclear cell layers. The enriched fractions after being washed were used to extract plasmacytoid dendritic cell population with plasmacytoid dendritic cell enrichment kit (Miltenyi Biotec #130-107-093). The extracted cells were seeded (IxlO5-6cells per well) into 24-well plates with complete RPMI 1640 medium for culture. Fiftymicroliters of the purified LTA or peptidoglycan solution were added to the medium and 0.5 mL culture medium were collected after 24 hours for mouse cytokine profiling.

[0193] In some embodiments, histology assessments, immunohistochemistry, and immunofluorescence were performed. For tissue histological analysis, Hematoxylin and eosin (H&E), and CD4, CD8, ki-67, CD31, CK14, F4 / 80 histological tissue sections were prepared and stained by the Human Tissue Resource Center at the University of Chicago. Anti-mouse CD4 (Sysy-HistoSure, Cat#HS-360-l 17, Clone: 78H9D2, rat IgG2b, kappa light chain, 1 :200 dilution), anti-mouse CD8 (eBioscince Affymetrix, Cat#14-0808-82, rat monoclonal antibody, Clone: 4SM15, rat IgG2a, kappa light chain, 1 :800 dilution), anti-CD31 (abeam, Cat#ab28364, lot#GR3247742-25, Rabbit antibody, 1 :450 dilution) for IF staining, anti-Ki67 (ThermoScientific, Cat#RM-9106-s, Clone: SP6, Rabbit monoclonal antibody, 1 :400 dilution), and anti-mouse F4 / 80 antibody (AbD Serotec, Cat#MCA497GA, 1 :200 dilution) were used for IHC staining. Anti-F4 / 80 (Biorad, #MCA497, rat IgG2b, 1 :400 diliution) / Cytokeratin 14 (ProteinTech Group, #10143-l-AP, rabbit polyclonal antibody, 1 :200 dilution) were used for dual IHC staining. All the tissue histological results were analyzed by the CaseViewer software (3DHISTECH) and QuPath (0.4.0). The histological damage, including hyperplasia, parakeratosis, neutrophil infiltration, loss of granular layer, dilated capillaries, dermal inflammation on a scale of 0-4 (from none to the maximum damage), was scored based on the H&E-stained skin tissue sections. The sum of all above values was the value of the histological damage score. The thickness of the epidermal layer and the counting of IHC positive cells were analyzed through Imaged.

[0194] In some embodiments, murine in-vivo 6- lead electrocardiogram (ECG) recording was performed. The procedure was carried out on an adult mouse, including both healthy individuals and those exhibiting psoriasis on the chest. The subjects were deeply anesthetized using 2-4% isoflurane. A 6-lead living hydrogel-hybrid mesh electrode was adhered to a specific area covering the mouse's chest, strategically aligned to conform to the standard positions for frontal plane ECG leads (I, II, III, aVR, aVL, and aVF).

[0195] The recording procedure employed an Intantech RHD USB interface board and an RHD 16-channel bipolar-input recording headstage. Signals were recorded at a rate of 20 kS s-1, within the bandwidth range of 0.6 - 100 Hz.

[0196] In some embodiments, cytokine analysis was performed. The Mouse Cytokine Array, Panel A (R&D Systems #ARY006) utilizes capture antibodies spotted onto anitrocellulose membrane to allow high-throughput multi-analyte profiling of 40 cytokines, chemokines, and more in a single sample. For cytokine assays, fresh skin psoriatic skin tissues were harvested and homogenized in cold RIPA buffer. Subsequently, 200 pg of lysate was used for each array by following the manufacturers’ instructions. Array images were collected and analyzed using the Bio-rad Gel Doc XR+ Imaging System.

[0197] In some embodiments, flow cytometry was performed. Psoriatic skin tissues were harvested after euthanasia and trimmed into small pieces of the similar weight for digestion in IX triple enzyme digestion solution (0.1 g collagenase type IV (Sigma Cat. C5318), 2000 Units DNase Type IV (Sigma Cat. D5025), 10 mg Hyaluronidase Type V (Sigma Cat. H6254) in 100 mL HBSS without calcium or magnesium) at 37°C for 30 minutes to 1 hour. The mixture was filtered through a 70 pm nylon mesh, the dissociated cells were spun down, and the resuspended cells were seeded in a density gradient medium, Lymphoprep (StemCell Technologies Cat. 07801), to enrich mononuclear cell layers. The enriched fractions, after being washed, were co-stained with Mito View 405 (Biotium #70070, 100 nM) for living cell labeling and the antibody anti-mouse CD4-PE-vio615 (Miltenyi Biotec Cat. 130-118-455, 1 :50 dilution). The stained samples were analyzed on the BD LSR Fortessa 4-15 benchtop analyzer at the UChicago flow cytometry core for immune cell population analysis. The output data were generated using NovoExpress software at the UChicago flow cytometry core.

[0198] In some embodiments, microbiome analysis was completed. Three groups of mice (C57BL / 6) were prepared for skin microbiome analysis: 1) The first group (Healthy) was healthy mice; 2) The second group (Control) was the mice with IMQ-induced psoriasis; 3) The third group was the mice with IMQ-induced psoriasis and treated with living bioelectronics for 4 days. Skin tissue samples from three different groups were collected and analyzed by the ZymoBIOMICS® Targeted 16S Sequencing Service (Zymo Research, Irvine, CA). DADA2 was used to infer unique amplicon sequence variants from raw reads (38). Chimeric sequences and potential sequencing errors were removed using the DADA2 pipeline. We used Uclust from Qiime version 1.9.1, a 16S database designed and curated as a reference, for taxonomy assignment. Linear discriminant analysis Effect Size (LEfSe) was used to identify taxonomies with significant abundance among different groups (39). PCoA plots were performed using internal scripts. Quantitative real-time PCR was used to quantify the absolute abundance and the results were displayed as the number of gene copies.

[0199] In some embodiments, quantitative RT-PCR was performed. SYBR Green real-time PCR was used to detect if the following bacterial strains existed in the post-treatment hydrogel: Staphylococcus epidermidis, Staphylococcus aureus, Delftia acidovorans, Microbacterium aerolatum, Rhodococcus erythropolis . These strains were chosen because they were detected in the 16S rRNA sequencing results of the psoriatic skin samples in this study. The total RNA molecules in the hydrogel (pre- and post-treatment) were extracted using the Qiagen RNeasy Mini Kit (Cat. No. 74104). Quantitative RT-PCR was conducted using Takara’s One-Step TB Green® PrimeScript™ RT-PCR Kit II (Perfect Real Time) (Cat. No. RR086A). Each reaction (20 pL) contained 200 ng of total RNA, 0.4 pM of primers, and 10 pL of 2x Master mix. Multiplex real-time PCR was performed on an ABI 7500 real-time PCR system (Applied Biosystems). A melting curve was added at the end of the PCR cycle to evaluate the specificity of the PCR amplification. The nucleotide sequences of 16S rRNAs of Staphylococcus epidermidis (Se), Staphylococcus aureus (Sa), Delftia acidovorans (Da), Microbacterium aerolatum (Ma), Rhodococcus erythropolis (Re), were retrieved from the previous 16S rRNA sequencing results and used in the design of primer sequences, which were evaluated for specificity using the standard nucleotide comparison tool: BLASTN.

[0200] Primer sequences include: Se-u: TGGCACGGCTGGTATTAGAG (SEQ ID NO: 1), Se-d: GACAGGATGCGCGATACTTG(SEQ ID NO: 2), Sa-u: CAAGCACAAGGCAGTGGTAT (SEQ ID NO: 3), Sa-d: GTGGCGTTGCAATCTCCTTA (SEQ ID NO: 4), Da-u: AAAGCCTGATCCAGCAATGC (SEQ ID NO: 5), Da-d: GATTAACGCTCGCACCCTAC (SEQ ID NO: 6), Re-u: CGTTTGTGAAAACCAGCAGC (SEQ ID NO: 7), Re-d: CTTTCGTTCCTCAGCGTCAG (SEQ ID NO: 8), Ma-u: TAGCAGGGAAGAAGCGAGAG(SEQ ID NO: 9), Ma-d: GTTGAGCCTCGGGATTTCAC (SEQ ID NO: 10).

[0201] In some embodiments, RNA sequencing was performed. Three groups of mice (C57BL / 6) were prepared for transcriptome analysis: 1) The first group (Control / IMQ) was the mice with IMQ-induced psoriasis; 2) The second group was the mice with IMQ-induced psoriasis and treated with non-living ABLE (Vehicle); 3) The third group was the mice with IMQ-induced psoriasis and treated with ABLE for 4 days (ABLE). RNA extraction, library preparations and sequencing reactions were conducted at Azenta Life Sciences. Briefly, total RNA was extracted and treated with TURBO DNase (Thermo Fisher Scientific, Waltham, MA, USA) to remove DNA contaminants. rRNA depletion sequencing library was prepared by using QIAGEN FastSelect rRNA HMR Kit (Qiagen, Hilden, Germany). RNA sequencinglibrary preparation used NEB Next Ultra II RNA Library Preparation Kit for Illumina by following the manufacturer’s recommendations (NEB, Ipswich, MA, USA). The sequencing libraries were multiplexed and clustered on the Illumina NovaSeq instrument according to manufacturer’s instructions. The samples were sequenced using a 2x150 Pair-End (PE) configuration. Raw sequence data (.bcl files) generated from Illumina NovaSeq was converted into fastq files and de-multiplexed using Illumina bcl2fastq program version 2.20. One mismatch was allowed for index sequence identification.

[0202] After demultiplexing, sequence data were checked for overall quality and yield. Then, raw sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36. The reads were then mapped to the Mus musculus reference genome available on ENSEMBL using the STAR aligner v.2.5.2b. BAM files were generated as a result of this step. Unique gene hit counts were calculated by using feature Counts from the Subread package v.1.5.2. Only unique reads that fell within exon regions were counted.

[0203] After extraction of gene hit counts, the gene hit counts table was used for downstream differential expression analysis. Using DESeq2, a comparison of gene expression between the groups of samples was performed. The Wald test was used to generate P values and Log2 fold changes. Genes with adjusted P values < 0.05 and absolute log2 fold changes >1 were called as differentially expressed genes for each comparison. Gene ontology analysis was performed on the statistically significant set of genes by implementing the software GeneSCF. The goa Mus musculus GO list was used to cluster the set of genes based on their biological process and determine their statistical significance. A PCA analysis was performed using the "plot PCA" function within the DESeq2 R package. The plot shows the samples in a 2D plane spanned by their first two principal components. The top genes, selected by highest row variance, were used to generate the plot.

[0204] In some embodiments, statistical analysis was completed. The image data was processed and analyzed using Imaged. GraphPad Prism 9.4.1 was employed for all statistical analyses. Unless stated otherwise, the error bars represent the standard deviation. For biological data analysis, multiple t-tests or one-way ANOVA were performed. A significance threshold of P < 0.05 was used to determine statistical significance. In transcriptome analysis, the P value is the Wald test p-value and Padj is the Benjamini -Hochberg adjusted p-value. In the figures, the following symbols were used to indicate significance levels: "ns" for non-significant (P > 0.05), for P < 0.05, "**" for P < 0.01, "***" for P < 0.001, and "****" forP < 0.0001.References1. Y. W. Jiang, Z. T. Zhang, Y. X. Wang, D. L. Li, C. T. Coen, E. Hwaun, G. Chen, H. C. Wu, D. L. Zhong, S. M. Niu, W. C. Wang, A. Saberi, J. C. Lai, Y. L. Wu, Y. Wang, A. A. Trotsyuk, K. Y. Loh, C. C. Shih, W. H. Xu, K. Liang, K. L. Zhang, Y. H. Bai, G. Gurusankar, W. P. Hu, W. Jia, Z. Cheng, R. H. Dauskardt, G. C. Gurtner, J. B. H. Tok, K. Deisseroth, I. Soltesz, Z. N. Bao, Topological supramolecular network enabled high-conductivity, stretchable organic bioelectronics. Science 375, 1411-1417 (2022).2. A. J. Boys, A. Camicer-Lombarte, A. Gueemes-Gonzalez, D. C. vanNiekerk, S. Hilton, D. G. Barone, C. M. Proctor, R. M. Owens, G. G. Malliaras, 3D Bioelectronics with a Remodellable Matrix for Long-Term Tissue Integration and Recording. Adv Mater 35, (2023).3. H. J. Hu, H. Huang, M. H. Li, X. X. Gao, L. Yin, R. X. Qi, R. S. Wu, X. J. Chen, Y. X. Ma, K. R. Shi, C. H. Li, T. M. Maus, B. Huang, C. Lu, M. Y. Lin, S. Zhou, Z. Y. Lou, Y. Gu, Y. M. Chen, Y. S. Lei, X. Y. Wang, R. T. Wang, W. T. Yue, X. Y. Yang, Y. Z. Bian, J. Mu, G. Park, S. Xiang, S. Q. Cai, P. W. Corey, J. S. Wang, S. Xu, A wearable cardiac ultrasound imager. Nature 613, (2023).4. X. Y. Liu, M. E. Inda, Y. Lai, T. K. Lu, X. H. Zhao, Engineered Living Hydrogels. Adv Mater 34, (2022).5. M. E. Inda-Webb, M. Jimenez, Q. Liu, N. V. Phan, J. Ahn, C. Steiger, A. Wentworth, A. Riaz, T. Zirtiloglu, K. Wong, K. Ishida, N. Fabian, J. Jenkins, J. Kuosmanen, W. Madani, R. McNally, Y. Lai, A. Hayward, M. Mimee, P. Nadeau, A. P. Chandrakasan, G. Traverse, R. T. Yazicigil, T. K. Lu, Sub-1.4 cm(3) capsule for detecting labile inflammatory biomarkers in situ. Nature 620, 386-392 (2023).6. X. Y. Jiang, T. Feng, B. L. An, S. S. Ren, J. F. Meng, K. Li, S. Y. Liu, H. Y. Wu, H. Zhang, C. Zhong, A Bi-Layer Hydrogel Cardiac Patch Made of Recombinant Functional Proteins. Adv Mater 34, (2022).7. K. B. Ramadi, J. C. McRae, G. Seising, A. Su, R. Fernandes, M. Hickling, B. Rios, S. Babaee, S. Min, D. Gwynne, N. Z. Jia, A. Aragon, K. Ishida, J. Kuosmanen, J. Jenkins, A. Hayward, K. Kamrin, G. Traverse, Bioinspired, ingestible electroceutical capsules for hungerregulating hormone modulation. Sci Robot 8, eade9676 (2023).8. K. Nan, V. R. Feig, B. Ying, J. G. Howarth, Z. Kang, Y. Yang, G. Traverse, Mucosainterfacing electronics. Nat Rev Mater 7, 908-925 (2022).9. M. Q. Wang, Y. R. Yang, J. H. Min, Y. Song, J. B. Tu, D. Mukasa, C. Ye, C. H. Xu, N. Heflin, J. S. McCune, T. K. Hsiai, Z. P. Li, W. Gao, A wearable electrochemical biosensor for the monitoring of metabolites and nutrients. Nat Biomed Eng 6, 1225-1235 (2022).10. W. Cheng, X. Wang, Z. Xiong, J. Liu, Z. Liu, Y. Jin, H. Yao, T. S. Wong, J. S. Ho, B. C. K. Tee, Frictionless multiphasic interface for near-ideal aero-elastic pressure sensing. Nat Mater, (2023).11. Y. Jiang, S. B. Ji, J. Sun, J. P. Huang, Y. H. Li, G. J. Zou, T. Salim, C. X. Wang, W. L. Li, H. R. Jin, J. Xu, S. H. Wang, T. Lei, X. Z. Yan, W. Y. X. Peh, S. C. Yen, Z. H. Liu, M. Yu, H. Zhao, Z. C. Lu, G. L. Li, H. J. Gao, Z. Y. Liu, Z. A. Bao, X. D. Chen, A universal interface for plug-and-play assembly of stretchable devices. Nature 614, 456-462 (2023).12. Y.-S. Guan, F. Ershad, Z. Rao, Z. Ke, E. C. da Costa, Q. Xiang, Y. Lu, X. Wang, J. Mei, P. Vanderslice, C. Hochman-Mendez, C. Yu, Elastic electronics based on micromesh- structured rubbery semiconductor films. Nature Electronics 5, 881-892 (2022).13. E. M. Song, Z. Q. Xie, W. B. Bai, H. W. Luan, B. W. Ji, X. Ning, Y. Xia, J. M. Baek, Y. J. Lee, R. Avila, H. Y. Chen, J. H. Kim, S. Madhvapathy, K. M. Yao, D. F. Li, J. K. Zhou,M. D. Han, S. M. Won, X. Y. Zhang, D. J. Myers, Y. F. Mei, X. Guo, S. Xu, J. K. Chang, X. G. Yu, Y. G. Huang, J. A. Rogers, Miniaturized electromechanical devices for the characterization of the biomechanics of deep tissue. Nat Biomed Eng 5, 759-771 (2021).14. Y. J. Gao, D. T. Nguyen, T. Yeo, S. B. Lim, W. X. Tan, L. E. Madden, L. Jin, J. Y. K.N. Long, F. A. Aloweni, Y. J. A. Liew, M. L. Tan, S. Y. Ang, S. D. O. Maniya, I. Abdelwahab, K. P. Loh, C. H. Chen, D. L. Becker, D. Leavesley, J. S. Ho, C. T. Lim, A flexible multiplexed immunosensor for point-of-care in situ wound monitoring. Sci Adv 7, (2021).15. W. Ouyang, W. Lu, Y. M. Zhang, Y. M. Liu, J. U. Kim, H. X. Shen, Y. Y. Wu, H. W. Luan, K. Kilner, S. P. Lee, Y. S. Lu, Y. Y. Yang, J. Wang, Y. J. Yu, A. J. Wegener, J. A. Moreno, Z. Q. Xie, Y. X. Wu, S. M. Won, K. Kwon, C. S. Wu, W. B. Bai, H. X. Guo, T. L. Liu, H. D. Bai, G. Monti, J. Zhu, S. R. Madhvapathy, J. Trueb, M. Stanslaski, E. M. Higbee- Dempsey, I. Stepien, N. Ghoreishi -Haack, C. R. Haney, T. I. Kim, Y. G. Huang, R. Ghaffari, A. R. Banks, T. C. Jhou, C. H. Good, J. A. Rogers, A wireless and battery-less implant for multimodal closed-loop neuromodulation in small animals. Nat Biomed Eng, (2023).16. J. Park, K. Jin, A. Sahasrabudhe, P. H. Chiang, J. H. Maalouf, F. Koehler, D. Rosenfeld, S. Rao, T. Tanaka, T. Khudiyev, Z. J. Schiffer, Y. Fink, O. Yizhar, K. Manthiram, P. Anikeeva,In situ electrochemical generation of nitric oxide for neuronal modulation. Nat Nanotechnol 15, 690-697 (2020).17. C. H. Wang, X. Y. Chen, L. Wang, M. Makihata, H. C. Liu, T. Zhou, X. H. Zhao, Bioadhesive ultrasound for long-term continuous imaging of diverse organs. Science 377, 517- 523 (2022).18. T. Zhou, H. Yuk, F. Q. Hu, J. J. Wu, F. J. Tian, H. Roh, Z. Q. Shen, G. Y. Gu, J. K. Xu,B. Y. Lu, X. H. Zhao, 3D printable high-performance conducting polymer hydrogel for allhydrogel bioelectronic interfaces. Nat Mater 22, 895-902 (2023).19. Q. S. Yang, T. Wei, R. T. Yin, M. Z. Wu, Y. M. Xu, J. Koo, Y. S. Choi, Z. Q. Xie, S. W. Chen, I. Kandela, S. L. Yao, Y. J. Deng, R. Avila, T. L. Liu, W. B. Bai, Y. Y. Yang, M. D. Han, Q. H. Zhang, C. R. Haney, K. B. Lee, K. Aras, T. Wang, M. H. Seo, H. W. Luan, S. M. Lee, A. Brikha, N. Ghoreishi -Haack, L. Tran, I. Stepien, F. Aird, E. A. Waters, X. G. Yu, A. Banks, G. D. Trachiotis, J. M. Torkelson, Y. G. Huang, Y. Kozorovitskiy, I. R. Efimov, J. A. Rogers, Photocurable bioresorbable adhesives as functional interfaces between flexible bioelectronic devices and soft biological tissues. Nat Mater 20, 1559-1570 (2021).20. J. Deng, H. Yuk, J. J. Wu, C. E. Varela, X. Y. Chen, E. T. Roche, C. F. Guo, X. H. Zhao, Electrical bioadhesive interface for bioelectronics. Nat Mater 20, 229-236 (2021).21. A. E. Rochford, A. Carnicer-Lombarte, M. Kawan, A. M. Y. Jin, S. Hilton, V. F. Curto, A. L. Rutz, T. Moreau, M. R. N. Kotter, G. G. Malliaras, D. G. Barone, Functional neurological restoration of amputated peripheral nerve using biohybrid regenerative bioelectronics. Sci Adv 9, (2023).22. C. Lim, Y. J. Hong, J. Jung, Y. Shin, S. H. Sunwoo, S. Baik, O. K. Park, S. H. Choi, T. Hyeon, J. H. Kim, S. Lee, D. H. Kim, Tissue-like skin-device interface for wearable bioelectronics by using ultrasoft, mass-permeable, and low-impedance hydrogels. Sci Adv 7 , (2021).23. M. Karin, H. Clevers, Reparative inflammation takes charge of tissue regeneration. Nature 529, 307-315 (2016).24. T. C. Tang, B. L. An, Y. Y. Huang, S. Vasikaran, Y. Y. Wang, X. Y. Jiang, T. K. Lu,C. Zhong, Materials design by synthetic biology. Nat Rev Mater 6, 332-350 (2021).25. A. Rodrigo-Navarro, S. Sankaran, M. J. Dalby, A. del Campo, M. Salmeron-Sanchez, Engineered living biomaterials. Nat Rev Mater 6, 1175-1190 (2021).26. M. M. Severn, A. R. Horswill, Staphylococcus epidermidis and its dual lifestyle in skin health and infection. Nat Rev Microbiol 21, 97-111 (2023).27. K. Sauer, P. Stoodley, D. M. Goeres, L. Hall-Stoodley, M. Burmolle, P. S. Stewart, T. Bjarnsholt, The biofilm life cycle: expanding the conceptual model of biofilm formation. Nat Rev Microbiol 20, 608-620 (2022).28. M. Baumgartner, F. Hartmann, M. Drack, D. Preninger, D. Wirthl, R. Gerstmayr, L. Lehner, G. Y. Mao, R. Pruckner, S. Demchyshyn, L. Reiter, M. Strobel, T. Stockinger, D. Schiller, S. Kimeswenger, F. Greibich, G. Buchberger, E. Bradt, S. Hild, S. Bauer, M. Kaltenbrunner, Resilient yet entirely degradable gelatin-based biogels for soft robots and electronics. Nat Mater 19, 1102-1109 (2020).29. J. E. Greb, A. M. Goldminz, J. T. Elder, M. G. Lebwohl, D. Gladman, J. J. Wu, N. N. Mehta, A. Y. Finlay, A. B. Gottlieb, Psoriasis. Nat Rev Dis Primers 2, (2016).30. H. Y. Liang, Y. Z. Yan, J. J. Wu, X. F. Ge, L. Wei, L. X. Liu, Y. M. Chen, Topical nanoparticles interfering with the DNA-LL37 complex to alleviate psoriatic inflammation in mice and monkeys. Sci Adv 6, (2020).31. E. Bracho-Sanchez, F. G. Rocha, S. K. Bedingfield, B. D. Partain, S. L. Macias, M. A. Brusko, J. M. Colazo, M. M. Fettis, S. A. Farhadi, E. Y. Helm, K. Koenders, A. J. Kwiatkowski, A. Restuccia, B. S. Morales, A. Wanchoo, D. Avram, K. D. Allen, C. L. Duvall, S. M. Wallet, G. A. Hudalla, B. G. Keselowsky, Suppression of local inflammation via galectin-anchored indoleamine 2,3 -dioxygenase. Nat Biomed Eng, (2023).32. Y. W. Jiang, A. A. Trotsyuk, S. M. Niu, D. Henn, K. Chen, C. C. Shih, M. R. Larson, A. M. Mermin-Bunnell, S. Mittal, J. C. Lai, A. Saberi, E. Beard, S. Jing, D. L. Zhong, S. R. Steele, K. F. Sun, T. Jain, E. Zhao, C. R. Neimeth, W. G. Viana, J. Tang, D. Sivaraj, J. Padmanabhan, M. Rodrigues, D. P. Perrault, A. Chattopadhyay, Z. N. Maan, M. C. Leeolou, C. A. Bonham, S. H. Kwon, H. C. Kussie, K. S. Fischer, G. Gurusankar, K. Liang, K. L. Zhang,R. Nag, M. P. Snyder, M. Januszyk, G. C. Gurtner, Z. N. Bao, Wireless, closed-loop, smart bandage with integrated sensors and stimulators for advanced wound care and accelerated healing. Nat Biotechnol 41, 652-662 (2023).33. M. Otto, Staphylococcus epidermidis - the 'accidental' pathogen. Nat Rev Microbiol 7 , 555-567 (2009).34. J. L. Linehan, O. J. Harrison, S. J. Han, A. L. Byrd, I. Vujkovic-Cvijin, A. V. Villarino,S. K. Sen, J. Shaik, M. Smelkinson, S. Tamoutounour, N. Collins, N. Bouladoux, A. Dzutsev, S. P. Rosshart, J. H. Arbuckle, C. R. Wang, T. M. Kristie, B. Rehermann, G. Trinchieri, J. M. Brenchley, J. J. O'Shea, Y. Belkaid, Non-classical Immunity Controls Microbiota Impact on Skin Immunity and Tissue Repair. Cell 172, 784-796 (2018).35. H. Terui, K. Yamasaki, M. Wada-Irimada, M. Onodera- Amagai, N. Hatchome, M. Mizuashi, R. Yamashita, T. Kawabe, N. Ishii, T. Abe, Y. Asano, S. Aiba, Staphylococcus aureus skin colonization promotes SLE-like autoimmune inflammation via neutrophil activation and the IL-23 / IL-17 axis. Sci Immunol 7, eabm9811 (2022).36. A. L. Byrd, Y. Belkaid, J. A. Segre, The human skin microbiome. Nat Rev Microbiol 16, 143-155 (2018).37. B. J. Callahan, P. J. McMurdie, M. J. Rosen, A. W. Han, A. J. Johnson, S. P. Holmes, DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13, 581- 583 (2016).38. N. Segata, J. Izard, L. Waldron, D. Gevers, L. Miropolsky, W. S. Garrett, C. Huttenhower, Metagenomic biomarker discovery and explanation. Genome Biol 12, R60 (2011).

Claims

CLAIMS1. A method of using Staphylococcus epidermidis to treat inflammation in an epidermis of an animal, the method comprising: administering a substance containing a population of Staphylococcus epidermidis to a particular region of the animal; and reducing inflammation in the region.

2. The method of claim 1, wherein the substance is a topical ointment.

3. The method of claim 1, wherein the substance is a lotion.

4. The method of claim 1, wherein the substance is a cream.

5. The method of any one of claims 1-4, wherein the substance is contained in a patch that is wearable by the animal.

6. A biomaterial matrix, comprising: a hydrogel; and a population of living bacteria, wherein the population of living bacteria is contained within the hydrogel.

7. The biomaterial matrix of claim 6, wherein the hydrogel comprises: a main protein substance; and a polysaccharide component.

8. The biomaterial matrix of claim 7, wherein the main protein substance and the polysaccharide component are each a biocompatible material.

9. The biomaterial matrix of claim 7 or 8, wherein: the main protein substance comprises gelatin, collagen, and / or casein; and the polysaccharide component comprises tapioca starch, cellulose, pectin, kappa- carrageenan, and / or glucan from Euglena gracilis.

10. The biomaterial matrix of claim 9, wherein the population of living bacteria comprises Staphylococcus epidermidis.

11. A method of sustaining a population of living bacteria in a hydrogel, the method comprising: forming a viscoelastic polysaccharide component; mixing the viscoelastic polysaccharide with a main protein substance to create a hydrogel; and encapsulating the population of living bacteria in the hydrogel to create a biomaterial matrix.

12. The method of claim 11, wherein the viscoelastic polysaccharide component is formed by boiling granules of a polysaccharide in an aqueous solution.

13. The method of claim 12, wherein the aqueous solution comprises water.

14. The method of claim 11 further comprising freezing the biomaterial matrix and optionally storing the frozen biomaterial matrix.

15. The method of claim 14 further comprising: removing the frozen biomaterial matrix from storage; adding the frozen biomaterial matrix to water; and reheating the frozen biomaterial matrix and water to restore the biomaterial matrix, wherein the population of living bacteria is still alive in the biomaterial matrix.

16. The method of claim 11, wherein the main protein substance comprises gelatin, the polysaccharide component comprises tapioca starch, and the population of living bacteria comprises Staphylococcus epidermidis.

17. A wearable electronic device, comprising: a first layer, wherein the first layer is a sensor layer; a second layer, wherein the second layer is applied to an interfacing side of the sensor layer, wherein the second layer is configured to be applied to a mammalian epidermis, and wherein the second layer is a biomaterial matrix layer, the biomaterial matrix layer comprising: a hydrogel, and a population of living bacteria, wherein the population of living bacteria is encapsulated in the hydrogel; and one or more probes, wherein the one or more probes extends from a sensor in the sensor layer, through the biomaterial matrix layer, and contacts the mammalian epidermis directly.

18. The wearable electronic device of claim 17 further comprising a stimulator.

19. The wearable electronic device of claim 18, wherein the stimulator is capable of regulating bacterial activities.

20. The wearable electronic device of claim 18, wherein the stimulator is capable of killing the population of living bacteria.

21. The wearable electronic device of claim 17, wherein the first layer and the second layer are laminated together.

22. The wearable electronic device of claim 17, wherein the sensor layer comprises at least one of an electrical impedance sensor, a humidity sensor, and a temperature sensor.

23. The wearable electronic device of claim 17, wherein the sensor of the sensor layer is drafted onto a planar sheet.

24. The wearable electronic device of claim 17, wherein the hydrogel comprises: a main protein substance; and a polysaccharide component.

25. The wearable electronic device of claim 24, wherein the main protein substance comprises gelatin, the polysaccharide component comprises tapioca starch, and the population of living bacteria comprises Staphylococcus epidermidis.

26. The method of claim 5, wherein the animal is a mammal.

Citation Information

Patent Citations

  • Strains for improving skin, and kit for improving skin using the same

    KR102587334B1

  • Bacterium-containing hydrogel and method of making the same

    US20180021452A1

  • Antimicrobial therapy

    US20210228652A1

  • 3D printing of biofilms

    US20220243190A1