Cold tolerance-related HSF21 molecular marker of corn and use thereof

Abstract

The present invention relates to the technical field of molecular markers. Particularly disclosed are a molecular marker HSF21Hap1 for enhancing cold tolerance of corn, and the use thereof in identification of cold tolerance trait phenotypes of corn, corn germplasm resource identification and improvement or molecular marker assisted breeding, and screening or creation of corn with different cold tolerance traits. The molecular marker HSF21Hap1 can be obtained by means of amplification with a primer pair shown as SEQ ID NO. 1-2. A method for identifying the cold tolerance trait phenotypes of corn comprises: using as a template the DNA of corn to be identified, and using primers shown as SEQ ID NO.1-2 to perform PCR amplification; and then determining the cold tolerance phenotype of said corn on the basis of a sequencing result.

Description

Molecular markers related to cold tolerance of maize HSF21 and their applications Technical Field

[0001] The present invention relates to the technical field of molecular markers, in particular to molecular markers related to the cold tolerance of corn HSF21 and applications thereof. Background Art

[0002] As one of the main abiotic stresses, low temperature stress has a significant impact on plant growth and development, geographical distribution, and food crop yields. Corn is one of the three major food crops in the world. As a crop variety of tropical origin, low temperature stress poses a serious threat to corn agricultural production and is a potential factor threatening world food security. Research on the molecular mechanism of crop tolerance to low temperatures can provide genetic resources and a molecular theoretical basis for breeding crops resistant to low temperature stress. It is of great significance to improving the cold resistance and yield of corn and alleviating the yield reduction caused by extreme temperatures. It is one of the important directions of basic biological research and applied research in my country. When crops perceive low temperature signals, it causes a series of changes in the transcription levels of genes related to low temperature response. Transcription factors play a vital role in this process.

[0003] Forward genetics using QTL (quantitative trait loci) and GWAS (genome-wide association study) methods has long been the most direct and effective way to identify cold-tolerance genes in maize, laying the genetic foundation for breeding and improvement. Combining physiological, biochemical, and omics analyses can further reveal the molecular mechanisms of cold tolerance in maize, providing a theoretical basis for breeding cold-tolerant maize varieties. Furthermore, by utilizing association populations composed of maize inbred lines from different latitudes, it is possible to effectively mine natural genetic variation, aiming to precisely edit these variants and cultivate a rich genetic variation resource for developing new cold-tolerant maize varieties. Summary of the Invention

[0004] In view of the deficiencies in the prior art, the present invention aims to provide molecular markers related to the cold tolerance of maize HSF21 and their applications.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] Molecular markers related to cold tolerance of maize HSF21,

[0007] The molecular marker is HSF21 Hap1 ; the HSF21 Hap1 A 5-bp deletion occurs at the -693-689 bp site of the HSF21 gene, and the 5-bp deletion sequence is CTGCT.

[0008] The molecular marker HSF21 Hap1 HSF21 Hap1 -F1 / HSF21 Hap1 -R1 was amplified.

[0009] The primer pair HSF21 Hap1 -F1 / HSF21 Hap1 -R1 sequence is:

[0010] HSF21 Hap1 -F1:ACGCCATTCTAGACCTCTTTGTA;

[0011] HSF21 Hap1 -R1: CTACTCCCATGTAAGCGCCTG.

[0012] Amplify the molecular marker HSF21 related to the cold tolerance of corn HSF21 according to claim 1 Hap1 The primers,

[0013] The primer HSF21 Hap1 -F1 / HSF21 Hap1 -R1 sequence is:

[0014] HSF21 Hap1 -F1:ACGCCATTCTAGACCTCTTTGTA;

[0015] HSF21 Hap1 -R1: CTACTCCCATGTAAGCGCCTG.

[0016] Containing the molecular marker HSF21 related to the cold tolerance of corn HSF21 according to claim 3 Hap1 A reagent or kit for the primers.

[0017] The molecular marker HSF21 related to the cold tolerance of corn HSF21 according to claim 1 or 2 is used. Hap1 Or the use of the primer according to claim 3 or the reagent or kit according to claim 4 in identifying the cold tolerance phenotype of corn.

[0018] The molecular marker HSF21 related to the cold tolerance of corn HSF21 according to claim 1 or 2 is used. Hap1 Or the use of the primer according to claim 3 or the reagent or kit according to claim 4 in the identification, improvement or molecular marker-assisted breeding of corn germplasm resources.

[0019] The molecular marker HSF21 related to the cold tolerance of corn HSF21 according to claim 1 or 2 is used. Hap1Or use of the primer according to claim 3 or the reagent or kit according to claim 4 in screening or creating corn with different cold tolerance traits.

[0020] A method for identifying a corn cold tolerance phenotype, comprising:

[0021] (1) Extracting DNA from the corn to be identified;

[0022] (2) Using the DNA obtained in step (1) as a template, PCR amplification was performed using the primers shown in SEQ ID NO. 1-2 to obtain a PCR amplification product;

[0023] (3) Sequencing the PCR amplification product obtained in step (2) to determine the cold tolerance phenotype of the corn to be identified; the DNA fragment in the PCR amplification product is molecularly labeled as HSF21 Hap1 The corn to be identified has high cold tolerance; the DNA fragment molecular marker in the PCR amplification product is not HSF21 Hap1 , the corn to be identified may be cold-sensitive.

[0024] The beneficial effects of the present invention are:

[0025] The present invention identifies SNP and Indel mutations located on the promoter of corn cold tolerance-related gene HSF21, which are linked to corn cold tolerance. The natural variation of this gene segment can be used as a molecular marker for corn cold tolerance.

[0026] Since corn cold tolerance is a quantitative trait, phenotypic analysis is time-consuming and labor-intensive. The molecular markers and primers of the present invention can be applied to corn cold tolerance breeding and can be identified during the corn seed period or the early stage of cotyledon growth, which is time-saving and accurate, and can accelerate the breeding process of corn cold tolerance varieties.

[0027] BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0029] In the attached figure:

[0030] Figure 1A is a genome-wide association analysis of relative leaf injury in 213 maize inbred lines under low temperature stress

[0031] Figure 1B shows the correlation analysis between a SNP (-683) and another linked Indel (-693) in the gene resequencing and the low temperature phenotype of maize.

[0032] FIG1C shows the three haplotypes of Hap1, Hap2 and Hap3 of 460 maize inbred lines.

[0033] Figure 1D shows the comparison of relative leaf damage of three haploid maize inbred lines under low temperature stress.

[0034] Figure 2A shows NIL-HSF21 Hap1 (NIL-HSF21 By815 ) and NIL-HSF21 Hap3 (NIL-HSF21 K22 ) Phenotypes before and after low temperature treatment

[0035] Figure 2B shows NIL-HSF21 Hap1 and NIL-HSF21 Hap3 Statistics of relative damage area of ​​blades after cold treatment of materials

[0036] Figure 2C shows HSF21 before and after low temperature treatment. Hap1 and HSF21 Hap3 Gene expression levels

[0037] Figure 3A shows the knockout forms of hsfn gain-of-function mutants (promoter editing materials hsfn-3 and hsfn-4)

[0038] Figure 3B shows the phenotypes of WT plants, hsfn-3 mutant plants, and hsfn-4 mutant plants before and after low temperature treatment.

[0039] Figure 3C shows the relative damage area of ​​leaves of WT plants, hsfn-3 mutant plants, and hsfn-4 mutant plants after low temperature treatment.

[0040] Figure 3D shows the expression levels of the HSF21 gene in WT plants, hsfn-3 mutant plants, and hsfn-4 mutant plants.

[0041] Figure 4 shows the analysis results of PCR amplification of the HSF21 promoter region in maize inbred lines using sequencing primers

[0042] DETAILED DESCRIPTION

[0043] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0044] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the equipment and reagents used in each example are conventionally commercially available.

[0045] The present invention discloses a molecular marker HSF21 related to corn cold toleranceHap1 The invention also provides a method for identifying corn cold tolerance phenotypes, identifying corn germplasm resources, improving corn germplasm resources or molecular marker-assisted breeding, and screening or creating corn with different cold tolerance traits. The molecular marker of the invention is HSF21 Hap1 , that is, a 5bp base deletion occurs at the -693bp to -689bp site of the HSF21 gene, and the base sequence of the 5bp deletion is CTGCT; molecular marker HSF21 Hap1 The method for identifying the cold tolerance phenotype of corn can be obtained by amplification using the primer pair shown in SEQ ID NOs. 1-2. When PCR amplification is performed using the primers shown in SEQ ID NOs. 1-2 using the DNA of the corn to be identified as a template, the cold tolerance phenotype of the corn to be identified can be determined based on the sequencing results. If the DNA fragment molecular marker in the PCR amplification product is HSF21Hap1, the corn to be identified has high cold tolerance; if the DNA fragment molecular marker in the PCR amplification product is not HSF21Hap1, the corn to be identified may be cold-sensitive, thereby improving the breeding efficiency of cold-tolerant corn.

[0046] Example 1

[0047] Using the leaf damage area of ​​213 maize inbred lines after low-temperature treatment as an indicator, the present invention cloned the candidate gene HSF21 that regulates maize cold tolerance through genome-wide association analysis (GWAS). Specifically, it was found that overexpressing the HSF21 gene in maize exhibited a cold-tolerance phenotype compared to the wild type, while knocking out the gene in maize exhibited a cold-sensitive phenotype. The cDNA of this gene consists of 1671 bases, and the sequence is shown in SEQ ID No. 3. The gene reading frame consists of two exons. The amino acid sequence encoded by the maize HSF21 gene is shown in SEQ ID No. 4.

[0048] To identify DNA sequence variants suitable as molecular markers for cold tolerance, this study resequenced the HSF21 gene region (including the coding region, 5' UTR, and 3' UTR) in 460 maize inbred lines from different latitudes. Using the Illumina sequencing platform, DNA from the HSF21 gene (SEQ ID No. 3) was sequenced from 460 maize inbred lines (published in: Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels, 2013, Nature Genet 45:1). Comparison and analysis of the sequencing data revealed 69 natural variants (non-synonymous mutations), including 41 single-nucleotide polymorphisms (SNPs) and 28 indels (MAF ≥ 5%). Association analysis (TASSEL5.0) was performed on the correlation between these natural variations and leaf injury of different maize inbred lines under low temperature. The results showed that, as shown in Figure 1A, this is a genome-wide association analysis diagram of the relative leaf injury phenotypes of 213 maize inbred lines under low temperature stress. The vertical axis represents the value of -Log(P), P is the significant effect value obtained by the genome-wide association analysis, and the horizontal axis value represents different chromosomes. The higher the significant effect value, the stronger the association between the SNP site and the phenotype. Among them, the SNP with the highest effect value is chr7.s_125861101 (P=1.15×10-7), which is located in the promoter region of the gene (Zm00001d020714, HSF21). To further analyze the association between the candidate gene HSF21 and the cold phenotype of maize, the gene was resequenced and a mixed model was used for candidate gene association analysis using Tassel 5.0 software. P < 1.03 × 10-5 (1 / 97438) was set as the threshold for effect significance, and 97438 was the number of significantly linked SNPs after PLINK (window size 50, step size 50, r2 ≥ 0.2) filtering.Figure 1B is an analysis of the association between a SNP (-683) and another linked Indel (-693) in the gene resequencing and the low-temperature phenotype of maize. The vertical axis represents the value of -Log(P), where P is the significant effect value obtained from the candidate gene analysis, and the horizontal axis value represents the distance between the gene mutation site and the HSF21 start codon ATG. The mutation sites with the highest effect value of the HSF21 gene (-log10(P) ≥ 7.0) were determined to be SNP (-683, TG) and another linked 5-bp Indel (-693). Since the effect values ​​of these two mutation sites were above the threshold line, the SNP (-683, TG) and 5-bp Indel (-693) in the promoter region of the HSF21 gene were significantly associated with the low-temperature phenotype of maize.

[0049] A total of 460 maize inbred lines, including 103 lines represented by By815, were found to harbor natural variations in the HSF21 gene promoter, including a SNP (-683, TG) and a 5-bp indel (-693). The 5-bp deletion in the HSF21 gene promoter region is a typical deletion variant, allowing for rapid differentiation of inbred line variation. Furthermore, the 5-bp deletion facilitates rapid identification of sequence differences between inbred lines based on PCR product size, making it suitable as a molecular marker. Combined with resequencing results, maize inbred lines harboring the 5-bp indel (-693) were classified as haplotype Hap1, those harboring the 3-bp indel (-693) as haplotype Hap2, and those without these natural variations as haplotype Hap3. The three haplotypes of Hap1, Hap2, and Hap3 for the 460 maize inbred lines are shown in Figure 1C. Figure 1D shows a comparison of relative leaf wound area among three haplotype maize inbred lines under 4°C stress. The vertical axis represents relative leaf wound area, and the horizontal axis represents the three haplotypes (Hap1, Hap2, and Hap3). n represents the number of each haplotype. The solid horizontal line in the figure represents the median relative leaf wound area of ​​the three haplotypes (Hap1, Hap2, and Hap3) under 4°C stress. The smaller the median, the smaller the relative leaf wound area of ​​the corresponding haplotype maize inbred line. The figure shows that the Hap1 maize inbred line has the lowest leaf wound area under low temperature stress, indicating better cold tolerance and is the dominant haplotype. The dominant haplotype Hap1 also contains a naturally occurring SNP (-683, G) and a 5-bp indel (-693). Because this fragment is located in the HSF21 promoter region, it is highly likely to affect HSF21 expression and, therefore, cold tolerance in maize. This locus also represents a potential untapped genetic locus for improving cold tolerance in maize.

[0050] To verify whether natural variation in the HSF21 promoter region affects cold tolerance in maize, a near-isogenic line (BC2F8) was constructed by backcrossing two generations and selfing two generations in the maize By815×K22 recombinant inbred line F6 population. Based on the different sources of the HSF21 allele in the near-isogenic lines, the near-isogenic lines were divided into NIL-HSF21 K22 (NIL-HSF21 Hap3 ) plants and NIL-HSF21 By815 (NIL-HSF21 Hap1 ) plants. We K22 plants and NIL-HSF21 By815 Plants were subjected to low temperature treatment experiment (4 o C, 4d), after 2d of recovery, Figure 2A shows NIL-HSF21 Hap1 (NIL-HSF21 By815 ) and NIL-HSF21 Hap3 (NIL-HSF21 K22 ) Phenotypes before and after low temperature treatment. The figure shows that NIL-HSF21 K22 Plants compared to NIL-HSF21 By815 Plants are more sensitive to low temperature stress. Figure 2B shows that NIL-HSF21 Hap1 and NIL-HSF21 Hap3 The relative damage area of ​​leaves after cold treatment of materials is statistically analyzed. The vertical axis represents the relative damage area of ​​leaves, and the horizontal axis represents two different near-allelic lines. The figure shows that NIL-HSF21 K22 Plants were compared with NIL-HSF21 By815 The relative damage area of ​​leaves of plants under low temperature stress was higher, which intuitively showed that NIL-HSF21 K22 Plants were larger than NIL-HSF21 By815 Plants are more sensitive to low temperature stress. Figure 2C shows the HSF21 before and after low temperature treatment. Hap1 and HSF21 Hap3 The gene expression level of HSF21 gene is shown in the vertical axis, and the horizontal axis shows the relative expression level of 4 o C low temperature treatment time, the figure shows that, without low temperature treatment, NIL-HSF21 By815 The HSF21 expression level of the plant is NIL-HSF21 K22 The expression level of HSF21 in plants was about two times higher than that in plants under low temperature conditions (4 o C), HSF21 By815 Expression levels and HSF21 K22 The difference in expression levels was more obvious, indicating that NIL-HSF21 By815The expression level of HSF21 in plants was significantly induced by low temperature, while NIL-HSF21 K22 The expression level of HSF21 in the plants was almost unaffected by low temperature. The expression levels of HSF21 in the two plants after low temperature treatment differed by about 7 times. Hap1 The gene expression level was higher after low temperature treatment and conferred stronger cold tolerance to maize.

[0051] To further validate that natural variation in the HSF21 promoter can affect HSF21 gene expression levels and, consequently, alter cold tolerance in maize, we used Crispr / Cas9 technology to construct two independent HSF21 promoter-edited mutants, designated hsfn-3 and hsfn-4. These mutants contain a 458-bp deletion (-519 to -977) and a 102-bp deletion (-624 to -726) in the promoter region, respectively. Both deletions encompass the region containing a promoter SNP (-683, G) and a 5-bp indel (-693). The knockout forms of these hsfn gain-of-function mutants (hsfn-3 and hsfn-4) are shown in Figure 3A. These editing materials, hsfn-3 and hsfn-4, delete the region containing the natural HSF21 variation. Triangles represent the region containing the A-box motif, and arrows indicate the gRNA target site. Figure 3B shows the phenotypes of WT, hsfn-3, and hsfn-4 mutant plants before and after low-temperature treatment. The figure shows that hsfn-3 and hsfn-4 plants exhibit a stronger cold-tolerance phenotype than wild-type controls grown at the same time. Figure 3C shows the relative leaf damage area of ​​WT, hsfn-3, and hsfn-4 mutant plants after low-temperature treatment. The vertical axis represents the relative leaf damage area, and the horizontal axis represents the different types of maize plants. The figure shows that the relative leaf damage area of ​​hsfn-3 and hsfn-4 mutant plants is smaller than that of wild-type controls grown at the same time. Figure 3D shows the expression levels of the HSF21 gene in WT, hsfn-3, and hsfn-4 mutant plants. The vertical axis represents the relative expression level of the HSF21 gene, and the horizontal axis represents the duration of low-temperature treatment at 4°C. Consistent with the phenotypic results, the figure shows that HSF21 gene expression levels in hsfn-3 and hsfn-4 plants were higher than those in wild-type controls both before and after low-temperature treatment. Furthermore, HSF21 gene expression levels in hsfn-3 and hsfn-4 plants were significantly induced after low-temperature treatment. Therefore, natural variation in HSF21 increases HSF21 gene expression levels, thereby improving cold tolerance in maize.

[0052] Example 2 Corn HSF21 Hap1 Acquisition of molecular markers

[0053] According to the sequencing results of Example 1, the present invention designed a pair of primers I: HSF21 Hap1 -F1 / HSF21 Hap1 -R1. The primer sequence is:

[0054] HSF21 Hap1 -F1:ACGCCATTCTAGACCTCTTTGTA (SEQ ID No. 1)

[0055] HSF21 Hap1 -R1: CTACTCCCATGTAAGCGCCTG (SEQ ID No. 2).

[0056] HSF21 Hap1 -F1 / HSF21 Hap1 -R1 were used as primers, maize inbred line genomic DNA was used as template, and Trans Taq Polymerase HiFi DNA polymerase was used for amplification.

[0057] The reaction system is as follows (50 μL):

[0058]

[0059] PCR products were sequenced using the HITAC-seq method (HITAC-seq enables high-throughput, cost-effective sequencing of plasmids and DNA fragments with identity. (2021) J Genet Genomics 48: 671-680) to construct libraries. The samples were then sequenced and aligned using MEGA 7.0 sequence alignment software. PCR amplification of the HSF21 promoter region in maize inbred lines using sequencing primers was followed by analysis. The results showed that only the Hap1 maize inbred line had a 5 bp indel (-693) naturally occurring variant in the PCR product. The specific sequence information for the 5 bp deletion fragment in the HSF21 promoter region is shown in Figure 4.

[0060] In summary, the molecular marker HSF21 Hap1 The 5 bp deletion mutation can be used to identify the cold tolerance phenotype of maize.

[0061] The present invention uses molecular marker HSF21 Hap1 The cold tolerance of corn can be identified, thereby improving the breeding efficiency of cold-tolerant corn.

[0062] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

[0063] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. Molecular markers related to cold tolerance of maize HSF21, characterized in that The molecular marker is HSF21 Hap1 ; = the HSF21 Hap1 is a 5-bp base deletion at the -693bp to -689bp locus of the HSF21 gene, and the 5-bp base sequence of the deletion is CTGCT; The molecular marker HSF21 Hap1 is amplified by the primer pair HSF21 Hap1 -F1 / HSF21 Hap1 -R1.

2. The molecular markers related to cold tolerance of maize HSF21 according to claim 1, characterized in that The primer pair HSF21 Hap1 -F1 / HSF21 Hap1 -R1 sequence is as follows: HSF21 Hap1 -F1: ACGCCATTCTAGACCTCTTTGTA; HSF21 Hap1 -R1: CTACTCCCATGTAAGCGCCTG.

3. Amplify the molecular marker HSF21 related to cold tolerance of maize HSF21 described in claim 1 Hap1 The primer is characterized in that The primer HSF21 Hap1 -F1 / HSF21 Hap1 -R1 sequence is as follows: HSF21 Hap1 -F1: ACGCCATTCTAGACCTCTTTGTA; HSF21 Hap1 - R1: CTACTCCCATGTAAGCGCCTG.

4. A reagent or kit containing a primer for the molecular marker HSF21 related to the cold tolerance of maize HSF21 described in claim 3 Hap1 .

5. Use of the molecular marker HSF21 related to cold tolerance of maize HSF21 as described in claim 1 or 2 Hap1 or the primer as described in claim 3 or the reagent or kit as described in claim 4 in the identification of the phenotypic traits of cold tolerance of maize.

6. Use of the molecular marker HSF21 related to cold tolerance of maize HSF21 according to claim 1 or 2 Hap1 or the primer according to claim 3 or the reagent or kit according to claim 4 in the identification, improvement or molecular marker-assisted breeding of maize germplasm resources.

7. Use of the molecular marker HSF21 related to cold tolerance of maize HSF21 as described in claim 1 or 2 Hap1 or the primer as described in claim 3 or the reagent or kit as described in claim 4 in screening or creating maize with different cold tolerance traits 8. A method for identifying the phenotypic traits of cold tolerance in maize, characterized in that, comprising: (1) Extracting the DNA of the maize to be identified; (2) Using the DNA obtained in step (1) as a template, performing PCR amplification with the primers shown in SEQ ID NO. 1-2 to obtain a PCR amplification product; (3) Sequence the PCR amplification product obtained in step (2) to determine the phenotypic traits of the cold tolerance of the maize to be identified; the DNA fragment molecular marker in the PCR amplification product is HSF21 Hap1 , the maize to be identified has high cold tolerance; the DNA fragment molecular marker in the PCR amplification product is not HSF21 Hap1 , then the maize to be identified may be cold-sensitive.

Images