Recombinant nucleic acid molecule for preparing circular RNA, and screening method therefor and use thereof

Abstract

The present disclosure relates to a recombinant nucleic acid molecule for regulating the circularization of circular RNA and the use thereof, specifically relates to a recombinant nucleic acid molecule, recombinant expression vector and composition for preparing a circular RNA, and further relates to the prepared circular RNA, a method for preparing the circular RNA, a method for expressing a target polypeptide in cells and animals and a method for screening a target circularization sequence. The recombinant nucleic acid molecule provided in the present disclosure provides a structured permuted intron-exon (S-PIE) system library with a new structure for the in-vitro preparation of a circular RNA. By means of introducing an S-PIE sequence with a unique secondary structure, extra exons and interval sequences are prevented from being introduced into the circular RNA and the circularization rate of the circular RNA molecule is greatly improved, such that the immunogenicity of the circular RNA is reduced. Additionally, the S-PIE system can be used at any IRES and for encoding polypeptide sequences of any length, and has high universality.

Description

A recombinant nucleic acid molecule for preparing circular RNA, its screening method and application This application claims the priority of a Chinese patent application titled "A Recombinant Nucleic Acid Molecule for Preparing Circular RNA, Its Screening Method and Application", with the application number 202410081904.5, filed with the Chinese Patent Office on January 19, 2024. The entire content thereof is incorporated herein by reference in its entirety. Technical Field The present invention belongs to the field of biotechnology, and specifically relates to a recombinant nucleic acid molecule for preparing circular RNA, its screening method and application. Background Art mRNA therapy is an effective method for treating or preventing diseases based on RNA molecules. Due to its high efficiency, mRNA vaccines have made great contributions in the fight against the COVID-19 pandemic. The 2023 Nobel Prize in Physiology or Medicine was awarded to two pioneers of mRNA technology, Katalin Karikó and Drew Weissman, in recognition of their discovery of nucleoside base modification and the successful development of effective mRNA vaccines against COVID-19 [1][2] . Through nucleoside base modification, the expression level of linear mRNA in cells and animals is significantly increased, and its immunogenicity is reduced. Circular RNA is an important class of RNA molecules that widely exist in organisms, including plants, animals, and fungi, etc. The research on circular RNA in humans started relatively late and was initially considered as an error product or secondary product generated during the splicing process, so it has not attracted much attention for a long time. However, with the development of RNA research technologies, especially the application of high-throughput sequencing technology, researchers have found that circular RNA is ubiquitously present in organisms and plays an important regulatory role in various biological activities [3][4] . Circular RNA (circRNA) is a circular closed single-stranded RNA molecule connected by covalent bonds without a 5'-terminal cap and a 3'-terminal poly(A) tail [5] . Endogenous circRNA lacks the free ends necessary for exonuclease-mediated degradation, so circRNA is more stable than linear mRNA [6] . Circularization can effectively solve the problem of the short half-life of linear mRNA. The circularized mRNA can efficiently and persistently express proteins in eukaryotic cells, and RNA with unmodified nucleotides will not cause unnecessary immune responses and protein expression [7] . Due to its stable structure and the ability to encode multiple functional proteins, circRNA has great application potential in the field of RNA therapy, is known as the "mRNA technology version 2.0", and has more advantages in production, delivery, and treatment. RNA circularization technology is the key to in vitro preparation of circRNA. The current common idea for in vitro synthesis of circular RNA (circRNA) is to use linear RNA as a precursor and connect the two ends through chemical ligation with cyanogen bromide (BrCN) or 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), enzymatic ligation with T4 RNA or T4 DNA ligase, or the ribozyme method using self-splicing introns to form a covalently closed circular structure. [5][8] . Among them, ribozymes are a class of RNAs with enzymatic catalytic functions. Currently, the PIE system (type I intron or type II intron) and other ribozymes (such as hairpin ribozymes) are mainly applied to RNA circularization reactions. The PIE system is a relatively common method. Based on the self-splicing function of type I or type II introns, in the presence of magnesium ions and free GTP, splicing effects are achieved, resulting in intron circularization and the ligation of intermediate sequences, thereby generating circRNA. [9] . The type I intron PIE system uses the T4 td gene or the Anabaena tRNA precursor gene to design and arrange the intron-exon structure. It is also the most widely used self-splicing circularization system in the industry. Its synthesis process is as follows: The RNA intron and the auxiliary exon fragment are divided into two parts. Among them, the 5' end sequence is transferred to the tail of the target sequence, and the 3' end sequence is inserted into the front end of the target sequence. Under the action of GTP, this PIE structure will cause the self-circularization of other sequences except the intron. [9]

[0011] . In the preparation of long-sequence circular RNA (circRNA), the PIE system has great advantages and is also the preferred platform for current circRNA enterprises. . However, although the PIE system based on the T4 td gene can achieve the circularization of circRNA, the exon region retained in circRNA after circularization will reduce the protein expression level and has certain immunogenicity, and its circularization rate is not excellent enough. This makes it difficult to achieve the drugability of circular RNA based on the T4td circularization system. . In order to change this situation, it is urgent to develop a new circularization strategy. The literature cited in the background technology is as follows: [1]Zheng, W., Wang, L., Geng, S. et al. CircMIB2 therapy can effectively treat pathogenic infection by encoding a novel protein. Cell Death Dis 14, 578 (2023). [2]Ewen Callaway & Miryam Naddaf. Pioneers of mRNA COVID vaccines win medicine Nobel. Nature 622, 228 - 229 (2023). [3]Xu - Kai Ma, Si - Nan Zhai, Li Yang. Approaches and challenges in genome - wide circular RNA identification and quantification. Trends in Genetics, 2023. [4]Lu - Lu Yu, Qi Xiao, Bing Yu, Qiao - Li Lv, Zhao - Qian Liu, Ji - Ye Yi. CircRNAs in tumor immunity and immunotherapy: Perspectives from innate and adaptive immunity. Cancer Letters, Volume 564, 2023, 216219. [5]Jiali Yang, Jiafeng Zhu, Jiaojiao Sun, Yiyun Chen, Yaran Du, Yiling Tan, Linpeng Wu, Mengting Zhai, Lixiang Wei, Na Li, Ke Huang, Qiangbo Hou, Zhenbo Tong, Andreas Bechthold, Hao Tian, Zhenhua Sun, Chijian Zuo. Intratumoral delivered novel circular mRNA encoding cytokines for immune modulation and cancer therapy. Molecular Therapy - Nucleic Acids, Volume 30, 2022, Pages 184 - 197. [6]C.X. Liu, L.L. Chen. Circular RNAs: characterization, cellular roles, and applications. Cell, 185(2022), pp.2016 - 2034. [7]Wesselhoeft, R. A., Kowalski, P. S. & Anderson, D. G. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun 9, 2629 (2018). [8]Obi P, Chen YG. The design and synthesis of circular RNAs. Methods. 2021 Dec;196:85 - 103. [9]M. Puttaraju, M. D. Been. Group I permuted intron - exon (PIE) sequences self - splice to produce circular exons. Nucleic Acids Res., 20(1992), pp.5357 - 5364.

[0010] Petkovic S, Müller S. RNA circularization strategies in vivo and in vitro. Nucleic Acids Res. 2015 Feb 27;43(4):2454 - 65.

[0011] Kyung Hyun Lee, Seongcheol Kim, Jaehwi Song, Seung Ryul Han, Ji Hyun Kim, Seong - Wook Lee. Efficient circular RNA engineering by end - to - end self - targeting and splicing reaction using Tetrahymena group I intron ribozyme. Molecular Therapy - Nucleic Acids, Volume 33, 2023, Pages 587 - 598. Summary of the Invention To solve the problems existing in the prior art, the present invention provides a recombinant nucleic acid molecule, which provides a structurally novel S-PIE system library for the in vitro preparation of circular RNAs. By introducing S-PIE sequences with unique secondary structures, it is possible to avoid introducing additional exons into circular RNAs, achieve excellent cyclization rates with only one transcription step, reduce the immunogenicity of circular RNAs, and this S-PIE system can be used for any IRES and polypeptide sequences encoding long fragments, with high generality and good application prospects in the fields of nucleic acid vaccines, expression of therapeutic proteins, gene therapy, etc. Specifically, the present invention adopts the following technical solutions: A recombinant nucleic acid molecule for preparing circular RNAs, along the 5' to 3' direction, includes elements arranged in the following order: intron fragment I, S sequence fragment I, target element, S sequence fragment II, intron fragment II; Among them, the S sequence fragment I consists of a first preset number of nucleotides, the S sequence fragment II consists of a second preset number of nucleotides, and after cyclization, the S sequence fragment I and the S sequence fragment II form a structural unit S-PIE fragment with a secondary structure, and this structural unit S-PIE fragment has a preset structural unit energy; Among them, the target element can be composed of a translation initiation element and a coding element, or can be composed of other elements. The nucleotide sequence of the coding element is used to form a coding element sequence encoding at least one target polypeptide along the 5' to 3' direction or the 3' to 5' direction; The nucleotide sequence of the translation initiation element is used to bind translation initiation proteins such as ribosomes along the 5' to 3' direction or the 3' to 5' direction to initiate protein translation of the coding element. The positions between the coding element and the translation initiation element can be interchanged. The lengths of the other elements can be composed of 0nt, 1nt, 1600nt, 2300nt, and 4800nt, and elements with lengths within their ranges. The nucleotide sequences of the intron fragment I and the intron fragment II are used to form an intron sequence, an intron reverse sequence, or an intron reverse complementary sequence along the 5' to 3' direction; the nucleotide sequence of the intron fragment I contains a partial sequence of the intron sequence close to the 3' direction, and the nucleotide sequence of the intron fragment II contains the remaining part of the intron sequence close to the 5' direction; Preferably, the intron fragment I and the intron fragment II are derived from Group I Intron; Optionally, the Group I intron is derived from any one of the following Group I introns: the td gene of T4 phage, tRNAle of Anabaena, TpaCOX2, and Ptu. Preferably, the first preset number of nucleotides of the S sequence fragment I is selected from 3 to 100 nucleotides, preferably 3 to 50 nucleotides. Preferably, the second preset number of nucleotides of the S sequence fragment II is selected from 1 to 100 nucleotides, preferably 1 to 50 nucleotides. Preferably, the preset structural unit energy of the S-PIE fragment is selected from between -0.7 and -0.1 (including -0.6 and -0.1), preferably between -0.6 and -0.2 (including -0.6 and -0.2), and preferably between -0.6 and -0.4. The calculation method of the structural unit energy (structuredness) is as follows: The minimum free energy ΔG can be calculated by RNA structure simulation software such as RNAfold, which indicates the structural stability degree of the S-PIE sequence fragment, and nt is the sum of the first preset number and the second preset number. Preferably, the ribozyme recognition site of the S-PIE fragment includes "TTGGGTCT" and its mutant ribozyme recognition sites. Preferably, the S-PIE fragment includes any paired nucleotide combination that constitutes its secondary structure sequence. Preferably, the S-PIE fragment includes any unpaired nucleotide combination that constitutes its secondary structure sequence. Preferably, the translation initiation element includes a sequence having the activity of initiating translation in the editing region; Optionally, the sequence having the activity of initiating translation in the editing region is selected from one or a combination of two or more of the following: IRES sequence, 5'UTR sequence, Kozak sequence, a sequence containing m6A modification, and a complementary sequence of ribosomal 18S rRNA. Preferably, the recombinant nucleic acid molecule is used for preparing a circular RNA containing a coding element; wherein, the coding element in the circular RNA includes nucleotides that can encode a single or multiple target polypeptide sequences, and the nucleotides encoding the target polypeptide sequences are spliced by a linker or by a translation initiation element. Preferably, the linker is a polynucleotide encoding a 2A peptide. Preferably, the target polypeptide is a human protein or a non-human protein; Optionally, the target polypeptide is selected from one or a combination of two or more of the following: antigen, antibody, antigen-binding fragment, fluorescent protein, a protein having disease treatment activity, a protein having gene editing activity, and a protease having metabolic regulation activity. Preferably, the recombinant nucleic acid molecule further comprises an insertion element a located between the coding element and the translation initiation element, or an insertion element b located between the S sequence fragment I and the translation initiation element; an insertion element c between the S sequence fragment II and the coding element; each of the insertion elements independently selected from at least one of the following (i)-(iv): (i) transcriptional level regulatory elements, (ii) translational level regulatory elements, (iii) purification elements (iv) encapsulation elements; Preferably, the insertion element is connected to the 5' end of any translation initiation element; optionally, each of the insertion elements independently comprises one or a combination of two or more of the following sequences: untranslated region sequence, polyA sequence, aptamer sequence, riboswitch sequence, sequence binding to a transcriptional regulatory factor. Preferably, the recombinant nucleic acid molecule further comprises a 5' homologous arm and a 3' homologous arm, and the nucleotide sequence of the 5' homologous arm hybridizes with the nucleotide sequence of the 3' homologous arm; The 5' homologous arm is connected to the 5' end of the intron fragment I, and the 3' homologous arm is connected to the 3' end of the intron fragment I; or, the 5' homologous arm is connected to the 5' end of the intron fragment II, and the 3' homologous arm is connected to the 3' end of the 3' intron fragment IV. Preferably, within any one of the intron fragment I, the translation initiation element, the coding element, and the intron fragment II, or between any two of the intron fragment I, S sequence fragment I, the coding element, the translation initiation element, S sequence fragment II, and the intron fragment II, there is no nucleotide sequence derived from exons E1 and E2; The present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises the above-mentioned recombinant nucleic acid molecule. On the other hand, the present invention provides the use of a recombinant nucleic acid molecule or the recombinant expression vector for preparing circular RNA in vitro. The present invention provides a method for preparing circular RNA in vitro, which comprises the following steps: One-step transcription step: Through a one-step transcription step, the aforementioned recombinant nucleic acid molecule or recombinant expression vector is transcribed to form a circularized nucleic acid molecule; RNA purification step by HPLC: The circularized nucleic acid molecule is purified and separated from the transcription system through a C18 column. Optionally, the method further comprises the step of purifying the circular RNA. The present invention provides a circular RNA prepared by the aforementioned method. The circular RNA, along the 5' to 3' direction, contains elements arranged in the following order: a translation initiation element, a coding element for encoding at least one target polypeptide, and a structural unit S-PIE fragment; Optionally, the circular RNA contains an insertion element located between the 5' end of the translation initiation element and the 3' end of the coding element; Wherein the definitions of the translation initiation element, the target polypeptide, or the insertion element are the same as those described above. Preferably, when the coding element contains two or more target polypeptides in the circular RNA, two adjacent coding regions can be connected by a linker or a translation initiation element. Preferably, the insertion element is connected to the 5' end of any translation initiation element. The present invention provides a composition, which contains the recombinant nucleic acid molecule, the recombinant expression vector described above, or the circular RNA described above. Optionally, the composition further contains one or more pharmaceutically acceptable carriers; Optionally, the pharmaceutically acceptable carrier is selected from lipids, polymers, or lipid-polymer complexes. The present invention provides a method for expressing a target polypeptide in a cell, which includes the step of transferring the circular RNA described above, or the composition into the cell. The present invention provides a method for screening an S-PIE sequence, which includes the following steps: S1. Determine the ribozyme recognition point sequence set: TTGGGTCT, TTAGGTCT, TCGGGTCT, TAGGGTCT, TTCGGCTT, TTCGGTCT, TTGGGCCT, TTGGGGCT, TTTGGTCT, etc. Among them, the ribozyme recognition site includes but is not limited to the above sequences. S2. Randomly generate a nucleotide sequence with a length of α at the 5' end of the ribozyme recognition point sequence set in S1, where 0 ≦ α ≦ 100. At the same time, randomly generate a nucleotide sequence with a length of β at the 3' end of the ribozyme recognition point sequence, where 0 ≦ β ≦ 100, and set the GC content of the sequence to be between 30-70%, to obtain a new sequence set. S3. Use RNA secondary structure simulation calculation software to perform batch secondary structure calculation simulations on the sequence set in S2, obtain the sequence secondary structure, and retain its minimum secondary structure unit to form a new sequence set. Among them, the definition of the minimum secondary structure unit is as follows: The sequences at both the 5'-end and 3'-end of the S1 ribozyme recognition site sequence form a paired structure with each other, but the sequences on one side do not independently form a secondary structure. Among them, in the RNA secondary structure simulation calculation software, when some sequence structures are simulated multiple times, there will be a structure with an independent secondary structure at the 5'-end and / or 3'-end. This sequence is also included in the protection scope. S4. Calculate the structure unit energy (stressedness) according to the calculation formula, and sort the sequence set obtained in S3 to obtain the relationship between the structure unit energy and the sequence set. The calculation formula for the structure unit energy (structuredness) is as follows: Calculate the minimum free energy ΔG of this secondary structure, which indicates the structural stability degree of the S-PIE sequence fragment I. nt is the sum of the first preset quantity and the second preset quantity. S5. According to the above method, obtain a sequence set that contains the relationship between the sequence and the structure unit energy, and randomly select a sequence from this sequence set according to the structure unit energy. Among them, in S2, the steps for judging the secondary sequence information of the said sequence set include Judging from the 3'-end to the 5'-end direction of the ribozyme recognition site of S1: 1) When this nucleotide pairs with the nucleotide +1 and above in the 3'-end direction of this nucleotide, then judge the next nucleotide in the 5'-end direction of this nucleotide. 2) When this nucleotide has no pairing information, then judge the next nucleotide in the 5'-end direction of this nucleotide. 3) When this nucleotide pairs with the nucleotide +1 and above in the 5'-end direction of this nucleotide, then intercept the nucleotide +1 and above in the 3'-end direction of this nucleotide as the 5'-end. +1 and above nucleotides as the 5'-end. Judging from the 5'-end to the 3'-end direction of the ribozyme recognition site of S1: a) When this nucleotide pairs with the nucleotide +1 and above in the 5'-end direction of this nucleotide, then judge the next nucleotide in the 3'-end direction of this nucleotide. b) When this nucleotide has no pairing information, then judge the next nucleotide in the 3'-end direction of this nucleotide. c) When this nucleotide pairs with the nucleotide +1 and above in the 3'-end direction of this nucleotide, then intercept the nucleotide +1 and above in the 5'-end direction of this nucleotide as the 3'-end. Establish a data set with the new nucleotide sequence obtained above. In some embodiments, the recombinant nucleic acid molecule provided by the present invention for preparing circular RNA comprises an intron fragment I, an S sequence fragment I, a translation initiation element, a coding element, an S sequence fragment II, and an intron fragment II. The recombinant nucleic acid molecule prepares circular RNA in vitro. Under the guidance of the intron sequence, the cleavage sites at the 3' end of the S sequence fragment II and the 5' end of the S sequence fragment I are sequentially cleaved, causing the linear nucleic acid molecule to ligate to form circular RNA, and the S sequence fragment I and the S sequence fragment II ligate to form an S-PIE fragment with a secondary structure. Because the S-PIE fragment has a stable secondary structure, it promotes the circularization efficiency of the recombinant nucleic acid molecule. Moreover, no additional exon sequence needs to be introduced into the recombinant nucleic acid molecule, thereby excluding additional exon sequences in the circular RNA and improving the stability of the circular RNA. In some embodiments, the recombinant nucleic acid molecule in the present disclosure provides a structurally novel S-PIE system for the in vitro preparation of circular RNA. Compared with the classical PIE system, the S-PIE system in the present disclosure can change the secondary structure of the sequence of the traditional PIE residual exon to make it more stable, does not require a spacer sequence to protect the stability of the translation initiation element and the coding element, improves the stability and translation efficiency of circular RNA in cells, and reduces the safety risk of circular RNA in clinical applications. Because it can be applied to different translation initiation elements and coding elements, it has higher versatility, is suitable for large-scale in vitro production of circular RNA, and has broad application prospects in the fields of mRNA infectious disease vaccines, therapeutic mRNA tumor vaccines, mRNA-based dendritic cell (DC) tumor vaccines, mRNA-based gene therapy, protein replacement therapy, etc. In some embodiments, the recombinant nucleic acid molecule provided by the present disclosure for preparing circular RNA does not need to introduce fragments such as spacer regions, homologous arms, exons, etc. The structure of the recombinant nucleic acid molecule is simple, and the prepared circular RNA has good safety, making it suitable for large-scale industrial preparation of circular RNA in vitro. In some embodiments, the translation initiation element and the coding element of the recombinant nucleic acid molecule provided by the present disclosure have multiple sequence selections, enabling different efficiencies of translation in the coding region of circular RNA, and providing multiple sequence selections for the preparation of circular RNA. In some embodiments, the circular RNA provided by the present disclosure is prepared using the above-mentioned recombinant nucleic acid molecule. The circular RNA does not contain extra-introduced exon sequences, has high sequence accuracy, small changes in secondary structure, high biological safety and structural stability, and low immunogenicity, and is applicable to the field of clinical disease treatment. The present invention provides a recombinant nucleic acid molecule, which provides a structurally novel S-PIE system library for the in vitro preparation of circular RNAs. By introducing S-PIE sequences with unique secondary structures, the introduction of additional exons and spacer sequences into circular RNAs is avoided, the cyclization rate of circular RNA molecules is greatly increased, thereby reducing the immunogenicity of circular RNAs. Moreover, this S-PIE system can be used for any IRES and polypeptide sequences encoding any length, with high versatility, and has good application prospects in the fields of nucleic acid vaccines, expression of therapeutic proteins, gene therapy, etc. Description of the Drawings Figure 1 shows the optimization logic of the S-PIE system for the natural T4 tdPIE system. Figure 2 shows a schematic structural diagram of the recombinant nucleic acid molecule T4 tdPIE system for the conventional preparation of circular RNAs. Figure 3 shows a schematic structural diagram of the recombinant nucleic acid molecule S-PIE system for the preparation of circular RNAs in the present disclosure. Figure 4 shows a schematic process logic diagram for screening S-PIE fragments in the present disclosure. Figure 5 shows a schematic diagram of plasmid linearization of the recombinant nucleic acid molecule for the preparation of circular RNAs. Figure 6 shows the relationship between the cyclization rate of circular RNAs composed of S-PIEs with different structural unit energies and their S-PIE structural unit energies. Figure 7A shows an RNA denaturing gel of circular RNA precursors composed of S-PIEs with different structural unit energies cyclized into circular RNAs in vitro. Figure 7B shows an RNA denaturing gel of different cyclization efficiencies of circular RNAs T4 td, Ana 3.0 and S-PIE. Figure 8 shows the different expression levels of Luciferase encoded by circular RNAs containing S-PIEs with different structural unit energies in Hela cells using the same translation initiation element and having the same coding sequence. Figure 9 shows a schematic diagram of the mutant ribozyme recognition sites of the S-PIE fragments of the circular RNAs of two examples of S-PIE. Figure 10 shows an RNA denaturing gel of different cyclization efficiencies after mutating the ribozyme recognition sites of the S-PIE fragments of the circular RNAs of two examples of S-PIE. Figure 11 shows a schematic diagram of the paired nucleotide sequences of the secondary structure of a circular RNA of an example of S-PIE that mutates the S-PIE fragment composition. Figure 12 shows an RNA denaturing gel of different cyclization efficiencies of a circular RNA of an example of S-PIE that mutates the paired nucleotide sequences of the secondary structure of the S-PIE fragment composition. Figure 13 shows a schematic diagram of the unpaired nucleotide sequence of the secondary structure of the circular RNA mutation of an exemplary S-PIE that constitutes the S-PIE fragment. Figure 14A shows the unpaired nucleotide sequence of the secondary structure of the circular RNA mutation of an exemplary S-PIE that constitutes the S-PIE fragment, and an RNA denaturing gel image with different cyclization efficiencies. Figure 14B shows the unpaired nucleotide sequence of the secondary structure of the circular RNA mutation of an exemplary S-PIE that constitutes the S-PIE fragment, and a graph of the change in protein expression level. Figure 15 shows an RNA denaturing gel image with different cyclization efficiencies of the circular RNA of an exemplary S-PIE replacing coding elements of different lengths. Figure 16 shows a graph of the change in protein expression level of the circular RNA of an exemplary S-PIE replacing different translation initiation elements. Figure 17A shows an HPLC chromatogram of different treatment methods of the circular RNA of an exemplary S-PIE after IVT and after HPLC purification. Figure 17B shows an RNA denaturing gel image of different treatment methods of the circular RNA of an exemplary S-PIE after IVT, after purification by Rnase R treatment and after HPLC purification. Figure 18 shows a luminescence intensity graph of the circular RNA of an exemplary S-PIE expressing Luciferase protein after purification by Rnase R treatment and after HPLC purification. Figure 19 shows a graph of the transcriptional level difference of the immune response (IFN-beta, IL-6 and RIG-I) induced by the circular RNA of an exemplary S-PIE after purification by Rnase R treatment and after HPLC purification. Figure 20 shows a luminescence intensity graph of the circular RNA of an exemplary S-PIE and Cap1-m1Ψ-mRNA expressing Luciferase protein at different days after transfection of Hela cells. Figure 21 shows a luminescence intensity graph of the circular RNA of an exemplary S-PIE and Cap1-m1Ψ-mRNA accumulating and expressing Luciferase protein 6 days after transfection of Hela cells. Figure 22 shows a luminescence intensity graph of the circular RNA of an exemplary S-PIE assembled by cationic liposomes and intramuscularly injected into the thigh of a mouse at different days. Figure 23 shows an in vivo imaging graph of the circular RNA of an exemplary S-PIE assembled by cationic liposomes and intramuscularly injected into the thigh of a mouse, expressing Luciferase protein at 1, 6, and 11 days. Figure 24 shows a denaturing gel image of circular RNA of an example S-PIE, demonstrating that circular RNA of S-PIE without a homologous arm sequence can also efficiently complete circularization. Detailed implementation Definition As used in the claims and the specification, the words "comprising", "having", "including", or "containing" mean inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Throughout the application, the term "about" means: a value includes the standard deviation of the error of the device or method used to measure the value. Although the disclosed content supports the definition of the term "or" as only alternatives and "and / or", unless explicitly stated as only alternatives or mutually exclusive alternatives, the term "or" in the claims means "and / or". The terms "polypeptide", "peptide", and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer can be linear or branched, it can contain modified amino acids, and it can have non-amino acid interruptions. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation, such as conjugation with a labeled component). As used in this disclosure, the "PIE system", also known as permuted introns and exons, is a method of using the self-splicing system of Group I Introns to ligate and form circular RNA. As used in this disclosure, Group I Introns refer to "Group I Introns", which have the property in GTP and Mg 2+A self-splicing system that undergoes self-cleavage and circularization in the presence of PIE. Group I introns are a class of very large ribozymes that can undergo self-splicing reactions and are usually widely present in many species, mainly participating in the catalytic excision of precursors of mRNA, tRNA, and rRNA. As shown in Figure 1, the relative positioning and base pairing interactions between the two intron halves (5H, 3H), the ribozyme recognition sites S1 and S2, the exon sequences E1 and E2, the internal guide sequence (IG) nucleotides and the RNA to be circularized (RC), as well as the added terminal homologous arms to promote intron folding and stability. RNA circularization occurs through a series of transesterification reactions, in which (i) a guanosine nucleophile inserts into the RC–5H junction (5’SS) and replaces the 3’ end of RC, and then (ii) inserts into the 3H-RC junction (3’SS), replacing the 3’ end of the intron 3H, because it is connected to the 5’ end of RC, thus forming circRNA. The uniqueness of the S1 and S2 segments in this process is that they are both integrated into the newly formed circRNA and participate in base pairing interactions with the intron sequence, which are considered crucial for catalytic activity. And E1 and E2 are important components affecting the circularization rate in this process. Truncating the E1 and E2 sequences will affect the circularization efficiency of circRNA. And E1 and E2 are also the main reasons why the circRNA circularized by the T4td system has low protein expression and high immunogenicity at the cellular level. As used in the present disclosure, "ribozyme", also known as ribozyme, is used to describe an RNA with catalytic activity. In some embodiments, the ribozyme recognition sites S1 and S2 in the present disclosure refer to polynucleotide sequences that can be recognized by the ribozyme and undergo internal phosphodiester bond cleavage when the RNA forms a ribozyme molecule with catalytic function. As used in the present disclosure, the term "circular nucleic acid molecule" refers to a nucleic acid molecule in a closed circular form. In some specific embodiments, the circular nucleic acid molecule is a circular RNA molecule. More specifically, the circular nucleic acid molecule is a circular mRNA molecule. As used in the present disclosure, the term "linear RNA" refers to a circular RNA precursor that can form circular RNA through a circularization reaction, which is generally transcribed from a linear DNA molecule (for example, a vector containing a recombinant nucleic acid molecule, etc.). As used in the present disclosure, the term "IRES" (Internal ribosome entry site) is also known as the internal ribosome entry site. The "internal ribosome entry site" (IRES) belongs to the translation control sequence, is usually located at the 5' end of the coding element, and enables the translation of RNA in a cap-independent manner. The transcribed IRES can directly bind to ribosome subunits so that the mRNA start codon is properly oriented in the ribosome for translation. The IRES sequence is usually located in the 5' UTR of mRNA (immediately upstream of the start codon). The IRES functionally replaces the need for various protein factors that interact with the eukaryotic translation mechanism. As used in the present disclosure, the term "translation initiation element" refers to any sequence element that can recruit ribosomes and initiate the translation process of RNA molecules. Exemplarily, the translation initiation element is an IRES element, an m6A modification sequence, or an initiation sequence for rolling circle translation, etc. In the present disclosure, the terms "coding element", "protein coding region", and "Open Reading Frame (ORF)" can be used interchangeably. The coding element starts from the start codon and has a continuous nucleotide sequence with the potential to encode a protein. In some embodiments, the coding element ends at the stop codon; in other embodiments, the coding region may not contain a stop codon either. In the present disclosure, when the coding element contains two or more target polypeptides, two adjacent coding regions can be linked by a linker or a translation initiation element. It should be noted that the number of coding regions can be one or more than two, and the present disclosure does not list them all. The term "expression" includes any step involved in polypeptide production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion. The term "antibody" is used in the broadest sense herein and refers to a protein containing an antigen-binding site, covering natural antibodies and artificial antibodies of various structures, including but not limited to polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutant, and grafted antibodies. The term "antibody" also includes antibody fragments such as Fab, F(ab’)2, FV, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function. Usually, such fragments will include antigen-binding fragments. As used herein, the term "hybridization" refers to the process by which bases on one nucleic acid strand bind through base pairing to complementary bases on another nucleic acid strand. The hybridization reaction can be selective such that a particular target sequence can be selected from a sample even when present at low concentration. The stringency of the hybridization conditions (e.g., high stringency, medium stringency, stringent) can be adjusted by, for example, the concentration of salt or formamide in the prehybridization solution and the hybridization solution, or the hybridization temperature, etc. For example, stringency can be increased by decreasing the salt concentration, increasing the formamide concentration, or raising the hybridization temperature. Generally, stringent conditions include hybridization at a temperature of about 25°C to about 42°C, in at least about 0% to at least about 15% v / v formamide and at least about 1 M to at least about 2 M salt, and washing in at least about 1 M to at least about 2 M salt; medium stringency conditions include hybridization at a temperature of about 25°C to about 65°C, in at least about 16% to at least about 30% v / v formamide and at least about 0.5 M salt to at least about 0.9 M salt, and washing in at least about 0.5 M to at least about 0.9 M salt; high stringency conditions include hybridization at a temperature of at least about 65°C, in at least about 31% to at least about 50% v / v formamide and at least about 0.01 M to at least about 0.15 M salt, and washing in at least about 0.01 M to at least about 0.15 M salt; formamide is optional in these hybridization conditions. Other suitable hybridization buffers and conditions are well known to those skilled in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manua1, 2nd ed. Cold Spring Harbor Press, Plainview, N.Y. (1989); and A Subel et al., Short Protocols in Molccular Biology, 4th cd., John Wilcy & Sons (1999). As used in the context of the present disclosure, the term "pharmaceutically acceptable carrier" refers to auxiliary materials widely adopted in the field of drug production. The main purpose of using a carrier is to provide a drug composition that is safe to use, has stable properties, and / or has specific functionality. It also aims to provide a method such that after administering the drug to a subject, the active ingredient can dissolve at a desired rate or promote the effective absorption of the active ingredient in the subject receiving the drug. A pharmaceutically acceptable carrier can be an inert filler or an active ingredient that provides a certain function to the pharmaceutical composition (such as stabilizing the overall pH value of the composition or preventing the degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable carriers include, but are not limited to, binders, suspending agents, emulsifying agents, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesion agents, glidants, wetting agents, gelling agents, absorption retardants, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc. As used in this disclosure, the terms "complementary" or "hybridizing" are used to refer to "polynucleotides" and "oligonucleotides" (which are interchangeable terms referring to nucleotide sequences) related to base pairing rules. For example, the sequence "CAGT" is complementary to the sequence "GTCA". Complementation or hybridization can be "partial" or "complete". "Partial" complementation or hybridization means that one or more nucleic acid bases are mismatched according to the base pairing rules, and "complete" or "total" complementation or hybridization between nucleic acids means that each nucleic acid base matches the other base under the base pairing rules. The degree of complementation or hybridization between nucleic acid strands has an important impact on the hybridization efficiency and strength between nucleic acid strands. This is particularly important in amplification reactions and detection methods that depend on the binding between nucleic acids. The term "recombinant nucleic acid molecule" refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide can be included in a suitable vector, and the vector can be used to transform into a suitable host cell. Then the polynucleotide is expressed in the recombinant host cell to produce, for example, "recombinant polypeptide", "recombinant protein", "fusion protein", etc. The term "recombinant expression vector" refers to a DNA construct used for expressing, for example, a polynucleotide encoding a desired polypeptide. A recombinant expression vector can include, for example, a transcriptional subunit comprising i) a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into a protein; and iii) appropriate transcriptional and translational start and stop sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector can be used, including plasmids, viruses, bacteriophages, and transposons. Possible vectors for the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as viral plasmids, bacterial plasmids, bacteriophage DNA, yeast plasmids, and vectors derived from combinations of plasmid and bacteriophage DNA, DNA from viruses such as lentivirus, retrovirus, vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies. The term "host cell" refers to a cell into which an exogenous polynucleotide has been introduced, including progeny of such a cell. Host cells include "transformants" and "transformed cells", which include the originally transformed cell and progeny derived therefrom. A host cell is any type of cell system that can be used to produce the antibody molecules of the present invention, including eukaryotic cells, such as mammalian cells, insect cells, yeast cells; and prokaryotic cells, such as Escherichia coli cells. Host cells include cultured cells, and also include cells within transgenic animals, transgenic plants, or cultured plant or animal tissues. The term "recombinant host cell" encompasses a host cell that is different from the parental cell after introduction of a recombinant nucleic acid molecule, a recombinant expression vector, or a circular RNA. The recombinant host cell is specifically achieved by transformation. The host cells of the present disclosure can be prokaryotic cells or eukaryotic cells, as long as they are cells capable of importing the recombinant nucleic acid molecules, recombinant expression vectors, circular RNAs, etc. of the present disclosure. As used in the present disclosure, the terms "individual", "patient", or "subject" include mammals. Mammals include, but are not limited to, domestic animals (such as cows, sheep, cats, dogs, and horses), primates (such as humans and non-human primates like monkeys), rabbits, and rodents (such as mice and rats). As used in the present disclosure, the terms "transformation", "transfection", and "transduction" have the meanings generally understood by those skilled in the art, which refer to the process of introducing exogenous DNA into a host. The methods of transformation, transfection, and transduction include any method of introducing nucleic acid into a cell, and these methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method. As used in the present disclosure, "treatment" means that after a subject has contracted a disease, the subject is contacted (e.g., administered) with the circular RNAs, circular precursor RNAs, compositions, etc. of the present invention, so that the symptoms of the disease are alleviated compared to when not contacted, and it does not necessarily mean complete suppression of the symptoms of the disease. Contracting a disease means that the body exhibits symptoms of the disease. As used in the present disclosure, "prevention" means that before a subject contracts a disease, by contacting (e.g., administering) the subject with the circular RNAs, compositions, etc. of the present invention, the symptoms after contracting the disease are alleviated compared to when not contacted, and it does not necessarily mean complete suppression of the disease. As used in the present disclosure, the term "effective amount" refers to such an amount or dose of the recombinant nucleic acid molecule, recombinant expression vector, circular precursor RNA, circular RNA, vaccine or composition of the present invention that, when administered to a patient in a single or multiple doses, produces the desired effect in a patient in need of treatment or prevention. The effective amount can be readily determined by an attending physician, who is a person skilled in the art, by considering various factors such as: the species of mammal; its size, age and general health; the specific disease involved; the degree or severity of the disease; the response of the individual patient; the specific antibody administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dosing regimen; and the use of any concomitant therapies. Unless otherwise defined or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure pertains. S-PIE system The process of forming circular RNAs by the traditional PIE system is shown in Figure 2, where the linear RNA includes the following elements connected in sequence: 3' intron, second exon E2, spacer 1, foreign fragment, spacer 2, first exon E1, and 5' intron. When GTP and Mg 2+ are present in the environment, GTP attacks the connection position between E1 and the 5' intron, generating a break at the 5' splicing site (5'ss) and releasing the 5' intron; then the 3'-OH end of E1 attacks the connection position between the 3' intron and E2, generating a break at the 3' splicing site (3'ss) and releasing the 3' intron; finally, the target circular RNA is formed by ligation. However, the application of traditional PIE systems results in the presence of additional exon sequences of E1 and E2 in circular RNAs, reducing the sequence accuracy of circular RNAs, increasing the innate immunogenicity of circular RNAs, making them prone to degradation within cells, and resulting in a lower expression level of the target polypeptide. However, simply deleting the additional E1 and E2 sequences and only retaining the ribozyme recognition sites S1 and S2 will significantly reduce the cyclization rate and the production efficiency of cricRNAs. To solve the above problems, the present invention provides a recombinant nucleic acid molecule, providing a structurally novel S-PIE system library for the in vitro preparation of circular RNAs. By introducing S-PIE sequences with unique secondary structures, the introduction of natural additional E1 and E2 exons in circular RNAs can be avoided, and the cyclization rate of circular RNA molecules can be increased while reducing the immunogenicity of circular RNAs. Moreover, this S-PIE system can be used with a variety of IRESs and encode polypeptide sequences of various lengths, possessing high versatility and having good application prospects in the fields of nucleic acid vaccines, expression of therapeutic proteins, gene therapy, etc. In the present disclosure, the S-PIE system includes, but is not limited to, DNA constructs for preparing circular RNAs, recombinant expression vectors comprising the DNA constructs, circular precursor RNA molecules obtained by in vitro transcription using the recombinant expression vectors, and the like. In some embodiments, the present disclosure provides a recombinant nucleic acid molecule for preparing circular RNAs. Exemplarily, the recombinant nucleic acid molecule can be the above-mentioned DNA construct for preparing circular RNAs, circular precursor RNA molecule, etc. In some embodiments, the structure of the recombinant nucleic acid molecule is as shown in Figure 2 or 3. Along the 5' to 3' direction, it includes elements arranged in the following order: intron fragment I, S sequence fragment I, translation initiation element, coding element, S sequence fragment II, intron fragment II. Among them, S sequence fragment I consists of a first preset number of nucleotides and, after cyclization is completed, forms a structural unit S-PIE fragment with secondary structure together with S sequence fragment II. This structural unit S-PIE fragment has a first preset structural unit energy (structuredness). The calculation method of the structural unit energy (structuredness) is as follows: The minimum free energy ΔG can be calculated by RNA secondary structure simulation software such as RNAfold, which indicates the structural stability degree of the S-PIE sequence fragment, and nt is the sum of the first preset number and the second preset number. The present disclosure provides a structurally novel S-PIE system library for in vitro preparation of circular RNAs. By introducing S-PIE sequences with unique secondary structures, additional exons and spacer sequences are avoided from being introduced into circular RNAs, greatly improving the cyclization rate of circular RNA molecules, thereby reducing the immunogenicity of circular RNAs. Moreover, this S-PIE system can be used with any IRES and for encoding polypeptide sequences of any length, featuring high versatility. In some embodiments, the recombinant nucleic acid molecules provided by the present invention include recombinant nucleic acid molecules in which the paired nucleotides of the secondary structure are replaced under the condition of maintaining the secondary structure of the S-PIE sequence unchanged. For example, in the S-PIE sequence composed of SEQ NO: 38 and SEQ NO: 103, in the secondary structure simulated by "GGGGAUUUCUCUGCUUCUGAAGUUGGGUCUCCCUCGACCUCGGAGGCUCCUCC" (SEQ NO: 126), the 5'-CUUCUG-3' and 5'-CGGAGG-3' in the paired region jointly form a paired region, where the 5'C of the former pairs with the 3'G of the latter, and the former pairs complementarily with the latter from 5' to 3' and the latter from 3' to 5'. Mutating and replacing any single pair or multiple pairs of complementary sequences therein will not affect the cyclization efficiency. In some embodiments, the recombinant nucleic acid molecules provided by the present invention include recombinant nucleic acid molecules in which the ribozyme recognition site is replaced under the condition of maintaining the secondary structure and the structural unit energy of the S-PIE sequence unchanged. In some embodiments, the recombinant nucleic acid molecules provided by the present invention include recombinant nucleic acid molecules in which the nucleotide sequences that are unpaired and do not form ribozyme recognition sites are replaced under the condition of maintaining the secondary structure, the structural unit energy and the ribozyme recognition site of the S-PIE sequence unchanged. Exemplarily, the unpaired nucleotide sequences are selected from GUACUAC (SEQ ID NO: 121), ACGUCUA (SEQ ID NO: 122) and AUCUCCU (SEQ ID NO: 123) or alternative sequences thereof, and can be partially or completely replaced. For example, in the S-PIE sequence composed of SEQ NO: 38 and SEQ NO: 103, the unpaired region UUUCUCU in the secondary structure simulated by "GGGGAUUUCUCUGCUUCUGAAGUUGGGUCUCCCUCGACCUCGGAGGCUCCUCC" (SEQ NO: 126) can be mutated to sequences such as GUACUAC, ACGUCUA, AUCUCCU, etc., while maintaining the cyclization rate unchanged. By introducing the S-PIE sequence with a unique secondary structure, the introduction of additional exons and spacer sequences in circular RNAs is avoided, the cyclization rate of circular RNA molecules is greatly increased, thereby reducing the immunogenicity of circular RNAs, and the S-PIE system can be used for any IRES and encode polypeptide sequences of any length, with high versatility. Translation initiation element In the present disclosure, the translation initiation element can be any type of element capable of initiating the translation of a target polypeptide. In some embodiments, the translation initiation element is an element comprising any one or more of the following sequences: IRES sequence, 5'LTR sequence, Kozak sequence, a sequence containing m 6 A modification (N(6)-methyladenosine modification), a complementary sequence of ribosomal 18SrRVA. In some other embodiments, the translation initiation element can also be any other type of cap-independent translation initiation element. In some embodiments, the translation initiation element is an IRES element, and the sources of the IRES element include but are not limited to viruses, mammals, Drosophila, etc. In some alternative embodiments, the IRES element is derived from a virus. Exemplarily, the IRES element contains the IRES sequence from the Coxsackievirus RNA virus. Further, the IRES element includes but is not limited to the IRES sequences derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, TurdivirS 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murinc kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Human parechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, French Guiana picornavirus, etc. In some alternative embodiments, the recombinant nucleic acid molecule provided by the present disclosure, along the 5' to 3' direction, is composed of the following elements: intron fragment I, S sequence fragment I, translation initiation element, coding element, S sequence fragment II, intron fragment II. In some other alternative embodiments, the recombinant nucleic acid molecule may further include any one or more than two other elements. For example, a transcriptional regulatory element for regulating the transcriptional level, a translational regulatory element for regulating the translational level, a purification element for purifying and preparing circular RNA, and the like. In some other alternative embodiments, one or more pairs of translation initiation element and coding element combinations may be added between the coding element and S sequence fragment II or between S sequence fragment I and the translation initiation element in the recombinant nucleic acid molecule, and the number may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. In some alternative embodiments, the recombinant nucleic acid molecule provided by the present disclosure, along the 5' to 3' direction, is composed of the following elements: intron fragment III, S sequence fragment III, translation initiation element, coding element, S sequence fragment IV, intron fragment IV. In some other alternative embodiments, the recombinant nucleic acid molecule may further include any one or more than two other elements. For example, a transcriptional regulatory element for regulating the transcriptional level, a translational regulatory element for regulating the translational level, a purification element for purifying and preparing circular RNA, and the like. In some other alternative embodiments, one or more pairs of translation initiation element and coding element combinations may be added between the coding element and S sequence fragment IV or between S sequence fragment III and the translation initiation element in the recombinant nucleic acid molecule, and the number may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. Intron fragment The intron fragment in the present disclosure is derived from group I introns. Group I introns have ribozyme activity for self-splicing reactions and are widely present in various species. Exemplarily, group I introns include but are not limited to the T4 phage td gene, Anabaena lRNALeu, TpaCOX2, Ptu, and the like. In some embodiments, intron fragment I and intron fragment II are derived from group I introns and respectively contain partial sequences near the 3' direction and partial sequences near the 5' direction that make up group I introns. The ribozyme recognition site in the S-PIE fragment is derived from the ribozyme recognition sites of the exon sequences (Exon 1, E1) and exon sequences (Exon 2, E2) connected by group I introns. Intron fragment I is connected to S sequence fragment I, and intron fragment II is connected to S sequence fragment II to form a self-splicing PIE system. In some alternative embodiments, the nucleotides of S sequence fragment I are selected from 3 to 100 nucleotides, preferably 3 to 50 nucleotides. Exemplarily, the first preset number can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 52, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, and any integer value between any two of them. In some alternative embodiments, the nucleotides of S sequence fragment II are selected from 1 to 100 nucleotides, preferably 1 to 50 nucleotides. Exemplarily, the second preset number is 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 10, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, and any integer value between any two of them. Wherein, the first preset structural unit energy is selected from between -0.7 and -0.1 (including -0.6 and -0.1), preferably between -0.6 and -0.2 (including -0.6 and -0.2), preferably -0.6 to -0.4. The calculation method of the structural unit energy (structuredness) is as follows: The minimum free energy ΔG can be calculated by RNA structure simulation software such as RNAfold, which indicates the structural stability degree of the S-PIE sequence fragment, and nt is the sum of the first preset number and the second preset number. In some alternative embodiments, the Group I intron is the T4 td Intron derived from the T4 phage td gene, and its Intron secondary structure is shown in Figure 1. The nucleotide sequences of the ribozyme recognition sites for circularization in the T4 td Intron are "5'-TTGGGTCT-3', 5'-TTAGGTCT-3', 5'-TCGGGTCT-3', 5'-TAGGGTCT-3', 5'-TTCGGCTT-3', 5'-TTCGGTCT-3', 5'-TTGGGCCT-3', 5'-TTGGGGCT-3', 5'-TTTGGTCT-3'", etc. Among them, the circularization position is between the 6th and 7th bases in the 5' to 3' direction. The 5' end of the S fragment I contains the 7th and 8th bases in the 5' to 3' direction of the ribozyme recognition site, such as 5'-CT-3'. The 3' end of the S fragment II contains the 1st to 6th bases in the 5' to 3' direction of the ribozyme recognition site, such as 5'-TTGGGT-3'. After circularization, the S fragment I and the S fragment II form the S-PIE fragment, forming a special secondary structure with structural unit energy; the 5' end of the S fragment III contains the 3rd to 8th bases in the 3' to 5' direction of the ribozyme recognition site, such as 5'-TGGGTT-3'. The 3' end of the S fragment IV contains the 1st to 2nd bases in the 3' to 5' direction of the ribozyme recognition site, such as 5'-TC-3'. After circularization, the S fragment III and the S fragment IV form the S-PIE fragment, forming a special secondary structure with structural unit energy. In some alternative embodiments, the nucleotide sequence of the intron fragment I derived from the T4 td Intron has a sequence identity of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% with the nucleotide sequence shown in SEQ ID NO:57. In some alternative embodiments, the nucleotide sequence of the intron fragment II derived from the T4 td Intron has a sequence identity of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% with the nucleotide sequence shown in SEQ ID NO:56. In some alternative embodiments, the Group I intron is TpaCOX2 intron, and TpaCOX2 intron is the intron sequence of the cox2 gene of the mitochondrial cytochrome oxidase subunit of T. papilionaceS. The nucleotide sequence of the ribozyme recognition site for cyclization in TpaCOX2 intron is "5'-ACGTCTTAACCAA-3'" (SEQ ID NO: 80), where the cyclization position is between the 7th and 8th bases in the 5' to 3' direction. The 5' end of S sequence fragment I contains the 8th to 13th bases in the 5' to 3' direction of the ribozyme recognition site, such as 5'-AACCAA-3', and the 3' end of S sequence fragment II contains the 1st to 7th bases in the 5' to 3' direction of the ribozyme recognition site, such as 5'-ACGTCTT-3'. After cyclization, S sequence fragment I and S sequence fragment II form the S-PIE fragment, forming a special secondary structure with structural unit energy; the 5' end of S sequence fragment III contains the 7th to 13th bases in the 3' to 5' direction of the ribozyme recognition site, such as 5'-TTCTGCA-3', and the 3' end of S sequence fragment IV contains the 1st to 6th bases in the 3' to 5' direction of the ribozyme recognition site, such as 5'-AACCAA-3'. After cyclization, S sequence fragment III and S sequence fragment IV form the S-PIE fragment, forming a special secondary structure with structural unit energy. In some alternative embodiments, the Group I intron is Ptu Intron. Ptu is the precursor RNA of the large subunit ribosomal RNA (rrnl) in the chloroplast of pedinomonas tuberculata, and pedinomonas tuberculata is a green algae in the family Pseudomonadaceae. The nucleotide sequence of the ribozyme recognition site for cyclization in Ptu intron is "5'-AGGGATCA-3'", where the cyclization position is between the 6th and 7th bases in the 5' to 3' direction. The 5' end of S fragment I contains the 7th to 8th bases in the 5' to 3' direction of the ribozyme recognition site, such as 5'-CA-3', and the 3' end of S fragment II contains the 1st to 6th bases in the 5' to 3' direction of the ribozyme recognition site, such as 5'-AGGGAT-3'. After cyclization, S fragment I and S fragment II form the S-PIE fragment, forming a special secondary structure with structural unit energy; the 5' end of S fragment III contains the 3rd to 8th bases in the 3' to 5' direction of the ribozyme recognition site, such as 5'-TAGGGA-3', and the 3' end of S fragment IV contains the 1st to 2nd bases in the 3' to 5' direction of the ribozyme recognition site, such as 5'-AC-3'. After cyclization, S fragment III and S fragment IV form the S-PIE fragment, forming a special secondary structure with structural unit energy. It should be noted that the present disclosure does not limit the sequences of ribozyme recognition sites and intron fragments. As long as they are derived from group I introns and can effectively form a loop, circular RNAs can be prepared in vitro. Target polypeptide The present disclosure does not limit the types of target polypeptides, which can be human proteins or non-human proteins. Exemplarily, the target polypeptide includes but is not limited to antigens, antibodies, antigen-binding fragments, fluorescent proteins, proteins with disease treatment activities, proteins with gene editing activities, etc. In the present disclosure, the term "antibody" is used in the broadest sense to refer to a protein containing an antigen-binding site, covering natural antibodies and artificial antibodies of various structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, intact antibodies, and antibody fragments. In the present disclosure, the term "antigen-binding fragment" is a part or segment of a complete or full antibody that has fewer amino acid residues than the complete or full antibody and can bind an antigen or compete with the complete antibody (i.e., the complete antibody from which the antigen-binding fragment is derived) for binding to the antigen. Antigen-binding fragments can be prepared by recombinant DNA technology, or by enzymatic or chemical cleavage of a complete antibody. Antigen-binding fragments include but are not limited to Fy, Fah, Fab', Fah3-SH, F(ab’)2; diabodies; linear antibodies: single-chain antibodies (e.g., scFv): single-domain antibodies; bivalent or bispecific antibodies or fragments thereof; camelid antibodies (heavy-chain antibodies): and bispecific or multispecific antibodies formed from antibody fragments. In the present disclosure, proteins with disease treatment activities can include but are not limited to enzyme replacement proteins, proteins for supplementation, protein vaccines, antigens (e.g., tumor antigens, viruses, bacteria), hormones, cytokines, antibodies, immunotherapies (e.g., for cancer), cell reprogramming / transdifferentiation factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (e.g., affecting susceptibility to immune responses / signaling), regulated death effector proteins (e.g., inducers of apoptosis or necrosis), non-lytic inhibitors of tumors (e.g., oncoprotein inhibitors), epigenetic modifiers, epigenetic enzymes, transcription factors, DNA or protein modification enzymes, DNA intercalators, efflux pump inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, enzyme competitive inhibitors, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains, ligands or receptors, and CRISPR systems or their components, etc. Coding elements for forming one or more coding regions In some embodiments, the recombinant nucleic acid molecule is used to prepare a circular RNA comprising a coding element, wherein the coding element in the circular RNA is used to express a target polypeptide. In some embodiments, the coding region can tandemly express multiple segments of target polypeptides through a linker, and the linker can be a polynucleotide encoding a 2A peptide. Among them, the 2A peptide is a short peptide (~18-25 amino acids) derived from a virus, and they are usually referred to as "self-cleaving" peptides, which can generate multiple proteins from one transcript. Exemplarily, the 2A peptide is P2A, T2A, E2A, F2A, etc. The number of target polypeptide sequences encoded can be 2, 3, 4, 5, 6, 7, 8, 9. Examples Example 1: Establishing the S-PIE sequence set As shown in Figure 4, this example illustrates how to establish and screen the S-PIE sequence set containing the GroupⅠ ribozyme recognition site, and establish the relationship between the S-PIE fragment and the unit structural energy. S1. Determine the ribozyme recognition point sequence set: TTGGGTCT, TTAGGTCT, TCGGGTCT, TAGGGTCT, TTCGGCTT, TTCGGTCT, TTGGGCCT, TTGGGGCT, TTTGGTCT, etc. Among them, the ribozyme recognition site includes but is not limited to the above sequences. S2. Randomly generate a nucleotide sequence with a length of α at the 5' end of the ribozyme recognition point sequence set described in S1, where 0≦α≦100. At the same time, randomly generate a nucleotide sequence with a length of β at the 3' end of the ribozyme recognition point sequence, where 0≦β≦100, and set the GC content of the sequence to be between 30-70%, to obtain a new sequence set. S3. Perform batch secondary structure calculation and simulation on the sequence set described in S2 through RNA secondary structure simulation calculation software to obtain the sequence secondary structure, and retain its minimum secondary structure unit to form a new sequence set. Among them, the definition of the minimum secondary structure unit is: the sequences at both the 5' end and the 3' end of the ribozyme recognition point sequence in S1 form a paired structure with each other, but the sequences on one side do not independently form a secondary structure. Among them, for some sequence structures, independent secondary structures at the 5' end and (or) 3' end will appear during multiple simulations in the RNA secondary structure simulation calculation software, and this sequence is also included in the protection scope. Judge the secondary sequence information of the sequence set described in S2, and judge from the 5' end to the 5' end direction of the ribozyme recognition site in S1: Judge from the 3' end to the 5' end direction of the ribozyme recognition site in S1: 1) When this nucleotide pairs with the nucleotide +1 and above in the 3' end direction, judge the next nucleotide in the 5' end direction of this nucleotide. 2) When this nucleotide has no pairing information, judge the next nucleotide in the 5' end direction of this nucleotide. 3) When the nucleotide pairs with the nucleotide at the +1 position and above in the 5'-end direction of the nucleotide, the nucleotide at the +1 position and above in the 3'-end direction of the nucleotide is intercepted as the 5'-end. Judge from the 5'-end to the 3'-end direction of the ribozyme recognition site of S1: a) When the nucleotide pairs with the nucleotide at the +1 position and above in the 5'-end direction of the nucleotide, judge the next nucleotide in the 3'-end direction of the nucleotide. b) When there is no pairing information for the nucleotide, judge the next nucleotide in the 3'-end direction of the nucleotide. c) When the nucleotide pairs with the nucleotide at the +1 position and above in the 3'-end direction of the nucleotide, the nucleotide at the +1 position and above in the 5'-end direction of the nucleotide is intercepted as the 3'-end. Build a data set with the newly obtained nucleotide sequence. S4. Calculate the structural unit energy (stressedness) according to the formula described in claim 5, and sort the sequence set of S3 to obtain the relationship between the structural unit energy and the sequence set. The calculation method of the structural unit energy (structuredness) is as follows: Calculate the minimum free energy ΔG (The minimum free energy) of the secondary structure, which indicates the structural stability degree of the S-PIE sequence fragment, and nt is the sum of the first preset quantity and the second preset quantity. S5. Through the above method, obtain a sequence set, which contains the relationship between the sequence and the structural unit energy. Randomly select 59 sequences from the sequence set according to the structural unit energy, and divide them into S fragment Ⅰ and S fragment 2 from the ribozyme recognition site. Example 2: Batch screening of the in vitro cyclization efficiency of S-PIE fragments with different structural unit energies This example provides the method and results for screening S-PIE fragments for encoding and expressing circular mRNA of luciferase in the present disclosure. (1) Plasmid construction of S-PIE-luciferase gene Through the method provided in Example 1, obtain the S-PIE fragment to be verified. Divide the S-PIE fragment into S sequence fragment Ⅰ and S sequence fragment Ⅱ between the 6th and 7th nucleotides of the ribozyme recognition site. Taking the ribozyme recognition site "5'-TTGGGTCT-3'" as an example, S sequence fragment Ⅰ is the "5'-CT-3'" sequence containing the ribozyme recognition site at the 5'-end, and S sequence fragment Ⅱ is the "5'-TTGGGT-3'" sequence containing the ribozyme recognition site at the 3'-end. The amino acid and nucleotide sequences involved in this example are shown in Table 1 below. The PUC57-T4td-IRES-Luciferase gene sequence was synthesized by entrusting Nanjing Genscript Biotech Co., Ltd., and the sequence is as shown in (seq). The obtained gene fragment was ligated to the pUC57 vector by homologous recombination, and positive colonies selected by resistance screening were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. (2) Preparation of linearized plasmid template 1) Plasmid extraction ① Pick a monoclonal colony with successful sequencing and culture it overnight at 37°C in a constant temperature shaker at 220 rpm; ② Extract the plasmid according to the instructions of the Tiangen Rapid Plasmid Mini Kit, measure the concentration using Nanodrop, and store it at -20°C for later use. 2) Plasmid digestion The plasmid prepared in step 1) above was digested by single digestion with XbaI, and the digestion system is shown in Table 1 below: Table 1 Digest overnight at 37°C. Purify the digested product using the Tiangen Large DNA Product Purification Kit, measure the concentration using Nanodrop, and identify the digested product by 1% agarose gel electrophoresis. The purified linearized plasmid template is stored at -20°C for later use in in vitro transcription. As shown in Figure 5, the digested plasmid shows a single band, meeting the requirements for in vitro transcription. (3) Preparation of circular mRNA by in vitro transcription 1) In vitro transcription mRNA was synthesized using a high-yield RNA synthesis kit (<2000 nt) (Wuhan Hanhai New Enzyme Biotechnology Co., Ltd.), and the transcription system is shown in Table 2 below: Table 2 Incubate at 37°C for 4 h, and then digest the linear DNA template with DNase I (Wuhan Hanhai New Enzyme Biotechnology Co., Ltd.). Digestion conditions: 37°C, 15 min. 2) mRNA purification The transcription product obtained in step 1) above was purified using RNAclean beads (Suzhou Nearshore Protein Technology Co., Ltd.), the mRNA concentration was measured using Nanodrop, and the RNA size was identified by 1% denaturing agarose gel electrophoresis. The preparation method of 1% denaturing agarose gel is as follows: Weigh 0.5 g of agarose, add 40 ml of DEPC-treated RNase-free Water, and dissolve it by microwave heating; cool to about 60°C, add 9 ml of formaldehyde solution and 5 ml of 10×MOPS in the fume hood, add nucleic acid dye at a ratio of 1:10000, and pour the gel; The procedure of denaturing agarose gel electrophoresis is as follows: Mix the mRNA solution with a concentration of about 300 ng / μl with an equal volume of 2×RNA Loading buffer, and denature it at 65°C for 10 min. Load the sample and perform electrophoresis under the conditions of 150 V / 25 min. After electrophoresis is completed, take a photo using a gel imaging system. 3) Screening of circular mRNA by RNase R Compared with linear mRNA, circular mRNA has better tolerance to RNase R. Use RNase R (Shanghai Beyotime Biotechnology Co., Ltd.) to digest linear mRNA to obtain effective circular mRNA. The RNase R digestion system is prepared as shown in Table 3 below and digested at 37°C for 10 min. Table 3 Experimental results: Figure 6 shows the relationship between the cyclization rate of recombinant nucleic acid molecules composed of S-PIE with different structural unit energies and their S-PIE structural unit energies. Experiments found that when the structural unit energy range is between -0.2 and -0.6, the cyclization rate of S-PIE recombinant nucleic acid molecules can be maintained above 70%, higher than 69% of the recombinant nucleic acid molecules of the T4td natural structure exon; while when the structural unit energy range is between -0.37 and -0.6, the cyclization rate of S-PIE recombinant nucleic acid molecules can be maintained above 90%. The structural unit energy of some sequences is near -0.1, and its cyclization rate also reaches near 90%. This shows that there is a correlation between the cyclization efficiency catalyzed by the T4td intron ribozyme and the stability of the secondary structure between its exon sequences. Through our screening, we can effectively improve its cyclization rate by replacing the original exon sequence with the S-PIE fragment. Figure 7A shows the RNA denaturing gel of recombinant nucleic acid molecules composed of S-PIE with some representative different structural unit energies circularized into circular RNA in vitro. By treatment with Rnase R, most of the uncircularized RNA can be eliminated to compare the cyclization efficiency of RNA. Figure 7B shows the difference in cyclization efficiency among T4td, Ana 3.0, and S-PIE after one-step transcription. It can be clearly seen from the RNA denaturing gel that S-PIE has a higher cyclization rate, which can reduce the difficulty of later purification and increase the yield. Demonstratively, the relationship between the cyclization rate of recombinant nucleic acid molecules composed of S-PIE with different structural unit energies obtained by the above method and their S-PIE structural unit energies, the normalized luminescence intensity is shown in Table 4. Table 4 Example 3: Batch screening of S-PIE circular mRNA with different structural unit energies for protein expression at the cellular level In this example, the circular mRNA digested by RNase R prepared in Example 2 was transfected into Hela cells, and the circular mRNA was screened by detecting the luciferase protein expression of the circular mRNA synthesized in vitro by the method of the present disclosure. The specific process is as follows: (1) Cell culture Hela was inoculated in MEM medium containing 10% fetal bovine serum and 1% double antibody and cultured in a 37°C, 5% CO2 incubator. The cells were passaged every 2 - 3 days. (2) Cell transfection One day in advance, Hela cells were seeded in 96-well plates at 1×10 4 cells / well and cultured in a 37°C, 5% CO2 incubator. After the cell confluence rate reached 90%, Lipofectamine TM MessengerMAX TM Reagent (invitrogen) was used to transfect the mRNA into the two types of cells at a dose of 100 ng / well. The specific operation is as follows: 1) Dilute Lipofectamine TM MessengerMAX TM Reagent as shown in Table 5 below: Table 5 After dilution and mixing, incubate at room temperature for 10 min; 2) Dilute the mRNA as shown in Table 6 below: Table 6 3) Mix the above mixtures 1) and 2) in a 1:1 volume ratio and incubate at room temperature for 5 min; 4) Take the above mRNA-lipid mixture and slowly add it to the 96-well plate at 10 μl / well, and continue to culture in a 37°C, 5% CO2 incubator. (3) Cell fluorescence detection Hela cells 24 hours after transfection were centrifuged at 300 g for 5 min using a tabletop centrifuge. The supernatant was discarded, and the cells were washed twice with PBS. Then, 1× cell lysis buffer (5× cell lysis buffer diluted with PBS) was added, and the cells were lysed at 4°C for 15 min. 20 μl of the lysate was added to a black 96-well plate, and 100 μl of luciferase assay reagent was added. The level of Luciferase enzyme reflecting RNA expression was observed by a microplate reader through the luminescence intensity of the luciferin substrate catalyzed by the luciferase enzyme. The results showed that: Figure 8 shows circular RNAs of S-PIE containing different structural unit energies. Using hela cells as experimental cells and the same translation initiation element, different expression levels of Luciferase protease with the same coding sequence were obtained. The results indicate that there is no direct correlation between the cyclization rate of circular RNAs of S-PIE containing different structural unit energies and the expression level of the target polypeptide after RR treatment. After replacing the exon of T4td with the S-PIE fragment, most S-PIE circular RNAs showed better protein expression levels, with a maximum increase in luminescence expression intensity compared to T4td by 146 times. Even for the S-PIE sequence with a more stable secondary structure (unit structure energy <0.4), a fluorescence intensity increase of 50 - 100 times was still observed. The stable secondary structure of the S-PIE sequence did not affect protein expression while effectively increasing the cyclization rate. Example 4: Effect of mutating the sequence of the ribozyme recognition site on the cyclization efficiency. In this example, taking two S-PIE sequences with relatively high cyclization rates and protein translation rates as examples, without affecting their secondary structures and the sequences of the structural energy units, the present disclosure mutated some sequences at the ribozyme site and detected its effect on the cyclization rate. The mutated sequences are shown in Figure 9. The method for calculating the cyclization rate was the same as in Example 2. As shown in Figure 10, it was found in this example that when the second position of "TTGGGTCT" at the ribozyme recognition site was mutated to A, the cyclization rates of the recombinant nucleic acid molecules of the two S-PIEs would decrease, and no change in the cyclization rate occurred for mutations at other selected sites. Example 5: Effect of mutating the structure pairing sequence on the cyclization efficiency. In this example, taking one S-PIE sequence with relatively high cyclization rate and protein translation rate as an example, without affecting its secondary structure, the present disclosure mutated the pairing sequences constituting the secondary structure of the S-PIE fragment and calculated its structural unit energy, with the change value of the unit structural energy within 0.03, and detected its effect on the cyclization rate. The mutated sequences are shown in Figure 11. As shown in Figure 12, the present disclosure found that, without affecting its secondary structure, mutating the secondary structure sequence constituting the S-PIE fragment did not significantly affect the cyclization rate. Example 6: Effects of mutating unstructured paired sequences on cyclization efficiency and expression level. In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, without affecting its secondary structure, the present disclosure mutated the unpaired sequences constituting the S-PIE fragment and calculated its unit structure energy. The change value of its unit structure energy was within 0.02. The effect on the cyclization rate was detected, and the mutated sequence is shown in Figure 13. Figure 14a shows that in this example, it was found that without affecting its secondary structure, mutating the unpaired sequences constituting the S-PIE fragment did not affect the cyclization rate. Figure 14b shows that in this example, it was found that without affecting its secondary structure, mutating the unpaired sequences constituting the S-PIE fragment, the change of the unpaired sequences would affect the expression of the target protein. Example 7: Effects of ORF sequences of different lengths on cyclization efficiency. In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, protein gene sequences with lengths of about 800bp, 1500bp, and 4000bp were integrated into the coding element of S-PIE by homologous recombination. The lengths of the cyclized RNA sequences were about 1600nt, 2300nt, and 4800nt. After in vitro transcription and purification by Rnase R digestion, the cyclization status was observed by calculating with RNA denaturing gel. Figure 15 shows that the S-PIE system did not cause a decrease in cyclization efficiency due to the increase in sequence length. This may benefit from the stable secondary structure of S-PIE. Even when dragging a sequence with a length close to 5000nt, the distance between the intron ribozyme and the cleavage site can still be kept close. Example 8: Effects of different IRESs on protein expression In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, different types of translation initiation elements were integrated into the translation initiation element of S-PIE by homologous recombination to screen for the optimal translation initiation element for expression. Figure 16 shows that replacing different IRESs as translation initiation cases can all initiate the expression of the target protein, and CVB3 has the best protein expression efficiency as a translation initiation element. Example 9: HPLC purification improves the expression level of S-PIE circular RNA Taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, a mixture of mRNA, DNA, enzymes, solvents, etc. obtained by one-step in vitro transcription of a linearized template was transfected into Hela cells after HPLC purification, and the expression of circular mRNA synthesized in vitro by the method of the present disclosure in Hela cells was detected. The specific process is as follows: (1) HPLC purification Purify the S-PIE RNA purified by magnetic beads after IVT using a C18 chromatographic column (5um, 4.6*250mm). Purification is carried out through the following gradient program: Eluent A: 50 mM TEAA (PH 8.5) Eluent B: 55% ACN / 50 mM TEAA (PH 8.5) Column temperature: 55 °C Flow rate: 1 ml / min Sample loading volume: 20 ul Composition of eluent: Detect with a UV wavelength of 260 nm. (2) Cell culture Inoculate Hela in MEM medium containing 10% fetal bovine serum and 1% double antibody, and culture in an incubator at 37 °C and 5% CO2. The cells are passaged every 2 - 3 days. (3) Cell transfection One day in advance, inoculate Hela cells at 1×10 4 cells / well in a 96-well plate and culture in an incubator at 37 °C and 5% CO2. After the cell confluence rate reaches 90%, use Lipofectamine TM MessengerMAX TM Reagent (invitrogen) to transfect the two types of cells with mRNA at a dose of 100 ng / well. The specific operation is as follows: 1) Dilute Lipofectamine TM MessengerMAX TM Reagent as shown in Table 7 below: Table 7 After dilution and mixing, incubate at room temperature for 10 min; 2) Dilute mRNA as shown in Table 8 below: Table 8 3) Mix the above mixtures 1) and 2) in a 1:1 volume ratio, and incubate at room temperature for 5 min; (4) Slowly add the above mRNA-lipid mixture into a 96-well plate at 10 μl / well, and continue culturing in an incubator at 37 °C with 5% CO₂. (4) Cell fluorescence detection Twenty-four hours after transfection, centrifuge the Hela cells at 300 g for 5 min using a plate centrifuge, discard the supernatant, add PBS and wash twice, add 1× cell lysis buffer (5× cell lysis buffer diluted with PBS), lyse at 4 °C for 15 min, take 20 μl of the lysate and add it to a black 96-well plate, and add 100 μl of luciferase assay reagent, and observe the fluorescence using a microplate reader. The results showed that: Figure 17 shows that after HPLC purification, the S-PIE fragment appears purer on an RNA denaturing gel, without the influence of impurities such as introns and RNA heterobands. Figure 18 shows that after HPLC purification, the expression level of luciferase of the S-PIE fragment in the Hela cell line is much higher than that of the S-PIE fragment treated with RnaseR. This indicates that the RnaseR treatment is not suitable for the purification of circRNA as a way to remove heterobands and introns, and heterobands and introns will reduce the protein expression of the S-PIE fragment in cells. Example 10: Detection of the immunogenicity of circular mRNA In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, the circular mRNA prepared by the method of the present disclosure was used to verify the transcriptional levels of immune-related factors RIG-I, IFN-beta, and IL-6 induced in Hela cells. The specific implementation process is as follows: (1) Cell culture Hela cells were inoculated in MEM medium containing 10% fetal bovine serum and 1% double antibody and cultured in an incubator at 37 °C with 5% CO₂. The cells were passaged every 2 - 3 days. (2) Cell transfection One day in advance, inoculate Hela cells at 1×10 5 cells / well into a 24-well plate and culture in an incubator at 37 °C with 5% CO₂. After the cell confluence rate reaches 90%, use Lipofectamine TM MessengerMAX TM Reagent (invitrogen) to transfect Hela cells with mRNA at a dose of 500 ng / well. The Blank group also uses the transfection reagent but does not transfect RNA. The specific operation is as follows: 1) Dilute LipofectamineTM MessengerMAX TM Reagent, as shown in Table 9 below: Table 9 After dilution and mixing, let it stand at room temperature for 10 min for incubation; 2) Dilute the mRNA, as shown in Table 10 below: Table 10 3) Mix the above (1) and (2) in a 1:1 volume ratio and let it stand at room temperature for 5 min for incubation; 4) Slowly add 50 μl / well of the above mRNA-lipid mixture to a 24-well plate and continue culturing in an incubator at 37 °C and 5% CO2. (3) Detect the transcriptional levels of RIG-I, IFN-beta, and IL-6 by qPCR After 24 h, collect the cells, extract the RNA, and reverse transcribe the RNA into cDNA using SweScript All-in-One SuperMix. Finally, introduce the specific primers for RIG-I, IFN-beta, and IL-6, and amplify by fluorescence quantitative PCR and calculate the transcriptional levels of the three proteins in the cells. The results are as follows: Figure 19 shows that compared with T4 td circular RNA, the immunogenicity of the exemplary S-PIE circular RNA in hela cells presents a lower level. And after HPLC purification, the immunogenicity of the exemplary S-PIE circular RNA is even lower. Example 11: Comparison of the expression levels and expression durations of S-PIE circular RNA and m1Ψ-modified mRNA in cells In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, the differences in the protein expression levels of HPLC-purified S-PIE circRNA and Cap1-m1Ψ-mRNA in hela cells at 1-6 days after transfection were compared. The specific operations are as follows: (4) Cell culture Hela cells were inoculated into MEM medium containing 10% fetal bovine serum and 1% double antibody and cultured in an incubator at 37 °C and 5% CO2. The cells were passaged every 2-3 days, and the supernatant culture medium was replaced on days 1, 2, 3, 4, and 5 after transfection. (5) Cell transfection One day in advance, Hela cells were inoculated into 96-well plates at 1×10 4 cells / well and cultured in an incubator at 37 °C and 5% CO2. After the cell confluence rate reached 90%, Lipofectamine TMMessengerMAX TM Reagent (invitrogen). Transfect two types of cells with mRNA at a dose of 100 ng / well respectively. The specific operation is as follows: 5) Dilute Lipofectamine TM MessengerMAX TM Reagent as shown in Table 11 below: Table 11 After dilution and mixing, incubate at room temperature for 10 min; 6) Dilute mRNA as shown in Table 12 below: Table 12 7) Mix the above-mentioned (1) and (2) in a 1:1 volume ratio, and incubate at room temperature for 5 min; 8) Slowly add 10 μl / well of the above mRNA-lipid mixture to a 96-well plate, and continue culturing in a 37 °C, 5% CO₂ incubator. (6) Cell fluorescence detection Centrifuge the transfected Hela cells at 300 g for 5 min using a plate centrifuge 24 hours after transfection. Discard the supernatant, add PBS and wash twice. Add 1×cell lysis buffer (dilute 5×cell lysis buffer with PBS), lyse at 4 °C for 15 min. Take 20 μl of the lysate and add it to a black 96-well plate, and then add 100 μl of luciferase assay reagent. Observe the luminescence intensity of the luciferase enzyme catalyzing the luciferin substrate with a microplate reader to reflect the level of RNA-expressed Luciferase enzyme. The results are as follows: Figure 20 shows that at 1 day after transfection, the protein expression level of Cap1-m1Ψ-mRNA is higher than that of S-PIE circRNA. However, over time, the protein expression level of Cap1-m1Ψ-mRNA shows an order-of-magnitude decay, while the protein expression level of S-PIE circRNA decays slowly and still remains at the same order of magnitude. Figure 21 shows that there is a significant difference in the total amount of accumulated expressed proteins of Cap1-m1Ψ-mRNA and S-PIE circRNA during the period from 1 to 6 days after transfection. At the cellular level, S-PIE circRNA has an advantage in expressing the target protein for a long time compared to Cap1-m1Ψ-mRNA. Example 13: Temporal performance of circular RNA in mouse muscle tissue In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, the S-PIE circRNA prepared by the method of the present disclosure was encapsulated into LNP-circRNA, purified by ultrafiltration to replace the buffer, and the RNA content was determined by Ribogreen staining. The LNP-circRNA was injected into the outer thigh of Balb / C mice by intramuscular injection, and the fluorescence expression of mouse tissues was observed by an in vivo imaging system 1-11 days after injection. The specific operations are as follows: (1) Preparation of circular mRNA-LNP complex According to the circular mRNA purified by HPLC prepared in Example 1: (supplemented with RNA), LNP encapsulation was carried out. The chip loaded with the aqueous phase (mRNA) and the organic phase was used to form a circular mRNA-LNP complex through the NanoAssemblr Spark TM instrument. The specific operation process is as follows: 1) Dilute the circular mRNA 1:5 in 125 mM sodium acetate. 2) Prepare the organic phase reaction solution according to Table 13 below Table 13 3) Add the organic phase and the aqueous phase (circular mRNA) sequentially at a ratio of 1:2 on the loading chip, and select the program for encapsulation. 4) After preparation, remove ethanol by dialysis, and at the same time replace the solution into PBS containing 5% sucrose at pH 7.4 to obtain a circular mRNA-LNP complex. 5) Use a Malvern, zetasizer instrument to measure the particle size, PDI and potential, and use Quant-iT TM Ribogreen RNA detection kit (Thermo) to calculate the encapsulation efficiency of the LNP complex. (2) In vivo fluorescence expression Calculate the content of circular mRNA encapsulated in the circular mRNA-LNP complex by the above-mentioned Quant-iT TM Ribogreen RNA detection kit, administer the drug to the mice by intramuscular injection. At different time points, anesthetize the mice and inject the luminescent substrate Luciferin intraperitoneally. After 15 minutes, observe the fluorescence expression of mouse tissues by the IVIS in vivo imaging system Results: Figure 22 shows that from 1 to 11 days after injection, S-PIE cricRNA can stably express Firefly luciferase protease in the muscle tissue of mice. This indicates that S-PIE circRNA can not only stably express at the cellular level, but also stably express the target protein in mice, showing the potential to express therapeutic proteins in vivo. Figure 23 shows the in vivo bioluminescence imaging of Firefly luciferase expressed by S-PIE circRNA in the muscle tissue of mice at 1 day, 6 days, and 11 days after injection, where the Firefly luciferase catalyzes the fluorescence substrate to emit light. Example 14: Effect of deleting the homologous arm sequence of the intron part on the cyclization efficiency. In this example, taking an S-PIE sequence with a relatively high cyclization rate and protein translation rate as an example, the homologous arm sequence in the intron was deleted by homologous recombination mutation. The sequence of intron fragment Ⅰ is shown in SEQ ID NO: 125, and the sequence of intron fragment Ⅱ is shown in SEQ ID NO: 124. After 4h of in vitro transcription and purification by Rnase R digestion, the cyclization status was observed by calculating on an RNA denaturing gel. Figure 24 shows that the S-PIE system did not cause a decrease in the cyclization efficiency due to the deletion of the intron homologous arm. This may be due to the stable secondary structure of S-PIE, which can still ensure that the distance between the intron ribozyme and the cleavage site is close even without the help of the homologous arm. Table 14

Claims

1. A recombinant nucleic acid molecule for preparing circular RNA, which, along the 5' to 3' direction, comprises elements arranged in the following order: intron fragment I, S sequence fragment I, target element, S sequence fragment II, intron fragment II; Among them, The S sequence fragment I consists of a first preset number of nucleotides, the S sequence fragment II consists of a second preset number of nucleotides, and after circularization is completed, the S sequence fragment I and the S sequence fragment II form a structural unit S-PIE fragment with a secondary structure, and this structural unit S-PIE fragment has a preset structural unit energy.

2. The recombinant nucleic acid molecule according to claim 1, wherein the target element may be composed of a translation initiation element and a coding element, or may be composed of other elements.

3. The recombinant nucleic acid molecule according to claim 2, wherein the nucleotide sequence of the coding element is used to form a coding element sequence encoding at least one target polypeptide along the 5' to 3' direction or the 3' to 5' direction; the nucleotide sequence of the translation initiation element is used to bind translation initiation proteins such as ribosomes along the 5' to 3' direction or the 3' to 5' direction to initiate protein translation of the coding element.

4. The recombinant nucleic acid molecule according to claim 2, wherein the positions of the coding element and the translation initiation element can be interchanged, and the translation initiation element contains a sequence having the activity of initiating translation of the initiation editing region.

5. The recombinant nucleic acid molecule according to claim 2, wherein the length of the other element can be composed of 0 nt, 1 nt, 1600 nt, 2300 nt and 4800 nt, and elements with lengths within their ranges.

6. The recombinant nucleic acid molecule according to claim 1, wherein the nucleotide sequence of the intron fragment I and the nucleotide sequence of the intron fragment II are used to form an intron sequence, an intron reverse sequence or an intron reverse complementary sequence along the 5' to 3' direction; the nucleotide sequence of the intron fragment I contains a partial sequence of the intron sequence near the 3' direction, and the nucleotide sequence of the intron fragment II contains the remaining part of the intron sequence near the 5' direction.

7. The recombinant nucleic acid molecule according to claim 1, wherein the intron fragment I and the intron fragment II are derived from group I introns.

8. The recombinant nucleic acid molecule according to claim 1, wherein the group I intron is derived from any one of the following group I introns: T4 phage td gene, Anabaena tRNAle, TpaCOX2, Ptu.

9. The recombinant nucleic acid molecule according to claim 1, wherein the first preset number of nucleotides of the S sequence fragment I is selected from 3 to 100 nucleotides, preferably 3 to 50 nucleotides; the second preset number of nucleotides of the S sequence fragment II is selected from 1 to 100 nucleotides, preferably 1 to 50 nucleotides.

10. The recombinant nucleic acid molecule according to claim 1, wherein the preset structural unit energy of the S-PIE fragment is selected from between -0.7 and -0.1, preferably between -0.6 and -0.2, and preferably between -0.6 and -0.

4. The calculation method of the structural unit energy is as follows: The minimum free energy ΔG can be calculated by RNA structure simulation software such as RNAfold, which indicates the structural stability degree of the S-PIE sequence fragment. nt is the sum of the first preset quantity and the second preset quantity.

11. The recombinant nucleic acid molecule according to claim 1, wherein the ribozyme recognition site of the S-PIE fragment comprises "TTGGGTCT" and its mutant ribozyme recognition sites, the S-PIE fragment comprises any paired nucleotide combination constituting its secondary structure sequence or any unpaired nucleotide combination constituting its secondary structure sequence, and the mutant ribozyme recognition sites are selected from TTAGGTCT, TCGGGTCT, TAGGGTCT, TTCGGCTT, TTCGGTCT, TTGGGCCT, TTGGGGCT, TTGGGTCT or TTTGGTCT; the unpaired nucleotide sequences are selected from GUACUAC (SEQ ID NO:121), ACGUCUA (SEQ ID NO:122) and AUCUCCU (SEQ ID NO:123) or alternative sequences of these sequences, which can be partial substitutions or complete substitutions.

12. The recombinant nucleic acid molecule according to claim 2, wherein the sequence having the activity of initiating translation in the editing region is selected from one or more combinations of the following: IRES sequence, 5'UTR sequence, Kozak sequence, sequence containing m6A modification, and complementary sequence of ribosomal 18S rRNA.

13. The recombinant nucleic acid molecule according to claim 1, further comprising insertion element a located between the coding element and the translation initiation element, or insertion element b located between the S sequence fragment I and the translation initiation element; insertion element c between the S sequence fragment II and the coding element; each of the insertion elements is independently selected from at least one of the following compositions (i)-(iv): (i) transcriptional level regulatory element, (ii) translational level regulatory element, (iii) purification element, (iv) encapsulation element.

14. The recombinant nucleic acid molecule according to claim 13, wherein the insertion element is connected to the 5'-end of any translation initiation element; each of the insertion elements independently comprises a sequence of one or more combinations of the following: untranslated region sequence, polyA sequence, aptamer sequence, riboswitch sequence, sequence binding to a transcriptional regulatory factor.

15. The recombinant nucleic acid molecule according to claim 1, wherein the recombinant nucleic acid molecule further comprises or does not comprise 5' homology arm and 3' homology arm, and the nucleotide sequence of the 5' homology arm hybridizes with the nucleotide sequence of the 3' homology arm; the 5' homology arm is connected to the 5'-end of the intron fragment I, and the 3' homology arm is connected to the 3'-end of the intron fragment I; or, the 5' homology arm is connected to the 5'-end of the intron fragment II, and the 3' homology arm is connected to the 3'-end of the 3' intron fragment IV.

16. The recombinant nucleic acid molecule according to claim 2, wherein within any one of the intron fragment I, the translation initiation element, the coding element, and the intron fragment II, or between any two of the intron fragment I, the S sequence fragment I, the coding element, the translation initiation element, the S sequence fragment II, and the intron fragment II, there is no nucleotide sequence derived from exons E1 and E2.

17. The recombinant nucleic acid molecule according to claim 1, including a recombinant nucleic acid molecule in which the paired nucleotides of the secondary structure are replaced under the condition of maintaining the secondary structure of the S-PIE sequence unchanged.

18. A recombinant expression vector, wherein, The recombinant expression vector contains the recombinant nucleic acid molecule according to any one of claims 1-17 above.

19. A circular RNA prepared from the recombinant nucleic acid molecule according to any one of claims 1-17, wherein, The coding element in the circular RNA contains nucleotides that can encode a single or multiple target polypeptide sequences, and the nucleotides encoding the target polypeptide sequences are spliced by a linker or by a translation initiation element.

20. The circular RNA according to claim 19, along the 5'-to-3' direction, includes elements arranged in the following order: a translation initiation element, a coding element for encoding at least one target polypeptide, and a structural unit S-PIE fragment.

21. The circular RNA according to claim 19, wherein the linker is a polynucleotide encoding a 2A peptide, and the target polypeptide is a human protein or a non-human protein.

22. A method for preparing circular RNA in vitro, which includes the following steps: A one-step transcription step: Through the one-step transcription step, the aforementioned recombinant nucleic acid molecule or recombinant expression vector is transcribed to form a circularized nucleic acid molecule; A step of purifying RNA by HPLC: The circularized nucleic acid molecule is purified and separated from the transcription system through a C18 column; A step of purifying the circular RNA.

23. A composition, which contains the recombinant nucleic acid molecule, recombinant expression vector described above, or the circular RNA described above.

24. A method for expressing a target polypeptide in a cell, which includes transferring the circular RNA according to any one of claims 19-21 into the cell.

25. A method for screening an S-PIE sequence, which includes the following steps: S1. Determine the ribozyme recognition site sequence set: TTGGGTCT, TTAGGTCT, TCGGGTCT, TAGGGTCT, TTCGGCTT, TTCGGTCT, TTGGGCCT, TTGGGGCT, TTTGGTCT, etc., where The ribozyme recognition sites include but are not limited to the above sequences; S2. Randomly generate a nucleotide sequence with a length of α at the 5' end of the ribozyme recognition point sequence set in S1, where 0 ≦ α ≦ 100, and at the same time randomly generate a nucleotide sequence with a length of β at the 3' end of the ribozyme recognition point sequence, where 0 ≦ β ≦ 100, and set the GC content of the sequence to be between 30-70%, to obtain a new sequence set; S3. Use RNA secondary structure simulation calculation software to perform batch secondary structure calculation and simulation on the sequence set in S2, obtain the sequence secondary structure, and retain its smallest secondary structure unit to form a new sequence set; S4. Calculate the structural unit energy according to the calculation formula, and sort the sequence set obtained in S3 to obtain the relationship between the structural unit energy and the sequence set. The structural unit energy calculation formula is as follows: Calculate the minimum free energy ΔG of this secondary structure, which indicates the structural stability degree of the S-PIE sequence fragment I. nt is the sum of the first preset quantity and the second preset quantity. S5. Obtain a sequence set, which contains the relationship between the sequence and the energy of the structural unit, and randomly select sequences from this sequence set according to the energy of the structural unit.

26. According to the screening method of claim 25, in S2, the step of judging the secondary sequence information of the sequence set includes, Judge from the 3'-end to the 5'-end of the ribozyme recognition site of S1: 1) If this nucleotide pairs with the nucleotide at position +1 or above in the 3'-end direction of this nucleotide, then judge the next nucleotide in the 5'-end direction of this nucleotide; 2) If there is no pairing information for this nucleotide, then judge the next nucleotide in the 5'-end direction of this nucleotide; 3) If this nucleotide pairs with the nucleotide at position +1 or above in the 5'-end direction of this nucleotide, then intercept the nucleotide at position +1 or above in the 3'-end direction of this nucleotide as the 5'-end; Judge from the 5'-end to the 3'-end of the ribozyme recognition site of S1: a) If this nucleotide pairs with the nucleotide at position +1 or above in the 5'-end direction of this nucleotide, then judge the next nucleotide in the 3'-end direction of this nucleotide; b) If there is no pairing information for this nucleotide, then judge the next nucleotide in the 3'-end direction of this nucleotide; c) If this nucleotide pairs with the nucleotide at position +1 or above in the 3'-end direction of this nucleotide, then intercept the nucleotide at position +1 or above in the 5'-end direction of this nucleotide as the 3'-end.

Images