Production of viral vectors
Inhibiting transcription and translation of heterologous nucleic acid in viral vectors using inhibitory RNA addresses issues of cellular stress and genetic instability, enhancing viral particle yield and stability in adenoviral, poxvirus, baculovirus, and herpes virus vectors.
Patent Information
- Application Number
- PCT/IB2024/052851
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-17
- Filing Date
- 2024-03-25
- Publication Date
- 2025-07-24
AI Technical Summary
Existing methods for producing viral vectors face challenges such as significant protein production leading to cellular stress, cell death, and genetic instability, resulting in reduced viral particle yield and transgene instability during passaging.
Inhibiting transcription and translation of heterologous nucleic acid in viral vectors using inhibitory RNA to enhance genetic stability and viral particle yield, specifically for adenoviral, poxvirus, baculovirus, and herpes virus vectors.
The method significantly increases genetic stability and viral particle yield, preventing cell death and maintaining transgene integrity during passaging, thereby improving the production of viral vectors.
Smart Images

Figure IMGF000047_0001 
Figure 00000060_0000 
Figure 00000061_0000
Abstract
Description
[0001] Production of viral vectors
[0002] BACKGROUND
[0003] The present disclosure provides a method of increasing genetic stability of a viral vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, said viral vector being an adenoviral (AV) vector, a poxvirus vector, abaculovirus vector, or a herpes virus vector, wherein said increasing is as compared to the absence of said inhibiting.
[0004] In this specification, a number of documents including patent applications and manufacturer's manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this disclosure, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0005] Many genetic engineering applications in research, diagnosis and therapy involve the transfer of foreign DNA to target cells, tissues, or organisms. Viral vectors or particles such as adenoviral (AV) vectors, poxvirus vectors, baculovirus vectors, or a herpes virus vectors comprising foreign DNA are useful tools for this purpose.
[0006] A frequent problem in the production of viral vectors comprising a nucleic acid encoding a protein of interest is that, during said production in a production cell line, significant amounts of said protein are produced, which in turn consume nutrients and have adverse effects on the production cell such as induction of cellular stress, or cell cycle arrest or even apoptosis in case of a toxic protein of interest. This may deteriorate viral particle yield, abolish yield altogether or cause cell death. While certain instruments such as the Tet system are available to control production of the transgene, such instruments are still insufficient or cumbersome. Another strategy to reduce the expression of harmful transgenes in the producer cells would be choosing a weaker promoter. For instance, by using p7.5 instead of the strong promoters mH5 or SSP helped to stabilize the measles virus fusion protein as transgene. However, this strategy also leads to reduced expression of the antigen upon vaccination. A further problem is genetic instability of said viral vectors, in particular when during production of said viral vectors passaging from one cell culture to another cell culture is required. Such genetic instability affects, at least primarily, the heterologous nucleic acid (or transgene) and leads to accumulation of undesirable mutations in the heterologous nucleic or even the complete loss thereof. Due to the error prone DNA replication process mutations or deletions can be introduced during amplification in the nucleic acid encoding a protein of interest. Mutations in the protein of interest may lead to functional inactivation of the protein and may confer a growth advantage to viral vectors encoding such mutant protein of interest leading to accumulation of mutant viral vectors during amplification rounds.
[0007] Even in cases when generation of recombinant virus is successful, their propagation and the generation of bulk material for larger preclinical studies or GMP-grade drug substance or drug product for clinical trials may suffer from transgene instability leading to the emergence of mutated recombinant viruses with reduced or abrogated antigen expression or modification of the transgene product.
[0008] The present disclosure addresses this problem. A technical problem underlying the instant disclosure may be seen as the avoidance of such adverse effects, such as improving viral particle yield (higher virus titers), avoiding production cell death or production cell growth reduction, avoiding the mentioned genetic instability, prolonging retention of the heterologous nucleic acid upon passaging and / or the provision of improved means and methods for the production of viral vectors encoding proteins of interest.
[0009] This problem has been solved by the aspects and embodiments disclosed below and as shown in the Examples.
[0010] SUMMARY
[0011] The previously described systems to conditionally regulate transgene expression in viral vectors have not been successful to enhance the genetic stability or successful for producing viral vectors with high titers. In the methods, cells and viral vectors of the disclosure, the action of an inhibitory RNA not only augmented the generation of the recombinant viral vector, but also led to a considerable increase in stability upon propagation and expansion of the virus.
[0012] In the case of poxviruses, the recombinant modified vaccinia virus Ankara (rMVA) is a versatile poxvirus vector with an excellent safety profile. However, rMVA producing certain transgenes is genetically unstable, leading to strong negative selection and accumulation of mutated rMVA (mrMVA) with impaired expression of the correct transgene. The method of increasing genetic stability of a viral vector and the method of producing a poxvirus vector of the disclosure are aiming to solve the problem of spontaneously loosing transgene expression. The Examples of the present disclosure provide evidence that the methods, cells and viral vectors of the disclosure conditionally repress MVA-driven transgene expression in an engineered production cell line and support the generation and expansion of rMVA encoding otherwise difficult to express transgene products.
[0013] In a first aspect, the present disclosure provides a method of increasing genetic stability of a viral vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, said viral vector being an adenoviral (AV) vector, a poxvirus vector, a baculo virus vector, or a herpes virus vector, wherein said increasing is as compared to the absence of said inhibiting.
[0014] In a second aspect, the present disclosure provides a method of producing an AV vector, a poxvirus vector, a baculovirus vector, or a herpes virus vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, wherein said inhibiting is performed by an inhibitory RNA.
[0015] In a third aspect, the present disclosure provides a cell comprising: (a) a first nucleic acid encoding or being an inhibitory RNA; (b) at least one second nucleic acid, said at least one second nucleic acid providing functions necessary for generating an AV vector; and (c) a third nucleic acid comprising a heterologous nucleic acid to be packaged into an AV vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
[0016] In a fourth aspect, the present disclosure provides a cell comprising: (a) a first nucleic acid encoding or being an inhibitory RNA; (b) a third nucleic acid comprising a heterologous nucleic acid to be packaged into a poxvirus vector, a baculovirus vector, or a herpes virus vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
[0017] In a fifth aspect, the present disclosure provides the use of a cell of the third or fourth aspect for producing an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector.
[0018] In a sixth aspect, the present disclosure provides the use of a cell of the third or fourth aspect for increasing genetic stability of an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector.
[0019] In a seventh aspect, the present disclosure provides an AV vector, a poxvirus vector, a baculovirus vector, or a herpesvirus vector (a) obtained by the method of the first or second aspect; and / or (b) carrying a heterologous nucleic acid encoding a protein of interest, wherein a non-coding flanking region of said heterologous nucleic acid comprises a binding site for an inhibitory RNA.
[0020] BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 shows vector maps CR19-GFP, CR19-M-TK and CR19-M-DelIII (nucleic acid comprising a heterologous nucleic acid or transfer plasmids). MfPV3 Ii-E1E2E6E7 or GFP were cloned into the shuttle vector SP-CR19III, suitable for integration into MVA's deletion site III (Dellll) under the control of the SSP promoter with one point mutation (CR19-M-DelIII and CR19-GFP vectors, respectively). CR19-M-TK was generated with the shuttle vector pLZAWl, suitable for integration into MVA's thymidine kinase locus (TK) under the control of the MVA SSP-promoter. Abbreviations: RF: right flank, LF: left flank, TK: thymidine kinase locus (MVA086R), GFP: green fluorescent protein, SSP-promoter: short synthetic promoter, tetO: tetracyclin operator, IBD1: shRNA target sequence, Dellll: Deletion site III. Arrow indicates orf reading direction.
[0022] Figure 2 shows the transgene expression of CR19 M-TK and CR19 M-Dellll on parental CR pIX and CR pIX PRO suppressor cell line. Figure 2A shows a schematic overview of TetR / tetO and shRNA / IBDl mediated transgene suppression. Abbreviations: Pol: MVA RNA polymerase; siRNA is the hairpin at the top right corner of the figure. Figure 2B shows a western blot analysis of CR pIX PRO suppressor cells and CR pIX cells infected with rMVA coding for MfPV3 Ii-E1E2E6E7 (integrated into Dellll or TK locus) controlled by tetO and IBD1, or infected with rMVA coding for GFP lacking tetO and IBD1. Antibodies used are indicated on the right. Figure 2C shows the expression analysis of CR pIX PRO and CR pIX cells infected with rMVA coding for MfPV3 Ii-E1E2E6E7 controlled by tetO and IBD1. Cells were stained with rabbit anti-vaccinia and goat anti-rabbit AF647 for MVA infection and mouse anti-myc and goat anti-mouse PE for transgene expression. Cells were gated on vaccinia-positive cells using the fluorescence background of cells infected with MVA without any antigen. MFI of PE out of AF647 positive cells is represented as mean with SEM, Statistical analysis was done with an unpaired t-test. **: p<0.005; ***: p< 0.0005; ****: p<0.00005; n=3 biological replicates. Figure 2D shows quantification of Ii-E1E2E6E7 transcript knock-down with RT-qPCR. Depicted is the fold reduction of Ii-E1E2E6E7 transcript level in CR pIX PRO suppressor cells compared to parental CR pIX cells of CR19 M-Dellll and CR19 M-TK after 6 and 24 hpi measured by RT-qPCR. Relative comparison of transcript levels between cell lines was normalized with the housekeeping gene MVA128L and calculated with the Pfaffl method. N=3 biological replicates, bars represent mean with SEM.
[0023] Figure 3 shows the replication kinetics and plaque morphology of CR19 empty, CR19 GFP and CR19 M-Dellll on parental CR pIX and CR pIX PRO suppressor cell line. Figure 3A shows multiple growth step curves for the indicated CR19 variants on CR pIX and CR pIX PRO cells. Cells were infected at an MOI of 0.05. Samples taken at 0, 24, 48, and 72 hpi (hours postinfection) were titrated on CR pIX PRO suppressor cells using the TCID50 method. Statistical analysis was done with an unpaired t-test. Data points represent mean with SEM, **: p< 0.005; ***: p<0.0005 n=3 independent biological replicates. Figure 3B shows CR pIX and CR pIX PRO suppressor cells that were infected at an MOI of 0.01 with the indicated rMVA-CR19. 48 hpi, cells were fixed and stained with an anti-vaccinia antibody, an HRP-coupled secondary antibody and KPL Trublue substrate. Photos were taken on a Keyence inverted microscope at a magnification of 10. Bar represents 100 pm. Shown plaques are representative for the respective conditions.
[0024] Figure 4 shows the growth kinetic (titer per passage) of CR19 M-Dellll (Figure 4A) and CR19 M-TK (Figure 4B) passaged on either parental CR pIX or CR pIX PRO suppressor cells. Samples of each passage were titrated on CR pIX PRO suppressor cells by using the TCID50 method. TCID50s for each passage are indicated. Data points represent the mean with SEM, n=2 independent biological replicates.
[0025] Figure 5 shows the expression analysis of CR19 M-Dellll (Figure 5A) and CR19 M-TK (Figure 5B) passaged on either parental CR pIX or CR pIX PRO suppressor cells by using flow cytometry. %gated Ii-E1E2E6E7 expressing cells out of vaccinia antigen positive cells represents myc-positive cells out of vaccinia-positive cells. Dashed line represents li- ElE2E6E7-expressing out of vac+ cells of passage 0 of CR19 M-Dellll or CR19 M-TK used as starting material for passaging on both cell lines. Data points represent mean with SEM, n=2 independent biological replicates.
[0026] Figure 6 shows deletions in the context of the Dellll integration locus across passaging. Figure 6A depicts the quotient of the mean read coverage of the entire Ii-E1E2E6E7 transgene integrated into Dellll and the mean read coverage of the essential MVA056L gene (MVA DNA polymerase, E9L) of CR19 M-Dellll passaged on parental CR pIX cells or CR pIX PRO suppressor cells, normalized to the unpassaged rMVA. Dashed line represents normalized read coverage of unpassaged rMVA used as starting material for passaging on both cell lines. Genotyping of rMVA passaged on CR pIX PRO suppressor cells (Figure 6B) and parental CR pIX cells (Figure 6C) cells by agarose gel analysis of PCR products obtained with the primer pair wide-III3-f and wide-III2-r. Expected size of CR19 M-Dellll: 14169 bp (black arrow); expected size of CR19 empty: 9471 bp (white arrow). Figure 7 shows the genotyping of rMVA generated by passaging on CR pIX PRO suppressor (Figure 7A) and parental CR pIX (Figure 7B) cells by using PCR and primer pair TK f and TK r. Expected size of CR19 M-TK of 5094 bp (black arrow) and expected size of CR19 empty of 920 bp (white arrow). Figure 7C shows the fraction of rMVA mutants among CR19 M-TK carrying the early translational stop mutations L299Tfs*342 or E265* across the passages on either CR pIX or CR pIX PRO cells is plotted against the passage number. Figure 7D shows a schematic overview of the transgene in the TK locus. Dark grey: homologous sequences used for integration into TK locus; black: transgene's subunits; hatched area: reading frames resulting from mutations that lead to early translational stops.
[0027] Figure 8 shows the plasmid map of the ProVector expression cassette that includes the shRNA sequence under the control of the U6 promoter and the TetR element controlled by a CMV promoter.
[0028] Figure 9 shows an agarose gel image of the pattern obtained after Dralll restriction digestion of Adl9a(II)-(TetO)-CMV-coHERV-K-IBDl in a sample at passage 0 (P0; lane 2) and a sample after five serial passages (P5; lane 3). Lane 1: DNA Marker lkb plus ladder (Biolabs); lane 2: Dralll digest of extracted DNA from Adl9a(II)-(TetO)-CMV-coHERV-K-IBDl vector stock (P0); lane 3: Dralll digest of extracted DNA from Adl9a(II)-(TetO)-CMV-coHERV-K- IBD1 vector stock (P5).
[0029] Figure 10 shows an adenoviral vector map constructed by cloning two copies of TetO and the shRNA target sequence (inhibitor binding domain 1; IBD1) at the 3Z-UTR of the HERV gene.
[0030] Figure 11 shows flow cytometry images representing the HEK293 population expressing GFP. Figure 11A shows HEK293 cells expressing TetR and shRNA transduced with Adl9a(II)- (TetO)-GFP-IBDl and Figure 11B shows HEK293 cells expressing only TetR (not shRNA) transduced with Adl9a(II)-(TetO)-GFP-IBDl. In both Figures 11A and 11B, doxicicline (DOX) was added in the third graph. The untransduced cells are also shown as control. An overlapping graph showing the three populations is shown at the end of Figures 11A and 11B. Figure 12 shows Sanger sequencing on pJET1.2 / blunt-subcloned PCR amplicons of passaged CR19 M-TK. The gDNA was prepared from bulk material of passage 3 (Figure 12A) or passage 10 (Figure 12B) and used as template in a PCR using the primer pair TK f and TK r flanking the transgene within the TK locus. The amplicons were cloned into pJET1.2 / blunt and Sanger- sequenced. Both mutations E265*(A) and L299Tfs342!<' (B) could be observed when the sequencing results were aligned with the transgene.
[0031] DETAILED DESCRIPTION
[0032] Throughout this specification, the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated integer (or components) or group of integers (or components), but not the exclusion of any other integer (or components) or group of integers (or components).
[0033] Throughout the specification, where compositions, cells or vectors are described as having, including, or comprising (or variations thereof), specific components, it is contemplated that compositions, cells or vectors also may consist essentially of, or consist of, the recited components. Similarly, where methods or processes are described as having, including, or comprising specific process steps, the processes also may consist essentially of, or consist of, the recited processing steps. Further, it should be understood that the order of steps or order for performing certain actions is immaterial, as long as the methods described herein remains operable. Moreover, two or more steps or actions can be conducted simultaneously.
[0034] As used herein, the term "about" modifying the quantity of an ingredient, parameter, calculation, or measurement in the compositions employed in the methods, the cell, the uses or the vector of the disclosure refers to the variation in the numerical quantity that can occur. Such variation can be within an order of magnitude, typically within 10%, more typically still within 5%, of a given value or range. Whether or not modified by the term "about," the paragraphs below include equivalents to the quantities. Reference to "about" a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to "about X" includes description of "X." Numeric ranges are inclusive of the numbers defining the range.
[0035] The term "nucleic acid" has its art-established meaning and includes DNA and RNA. Preferred is DNA. In some embodiments, said DNA is circular (also referred to as "plasmid").
[0036] The term "inhibitory RNA", as used herein, refers to RNA molecules that inhibit or reduce a nucleic acid transcription or translation in a sequence-specific manner. In some embodiments, the inhibitory RNA is an RNA molecule that inhibit or reduce the expression of a gene. In some embodiments, the inhibitory RNA is selected from the group consisting of a shRNA, a miRNA and a siRNA.
[0037] The "inhibitory RNA" may refer to a single, double, or tripartite RNA molecule (e.g., an siRNA, an shRNA, an miRNA, a piRNA, etc.) that exerts an effect on a biological process by interacting with one or more components of the RNAi pathway including but not limited to Drosha, RISC, Dicer, etc. The RNA inhibition process includes, but is not limited to, gene silencing by degrading mRNA, attenuating translation, interactions with tRNA, rRNA, hnRNA, cDNA and genomic DNA, inhibition of as well as methylation of DNA with ancillary proteins. Binding sites of the inhibitory RNA may or may not be comprised within a coding sequence of said heterologous nucleic acid or said third nucleic acid, respectively. Binding sites may be located in the S'-untranslated region (3'-UTR), the 5'-UTR or in the coding sequence (CDS). In some embodiments, the inhibitory RNA binding site is in the 3'-UTR.
[0038] The term "siRNA" or "short interfering RNA", as used herein, refers to a double-stranded RNA molecule that comprises typically 20-24 base pairs in length, and operates within the RNA interference pathway. Further information about design, structure and function of siRNAs can be found, e.g., in Elbashir S.M., et al., Nature 411:494-498 (2001).
[0039] The term "shRNA" or "short hairpin RNA" or "small hairpin RNA", as used herein, refers to an RNA molecule that forms a hairpin loop that target mRNA for transcript cleavage and / or translational attenuation. Further information about design, structure and function of shRNAs can be found, e.g., in Paddison P.J., et al., Genes & Dev. (2002) 16: 948-958 and Moore et al. Methods Mol Biol. 2010; 629: 141-158.
[0040] The term "miRNA" or "microRNA" or "miR", as used herein, refers to small, single stranded, non-coding RNA molecules. Without wishing to be bound by a particular theory, miRNA exploits the RNA Induced Silencing Complex (RISC) which utilizes the seed region (positions 2-7) of the miRNA guide strand to target the mRNA for transcript cleavage and / or translational attenuation. A perfect match to the target mRNA is not required. Further information about design, structure and function of miRNAs can be found, e.g., in Riolo et al., Methods Protoc. 4, 1-20 (2021) and Saliminejad et al., J Cell Physiol. 2019 May;234(5):5451- 5465.
[0041] The term "gene", as used herein, is defined to include both transcribed and non-transcribed elements. Thus, for instance, a gene can include any non-transcribed enhancer and / or promoter (i.e., genomic DNA) that plays a role in determining the level, timing, or tissue specificity of expression of a particular mRNA transcript or non-coding RNA. In addition, the 5' UTR, ORF, 3' UTR and introns are included as elements of a gene.
[0042] The terms "silencing", "inhibition" or "reduction" of a nucleic acid transcription or translation are used interchangeably and are defined as a reduction in gene transcription or translation by an inhibitory RNA that can be measured by any number of methods including PCR-based methods, Northern blot analysis, Branched DNA, western blot analysis, and other art recognized techniques.
[0043] To the extent use is made of an inhibitory RNA (as opposed to a nucleic acid encoding it, such as the first nucleic acid disclosed in conjunction with cells of the present disclosure), said RNA may be modified, for example to increase its stability in a biological, such as cellular environment, or to increase specificity. For example, specificity modifications can be incorporated into any inhibitory RNA in order to decrease off-targeting. Such specificity modifications can be an aspect of on-targeting. Further descriptions of modifications that enhance stability and / or specificity include those described in WO 2005 / 097992, WO 2007 / 095387, WO 2008 / 036825, WO 2008 / 147837, WO 2009 / 012173 and U.S. 10 / 551,350, 11 / 619,993, and 11 / 857,732, the disclosures of which are incorporated by reference. Modifications to the internucleotide linkages that can enhance overall stability or enzymatic processing can include phosphorothioates, phosphorodithioates, alkylphosphonates, phosphonoacetates, phosphonoacetamides, phosphonoacetic acid esters, phosphonamidates, phosphonoalcohols, phosphonoalcohol esters, phosphonoformates, boranophosphonates, peptide nucleic acids, and more. Similarly, chemically modified nucleotides having modifications to the sugar structures can be included to enhance or alter oligonucleotide stability, functionality, enzymatic processing, and specificity. Possible modifications to the sugar ring structure include 2'-O-alkylribose, 2'-O-methyl, 2'-fluoro, 2'-halo-2'-deoxyribose, 2'-deoxyribose, 2' amino-2'-deoxyribose, 2'-thio-2'-deoxyribose, arabinose, L-ribose, 2'-halo-2'- deoxyarabinose, 2'-O-alkylarabinose, 2'-amino-2'-deoxyarabinose, 2'-thio-2'-deoxyarabinose, 2'-O, 4'-C-methylene bicycloribose ("locked nucleic acid"), 4'-aminoalkylribose, 5'- aminoalkylribose, 4-thioribose, and more.
[0044] Even though being referred to as "RNA" herein, inhibitory RNAs in accordance with the disclosure may comprise one or more deoxyribose moieties, for example, but not limited to cases where the inhibitory RNA is implemented as an antisense RNA.
[0045] Said inhibitory RNA (as recited in the methods of the first and second aspect or comprised in the first nucleic acid or encoded by said first nucleic acid of the cell of the third and fourth aspect) binds or recognizes a binding site which is in said heterologous nucleic acid or in said third nucleic acid, and / or is capable of controlling transcription and / or translation of said heterologous nucleic acid or third nucleic acid. Upon binding to said binding site, said inhibitory RNA exerts control on what is to be transcribed or translated from said heterologous nucleic acid or said third nucleic acid, e.g., a gene of interest. In particular, said inhibitory RNA represses or reduces transcription and / or translation of said heterologous nucleic acid or said third nucleic add, respectively.
[0046] "Viral particles", as used herein, are particles comprising nucleic acid associated with one or more viral proteins and / or packaged into a capsid formed by one or more viral proteins. Viral particles may furthermore comprise an envelope which is a lipid membrane, typically equipped with one or more viral proteins. The lipid membrane of enveloped viral particles may be inherited from the cell producing said particles. A cell or cell line capable of producing viral particles ("production cell" or "production cell line") is subject of further aspects of the present disclosure; see below. The terms "viral particles" and "viral vectors" are used equivalently herein.
[0047] Viral particles in accordance with the disclosure, while sharing features with their naturally occurring counterparts (viruses), preferably contain heterologous nucleic acids. Viral particles in accordance with the disclosure are capable of infecting cells, for example mammalian cells, including human cells, which renders them suitable as vectors for transferring nucleic acids into said cells, for example for therapeutic or preventive purposes.
[0048] The present disclosure refers to different types of cells. First, there is a cell of the third aspect. This cell is also referred to as "production cell" because it is equipped with the necessary nucleic acids and therefore capable of producing viral particles. Of note, the cell of the third aspect is tailored for the production of AV vectors which generally require helper functions in the course of their production. Secondly, there is a cell of the fourth aspect. While being related to the cell of the third aspect, it dispenses with helper functions because poxvirus vectors, baculovirus vectors and herpes virus vectors generally do not require such helper functions. To the extent the production of AV vectors does not require helper functions, a cell of the fourth aspect is useful for producing AV vectors. On the other hand, to the extent it would become necessary, also a cell of the fourth aspect can be equipped with helper functions. Also, the cell of the fourth aspect is a production cell.
[0049] Thirdly, and upon harvesting the viral particles produced by the production cell, the user may choose a target cell which is to be brought into contact with said viral particles. Said bringing into contact will deliver the heterologous nucleic acid (or nucleic acid of interest) in accordance with the disclosure to said target cell which in turn becomes genetically modified by said heterologous nucleic acid or nucleic acid of interest. Said harvesting is generally performed about 12 to about 96 hours, about 24 to about 72 hours, such as for example, about 48 hours after transfection. Moreover, said cells may continuously produce said viral particles.
[0050] The term "functions necessary for generating an adenovirus vector" (sometimes collectively referred to as "helper functions", "helper proteins" or "helper nucleic acids") include those nucleic acids and, to the extent said nucleic acids encode proteins, proteins encoded by said nucleic acids which are needed for viral replication and production, for example, for packaging the viral particles.
[0051] In some embodiments, adenovirus vectors are deleted for El and E3, and optionally for E4. In such embodiments, El, E3, and optionally E4 are the functions necessary for generating an adenovirus vector and are provided by one or more second nucleic acids. In some embodiments, the functions necessary for generating an adenovirus vector provided in at least one second nucleic acid comprise at least one Early (E) region of the viral genome, such as El, E2, E3, E4, E4ORF6 or pIX, and combinations thereof, or functional homologues or fragments thereof. In other embodiments, the functions necessary for generating an adenovirus vector provided in the second nucleic acid include a full adenovirus genome lacking the packaging signal. In some embodiments, the functions necessary for generating an adenovirus vector provided in the second nucleic acid are encoded in a cell's genome. Said cell may be stably transfected with said functions. Further information about the functions necessary for generating an adenovirus vector can be found, for example, in Sayedahmed et al. Methods Mol Biol. 2019; 1937: 155-175.
[0052] A further helper protein is encoded by the El region of Adenovirus. El proteins may be provided by a suitable established cell line such as HEK293 cells or CAP® cells (Schiedner G, et al., Hum Gene Ther. 11, 2105-2116 (2000)) but may also be provided as helper protein (or encoded by a helper nucleic acid).
[0053] The way how such functions necessary for generating an adenovirus vector are provided is not particularly limited. In some embodiments, e.g., for the production of high-capacity adenovirus vectors (as described in Ricobaraza A et al. Int J Mol Sci. 2020 May 21;21(10):3643), said functions are provided by helper viruses, more specifically by other adenoviruses. In another embodiment, said helper viruses are replication defective. In an embodiment, said helper viruses are infective.
[0054] It is understood that instead of these specific proteins and nucleic acids that are necessary to generate an adenovirus vector, functional homologues may be used. Functional homologues exhibit at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity to the respective parent protein or nucleic acid (preferred parent proteins and nucleic acids being disclosed above), respectively. Said homologues retain their function, i.e., the capability to help or trigger replication of the third nucleic acid and packaging it into viral particles. In some embodiments, said capability to trigger replication and packaging is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the capability of the parent protein or parent nucleic acid.
[0055] The present disclosure provides means and methods to control transcription and / or translation of a heterologous nucleic acid or third nucleic acid, e.g., gene of interest and, to the extent said gene of interest encodes a protein of interest, of said protein of interest. Such control is reduction, repression, inhibition and / or degradation. The inhibition of the transcription and / or translation of the heterologous nucleic acid by the methods of the disclosure lead to higher virus titers, larger plaques, prolonged retention of the heterologous nucleic acid upon passaging, and enhanced genetic stability of the viral vector upon passaging.
[0056] Accordingly, control of translation embraces the control of the stability of an RNA (such as mRNA or non-coding RNA) transcribed from said heterologous nucleic acid. In other words, the degradation of such transcript is also a means to control or, more specifically, prevent translation into a protein of interest. In case of non-coding RNAs being transcribed from the heterologous nucleic acid, said degradation is a means of preventing any deleterious effects as described herein which may arise from the presence of such non-coding RNAs.
[0057] Taken together, the present disclosure provides means and methods to control one or more of transcription of a heterologous nucleic acid, its translation, and the stability of a coding or non-coding RNA transcribed from said heterologous nucleic acid, the latter also being referred to as or embraced by "post-transcriptional control".
[0058] Without wishing to be bound by theory, one explanation of the instability of the viral vectors when expressing a foreign protein (such as an antigen or therapeutic protein) or a heterologous nucleic acid is that the expression of the foreign protein or nucleic acid may be harmful to the host cell. Impaired replication leads to fewer progeny of the viral vectors expressing the desired protein or nucleic acid compared to viral vectors not expressing said protein or nucleic acid. Protein or nucleic acid expression thus exerts a negative selection pressure leading to reduced viral fitness in a classical Darwinian "survival of the fittest" competition.
[0059] As shown in the Examples below, for example for MV A, the general conclusion of negative selection was confirmed within the virus population, as a loss of rMVA within few rounds of passaging for two different rMVA (TK- and Dellll-integration) carrying the same transgene was observed. In the case of Dellll integration site, the transgene was removed by deletions that range from partial transgene deletion to complete deletion even extending into flanking non-essential viral genes. In contrast, in the case of TK insertion, no deletions but rather mutations within the transgene occurred and either a premature stop codon or insertion of a single base causing a frameshift led to a stop codon in the shifted frame.
[0060] The increase of stability is advantageous because the viral taxa recited in the aspects of the disclosure require passaging from a cell culture to another cell culture to secure formation of viral particles or viral vectors. It has been observed that, in the course of said passaging, the heterologous nucleic acid becomes genetically instable. For example, as shown in the Examples, the heterologous nucleic acid may acquire and accumulate mutations which render the viral particles unsuitable as vectors for transferring the desired heterologous nucleic acid to target cells, e.g., for the purpose of vaccination or gene therapy. In other cases, it has been observed that the heterologous nucleic acid is entirely lost in the course of said passaging. Obviously, this renders the viral particles unsuitable for the intended purpose as well.
[0061] The term "passaging" as used herein has its art-established meaning. In particular, for manufacturing of viral vectors as defined herein, a nucleic acid encoding a recombinant vector is first transfected into cells and viral particles are obtained. This first step is also referred to as viral vector rescue. Infectious viral particles are released from the transfected cells, e.g., via detergent-mediated lysis or freeze-thaw and the supernatant containing said infectious vectors is used to infect fresh cells. This process is called passaging and repeated until sufficient infectious particles are obtained to infect a large batch of cells to produce sufficient quantities of viral vectors.
[0062] The present inventors surprisingly found that using an inhibitory RNA as defined herein is a means of decreasing or entirely abolishing such genetic instability.
[0063] Accordingly, a first aspect of this disclosure provides a method of increasing genetic stability of a viral vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, said viral vector being an adenoviral (AV) vector, a poxvirus vector, a baculo virus vector, or a herpes virus vector, wherein said increasing is as compared to the absence of said inhibiting. In some embodiments, the present disclosure relates to a method of increasing genetic stability of a viral vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, said viral vector being an adenoviral (AV) vector, a poxvirus vector, a baculo virus vector, or a herpes virus vector, wherein said increasing is as compared to the absence of said inhibiting, wherein the method comprises inhibiting transcription and / or translation of said heterologous nucleic acid by using an inhibitory RNA and wherein the viral vector is stable during at least one passaging step. Evidence for said increasing of genetic stability can be found in the Examples enclosed herewith.
[0064] The terms "heterologous nucleic acid", "transgene" and "nucleic acid of interest" are used equivalently herein. A third nucleic acid as disclosed further below in conjunction with cells of the present disclosure comprises said heterologous nucleic acid or nucleic acid of interest.
[0065] Related thereto, and in a second aspect, the present disclosure provides a method of producing an AV vector, a poxvirus vector, a baculovirus vector, or a herpes virus vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, wherein said inhibiting is performed by an inhibitory RNA.
[0066] It turned out in a number of circumstances that no production of the mentioned vectors was possible at all, or the production was very low in a scenario where the transcription and / or translation of said heterologous nucleic acid was allowed to occur. In other words, the method of the second aspect is required to make said production (in certain contexts also referred to as virus vector "rescue") at all possible or to facilitate or increase the production.
[0067] In an embodiment of the methods of the first and the second aspect, said method comprises at least one step of passaging said viral vector from one cell culture to another cell culture, preferably of the same cell type.
[0068] In some embodiments, the mentioned control of transcription and / or translation is desirable since the purpose of the cells of the disclosure is the production of viral particles and generally not the concomitant transcription or translation of a gene of interest. In some embodiments, the control of transcription and / or translation comprises the reduction of the transcription and / or translation of the heterologous nucleic acid.
[0069] In addition, certain heterologous nucleic acids or genes of interest are or encode products which are toxic for said cell (i.e., for the production cell line of the third and the fourth aspect). Non-limiting examples of such toxic products include proteins selected from the group consisting of endogenous virus-derived antigens HERV antigens derived from gag, env, W, H, MSRV, 3.1 (also known as HERV-R), coHERV, or HPV-encoded genes derived from the El, E2, E6 and E7 region of HPV16 or other HPV strains. Toxic proteins may also include pro- apoptotic proteins, such as RIPK3, proteins interacting with a component of the NFKB pathway, such as TRIF interacting with TLR3, etc. Reducing or inhibiting expression of a toxic gene product is not only a means to secure survival of the production cell, but, as stated above, also to increase production and / or genetic stability of said viral particles as compared to a setup where both said inhibitory RNA and said binding site are absent.
[0070] In some embodiments, said increase in yield of viral particles may be at least 1.5-fold, at least 2-fold or at least 5-fold compared to the absence of said inhibitory RNA, preferably compared to the absence of both said inhibitory RNA and said binding site. Of note, since in certain instances no viral particles could be obtained at all in the absence of said inhibitory RNA and its binding site, such increase amounts to an arbitrarily high number.
[0071] In some embodiments of the method of the second aspect, said heterologous nucleic acid is flanked by inverted terminal repeats (ITRs) at either end.
[0072] In some embodiments, (a) said AV vector is derived from a human or primate AV, and / or is selected from the group consisting of Ad5, hAd5, hAd6, Adl9a / 64, hAd26, chimpanzee AdOxl, chimpanzee Ad3, chimpanzee Ad63, Gorilla Ad34 and Gorilla Ad36; (b) said baculovirus vector is derived from a baculovirus, and / or is selected from Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) and Bombyx mori nuclear polyhedrosis virus (BmNPV); (c) said poxvirus vector is derived from an orthopoxvirus vector, and / or is a Vaccinia viral vector such as Modified Vaccinia virus Ankara (MV A); or (d) said herpes virus vector is derived from an HSV vector, and / or is an HSV-1 vector.
[0073] Further information about vectors, in particular vaccine vectors can be found in Colloca et al., Sci. Transl. Med. 4, 115 (2012). Of note, the method of the first and the second aspect is not particularly limited to any of the above exemplary representatives of the various viral taxa. For example, it can be applied to any type of AV vectors including high-capacity AV vectors or El, E3, E4-deleted AV vectors.
[0074] The present disclosure is advantageous over art-established systems for inhibiting expression such as the Tet system or other -drug-dependent transcriptional regulation systems leading to repression of gene expression, such as the CRISPR based repression systems or tamoxifen inducible repression. The Tet system and the CRISPR repression systems require the presence of an expressed Tet repressor protein binding to TetO sequences. Therefore, the Tet and CRISPR repression systems adds complexity to a system to produce viral particles and may deliver a slow or delayed inhibitory response. While using tamoxifen (an estrogen receptor modulator) instead of an antibiotic for expression control, disadvantages of the Tet system generally apply as well to the other drug-dependent transcriptional regulation system leading to repression of gene expression. The present disclosure overcomes these deficiencies. Of note, and despite dispensing with said art-established systems, the present disclosure delivers performance.
[0075] Therefore, the present disclosure does not have to rely on any further or alternative means to control transcription and / or translation of a transgene ("heterologous nucleic acid"; "nucleic acid of interest", "gene of interest" or "third nucleic acid"). Accordingly, in some embodiments, the methods of the first and the second aspect or the cell of the third or fourth aspect make no use of other systems than said inhibitory RNA and, where applicable, said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic acid.
[0076] In another embodiment, the methods of the disclosure may further use the Tet system, the tamoxifen inducible Cre system and / or other means to control transcription or translation of a gene of interest, in addition to the inhibitory RNA.
[0077] In another embodiment, said inhibitory RNA is a small inhibitory RNA. Non-limiting examples of small inhibitory RNAs are an shRNA, a miRNA, an siRNA or an antisense RNA. In a further embodiment, more than one inhibitory RNA is used, such as two, three, four, five of more inhibitory RNAs. Each member of such plurality of inhibitory RNAs may, but does not have to, recognize different binding sites. Without wishing to be bound by a specific theory, it is considered that the use of more than one inhibitory RNA causes synergistic effects in terms of inhibiting expression of the nucleic acid of interest comprised in the third nucleic acid. When making use of more than one inhibitory RNA, the molecular architecture is not particularly limited. One may use, e.g., two shRNAs, two miRNAs, two siRNAs, two antisense RNAs, one shRNA and one miRNA, one shRNA and one siRNA, etc.
[0078] In some embodiments, said heterologous nucleic acid comprises a gene to be transcribed, in particular a gene to be transcribed in a production cell of the present disclosure (see third and fourth aspect and the third nucleic acid recited in that context). Such gene would be transcribed into a transcript which encodes a protein, or into a non-coding nucleic acid such as a non-coding RNA. In either case, in some embodiments, the transcript of said heterologous nucleic acid or of said gene of interest comprises the region coding for said protein or comprises said non-coding RNA, and furthermore comprises said binding site in accordance with the present disclosure.
[0079] In one embodiment, said inhibitory RNA has less than 100%, less than 98%, less than 95%, less than 90%, less than 80% complementarity or no statistically significant complementarity to a sequence of a gene endogenous to the cell of the third or the fourth aspect, in order not to inhibit or reduce said gene expression substantially. This can be measured by mRNA sequencing methods. Said endogenous gene is to be held distinct from any nucleic acid recited in the definition a cell of the third or fourth aspect. Of note, such endogenous genes may encode functions vital to the cell, the inhibition of which is generally undesirable.
[0080] In some embodiments, said inhibitory RNA has a lower degree of complementarity or no statistically significant complementarity to any of said second nucleic acid(s) as defined in the third aspect. In other embodiments, said inhibitory RNA has a lower degree of complementarity or no statistically significant complementarity to a sequence of a gene endogenous to the cell line of the third or fourth aspect. In other words, in such embodiments, binding of said inhibitory RNA to its binding site is specific. In one embodiment, said inhibitory RNA, when transcribed, inhibits the transcription of said heterologous nucleic acid, said nucleic acid of interest and / or the expression of said protein of interest.
[0081] In a further embodiment, the binding site of the inhibitory RNA is located in the nucleic acid of interest, for example, in an untranslated region (UTR) comprised in said nucleic acid of interest, such as the 3'-UTR or the 5'-UTR.
[0082] In one embodiment, said binding site is a sub-sequence of said nucleic acid of interest, in particular of a coding region of said nucleic acid of interest.
[0083] Small inhibitory RNAs, such as shRNAs, miRNAs, siRNAs and antisense RNAs can easily be tailored to bind a nucleic acid of interest. Generally speaking, a certain degree of complementarity of said inhibitory RNA to said nucleic acid of interest or to said third nucleic acid is preferred. Complementarity entails the capability of the inhibitory RNA to hybridize or, in other words, perform Watson-Crick base pairing with said nucleic acid of interest or said third nucleic acid. In some embodiments, complementarity with the nucleic acid of interest or third nucleic acid is over at least 80%, at least 90%, at least 95%, at least 98% or 100% of the length of said inhibitory RNA. In other embodiments, for small inhibitory RNAs, there are 3 or less, 2 or less, one, or no mismatch between the small inhibitory RNA and the nucleic acid of interest or third nucleic acid. Without wishing to be limited by a specific theory, it is considered that complementarity requirements are lower for miRNAs than for shRNAs, siRNAs and antisense RNAs. In some embodiments, the small inhibitory RNAs, such as shRNAs, miRNAs, siRNAs and antisense RNAs, comprise higher degrees of complementarity including 100% complementarity with the nucleic acid of interest or third nucleic acid over the length of said inhibitory RNA. In some embodiments, miRNAs, depending on their mechanism of action, may exhibit less than 100% complementarity to the nucleic acid of interest or to the third nucleic acid. Whether a certain level of complementarity which is below 100% is sufficient, can be determined, for example, by measuring the degree of inhibition of transcription of said nucleic acid of interest, e.g., by mRNA sequencing and / or by quantifying the amount or number of viral particles produced. In an alternative embodiment, said binding site is unrelated to the coding region of said nucleic acid of interest. Such unrelatedness confers distinct advantages in that it does not entail a requirement of said inhibitory RNA to be tailored to the coding region of a particular heterologous nucleic acid or nucleic acid of interest. In other embodiments, when said binding site is unrelated to the coding sequence of said nucleic acid of interest, use is made of a generic binding site which is comprised in or to be incorporated into said nucleic acid of interest or third nucleic acid. This approach allows for a universal inhibitory RNA or first nucleic acid (and universal plasmid comprising said first nucleic acid) that comprises the inhibitory RNA and which does not require adaptation, neither to the virus family or viral serotype, nor to the specific nucleic acid of interest.
[0084] In some embodiments, said methods of the first and the second aspects make no use of other systems than said inhibitory RNA and said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic add. In some embodiments, no use is made of inducible gene expression systems, such as the Tet system and / or the Tamoxifen inducible Cre system. Inducible gene expression systems are well known in the art and have been described, for example, in Kallunki T., et al. Cells 2019, 8, 796.
[0085] Just for the sake of completeness, the following description of an exemplary Tet system (also known as "T-Rex") is given. In the T-Rex system, the gene of interest is flanked by an upstream CMV promoter and two copies of tetracycline operator 2 (TetO2) sites. Expression of the gene of interest is repressed by the high affinity binding of TetR homodimers to each TetO2 sequences in the absence of tetracycline. Introduction of tetracycline results in binding of one tetracycline on each TetR homodimer followed by release of the TetR homodimer from the TetO2. Unbinding of TetR homodimers form the TetO2 results in de-repression of the gene of interest. See, for example, Hillen W. and Berens. Annu Rev Microbiol. 1994;48:345-69; W Hillen et al. J Mol Biol. 1983 Sep 25;169(3): 707-21; Kathleen Postle et al. Nucleic Acids Research, Volume 12, Issue 12, 25 June 1984, Pages 4849-4863; and Feng Yao et al. Human Gene Therapy. Sep 1998.1939-1950.
[0086] In one embodiment, said method of the first and / or second aspect is an in vitro or ex vivo method. In one embodiment, said inhibitory RNA is an shRNA and comprises the sequence of SEQ ID NO: 1 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the sequence of SEQ ID NO: 1. In some embodiments, the binding site of said shRNA of SEQ ID NO: 1 comprises a sequence at least 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% identical to the sequence of SEQ ID NO: 2 or is a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the sequence of SEQ ID NO: 2.
[0087] As common in the design of inhibitory RNAs, the inhibitory RNA comprises a strand which comprises a sequence which is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, or 100% identical to a sequence comprised in the respective binding site.
[0088] In one embodiment, said shRNA comprises or consists of:
[0089] (a) a first sequence attttctggttagcactgtgc (SEQ ID NO: 3) or cgtgtcacgattggtctttta (SEQ ID NO: 5);
[0090] (b) a second sequence which is the reverse complement of said first sequence, wherein first and second sequence, upon base-pairing, form a stem; and optionally
[0091] (c) a third sequence connecting said first sequence to said second sequence, wherein said third sequence, upon formation of said stem, forms a loop,
[0092] Wherein, in case of said third sequence being present, first, second and third sequences are connected as follows: 5' — second sequence— third sequence— first sequence— 3' or 5'— first sequence— third sequence— second sequence— 3', and wherein 5' and / or 3' end may carry flanking sequences.
[0093] The design 5' — second sequence— third sequence— first sequence— 3' maybe used with a first sequence which is the sequence of SEQ ID NO: 3. The design 5'— first sequence— third sequence— second sequence— 3' may be used with a first sequence which is the sequence of SEQ ID NO: 5.
[0094] The third sequence may be 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides long and may have any sequence of nucleobases. In some embodiments, said third sequence is CATGAG, TGTGCTT, GAGTAC, or TTCGTGT. Third sequences CATGAG and TGTGCTT may be used with SEQ ID NO: 3 as first sequence. Third sequences GAGTAC and TTCGTGT may be used with SEQ ID NO: 5 as first sequence.
[0095] In one embodiment, the binding site of the above defined shRNA comprises or consists of the sequence gcacagtgctaaccagaaaat (SEQ ID NO: 4) or taaaagaccaatcgtgacacg (SEQ ID NO: 6). The binding site comprising or consisting of the sequence of SEQ ID NO: 4 is complementary to the first sequence of SEQ ID NO: 3, as comprised in the above defined shRNA. The binding site comprising or consisting of the sequence of SEQ ID NO: 6 is complementary to the first sequence of SEQ ID NO: 5, as comprised in the above defined shRNA.
[0096] While the above provided sequences all contain thymines, it is understood that in the above defined shRNA, generally uridines will take the place of thymines. Furthermore, it is understood that the shRNA will generally carry a hydroxy group at the 2' position of the ribose moieties. A nucleic acid encoding said shRNA will generally be DNA and generally carry a hydrogen at the 2' position of the ribose moieties (deoxyribose). The binding site will generally be DNA but may also be RNA.
[0097] Instead of the sequences of any one of SEQ ID NO: 3 to 6, sequences with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% identity thereto may be used. Furthermore, 1, 2 or 3 bases may be changed in the sequences CATGAG, TGTGCTT, GAGTAC, and TTCGTGT.
[0098] In a further embodiment, said inhibitory RNA comprises or consists of a sequence complementary to a UTR comprised in said heterologous nucleic acid, preferably to a 5' UTR such as the 5' UTR of a gene encoding a CMV antigen. This includes sequences complementary to a region as opposed to the entirety of said UTR. In some embodiments, the binding site is a sequence comprised in a UTR comprised in said heterologous nucleic acid, preferably in a 5' UTR such as the 5' UTR of a gene encoding a CMV antigen. Preferred lengths of said sequence comprised in said inhibitory RNA and of said sequence comprised in a UTR comprised in said heterologous nucleic acid are from about 12 to about 30, from about 15 to about 25, such as from about 19 to about 21 nucleotides. Also, in the context of these embodiments, sequences with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% to the recited sequences may be used.
[0099] In a third aspect, the present disclosure provides a cell comprising: (a) a first nucleic acid encoding or being an inhibitory RNA; (b) at least one second nucleic acid, said at least one second nucleic acid providing functions necessary for generating an AV vector; and (c) a third nucleic acid comprising a heterologous nucleic acid to be packaged into an AV vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
[0100] The term "cell", "cell line" and "cell in culture" are used equivalently herein.
[0101] In some embodiments, said inhibitory RNA does not bind to the second nucleic acid(s). This can be measured by mRNA sequencing methods. In other words, said inhibitory RNA is tailored to bind to a site within said third nucleic acid. In structural terms, said inhibitory RNA has less than 100%, less than 98%, less than 95%, less than 90%, less than 80% complementarity or no statistically significant complementarity to any of said second nucleic acid(s).
[0102] In some embodiments, the second and third nucleic acids are plasmids. It is understood that the plasmid / s comprising the at least one second nucleic acid comprise the necessary elements for transcription of said nucleic acids or proteins, as defined above which provide the functions necessary for generating viral vectors.
[0103] Furthermore, the plasmid comprising the third nucleic acid and said binding site for the inhibitory RNA contains such necessary elements, as well. This ensures that, in the absence of said inhibitory RNA (e.g., in a target cell to be transfected with said viral particles), transcription, and, where applicable, translation of said nucleic acid of interest or of said protein of interest ensues. Said necessary elements include promoters. In addition, enhancers may be present, as well.
[0104] In some embodiments of the cell of the third aspect, said at least one second nucleic acid is or comprises a nucleic acid encoding at least one of adenoviral El, E2, E3, E4, E4ORF6, pIX, or a functional homologue or fragment thereof. In some embodiments of the cell of the third aspect, said third nucleic acid comprises inverted terminal repeats (ITRs). In some embodiments, said ITRs flank the heterologous nucleic acid comprised in said third nucleic acid at either end.
[0105] In a fourth aspect, the present disclosure provides a cell comprising: (a) a first nucleic acid encoding or being an inhibitory RNA; (b) a third nucleic acid comprising a heterologous nucleic acid to be packaged into a poxvirus vector, a baculovirus vector, or a herpes virus vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
[0106] In a further embodiment of the cell line of the third and the fourth aspect, said first nucleic acid encodes said inhibitory RNA and comprises a promoter selected from the group consisting of (i) an RNA polymerase III promoter; (ii) a small RNA-expressing promoter, such as a U6 promoter or Hl promoter; (iii) an RNA polymerase II promoter; and (iv) a promoter with activity in eukaryotic cells, such as CMV promoter. Those skilled in the art can determine the appropriate promoter to be used for the first nucleic acid.
[0107] In embodiments of the cell of the third and the fourth aspect, said cell does not comprise any means other than said first nucleic acid and said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic add. Exemplary means such as the Tet system are disclosed further above.
[0108] In embodiments of the cell of the third and the fourth aspects, said cell is a cell in culture, an in vitro cell or an ex vivo cell.
[0109] In embodiments of the cell of the third aspect, said cell is stably or transiently transfected with said at least one second nucleic acid of (b).
[0110] In embodiments of the cell of the third or the fourth aspect, to the extent applicable:
[0111] (i) said first nucleic acid and said at least one second nucleic acid are comprised in a first plasmid and said third nucleic acid is comprised in a second plasmid; (ii) said first nucleic acid and said third nucleic acid are comprised in a first plasmid and said at least one second nucleic acid is comprised in at least one second plasmid;
[0112] (iii) said first nucleic acid is comprised in a first plasmid, said at least one second nucleic acid is comprised in at least one second plasmid and said third nucleic acid is comprised in a third plasmid;
[0113] (iv) said first nucleic acid, said at least one second nucleic acid and said third nucleic acid are comprised in the same plasmid; or
[0114] (v) said first nucleic acid is comprised in a first plasmid, and said at least one second nucleic acid and said third nucleic acid are comprised in a second plasmid.
[0115] Plasmids carrying second nucleic acids are commonly referred to as "helper plasmids". Similar to the terms "helper function", "helper nucleic acid" and "helper protein" being defined as above, the notion of a "helper plasmid" has the same meaning. In particular, it includes what is sometimes also referred to as "packaging plasmids". In the case of AV, a plasmid carrying at least one gene of the E region of the adenovirus genome would be called "packaging plasmid" and, in accordance with the disclosure, it would be referred to as a "helper plasmid". Of note, and as known in the art, packaging functions are generally specific for each viral serotype.
[0116] Helper plasmids and helper functions are well known in the art and have been described, for example, in Bulcha J.T., et al. Signal Transduction and Targeted Therapy (2021) 6:53.
[0117] In some embodiments, relating in particular to adenoviral vectors, helper functions are provided by the cell, i.e., said cell is stably transfected with nucleic acids providing said helper functions. To the extent use is made of E4Orf6 as helper function, this may be provided as a plasmid.
[0118] In some embodiments of the cell of the third or fourth aspect, said binding site is in an untranslated region of said heterologous nucleic acid.
[0119] Cells comprising the nucleic acids required by the third and the fourth aspect, respectively, may be obtained by transfection of the different nucleic acids. Said transfection can be carried out using one of a variety of methods known to those skilled in the art. For example, transfection reagents such as polyethyleneimine (PEI) or polybrene may be used. Electroporation is another established transfection method.
[0120] In some embodiments, said cell line is not the human body, at the various stages of its formation and development.
[0121] In one embodiment of said cell line, the first nucleic acid and / or at least one of the at least one second nucleic acids is / are integrated into the genome of said cell. In another embodiment, the third nucleic acid is integrated into the genome of said cell. See, e.g., Escandell et al., Biotechnol. Bioeng. 120, 2578-2587 (2023). In another embodiment, the third nucleic acid comprising a nucleic acid or a gene of interest is integrated into the genome of said cell.
[0122] In one embodiment, said cell is of avian origin and is selected from AGEI.CR.pIX, DF-1, and chick embryo fibroblasts (CEF); is of mammalian origin and is selected from HEK-293, HeLa, immortalized human amniocyte cell (CAP®), and BHK-21; or is of insect origin and is selected from Sf9, Sf21, Tn-368 and BTI-TN-5B1-4. These designations as such refer to art-established cell lines, i.e., parental cell lines. Of note, though, in the context of the cells of the third and the fourth aspec,t it is understood that such art-established cell lines serve as starting point for the generation of said cell of the third or fourth aspect. In other words, while in the context of this embodiment designations as common in the art are used, they actually refer to cells derived from the art-established cell lines. They differ therefrom in that they comprise the nucleic acids required by the third or fourth aspect.
[0123] For poxviruses including Vaccinia virus, such as MV A, AGEI.CR.pIX, DF-1, CEF, and BHK- 21 cells are particularly suitable.
[0124] An exemplary method for making cell lines of the fourth aspect is as follows. A suitable parental cell line, a parental virus to be selected from the viral taxa disclosed herein (a poxvirus vector, a baculovirus vector or a herpes virus vector), said parental virus not carrying the heterologous nucleic acid, and a plasmid carrying said heterologous nucleic acid or third nucleic acid, are combined. In particular, the parental cell line is transfected with said parental virus and said plasmid. Suitable flanking regions designed for homologous recombination provide for integration of said heterologous nucleic acid into the parental virus, providing a recombinant virus. This yields a cell of the fourth aspect, wherein the third nucleic acid is implemented as a recombinant virus.
[0125] The generation of recombinant baculoviruses is described in e.g., Luckow et al., J Virol. 1993 Aug; 67(8): 4566-4579; and Anderson et al., Focus 17, 53 (1996).
[0126] In some embodiments, the recombinant virus may comprise said first nucleic acid.
[0127] In some embodiments, the recombinant virus comprises both said first nucleic acid and said third nucleic acid.
[0128] Said cell of the third or fourth aspect comprises said recombinant virus in the above embodiments.
[0129] In embodiments of the method and cells of the present disclosure, said heterologous nucleic acid or third nucleic acid, respectively, (a) encodes a protein of interest; or (b) is capable of being transcribed into a non-coding nucleic acid, including non-coding RNAs such as miRNAs.
[0130] In further embodiments of the method and the cells of the present disclosure, said protein of interest is (a) an antigen for vaccination, preferably an antigen from human papilloma virus (HPV), human immunodeficiency virus (HIV), human cytomegalovirus (HCMV), Epstein- Barr virus (EBV), a human endogenous retrovirus (HERV), a coronavirus, or monkeypox virus; or (b) a therapeutic protein.
[0131] In some embodiments, said HIV antigen is an env protein. In some embodiments, said coronavirus antigen is the spike protein of SARS-CoV-2. In some embodiments, said antigens are viral fusion proteins, i.e., viral proteins which are responsible for binding to and infecting host cells. HIV env and SARS-CoV-2 spike protein are examples in that respect.
[0132] Further antigens are HPV El, E2, E6 and E7, in particular E2. Said HPV antigens may be coupled to a fragment of CD74 (see, e.g., Esposito et al., Sci Transl Med. 2020 Jun 17; 12(548): eaaz7715; Xu et al., EBioMedicine. 2017 Apr; 18: 204-215; and Daradoumis et al., Cancers (Basel). 2023 Dec; 15(24): 5863). A further preferred HPV antigen comprises El, E2, E6, and E7, for example as a fusion protein. In some embodiments, the latter antigen is as described in WO 2023 / 021116. Further HIV antigens are tat, rev, vif, vpr and gag. Exemplary HERV antigens are gag, env, W, H, MSRV, 3.1 (also known as HERV-R), coHERV, and MER34.
[0133] Said therapeutic protein may be useful for the treatment or prevention of cancer, degenerative diseases including neurodegenerative diseases, infections by pathogens, and ageing.
[0134] Of note, culturing said cell line of the third or the fourth aspect is a means to produce respective viral particles. Said viral particles in turn have applications in various fields including vaccination and gene therapy. Accordingly, in embodiments of the method of the first or the second aspect, said method comprises culturing the cell of the third or the fourth aspect. In some embodiments, said method comprises at least one step of passaging said viral vector from said cell to a cell culture, preferably of the same cell type.
[0135] In some embodiments, the cells are harvested, lysed, and clarified or filtered by methods known to those skilled in the art, to obtain the viral particles.
[0136] In some embodiments of said methods or said cells of any one of the preceding aspects, said nucleic acid of interest is or encodes a vaccine, is a therapeutic gene or encodes a therapeutic protein, is a diagnostic gene, or encodes a protein capable of binding to a cognate binding partner.
[0137] In some embodiments, said therapeutic gene or said therapeutic protein complements a genetic disorder and / or a disorder related to the under-expression of the naturally occurring counterpart of said gene or protein; encodes or is a chimeric antigen receptor (CAR); encodes or is a base editor; or said cognate binding partner is a biomolecule of diagnostic or analytical interest, for example, said biomolecule being a protein.
[0138] In a fifth aspect, the present disclosure provides the use of a cell of the third or fourth aspect for producing an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector.
[0139] In a sixth aspect, the present disclosure provides the use of a cell of the third or fourth aspect for increasing genetic stability of an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector. The embodiments disclosed above for the cell of the third and fourth aspect apply mutatis mutandis to the uses in accordance with the fifth and the sixth aspect.
[0140] In a seventh aspect, the present disclosure provides an AV vector, a poxvirus vector, a baculovirus vector, or a herpesvirus vector (a) obtained by the method of the first or second aspect; and / or (b) carrying a heterologous nucleic acid encoding a protein of interest, wherein a non-coding flanking region of said heterologous nucleic acid comprises a binding site for an inhibitory RNA.
[0141] The different embodiments disclosed above for the preceding aspects apply mutatis mutandis to the vector of the seventh aspect.
[0142] In some embodiments of said vector, said flanking region is a UTR, preferably a 3'-UTR.
[0143] In some embodiments of said vector, said heterologous nucleic acid encodes a protein of interest, wherein said protein of interest is as defined above.
[0144] EXAMPLES
[0145] Example 1: Tet repressor- and shRNA-mediated knock-down of MVA trans gene expression Materials and methods
[0146] Antigen generation
[0147] The antigen Ii-E1E2E6E7 was generated as previously described (WO 2023 / 021116). Briefly, the sequence of the antigen Ii-E1E2E6E7 was assembled by connecting the amino acid sequence of li (NM_004355.3) with El, E2, E6, and E7 of MfPV3 (EF558839.2). El was linked to E2, and E6 to E7, via a GS-linker, respectively. Mutations were introduced into E6 and E7 to inactivate the 25 oncogenic potential: L110Q and deletion of C-terminal ETEV in E6; D24G, L71R, C95A; C297A was introduced into E2 to inactivate DNA-binding. Cell lines
[0148] Adherent AGEI.CR pIX (CR pIX) cells were cultivated in DMEM / F-12 containing 5% fetal calf serum (FCS) as previously described (Jordan I et al. Vaccine (2009) 27:748-756.). CR pIX cells in suspension were cultivated as previously described (Jordan et al. 2009, supra). Modified AGEI.CR pIX (CR pIX PRO) cells were generated by transduction of CR pIX cells with a VSV- G pseudotyped lentiviral vector at MOI 1 in the presence of 8 pg / ml polybrene (hexadimethrrne bromide, Cat. H9268, Sigma-Aldrich, Germany) coding for the ProVector expression cassette (Figure 8). This ProVector expression cassette contains an shRNA (SEQ ID NO: 1) under control of a U6 promoter, the tetracyclin repressor gene (tetR) controlled by a CMV promoter, and a puromycin resistance marker gene controlled by the EFlot core promoter.
[0149] Generation of recombinant viruses
[0150] Recombinant MVA-CR19 vectors were generated as previously described (Jordan I et al. Virol Sin (2020) 35:212-226.). Briefly, MfPV3 Ii-E1E2E6E7 (WO 2023 / 021116) or GFP (CR19 GFP vector) was cloned into the shuttle vector SP-CR19III, suitable for integration into MVA's deletion site III (Dellll) under the control of the MVA E / L-promoter (SSP with one point mutation (Jordan 2020, supra) (vector CR19-M-DelIII) or cloned into the shuttle vector pLZAWl, suitable for integration into MVA's thymidine kinase locus (TK) under the control of the MVA SSP-promoter (vector CR19- M-TK) (Chakrabarti S et al. England (1997)). The shuttle vectors were modified further by inserting two copies of the tetracycline operator sequence (tetO) directly downstream of the MVA promoter and by adding the shRNA target sequence (inhibitor binding domain 1; IBD1; SEQ ID NO: 2) at the 3'-UTR of the Gene of Interest (GOI). The recombinant MVA-CR19 vectors generated were CR19-GFP, CR19- M-TK and CR19-M-DelIII. See Figure 1.
[0151] Recombinant MVA encoding the different GOIs were generated by homologous recombination in adherent avian cell line AGE1.CR pIX (CR pIX) or CR pIX PRO cells (cells transfected with the ProVector expression cassette) that prevent the undesirable expression of the GOI during generation and propagation of the recombinant MVA. To this end, the culture monolayers seeded in a six- well plate were infected with MVA or MVA-CR19 with an MOI of 0.05 and transfected with 2 pg of the individual shuttle vector by using the Effectene Transfection Reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The CR pIX PRO suppressor cell line used in conjunction with the tetO / shRNA transfer plasmids for in vitro recombination (IVR), rMVA plaque selection and subsequent rMVA amplification is in the following referred to as ProVector system.
[0152] The infected / transfected culture was harvested 2-3 days post-infection / transfection, sonicated, and used for infection of a cell monolayer in a six-well plate format. Resulting plaques were validated by PCR and an iterative plaque purification procedure was initiated until MVAs without the correct GOI expression cassette were absent (usually within 5-8 rounds of plaque purification).
[0153] For the propagation of plaque-purified MVAs, the cell harvest material was sonicated by using a Vial Tweeter (set to 20 s of 100% cycle and 90% amplitude, Hielscher, Germany), and CR pIX PRO cells (grown in suspension at 2xl06cells per ml in 1:1 mixtures of CD-U4 and CD-VP4 media (Merck-Millipore, Darmstadt, Germany)) were inoculated with the individual recombinant MVA vectors at MOI 0.05. Finally, MVAs were harvested 48 h - 72 h postinfection and the TCID50 titer was determined. 3 propagation cycles were needed to generate the viral stocks.
[0154] Virus titration
[0155] Virus titers were measured by using the tissue-culture-infectious-dose 50 (TCID50) assay. Briefly, 3xl04CR pIX PRO cells per well were seeded in 96-well plates. Virus-containing material was serially diluted 1:10 in 8 technical replicates and added to the cells. 72 h postinfection the cells were screened for CPE by optical inspection under the microscope. TCID50 was calculated with the Spearman-Karber formula (Ramakrishnan MA. Determination of 50% endpoint titer using a simple formula. World J Virol (2016) 5:85-86.).
[0156] Antibodies
[0157] The following antibodies were used in this study: monoclonal mouse anti-myc antibody (9B11, 1:1000 in western blot, 1:500 in flow cytometry, Cell Signaling Technologies, Danvers, USA), polyclonal rabbit anti-vaccinia (1-VA003-07, 1:5000 in western blot, 1:1000 in flow cytometry and immunostaining, Quartett, Berlin, Germany), monoclonal mouse anti-tubulin (DMlot, 1:1000 in western blot, Santa Cruz Biotechnologies, Heidelberg, Germany), polyclonal goat anti-mouse-HRP (115-036-003, 1:5000, Jackson, West Grove, USA), polyclonal goat anti- rabbit-HRP (P0448, 1:2000 in western blot and immunostaining, Dako, Santa Clara, USA), polyclonal goat anti-mouse-PE (550589, 1:200 in flow cytometry, BD, Franklin Lakes, USA), goat anti-rabbit Alexa Fluor 647 (A21244, 1:200 in flow cytometry, Life Technologies, Eugene, USA).
[0158] Western blot
[0159] Western blot analysis was performed as previously described (Kiener R et al. Sci Rep (2018) 8:1474). Briefly, cells of interest were lysed in TDLB buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40 and 0.5% sodium deoxycholate) supplemented with protease inhibitors (Complete Mini, Roche, Basel, Switzerland). Total protein concentration of the supernatants was measured by the Bradford method (Protein Assay, BioRad, Feldkirchen, Germany). The proteins were separated on 10% SDS-PAGE under reducing conditions and blotted on a nitrocellulose membrane for western blot analysis. Targets were probed with primary and secondary antibodies as listed above. HRP-labeled secondary antibodies and enhanced chemiluminescence substrate or Femto ECL (Thermo Fisher, Waltham, USA) were used for detection in a Chemilux Pro device (Intas, Gottingen, Germany).
[0160] Flow cytometry
[0161] Intracellular staining of antigens was performed by using standard methods (Kiener et al., 2018, supra). Cells were fixed and permeabilized with cytofix / cytoperm-Buffer (4% PFA, 1% saponine, in PBS). All washing steps were done with perm / wash-buffer (PBS containing 0.1% saponine). All antibodies were diluted in perm / wash-buffer and incubated for 30 min each. Flow cytometry was performed by using an Attune NxT device (Thermo Fisher, Waltham, USA) with 488 nm and 638 nm excitation and 574 / 26 nm and 670 / 14 nm emission filters. Cells were gated on stained, uninfected, and stained mock-MVA-infected cells. Evaluation of data was performed by using Attune NxT software.
[0162] Quantification of transgene expression 3xl04CR pIX and CR pIX PRO cells were seeded and infected with the indicated MVA strain at an MOI of 1. After 6 and 24 hpi, cells were harvested into PBS. Total RNA was prepared with Rneasy Mini kit (Cat. 74106, Qiagen, Hilden, Germany) according to manufacturer's instructions. Impurities from genomic DNA were digested with Turbo DNA-free kit (Cat. AM1907, Thermo Fisher, Waltham, USA). Reverse transcription quantitative PCR (RT-qPCR) was performed with Luna Universal Probe One- Step RT-qPCR kit (E3006L, NEB, Ipswich, USA) according to manufacturer's instructions. 2 pl of total RNA extract were used on a StepOnePlus qPCR cycler (Thermo Fisher) with the following protocol: Initial reverse transcription at 55°C for 10 min, followed by initial denaturation at 95°C for 1 min, followed by 40 cycles of denaturation for 15 s at 95°C and armealing / extension for 30 s at 60°C.
[0163] For relative quantification of the transgene expression, Ct values were normalized according to the equation according to Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res (2001) 29:e45.
[0164] Immunostaining of plaques
[0165] Immunostaining was used to visualize plaques. 3xl05CR pIX or CR pIX PRO cells per well were seeded in 24-well plates. Cells were infected with an MOI of 0.01 in 1 ml DMEM / F-12 without additives. 2 h post-infection, medium was exchanged to DMEM / F-12 with 5% FCS. 48 h post-infection, cells were fixed with ice-cold acetone / methanol solution (1:1, v / v) and blocked with blocking buffer (PBS containing 3% BSA) overnight at 4°C. Cells were sequentially stained by using an anti-vaccinia antibody and anti-rabbit-HRP, both incubated for 1 h at RT with gentle agitation. All wash steps and antibody dilution steps were conducted in blocking buffer. Finally, plaques were stained with TrueBlue Peroxidase Substrate (5510- 0030, Seracare, Milford, USA) until plaques were visible (usually 5-10 min); subsequently the reaction was stopped with water. Pictures were taken with an inverted microscope (BZ-9000, Keyence, Frankfurt, Germany)
[0166] Multistep growth curve
[0167] To analyze virus replication, a multi-step growth curve was conducted as described previously (Carroll MW, Moss B. Host range and cytopathogenicity of the highly attenuated MVA strain of vaccinia virus: propagation and generation of recombinant viruses in a nonhuman mammalian cell line. Virology (1997) 238:198-211). 3xl05CR pIX and CR pIX PRO cells per well were seeded in 24-well plates. Cells were infected at an MOI of 0.05 in 200 pl DMEM / F-12 without additives. 45 min post-infection, cells were carefully washed once with PBS and incubated with a medium containing 5% FCS. Cells and supernatant were harvested at 0, 24, 48, and 72 h after adsorption, freeze-thawed thrice, sonicated for 1 min, and titrated as mentioned above.
[0168] Passaging of MVA
[0169] For analysis of genetic stability of MVA, the viruses were passaged on CR pIX and CR pIX PRO cells, similar to the protocol of Kremer M et al. "Easy and Efficient Protocols for Working with Recombinant Vaccinia Virus MVA BT- Vaccinia Virus and Poxvirology: Methods and Protocols," in, ed. S. N. Isaacs (Totowa, NJ: Humana Press), 59-92. doi:10.1007 / 978-1-61779- 876-4 4. 1.2xl06cells per well were seeded in a 6-well plate 24 h before infection. Cells were infected at an MOI of 0.05 in 1 ml DMEM / F-12 without additives. 2 h post-infection, medium was exchanged to DMEM / F-12 with 5% FCS. 48 h post-infection, cells and supernatant were harvested (=passage 1), freeze- thawed three times, and additionally sonicated three times for 1 min in a cup sonifier. New cells were again infected with 1 ml of a 1:1000 dilution of the virus material from the previous passage. This was repeated to a maximum number of 10 passages. All obtained virus material was stored at -80°C.
[0170] To obtain single plaques, cell monolayers were infected with different dilutions and covered with growth medium containing 0.8% low melting agarose. 72 h post-infection, plaques were picked in 300 pl DMEM / F-12, freeze-thawed three times, sonicated for 1 min, and amplified by infection of 3xl05cells per well in 24-well plates.
[0171] Genotyping of MVA
[0172] For genotyping of transgene insertion loci, PCR was utilized. Genomic DNA of either plaque- purified or bulk material of virus-infected cells or virus stocks was prepared with a Quick- DNA MiniPrep kit (D3025, Zymo, Freiburg, Germany) according to the manufacturer's instructions. PCR was conducted with Q5 High-fidelity DNA polymerase (M0491L, NEB, Ipswich, USA) according to standard protocols. Primers were taken from literature (Jordan I et al. Virol Sin (2020) 35:212-226; and Kremer M et al. "Easy and Efficient Protocols for Working with Recombinant Vaccinia Virus MVA BT- Vaccinia Virus and Poxvirology: Methods and Protocols," in, ed. S. N. Isaacs (Totowa, NJ: Humana Press), 59-92. doi:10.1007 / 978-l-61779-876-4_4). Analysis was done by electrophoresis in 0.5%, 0.8% or 1.5% agarose TBE gels, depending on the amplicon size.
[0173] For Sanger sequencing analysis, PCR amplicons of bulk material were purified from agarose gel by using QIAquick Gel Extraction Kit (28706X4, QIAGEN, Hilden, Germany), ligated into pJET1.2 / blunt (K1231, Thermo Fisher Scientific, Waltham, USA) and used for transformation of E. coli. Plasmids were isolated from single clones and sequenced.
[0174] Next-generation sequencing (NGS)
[0175] Exogenous cellular gDNA was depleted from virus-containing material as described previously (Jordan I, Horn D, John K, Sandig V. A genotype of modified vaccinia Ankara (MVA) that facilitates replication in suspension cultures in chemically defined medium. Viruses (2013) 5:321-339.). Briefly, virus stock or virus-containing material was precipitated by the addition of polyethylene glycol to a final concentration of 8% (w / w), incubated for 30 min on ice, and subsequently centrifuged at 6600 g for 1 h. The translucent pellet was dissolved in PBS and exogenous gDNA was digested with 8 units of TurboDNAse for 1 h, followed by adding 20 mM EDTA and heat-inactivation at 80°C for 10 min. Viral gDNA was prepared with a Quick-DNA MiniPrep kit (D3025, Zymo, Freiburg, Germany) according to the manufacturer's instructions. 10 pl of each gDNA were barcoded for NGS with the Nextera XT DNA library Prep kit (FC-131-1096, Illumina, San Diego, USA) according to the manufacturer's instructions. NGS was performed with the NextSeq500 system by using a NextSeq500 / 550 High Output Kit v2.5 with 300 cycles (20024905, Illumina, San Diego, USA). FastQ files were evaluated with CLC Genomics Workbench 22 (Qiagen, Hilden, Germany). Obtained sequences were assembled by using derivatives of the MVA-CR19 genome sequence (GenBank accession number KY633487.1) with Ii-E1E2E6E7 transgene integrated into Dellll or TK locus. Normalized transgene coverage was calculated with the formula:
[0176] % = ((read coverage transgene of passage x) / (read coverage of MVA056L of passage x)) / ((read coverage transgene of seed stock) / (read coverage of MVA056L of seed stock)) RESULTS
[0177] The aim of this Example was to analyze the potential impact of transgene expression on genetic stability and sustained expression across successive passages during rMVA selection, and the development and validation of a system to repress transgene expression in producer cells to abrogate the negative selection pressure.
[0178] The method developed here is aiming to solve the problem of spontaneously loosing transgene expression. The inventors provide evidence that the expression of the papillomavirus early antigens was associated with genetic instability and selection of rMVA mutants escaping transgene expression alongside with replication. Loss of transgene expression was mainly caused by early translation terminations or large deletions depending on the locus of the integrated transgene in the rMVA genome.
[0179] It was previously demonstrated that a fusion protein comprising the early antigens El, E2, E6 and E7 of Macaca fascicularis papillomavirus type 3 (MfPV3) were well suited to induce potent T cell responses in outbred GDI and OF1 mice when delivered via DNA or adenoviral vectors (Neckermann P et al. Front Immunol (2021) 12:4409). Repeated attempts to generate a recombinant MVA (rMVA-CR19) expressing the corresponding Ii-E1E2E6E7 fusion protein for booster immunization purposes was hampered by the stepwise loss of transgene positive plaques alongside the plaque selection process. This led the inventors to hypothesize that expression of the transgene Ii-E1E2E6E7 imposed a disadvantage on rMVA propagation.
[0180] As explained above, the CR pIX cell line was modified by means of lentiviral transduction to constitutively express the TetR together with a shRNA yielding CR pIX PRO cell line. Complementary, two tetO and a shRNA target sequence (IBD1) were integrated into the 5' and the 3' UTR of the transgene expression module of the transfer plasmid used to generate rMVA via IVR. According to these design features, residual mRNAs possibly resulting from incomplete TetR / tetO-mediated transcription repression will be degraded via binding of shRNA to the 3' IBD1 on the transcript, collectively resulting in a sustained knock-down of toxic transgene expression. (Figure 2A). Performing the IVR with the transfer plasmids encoding the presumably toxic MfPV3 li- E1E2E6E7 fusion protein, now flanked by the tetO / IBDl control elements, in the CR pIX PRO suppressor cells and applying the ProVector system for subsequent rMVA selection, the inventors eventually succeeded to generate two rMVA: MVA-CR19-TK (short CR19 M-TK) and MVA-CR19-DelIII (CR19 M-Dellll) with the MfPV3 Ii-E1E2E6E7 transgene sequence integrated either into the thymidine kinase (TK) locus or, alternatively, in the deletion III (Dellll) locus, respectively. Virus stocks for the subsequent experiments were produced starting from single plaques via 3 rounds of expansion on CR pIX PRO suppressor cells.
[0181] Specific knock-down of Ii-E1E2E6E7 expression by CR pIX PRO suppressor cells was initially proven via western blot analysis and quantified by flow cytometry using a C-terminally fused myc-tag for expression monitoring of the fusion protein (Figure 2B & C). Expression of li- E1E2E6E7 was clearly reduced in CR pIX PRO suppressor cells as compared to parental CR pIX cells, when infected with CR19 M-TK and CR19 M-Dellll, respectively, suggesting successful suppression of transgene expression (Figure 2B). GFP expression was comparable in parental CR pIX cells and CR pIX PRO suppressor cells following infection with rMVA- GFP lacking tetO and IBD1, respectively. This demonstrates that the presence of the TetR and the shRNAs do not impact transgene expression per se. Flow cytometry analysis confirmed approximately 4.3-fold and 6-fold suppression of Ii-E1E2E6E7 expression in CR pIX PRO suppressor cells compared with the parental CR pIX cells 48 hpi with CR19 M-TK and CR19 M-Dellll (Figure 2C). Ii-E1E2E6E7 mRNA levels were determined by RT-qPCR and shown to be reduced in CR pIX PRO suppressor cells by a factor of 5.8 (CR19 M-Dellll) or 1.98 (CR19 M-TK) at 6 hpi, respectively, and by a factor of 11.43 (CR19 M-Dellll) or 2.96 (CR19 M-TK) after 24 h; see Figure 2D. rMVA expressing MfPV3 H-E1E2E6E7 has a replication disadvantage on parental CR pIX cells which can be rescued on CR pIX PRO suppressor cells
[0182] Following successful generation of an rMVA-MfPV3-li-ElE2E6E7 virus stock on CR pIX PRO suppressor cells, the inventors set out to test the hypothesis that (i) expression of certain potentially harmful transgenes can have a detrimental impact on virus replication and that (ii) replicative capacity can be restored in such cases by restricting expression of such transgenes. For this purpose, replication kinetics of CR19 M-Dellll and, for comparison, CR19 GFP, and CR19 empty were measured under restricting and non-restricting conditions. CR pIX PRO suppressor cells and non-modified parental CR pIX cells were infected with the respective rMVA at an MOI of 0.05, and a multistep growth curve was generated by harvesting infected cells together with cell supernatant after 0, 24, 48, and 72 hpi. Titration on CR pIX PRO suppressor cells showed that the titer of CR19 M-Dellll was significantly reduced by a factor of approximately 10 when propagated on CR pIX cells compared with CR pIX PRO suppressor cells at all time points (Figure 3A). As a reference, virus titer of CR19 M-Dellll on CR pIX PRO cells was equal to the titers of both control viruses CR19 empty and CR19 GFP that in turn displayed no differences on both cell lines. Consistent results were obtained when comparing the plaque size of the rMVA at 48 hpi (MOI of 0.01) (Figure 3B). Immunostaining with a vaccinia-specific antibody revealed comparable plaques sizes formed by CR19 empty, CR19 GFP, and CR19 M-Dellll on CR pIX PRO suppressor cells. In contrast, smaller sized plaques with less intense staining were notified following infection of the parental CR pIX cells CR19 M-Dellll expressing the Ii-E1E2E6E7 transgene, but not for CR19 GFP and CR19 empty.
[0183] Taken together, this experiment suggests that unrestricted expression of the MfPV3 li- E1E2E6E7 antigen results in a replication disadvantage for CR19 M-Dellll and, consequently, reduced virus titers and mitigated virus spread. This replication deficit can be restored when Ii-E1E2E6E7 expression is knocked-down in CR pIX PRO suppressor cells.
[0184] Replication of CR19 M-Dellll, but not of CR19 M-TK, is restored upon passaging on parental CR pIX cells
[0185] Provided the MfPV3-li-ElE2E67 transgene has negative impact on the MVA replicative capacity under non-restricting conditions, the transgene might also have an influence on the genetic stability of the rMVA by imposing a strong negative selection on such transgeneexpressing rMVA. To test this, the inventors first generated a CR19 M-Dellll and CR19 M-TK seed virus stock (defined as passage 0) by expanding the originally selected, positive plaques (i.e., passage -3) in three consecutive amplification steps on CR pIX PRO suppressor cells, respectively. Such seed virus stocks were then serially passaged side-by-side on the parental CR pIX cells and on CR pIX PRO suppressor cells for 10 passages as described by Kremer et al. ("Easy and Efficient Protocols for Working with Recombinant Vaccinia Virus MVA BT- Vaccinia Virus and Poxvirology: Methods and Protocols," in, ed. S. N. Isaacs (Totowa, NJ: Humana Press), 59-92). Harvested virus samples were subsequently titrated under restricting conditions on CR pIX PRO suppressor cells.
[0186] Titration of CR19 M-Dellll virus samples harvested after each passage on CR pIX PRO suppressor cells yielded similar titers across all passages with a trend towards marginally higher titers in later passages, which did, however, not reach statistical significance (Figure 4A). Starting from the same seed virus stock (passage 0), CR19 M-Dellll lost already after 1 passage on the parental CR pIX cells one order of magnitude in virus titer as compared to the same virus passaged on CR pIX PRO suppressor cells (Figure 4A). This observation was in line with previous findings suggesting a replication disadvantage of CR19 M-Dellll under non-restricting conditions in the parental CR pIX cells (Figure 3). Beginning with passage 3, the titers of CR pIX-passaged CR19 M-Dellll increased and reached the same level as CR-pIX- PRO-passaged CR19 M-Dellll from passage 5 onwards.
[0187] A different effect was observed when CR19 M-TK was passaged on the two cell lines: Whilst CR19 M-TK, similar to CR19 M-Dellll, experienced a significant loss in titer after a single passage on the parental CR pIX cells, the titers of CR19 M-TK did - unlike notified for CR19 M-Dellll - not increase while being passaged on the parental CR pIX cells and consistently remained approximately 100-fold below the levels obtained for CR19 M-TK passaged on CR pIX PRO suppressor cells (Figure 4B). In general, CR19 M-TK exhibited slightly lower virus titers as compared with CR19 M-Dellll across all passages on both cell lines.
[0188] Passaging on CR pIX cells leads to rapid loss of H-E1E2E6E7 expression
[0189] We next quantified Ii-E1E2E6E7 transgene expression under non-restricting conditions in parental CR pIX cells of CR19 M-Dellll samples harvested after each passage on either CR pIX or CR pIX PRO suppressor cells, respectively, in a high-throughput flow-cytometry-based assay. CR pIX cells were infected at an MOI of 0.1 (CR19 M-Dellll) or MOI of 0.01 (CR19 M- TK) with virus samples obtained after each passage and were harvested 48 hpi. Cells were stained with rabbit anti-vaccinia and goat anti-rabbit AF647 for MVA infection and mouse anti-myc and goat anti-mouse PE for transgene expression. Cells were gated on vacciniapositive cells using cells infected with MVA without any antigen. Infected CR pIX cells were co-stained to monitor intracellular expression of Ii-E1E2E6E7 (via its myc-tag) and vaccinia proteins (polyclonal anti-vaccinia-antibody) 48 hpi (Figure 5). As controls, uninfected cells and CR19-empty-infected cells were used to gate for CR19-infected cells (vac+), and CR19 M- Dellll to gate for Ii-E1E2E6E7 expression out of vac+ cells. A rapid reduction in the frequency of Ii-E1E2E6E7 expressing cells among the CR19 M-Dellll-infected cells was observed. This was already apparent with virus samples derived from passage 1 on CR pIX cells (Figure 5A). After only 3 passages on the parental CR pIX cells, expression of Ii-E1E2E6E7 was lost. In contrast, expression of Ii-E1E2E6E7 could be observed with CR19 M-Dellll passaged on CR pIX PRO suppressor cells throughout all 10 passages. A rapid reduction in the frequency of Ii-E1E2E6E7+ cells amongst vaccinia virus antigen positive cells was also observed for CR19 M-TK passaged on CR pIX cells (Figure 5B). Interestingly, no significant difference in the fraction of Ii-E1E2E6E7 expressing cells was observed with passage level of CR19 M-TK grown on CR pIX PRO suppressor cells.
[0190] In conclusion, this experiment suggests a strong negative selection on rMVA expressing li- E1E2E6E7. Suppression of transgene expression by CR19 pIX PRO suppressor cells led to prolonged production of Ii-E1E2E6E7.
[0191] Loss of H-E1E2E6E7 expression from the Dellll locus is mainly caused by transgene deletions (CR19-M-DelIII)
[0192] The inventors next investigated whether the reduction of li-ElE2E6E7-expressing CR19-M- Dellll- and CR19-M-TK-infected cells is caused by alterations in the DNA sequence of the transgene expression cassette. PCR analyses on single plaques from selected passages were performed with primers that bind in the flanking regions of the Dellll and TK locus, respectively. In line with the transgene expression analysis above, the fraction of correctly sized PCR amplicons for CR19 M-Dellll quickly declined with the number of passages on CR pIX cells. Some plaques, which proved positive with vaccinia-specific primers, showed no specific Dellll amplicon, neither the full length, not a shortened PCR product. This may be explained by acquisition of mutations or deletions in the primer binding sites. In contrast, the expected PCR amplicon could be detected in almost all plaques of CR19 M-Dellll passaged on CR pIX PRO.
[0193] However, this analysis does not exclude short deletions, point mutations or insertions / deletions of few bases that might result in frame shifts or truncated products. Thus, next-generation sequencing (NGS) was employed as an unbiased method to deeply characterize the genetic integrity of the passaged rMVA. Predominantly viral DNA was isolated from CR-pIX- and CR-pIX-PRO-passaged CR19 M-Dellll and CR19 M-TK by depleting cellular gDNA, and subjected to Illumina NextSeq500 deep-sequencing. The resulting reads were aligned to the CR19 M-Dellll guiding sequence. The obtained coverage maps revealed a wide deletion at the Dellll locus when CR19 M-Dellll had been passaged on parental CR pIX cells. To quantify the fraction of the Dellll locus deletion along the passages, the mean read coverage of the transgene Ii-E1E2E6E7 was normalized to the mean read coverage of the essential MVA-DNA polymerase gene locus (MVA056L) (Figure 6A). The normalized Ii-E1E2E6E7 mean read coverage of CR19 M-Dellll rapidly dropped to almost 0% within three passages on CR pIX cells, whereas normalized mean read coverage of li- E1E2E6E7 of CR-pIX-PRO-passaged CR19 M-Dellll was overall high with a trend towards some decline at later passages.
[0194] CR-pIX-PRO-passaged CR19 M-Dellll exhibited a slight reduction in read coverage in passages 5-10. Detailed analysis revealed reduced read coverage spanning from the middle of the E2 gene within the transgene until MVA165R (nucleotide position 161317 to 165771), indicative for a truncation of the transgene. This may explain the continuously decreasing fraction of Ii-E1E2E6E7 expressing cells amongst vaccinia virus positive cells from 70% (passage 1) to only 10% (passage 10).
[0195] To confirm the deletions found by NGS, a PCR analysis with a primer pair spanning from MVA155R to MVA167R was done with the same DNA preparation used for NGS (Figure 6 B & C). This PCR analysis confirmed fast deletion of the trans gene from the Dellll locus when passaged on parental CR pIX cells (Figure 6C), resulting in bands of a lower molecular weight than the expected full-length PCR amplicon of 14169 bp (CR19 M-Dellll; black arrow, Figure 6C). Moreover, frequent detection of bands of a lower molecular weight than the expected empty Dellll integration site was observed (< 9471 bp, white arrow). These bands resemble deletions not only of the transgene itself but also of neighboring genes upstream and downstream of the Dellll locus.
[0196] Early translational stop as a result of mutations impairs transgene expression from the TK locus under non-restricting conditions (CR19 M-TK)
[0197] In contrast to CR19 M-Dellll passaged on CR pIX, CR19 M-TK bands resembling shortened PCR products as a result of deletions represented only a minor fraction in the PCR analysis (Figure 7 A and B). This PCR analysis was repeated for an independent replicate of the passaging experiment and the results were similar. This was also confirmed by the deepsequencing analysis of the passaged CR19 M-TK that revealed no difference in normalized transgene coverage between the two cell lines. However, instead of deletions, specific mutations within the transgene could be observed (Figure 7C and D). Passaging of CR19 M- TK on parental CR pIX cells led to the early accumulation of a virus variant harboring a specific guanine to thymidine exchange resulting in the transition of E265 (GAG) to an early stop codon (TAG; referred to as E265*). The fraction of the E265* rMVA mutant among all rMVA peaked at passage 5, but then declined again until passage 9. Furthermore, during passaging on CR pIX, a variant carrying an insertion of guanine after nucleotide position 893 emerged. This insertion results in a frameshift beginning at L299 leading to an early translational stop at position 342 and thus to a truncated protein, referred to as L299Tfs*342. L299Tfs*342 could already be detected in about 5% of the recovered reads of passage 1 on CR pIX cells and accumulated until all recovered reads in passage 9 exhibited this mutation. Both mutations found by deep-sequencing could be verified by Sanger sequencing (see Figure 12) of pJET1.2 / blunt-subcloned PCR amplicons of passage 3 and 10. L299Tfs*342 could also be observed among CR19 M-TK passaged on CR pIX PRO cells, albeit only in a very small fraction of the recovered reads. The frequency of this mutant increased only gradually so that at passage 10 the fraction of reads without the L299Tfs*342 was still approximately 90%.
[0198] Example 2: Genetic stability of an adenovirus vector over several passages Similar to the generation of MV A, the ProVector expression cassette was used to prevent the undesirable expression of the GOI during generation and propagation of the recombinant adenovirus. The ProVector expression cassette contains an shRNA (SEQ ID NO: 1) under the control of a U6 promoter, the TetR controlled by a CMV promoter, and a puromycin resistance marker gene under the EFla core promoter. See Figure 8.
[0199] An adenoviral vector was generated (Adl9a(II)-(TetO)-CMV-coHERV-K-IBDl). In particular, and adenovirus 19 was constructed by cloning two copies of TetO and by adding the shRNA target sequence (inhibitor binding domain 1; IBD1; SEQ ID NO: 2) at the 3'-UTR of the Gene of Interest. The Gene of Interest in this case was coHERV (Human Endogneous Retrovirus) gene, which is toxic when produced in adenovirus (Wenxue et al., Sci Transl Med. 2015 Sep 30; 7(307): 307ral53).
[0200] HEK293 cells were stably transduced with the Provector expression cassette, to generate ProVector cells. Recombinant adenovirus type 19 particles were generated by transfecting the ProVector cells with the linearized (with PacI) adenoviral plasmid. Adenoviral particles were then amplified in several amplifications rounds, each time transducing the cells with particles of the previous round. The adenoviral plasmid Adl9a(II)-(TetO)-CMV-coHERV-K-IBDl is shown in Figure 10.
[0201] The stability of the adenoviral vector Adl9a(II)-(TetO)-CMV-coHERV-K-IBDl was determined by serial passaging on ProVector cells. For serial passaging, 1.3xl07Provector cells seeded in a T225 cell culture flask (Corning) were inoculated with 200 pl of Adl9a(II)-(TetO)- CMV-coHERV-K-IBDl original stock vector (P0) for 2 days. Viral particles were harvested and resuspended in 500 pl DMEM medium supplemented with 2mM L-Glu and 10% FBS (reagents and cell culture medium from Thermo Fisher Scientific). Viral particles were released via 3x freeze / thaw cycles. For freeze-thawing, samples were transferred for 2 minutes into liquid nitrogen and then to 37°C for 3 minutes and the procedure was repeated 3 times. 200 pl of the resulting lysate was used to inoculate 1.3xl07fresh Provector cells in T225. The above procedure was repeated 5 times followed by DNA extraction and Dralll restriction enzyme digestion (P5, cells have been passaged for 5 times). As a control, DNA from the original stock (PO) was extracted and Dralll digested (Dralll-HF enzyme from Biolabs). Both samples, PO and P5 (3 pl) were loaded on an 0.8% agarose gel and identity was confirmed by comparing the resulted restriction patterns (Figure 9). In silico Dralll digestion yields the following band sizes in the gel:
[0202] As shown in Figure 9, the adenovirus vector carrying the HERV transgene maintains its genetic stability after at least 5 passages (lane 3). This is possible because of the adequate inhibition of the transgene expression by the shRNA that binds its target site and / or the TetR that binds TetO in the adenovirus vector.
[0203] This confirms the data presented in Example 1 for a poxvirus, such as MV A, and shows that the genetic stability of an adenovirus can also be maintained throughout different passages, allowing the production of viral vectors carrying a heterologous nucleic acid that may be toxic.
[0204] Example 3: Tet repressor- and shRNA-mediated knock-down of transgene expression in adenovirus
[0205] HEK293 cells were transfected with either (i) an expression cassette containing an shRNA (SEQ ID NO: 1) under the control of a U6 promoter, the TetR controlled by a CMV promoter, and a puromycin resistance marker gene under the EFla core promoter (See Figure 8) or (ii) an expression cassette containing the TetR element and a puromycin resistance marker gene under the EFla core promoter, but shRNA was not present.
[0206] An adenoviral vector was generated (Adl9a(II)-(TetO)-GFP-IBDl). In particular, an adenovirus 19 was constructed by cloning two copies of TetO and by adding the shRNA target sequence (inhibitor binding domain 1; IBD1; SEQ ID NO: 2) at the 3'-UTR of the Gene of Interest. The Gene of Interest in this case was GFP.
[0207] The HEK293 cells transfected with the above expression cassettes were transduced with purified viral vector Adl9a(II)-(TetO)-GFP-IBDl at MOI of 1 and incubated for 48h. After 24h, some samples were treated with 1 mg / mE doxycycline, while some samples were left untreated. The GFP expression in the transduced cells was analyzed by flow cytometry after gating on healthy cells using forward and side scatter. Data was analyzed using Flowjo™ software.
[0208] Cells expressed equal amount of GFP when transduced with adenovirus vectors that did not contain suppressive elements (TetO in 5' UTR and shRNA target sequence in 3' UTR).
[0209] In the HEK293 cells transfected with an expression cassette comprising TetR only, and not shRNA, and transduced with the adenoviral vector Adl9a(II)-(TetO)-GFP-IBDl, there is still GFP expression detected by flow cytometry, when the Tet system is active (i.e., doxycycline (DOX) is not present). Therefore, the Tet system is not fully efficient on its own. As a control, when these cells expressing only TetR are transduced with Adl9a(II)-(TetO)-GFP-IBDl and treated by doxycycline (i.e., the Tet system is not active), there is no repression of GFP expression and expression is further increased. See Figure 11B.
[0210] In contrast, the shRNA mediates virtually complete suppression of GFP transgene expression as expression is not induced by doxycycline (see Figure 11A, the histograms are superimposable), whereas only a partial suppression is seen in cells expressing TetR alone (Figure 11B). This suppression being reversible with doxycycline. The data clearly demonstrates a benefit of TetR in the GFP expression repression, that is nevertheless completely overshadowed by the shRNA system and clearly suggest the shRNA alone would be sufficient to inhibit expression and logically would induce much tighter repression on top of the repression mediated by TetR. Particular aspects and embodiments of the disclosure are set forth in the following numbered paragraphs (items):
[0211] 1. A method of increasing genetic stability of a viral vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, said viral vector being an adenoviral (AV) vector, a poxvirus vector, a baculovirus vector, or a herpes virus vector, wherein said increasing is as compared to the absence of said inhibiting.
[0212] 2. A method of producing an AV vector, a poxvirus vector, a baculovirus vector, or a herpes virus vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, wherein said inhibiting is performed by an inhibitory RNA.
[0213] 3. The method of item 1 or 2, wherein said method comprises at least one step of passaging said viral vector from one cell culture to another cell culture, preferably of the same cell type.
[0214] 4. The method of any one of items 1 to 3, wherein
[0215] (a) said AV vector is derived from a human or primate AV, and / or is selected from Ad5, hAd5, hAd6, Adl9a / 64, hAd26, chimpanzee AdOxl, chimpanzee Ad3, chimpanzee Ad63, Gorilla Ad34, or Gorilla Ad36;
[0216] (b) said baculovirus vector is derived from a baculovirus, and / or is selected from Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) and Bombyx mori nuclear polyhedrosis virus (BmNPV);
[0217] (c) said poxvirus vector is derived from an orthopoxvirus vector, and / or is a Vaccinia viral vector such as MV A; or
[0218] (d) said herpes virus vector is derived from an HSV vector, and / or is an HSV-1 vector. 5. The method of item 1 or items 3 and 4, to the extent items 3 and 4 refer back to item 1, wherein said inhibiting is performed by an inhibitory RNA, said inhibitory RNA preferably being selected from shRNA, miRNA, siRNA and antisense RNA.
[0219] 6. The method of item 5, wherein said inhibitory RNA binds to a binding site, said binding site being located on said heterologous nucleic acid and / or capable of controlling transcription and / or translation of said heterologous nucleic acid.
[0220] 7. The method of any one of items 2, 5 or 6, wherein no use is made of other systems than said inhibitory RNA and, where applicable, said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic acid.
[0221] 8. The method of any one of items 1 to 7, wherein no use is made of a Tet system and / or of a Cre system.
[0222] 9. The method of any one of items 1 to 8, wherein said method is an in vitro or ex vivo method.
[0223] 10. The method of any one of claims 6 to 9, wherein said inhibitory RNA consists of or comprises:
[0224] (a) the sequence of SEQ ID NO: 1 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 1;
[0225] (b) (i) a first sequence (SEQ ID NO: 3 or 5) or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 3 or 5;
[0226] (ii) a second sequence which is the reverse complement of said first sequence or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to said reverse complement, wherein first and second sequence, upon base-pairing, form a stem; and optionally (iii) a third sequence connecting said first sequence to said second sequence, wherein said third sequence, upon formation of said stem, forms a loop; or
[0227] (c) a sequence complementary to a UTR comprised in said heterologous nucleic acid, preferably to a 5' UTR, such as the 5' UTR of a gene encoding a CMV antigen.
[0228] 11. The method of claim 10, wherein the binding site for said inhibitory RNA comprises or consists of
[0229] (a) the sequence of sequence of SEQ ID NO: 2 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 2;
[0230] (b) the sequence of SEQ ID NO: 4 or 6 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 4 or 6; or
[0231] (c) a sequence comprised in a UTR comprised in said heterologous nucleic acid, preferably in a 5' UTR such as the 5' UTR of a gene encoding a CMV antigen.
[0232] 12. A cell comprising:
[0233] (a) a first nucleic acid encoding or being an inhibitory RNA;
[0234] (b) at least one second nucleic acid, said at least one second nucleic acid providing functions necessary for generating an AV vector; and
[0235] (c) a third nucleic acid comprising a heterologous nucleic acid to be packaged into an AV vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
[0236] 13. A cell comprising:
[0237] (a) a first nucleic acid encoding or being an inhibitory RNA;
[0238] (b) a third nucleic acid comprising a heterologous nucleic acid to be packaged or recombined into a poxvirus vector, a baculovirus vector, or a herpes virus vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a). 14. The cell of item 12 or 13, wherein said cell does not comprise any means other than said first nucleic acid and said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic acid.
[0239] 15. The cell of any one of items 12 to 14, wherein said cell is a cell in culture, an in vitro cell or an ex vivo cell.
[0240] 16. The cell of any one of items 12 to 15, wherein said first nucleic acid of (a) is located on a plasmid or said cell is stably transfected therewith.
[0241] 17. The cell of item 12 or items 14 to 16, to the extent they refer back to item 12, wherein said cell is stably or transiently transfected with said at least one second nucleic acid of (b).
[0242] 18. The cell of any one of items 12 to 17, wherein said binding site is in an untranslated region of said heterologous nucleic acid.
[0243] 19. The cell of any one of items 12 to 18, wherein said cell is of mammalian, avian or insect origin.
[0244] 20. The cell of item 19, wherein said cell is of avian origin and is selected from AGEI.CR.pIX, DF-1, and chick embryo fibroblasts (CEF); is of mammalian origin and is selected from HEK-293, HeLa, CAP, and BHK-21; or is of insect origin and is selected from Sf9, Sf21, Tn-368 and BTI-TN-5B1-4.
[0245] 21. The cell of item 12 or any one of items 14 to 20, to the extent they refer back to item 12, wherein said at least one second nucleic acid is or comprises a nucleic acid encoding at least one of adenoviral El, E2, E3, E4, E4ORF6, pIX, or a functional homologue or fragment thereof.
[0246] 22. The cell of item 13 or any one of items 14 to 20, to the extent they refer back to item 13, wherein the vector is a poxvirus vector, and wherein said cell comprises a nucleic acid encoding Vaccinia virus D13L or a functional homologue or fragment thereof. 23. The method of any one of items 6 to 11 or the cell of any one of items 12 to 22, wherein said binding site is not comprised within a coding sequence of said heterologous nucleic acid.
[0247] 24. The method of any one of items 6 to 11 or the cell of any one of items 12 to 23, wherein the binding of said inhibitory RNA to said binding site is specific.
[0248] 25. The method of any one of items 1 to 11, 23 or 24, or the cell of any one of items 12 to
[0249] 24, wherein said first nucleic acid, to the extent it encodes said inhibitory RNA, further comprises a promoter controlling transcription of said inhibitory RNA, said promoter preferably being an RNA polymerase III promoter; a small RNA-expressing promoter, preferably a U6 promoter or Hl promoter; an RNA polymerase II promoter; and / or a promoter with activity in eukaryotic cells such as CMV promoter.
[0250] 26. The method of any one of items 1 to 11 or 23 to 25, or the cell of any one of items 12 to
[0251] 25, wherein said heterologous nucleic acid
[0252] (a) encodes a protein of interest; or
[0253] (b) is capable of being transcribed into a non-coding nucleic acid, including non-coding RNAs such as miRNAs.
[0254] 27. The method or the cell of item 26, wherein said protein of interest is an
[0255] (a) antigen for vaccination, preferably an antigen from human papilloma virus (HPV), human immunodeficiency virus (HIV), human cytomegalovirus (HCMV), Epstein-Barr virus (EBV), a human endogenous retrovirus (HERV), a coronavirus, or monkeypox virus; or
[0256] (b) a therapeutic protein.
[0257] 28. The method of any one of items 1 to 11 or 23 to 27, wherein said method comprises culturing the cell of any one of items 12 to 27.
[0258] 29. The method of item 28, wherein said method comprises at least one step of passaging said viral vector from said cell to a cell culture, preferably of the same cell type. 30. Use of a cell of any one of items 12 to 27 for producing an AV vector, a poxvirus vector, a baculo virus vector or a herpes virus vector.
[0259] 31. Use of a cell of any one of items 12 to 27 for increasing genetic stability of an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector.
[0260] 32. An AV vector, a poxvirus vector, a baculovirus vector, or a herpesvirus vector
[0261] (a) obtained by the method of any one of items 6 to 11 or 23 to 29; and / or
[0262] (b) carrying a heterologous nucleic acid encoding a protein of interest, wherein a noncoding flanking region of said heterologous nucleic acid comprises a binding site for an inhibitory RNA.
[0263] 33. The vector of item 33, wherein said flanking region is a UTR, preferably a 3 -UTR.
[0264] 34. The vector of item 33 or 34, wherein said heterologous nucleic acid encodes a protein of interest, wherein said protein of interest is as defined in item 27.
[0265] 35. The cell of any of items 12 to 27, wherein said inhibitory RNA is as defined in item 10.
[0266] 36. The cell of any one of items 12 to 27 and 35, or the vector of any one of items 32 to
[0267] 34, wherein the binding site for said inhibitory RNA is as defined in item 11.
Claims
Claims1. A method of increasing genetic stability of a viral vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, said viral vector being an adenoviral (AV) vector, a poxvirus vector, a baculovirus vector, or a herpes virus vector, wherein said increasing is as compared to the absence of said inhibiting.
2. A method of producing an AV vector, a poxvirus vector, a baculovirus vector, or a herpes virus vector carrying a heterologous nucleic acid, said method comprising inhibiting transcription and / or translation of said heterologous nucleic acid, wherein said inhibiting is performed by an inhibitory RNA.
3. The method of claim 1 or 2, wherein said method comprises at least one step of passaging said viral vector from one cell culture to another cell culture, preferably of the same cell type.
4. The method of any one of claims 1 to 3, wherein(a) said AV vector is derived from a human or primate AV, and / or is selected from Ad5, hAd5, hAd6, Adl9a / 64, hAd26, chimpanzee AdOxl, chimpanzee Ad3, chimpanzee Ad63, Gorilla Ad34 and Gorilla Ad36;(b) said baculovirus vector is derived from a baculovirus, and / or is selected from Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) and Bombyx mori nuclear polyhedrosis virus (BmNPV);(c) said poxvirus vector is derived from an orthopoxvirus vector, and / or is a Vaccinia viral vector such as MV A; or(d) said herpes virus vector is derived from an HSV vector, and / or is an HSV-1 vector.
5. The method of claim 1 or claims 3 and 4, to the extent claims 3 and 4 refer back to claim 1, wherein said inhibiting is performed by an inhibitory RNA, said inhibitory RNA preferably being selected from shRNA, miRNA, siRNA and antisense RNA.
6. The method of claim 2 or 5, wherein said inhibitory RNA binds to a binding site, said binding site being located on said heterologous nucleic acid and / or capable of controlling transcription and / or translation of said heterologous nucleic acid.
7. The method of any one of claim 2, 5 or 6, wherein no use is made of other systems than said inhibitory RNA and, where applicable, said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic acid.
8. The method of any one of claims 1 to 7, wherein no use is made of a Tet system and / or of a Cre system.
9. The method of any one of claims 1 to 8, wherein said method is an in vitro or ex vivo method.
10. The method of any one of claims 6 to 9, wherein said inhibitory RNA consists of or comprises:(a) the sequence of SEQ ID NO: 1 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 1;(b) (i) a first sequence (SEQ ID NO: 3 or 5) or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 3 or 5;(ii) a second sequence which is the reverse complement of said first sequence or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to said reverse complement, wherein first and second sequence, upon base-pairing, form a stem; and optionally(iii) a third sequence connecting said first sequence to said second sequence, wherein said third sequence, upon formation of said stem, forms a loop; or (c) a sequence complementary to a UTR comprised in said heterologous nucleic acid, preferably to a 5' UTR, such as the 5' UTR of a gene encoding a CMV antigen.
11. The method of claim 10, wherein the binding site for said inhibitory RNA comprises or consists of(a) the sequence of sequence of SEQ ID NO: 2 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 2;(b) the sequence of SEQ ID NO: 4 or 6 or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the sequence of SEQ ID NO: 4 or 6; or(c) a sequence comprised in a UTR comprised in said heterologous nucleic acid, preferably in a 5' UTR such as the 5' UTR of a gene encoding a CMV antigen.
12. A cell comprising:(a) a first nucleic acid encoding or being an inhibitory RNA;(b) at least one second nucleic acid, said at least one second nucleic acid providing functions necessary for generating an AV vector; and(c) a third nucleic acid comprising a heterologous nucleic acid to be packaged into an AV vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
13. A cell comprising:(a) a first nucleic acid encoding or being an inhibitory RNA;(b) a third nucleic acid comprising a heterologous nucleic acid to be packaged or recombined into a poxvirus vector, a baculovirus vector, or a herpes virus vector, wherein said third nucleic acid comprises a binding site for an inhibitory RNA of (a).
14. The cell of claim 12 or 13, wherein said cell does not comprise any means other than said first nucleic acid and said binding site that would be designed to inhibit transcription and / or translation of said heterologous nucleic acid.
15. The cell of any one of claims 12 to 14, wherein said cell is a cell in culture, an in vitro cell or an ex vivo cell.
16. The cell of any one of claims 12 to 15, wherein said first nucleic acid of (a) is located on a plasmid or said cell is stably transfected therewith.
17. The cell of claim 12 or claim 14 to 16, to the extent they refer back to claim 12, wherein said cell is stably or transiently transfected with said at least one second nucleic acid of (b).
18. The cell of any one of claims 12 to 17, wherein said binding site is in an untranslated region of said heterologous nucleic acid.
19. The cell of any one of claims 12 to 18, wherein said cell is of mammalian, avian or insect origin.
20. The cell of claim 19, wherein said cell is of avian origin and is selected from AGEI.CR.pIX, DF-1, and chick embryo fibroblasts (CEF); is of mammalian origin and is selected from HEK-293, HeLa, CAP, and BHK-21; or is of insect origin and is selected from Sf9, Sf21, Tn-368 and BTI-TN-5B1-4.
21. The cell of claim 12 or any one of claims 14 to 20, to the extent they refer back to claim12, wherein said at least one second nucleic acid is or comprises a nucleic acid encoding at least one of adenoviral El, E2, E3, E4, E4ORF6, pIX, or a functional homologue or fragment thereof.
22. The cell of claim 13 or any one of claims 14 to 20, to the extent they refer back to claim13, wherein the vector is a poxvirus vector, and wherein said cell comprises a nucleic acid encoding Vaccinia virus D13L or a functional homologue or fragment thereof.
23. The method of any one of claims 6 to 11 or the cell of any one of claims 12 to 22, wherein said binding site is not comprised within a coding sequence of said heterologous nucleic acid.
24. The method of any one of claims 6 to 11 or the cell of any one of claims 12 to 23, wherein the binding of said inhibitory RNA to said binding site is specific.
25. The method of any one of claims 1 to 11, 23 or 24, or the cell of any one of claims 12 to 24, wherein said first nucleic acid, to the extent it encodes said inhibitory RNA, further comprises a promoter controlling transcription of said inhibitory RNA, said promoter preferably being an RNA polymerase III promoter; a small RNA-expressing promoter, preferably a U6 promoter or Hl promoter; an RNA polymerase II promoter; and / or a promoter with activity in eukaryotic cells such as CMV promoter.
26. The method of any one of claims 1 to 11 or 23 to 25, or the cell of any one of claims 12 to 25, wherein said heterologous nucleic acid(a) encodes a protein of interest; or(b) is capable of being transcribed into a non-coding nucleic acid, including noncoding RNAs such as miRNAs.
27. The method or the cell of claim 26, wherein said protein of interest is an(a) antigen for vaccination, preferably an antigen from human papilloma virus (HPV), human immunodeficiency virus (HIV), human cytomegalovirus (HCMV), Epstein-Barr virus (EBV), a human endogenous retrovirus (HERV), a coronavirus, or monkeypox virus; or(b) a therapeutic protein.
28. The method of any one of claims 1 to 11 or 23 to 27, wherein said method comprises culturing the cell of any one of claims 12 to 27.
29. The method of claim 28, wherein said method comprises at least one step of passaging said viral vector from said cell to a cell culture, preferably of the same cell type.
30. Use of a cell of any one of claims 12 to 27 for producing an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector.
31. Use of a cell of any one of claims 12 to 27 for increasing genetic stability of an AV vector, a poxvirus vector, a baculovirus vector or a herpes virus vector.
32. An AV vector, a poxvirus vector, a baculovirus vector, or a herpesvirus vector(a) obtained by the method of any one of claims 6 to 11 or 23 to 29; and / or(b) carrying a heterologous nucleic acid encoding a protein of interest, wherein a non-coding flanking region of said heterologous nucleic acid comprises a binding site for an inhibitory RNA.
33. The vector of claim 32, wherein said flanking region is a UTR, preferably a 3 -UTR.
34. The vector of claim 32 or 33, wherein said heterologous nucleic acid encodes a protein of interest, wherein said protein of interest is as defined in claim 27.
35. The cell of any of claims 12 to 27, wherein said inhibitory RNA is as defined in claim 10.
36. The cell of any one of claims 12 to 27 and 35, or the vector of any one of claims 32 to34, wherein the binding site for said inhibitory RNA is as defined in claim 11.
Citation Information
Patent Citations
Utilization of micro-RNA for downregulation of cytotoxic transgene expression by modified vaccinia virus ankara (MVA)
CA3230406A1
Repressor proteins producing cell lines for the propagation of vectors
WO2000006751A2
Viral vector production system
WO2015092440A1
Viral vector production
WO2018209216A1
Modified EC7 cells having low toxicity to viral production payloads
WO2019074907A1