Wheat white grain pre-harvest sprouting tamyb10-94e gene and use thereof
By developing a TaMyb10-94E gene identification method based on SNP sites, using KASP and CAPS marking detection technology, the efficient screening of genes with germination resistance in white wheat ears was solved, and breeding efficiency and accuracy were improved.
Patent Information
- Application Number
- PCT/CN2024/129554
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-25
- Filing Date
- 2024-11-04
- Publication Date
- 2025-07-31
AI Technical Summary
The prior art is difficult to efficiently screen out the resistance gene for germination of white wheat ears, resulting in low breeding efficiency and unable to meet the needs of large-scale breeding.
A TaMyb10-94E gene identification method based on SNP sites was developed, and the resistance genes carrying white grain wheat ears in wheat breeding materials were quickly and accurately identified.
It has achieved efficient screening of white-grained ear-resistant germinated wheat varieties, improved breeding efficiency and accuracy, and met the needs of large-scale breeding.
Smart Images

Figure CN2024129554_31072025_PF_FP_ABST
Abstract
Description
Wheat white grain anti-ear sprouting gene TaMyb10-94E and its application Technical Field
[0001] The present invention relates to the field of wheat breeding, and in particular to a TaMyb10-94E gene related to grain color and ear sprouting resistance and an application thereof. Background Art
[0002] Wheat is an important food crop in the world. About 35% to 40% of the world's population relies on wheat as their staple food. Sprouting refers to the phenomenon that wheat seeds germinate on the ears due to continuous wet weather before harvest. Sprouting causes a series of physiological and biochemical changes, including the activity of plant hormones and hydrolases, the decomposition of grain proteins and storage substances, and drastic changes in grain quality characteristics, which leads to a decrease in yield and unsuitability for processing, thus affecting economic benefits (Yang Yan, Zhang Chunli, He Zhonghu, Xia Lanqin. Research Progress on Wheat Sprouting Resistance [J]. Journal of Plant Genetic Resources, 2007, 8(4): 503-509). In recent years, major wheat producing areas in my country, such as Hebei, Henan, Shandong, Anhui, Hubei, Jiangsu, Sichuan and other provinces, have experienced serious sprouting incidents many times, causing direct and indirect economic losses to local farmers. On the one hand, the reduction in yield due to sprouting leads to a direct decrease in farmers' income. On the other hand, wheat grains with sprouted ears are not popular in the market, whether as seeds or for sale. In the wheat-growing areas of Sichuan, Anhui, and Jiangsu, where rainfall is plentiful and spike sprouting is a serious problem, red-skinned wheat is often cultivated. However, white-skinned wheat, with its thinner skin, relatively high endosperm content, and higher commercial flour yield, is more popular in production. Therefore, the discovery and utilization of genes that confer resistance to spike sprouting in white-grained wheat is of great value.
[0003] Molecular marker-assisted breeding uses molecular markers that are closely linked and co-segregated with the target gene to accurately perform association analysis on the genotype and phenotype of different individuals in the hybrid offspring, thereby assisting in selection. Compared with traditional breeding, molecular marker-assisted breeding has the advantages of shortening the breeding period, improving breeding efficiency, saving manpower and material resources, being free from time and environmental restrictions, and being able to select samples at different stages or under various environmental conditions. However, the screening efficiency of existing markers is low and cannot meet the needs of large-scale breeding screening. Among them, the development of next-generation sequencing and bioinformatics applications has contributed to the development of markers based on single nucleotide polymorphisms (SNPs). SNP-based detection is time-saving and has high accuracy and effectiveness, and has a very large advantage in genotyping. By developing polymorphic SNP molecular markers for the white-grain wheat spike sprouting resistance gene and combining them with relevant detection technologies, such as CAPS (C1eaved Amplified Polymorphic Sequences) marker detection and KASP (Kompetitive Allele-Specific PCR) marker detection, it is possible to identify the polymorphism of the white-grain wheat spike sprouting resistance gene in wheat breeding materials in a high-throughput, rapid and accurate manner, and to efficiently breed white-grain wheat varieties that are resistant to spike sprouting.
[0004] Summary of the Invention
[0005] To address the above problems, the present invention provides the TaMyb10-94E gene related to wheat grain color and ear sprout resistance and its application. At the same time, a SNP site-based identification method of the TaMyb10-94E gene is developed, which is conducive to the efficient breeding of white-grained wheat varieties with resistance to ear sprouting.
[0006] Specifically, the present invention is achieved through the following technical solutions.
[0007] In the first aspect, the present invention provides a TaMyb10-94E protein or a variant thereof, wherein the TaMyb10-94E protein comprises the amino acid sequence shown in SEQ ID NO:3, and the variant is the TaMyb10-94E protein in which one or several amino acid residues are substituted and / or deleted and / or added and is a protein associated with wheat grain color and ear sprouting resistance.
[0008] In a second aspect, the present invention provides a gene TaMyb10-94E encoding the TaMyb10-94E protein or a variant thereof according to the first aspect.
[0009] In a third aspect, the present invention provides a recombinant expression vector comprising the gene TaMyb10-94E of the second aspect.
[0010] In a fourth aspect, the present invention provides a recombinant cell comprising the gene TaMyb10-94E of the second aspect or the recombinant expression vector of the third aspect.
[0011] In the fifth aspect, the present invention provides the use of the TaMyb10-94E protein or its variant of the first aspect, the gene TaMyb10-94E of the second aspect, the recombinant expression vector of the third aspect or the recombinant cell of the fourth aspect in regulating grain color and reducing grain germination rate.
[0012] In the sixth aspect, the present invention provides a method for identifying the gene TaMyb10-94E of the second aspect, which comprises detecting sample DNA using a marker based on a single nucleotide polymorphism (SNP) site to identify the sample phenotype; wherein the SNP site is located at wheat Chr3D 572163094, the polymorphism is G or A, the gene TaMyb10-94E is A at this site, and the normal TaMyb10 gene is G at this site.
[0013] Compared with the prior art, the present invention has the following advantages:
[0014] The present invention provides the TaMyb10-94E gene related to wheat grain color and ear sprout resistance, and further develops an identification method of the TaMyb10-94E gene based on SNP sites, which is helpful for the efficient breeding of white-grained wheat varieties resistant to ear sprout. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other implementation plans can be obtained based on these drawings without paying any creative work.
[0016] Figure 1: Comparison of the nucleic acid sequences of TaMyb10-94E in Suining Tuotuo wheat and other wheat TaMyb10 genes.
[0017] Figure 2: Protein sequence alignment of the TaMYB10-94E protein from Suining Tuotuo wheat and other wheat TaMYB10 proteins represented by wheat Chinese Spring.
[0018] Figure 3: Segregation and identification of grain color of Suining Tuotuo wheat (white grain) x China Spring (red grain) parents and hybrid offspring.
[0019] Figure 4: Segregation and identification of allelic variation in the TaMyb10 gene between the parents and hybrid offspring of Suining Tuotuo wheat (white grain) x Chinese Spring (red grain).
[0020] Figure 5: Expression of TaMYB10 gene in Tuotuo wheat seeds.
[0021] Figure 6: Identification results of transgenic wheat overexpressing TaMyb10-94E.
[0022] Figure 7: Germination rate of TaMyb10-94E-OE transgenic wheat grains.
[0023] Figure 8: Comparison of grain color between TaMyb10-94E-OE transgenic wheat (2# and 12#) and TaMyb10-OE transgenic wheat (58-4#).
[0024] Figure 9: Detection results of the KASP marker primer set in the Tuotuomai × Chinese Spring F3 population.
[0025] Figure 10: Partial detection results of the CAPS marker primer set in the Tuotuomai × China Spring F3 population. DETAILED DESCRIPTION
[0026] Hereinafter, the present invention will be described in detail. It should be understood that the following description is only for illustration of the present invention and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the appended claims. In addition, those skilled in the art will understand that the technical solutions of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of the present invention belongs. Before describing the present invention in detail, the following definitions are provided for a better understanding of the present invention.
[0028] In the context of the present invention, many embodiments use the expression "comprising", "including" or "consisting essentially / mainly of..." The expression "comprising", "including" or "consisting essentially / mainly of..." can generally be understood as an open expression, indicating that it includes not only the elements, components, assemblies, method steps, etc. specifically listed after the expression, but also other elements, components, assemblies, method steps. In addition, in this article, the expression "comprising", "including" or "consisting essentially / mainly of..." can also be understood as a closed expression in some cases, indicating that it only includes the elements, components, assemblies, method steps specifically listed after the expression, but does not include any other elements, components, assemblies, method steps. In addition, in the context of the present invention, many embodiments use the expression "consisting of...", which should be understood as a closed expression, indicating that it only includes the elements, components, assemblies, method steps specifically listed after the expression, but does not include any other elements, components, assemblies, method steps.
[0029] Where a numerical range is provided, such as a concentration range, a percentage range, or a ratio range, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of the range and any other stated or intervening values in the stated range are encompassed within the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and such embodiments are also encompassed within the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also encompassed within the subject matter.
[0030] For a better understanding of the present teachings and without limiting the scope of the present teachings, all numbers and other numerical values expressing quantities, percentages or ratios used in the specification and claims should be understood as being modified in all cases by the term "about", unless otherwise indicated. Therefore, unless indicated to the contrary, the numerical parameters set forth in the following specification and the appended claims are approximate values that may vary depending on the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0031] The R gene that regulates grain color in wheat encodes the Myb-type transcription factor, Myb10. By conducting genome-wide association studies (GWAS) on thousands of wheat accessions and mapping genes associated with anti-sprouting in RILs (Ril-like interlinked loci) of synthetic wheat offspring, the inventors discovered that white wheat commonly harbors a 2.4Mb deletion on chromosome 3D. Myb10-3D lies within this deleted region, and wheat containing the Myb10-3D gene produces red grains.
[0032] The inventors discovered that the 3D chromosome of the white-grain wheat Suining Tuotuomai (TTM), a white-grain resistant ear sprouting material, contains the Myb10 gene, which was named the Myb10-94E gene. The gene has a specific base sequence, and its protein is named TaMYB10-94E protein. Compared with the known wheat TaMYB10 protein, it has a different amino acid sequence and has characteristics that other TaMYB10 proteins do not have (does not produce the red trait of grains). It has different types of functions and is a special type that has not been discovered in the relevant field.
[0033] Therefore, in the first aspect, the present invention provides a TaMyb10-94E protein or a variant thereof, wherein the TaMyb10-94E protein comprises the amino acid sequence shown in SEQ ID NO:3, and the variant is the TaMyb10-94E protein in which one or several amino acid residues are substituted and / or deleted and / or added and is a protein associated with wheat grain color and ear sprouting resistance.
[0034] As used herein, the term "variant" refers to an amino acid sequence that has at least 75% (e.g., at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100%) sequence identity thereto and has substantially the same function.
[0035] In one embodiment, the variant is a TaMyb10-94E protein that has undergone substitution and / or deletion and / or addition of one or more (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10 or more) amino acid residues and is associated with wheat grain color and ear sprouting resistance.
[0036] As used herein, the terms "anti-ear sprouting" and "ear sprout resistance" are used interchangeably to refer to seeds that are resistant to ear sprouting and do not, rarely, or only rarely undergo ear sprouting.
[0037] Herein, the above-mentioned "protein related to wheat grain color and ear sprouting resistance" can be a protein that changes wheat grain color and / or improves ear sprouting resistance, such as a protein that exhibits white grains and / or improved ear sprouting resistance.
[0038] In one embodiment, the TaMyb10-94E protein consists of the amino acid sequence shown in SEQ ID NO:3.
[0039] In one embodiment, in order to facilitate the purification and detection of the TaMyb10-94E protein or its variant, a tag may be connected to its amino terminus or carboxyl terminus. The tag may be selected from Table 1 below.
[0040] Table 1: Sequences of tags
[0041] In one embodiment, the TaMyb10-94E protein or its variant can be artificially synthesized.
[0042] In a second aspect, the present invention provides a gene TaMyb10-94E encoding the TaMyb10-94E protein or a variant thereof according to the first aspect.
[0043] In one embodiment, the gene TaMyb10-94E comprises the nucleotide sequence shown in SEQ ID NO:2 or a nucleotide sequence having more than 90% similarity to the nucleotide sequence shown in SEQ ID NO:2, for example, a nucleotide sequence having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% similarity.
[0044] As used herein, the term "similarity" refers to the percentage of identical and similar DNA bases or amino acid residues at corresponding positions.
[0045] In one embodiment, the gene TaMyb10-94E consists of the nucleotide sequence shown in SEQ ID NO:2.
[0046] In a third aspect, the present invention provides a recombinant expression vector comprising the gene TaMyb10-94E of the second aspect.
[0047] In one embodiment, the recombinant expression vector is a plant expression vector, such as an Agrobacterium vector (eg, a binary Agrobacterium vector such as pUBI-CAMBIA3301 vector) and a vector that can be used for plant microprojectile bombardment.
[0048] When using the TaMyb10-94E gene to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcriptional initiation nucleotide. These promoters can be used alone or in combination with other plant promoters. In addition, when using the TaMyb10-94E gene to construct a recombinant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are diverse and can be natural or synthetic. The translation initiation region can be derived from the transcriptional initiation region or a structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, such as by adding a gene that expresses an enzyme or luminescent compound that produces a color change in the plant, an antibiotic resistance marker, or a chemical resistance marker gene.
[0049] In a preferred embodiment, the recombinant expression vector may be a recombinant expression vector obtained by replacing the fragment between the BamHI and PmlI restriction sites of the pUBI:cas vector with the nucleotide sequence shown in SEQ ID NO: 2.
[0050] In a fourth aspect, the present invention provides a recombinant cell comprising the gene TaMyb10-94E of the second aspect or the recombinant expression vector of the third aspect.
[0051] In one embodiment, the recombinant cell is a eukaryotic cell, such as a plant cell, or a prokaryotic cell, such as Agrobacterium.
[0052] In a preferred embodiment, the recombinant cell is Agrobacterium tumefaciens EHA105.
[0053] In the fifth aspect, the present invention provides the use of the TaMyb10-94E protein or its variant of the first aspect, the gene TaMyb10-94E of the second aspect, the recombinant expression vector of the third aspect or the recombinant cell of the fourth aspect in regulating grain color and reducing grain germination rate.
[0054] In one embodiment, the application is plant breeding.
[0055] As demonstrated in this article, the TaMyb10-94E gene can regulate grain color and reduce grain germination rate. Overexpression of the TaMyb10-94E protein can produce wheat seeds with white grains and ear sprout resistance. Therefore, this gene can be used in plant genetic engineering, gene editing, and molecular breeding.
[0056] In the sixth aspect, the present invention provides a method for identifying the gene TaMyb10-94E of the second aspect, which comprises detecting sample DNA using a marker based on a single nucleotide polymorphism (SNP) site to identify the sample phenotype; wherein the SNP site is located at wheat Chr3D 572163094, the polymorphism is G or A, the gene TaMyb10-94E is A at this site, and the normal TaMyb10 gene is G at this site.
[0057] As used herein, unless otherwise specified, generally, "G", "C", "A", "T" and "U" in a nucleotide sequence each represent a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base.
[0058] As used herein, the term "single nucleotide polymorphism (SNP)" refers to a polymorphism caused by a mutation of a single nucleotide (A, T, C, and G) in a genomic DNA sequence. A SNP represents a change in a nucleotide at a certain site in the genome, resulting from a single base transition, transversion, insertion, or deletion.
[0059] As described in this article, compared with other wheat TaMYB10 genes, including Chinese Spring, the 281st base in the coding region of the TaMyb10-94E gene changes from G to A, that is, there is a SNP site, which affects the function of the gene and leads to changes in biological traits (white grains and ear sprout resistance).
[0060] Therefore, the present invention provides a method for identifying the gene TaMyb10-94E based on this SNP site. This method can be used to quickly and accurately identify the polymorphism of the white-grain wheat spike sprout resistance gene in wheat breeding materials with high throughput, and to efficiently breed white-grain wheat varieties resistant to spike sprout. There are many SNP-based detection methods, including Amplification Refractory Mutation System PCR (ARMS PCR), Competitive Allele Specific PCR (KASP), and Cleaved Amplified Polymorphic Sequences (CAPS).
[0061] KASP is a genotyping technology based on fluorescence detection after PCR amplification. It detects SNPs based on the specific matching of primer terminal bases and achieves the genotyping effect by specifically identifying gene loci through fluorescent probes. It avoids the traditional molecular marker-assisted selection and enzyme digestion and electrophoresis methods after PCR amplification. This method is simple and easy to use, and its results are accurate and reliable. It can detect multiple samples with high throughput, thereby improving detection efficiency.
[0062] In one embodiment, the SNP site-based marker is a KASP marker primer set, which includes a first primer, a second primer and a universal primer, wherein:
[0063] The first primer consists of a first tag sequence and a first core sequence from 5' to 3' direction, wherein the first core sequence includes base G at the SNP site of the TaMyb10 gene and 16-24 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24) consecutive bases before the base G;
[0064] The second primer consists of a second tag sequence and a second core sequence from 5' to 3' direction, wherein the second core sequence comprises base A at the SNP site of the gene TaMyb10-94E and 16-24 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24) consecutive bases before the base A;
[0065] The universal primer is any 17-25 (e.g., 17, 18, 19, 20, 21, 22, 23, 24, 25) consecutive bases in the homologous sequence region of the TaMyb10 gene and the gene TaMyb10-94E;
[0066] The first tag sequence and the second tag sequence are respectively bound to fluorescent probes with different colors.
[0067] In one embodiment, the fluorescent probe is selected from FAM, HEX, FITC, AMC, CY2, VIC, DY-495, and SIMA.
[0068] In a preferred embodiment, the fluorescent probe bound to the first tag sequence is FAM, and the fluorescent probe bound to the second tag sequence is HEX.
[0069] In a preferred embodiment, the first primer has a nucleotide sequence as shown in SEQ ID NO:6, the second primer has a nucleotide sequence as shown in SEQ ID NO:7, and the universal primer has a nucleotide sequence as shown in SEQ ID NO:8.
[0070] In one embodiment, a 10 μL PCR reaction system using the KASP labeled primer set includes: 5 μL of 2×KASP Master Mix, 1.4 μL of KASP Assay Mix, 1 μL of template DNA at a concentration of 100 ng / μL, 0.08 μL of MgCl2, and the volume is made up to 10 μL with ddH2O; wherein, per 100 μL of the KASP Assay Mix includes 12 μL of the first primer at a concentration of 100 μM, 12 μL of the second primer at a concentration of 100 μM, and 30 μL of the universal primer at a concentration of 100 μM, and the volume is made up to 100 μL with ddH2O.
[0071] In one embodiment, the PCR reaction procedure using the KASP marker primer set is:
[0072] 94℃15min;
[0073] 94℃ for 20s, 70-60℃ for 1min, decreasing 1℃ each time, for a total of 10 cycles;
[0074] 94°C for 20 s, 58°C for 1 min, for a total of 35 cycles.
[0075] In one embodiment, the method further comprises performing fluorescence detection on the amplified products, wherein samples exhibiting the corresponding fluorescence color of the fluorescent probe bound to the second tag sequence are homozygous TaMyb10-94E genotypes, samples exhibiting the corresponding fluorescence color of the fluorescent probe bound to the first tag sequence are TaMyb10 genotypes, and samples exhibiting other colors are TaMyb10-94E / TaMyb10 heterozygous genotypes.
[0076] CAPS is a type of co-dominant molecular marker based on PCR. Its basic principle is to first use the DNA sequence of a known locus to design a set of specific PCR primers (19-27 bp). These primers are then used to amplify a DNA fragment at that locus. The resulting amplified band is then cut with a specific restriction endonuclease and analyzed by electrophoresis.
[0077] In one embodiment, the SNP site-based marker is a CAPS marker primer set, which includes a forward primer and a reverse primer, wherein the forward primer is any 18-24 (e.g., 18, 19, 20, 21, 22, 23, 24) consecutive bases selected from the 200-400bp interval before base A at the SNP site of the gene TaMyb10-94E, and the reverse primer is any 18-24 (e.g., 18, 19, 20, 21, 22, 23, 24) consecutive bases selected from the 50-350bp interval after base A at the SNP site of the gene TaMyb10-94E, and the compatible endonuclease is BsrB I.
[0078] In one embodiment, the forward primer is 24 bases in length and the reverse primer is 18 bases in length.
[0079] In a preferred embodiment, the forward primer has the nucleotide sequence shown in SEQ ID NO:9, and the reverse primer has the nucleotide sequence shown in SEQ ID NO:10.
[0080] In one embodiment, a 25 μL PCR reaction system using the CAPS labeled primer set includes: 12.5 μL of 2×T5SuperPCRMix, 1 μL of template DNA with a concentration of 100 ng / μL, 0.08 μL of MgCl2, 0.5 μL each of the forward primer and the reverse primer, and the volume is made up to 25 μL with ddH2O.
[0081] In one embodiment, the PCR reaction procedure using the CAPS marker primer set is:
[0082] Pre-denaturation at 98°C for 3 min;
[0083] 98°C denaturation for 10 s, 58°C annealing for 10 s, and 72°C extension for 15 s, for 35 cycles;
[0084] Finally, extend at 72°C for 5 min and keep at 12°C.
[0085] In one embodiment, the enzyme digestion system using the CAPS labeled primer set is as follows: 0.2 μL restriction endonuclease BsrB I, 1 μL 10×CutSmart Buffer, 5 μL PCR product (3.8 μL), and ddH2O is added to make up to 10 μL. The enzyme digestion reaction conditions are digestion at 37°C for 1.5 hours and inactivation at 65°C for 20 minutes.
[0086] In one embodiment, the cleavage products are observed by electrophoresis using 1% non-denaturing polyacrylamide gel.
[0087] In one embodiment, a sample that forms only a band of approximately 383 bp after enzyme digestion is a homozygous TaMyb10-94E genotype, a sample that forms only a band of approximately 455 bp is a TaMyb10 genotype, and a sample that forms both a band of approximately 383 bp and a band of approximately 455 bp is a TaMyb10-94E / TaMyb10 heterozygous genotype.
[0088] The KASP marker primer set and CAPS primer set provided by the present invention are applicable to all varieties of wheat.
[0089] Example
[0090] Below with reference to embodiment, embodiment of the present invention is described in detail.It will be appreciated by those skilled in the art that the following examples are merely illustrative and should not be construed as limiting the scope of the present invention.In the examples, where no specific techniques or conditions are indicated, the techniques or conditions described in the literature in this area or the product specifications are used. Reagents or instruments used where the manufacturer is not indicated are conventional products that can be obtained commercially.
[0091] Experimental materials used:
[0092] The local wheat variety Sichuan Suining Tuotuomai (hereinafter referred to as TTM), other wheat TaMyb10 gene-overexpressing transgenic line 58-4#, Chinese Spring (hereinafter referred to as CS), and the wheat variety Fielder. All materials were provided by the Crop Genetics and Breeding Team of the Wheat Research Institute of Sichuan Agricultural University.
[0093] Example 1: Obtaining TaMYB10-94E protein and its encoding gene
[0094] Total RNA was extracted from the common wheat landrace Suining Tuotuomai, and cDNA was reverse transcribed. PCR amplification was performed using the primer pair TaMYB10-F: 5'-ATGGGGAGGAAGCCATGCTGCGCCA-3' and TaMYB10-R: 5'-CTAGCAAAGCCACGCCAACTCCAGG-3'. The reaction procedure was: 94°C for 2 min; 34 cycles of 94°C for 30 s, 60°C for 30 s, and 68°C for 1 min; and finally 68°C for 10 min. The approximately 798 bp PCR product was recovered and sent to Qingke Biotechnology Co., Ltd. for sequencing.
[0095] The sequencing results showed that a DNA coding sequence was found in the amplified product of cDNA, as shown in SEQ ID NO: 2, and the protein encoded by the sequence was shown in SEQ ID NO: 3.
[0096] The protein shown in SEQ ID NO: 3 was named TaMYB10-94E protein. The gene encoding TaMYB10-94E protein was named TaMyb10-94E gene, and its open reading frame was shown in SEQ ID NO: 2.
[0097] Compared with the TaMYB10 genes of other wheat varieties, including Chinese Spring, the 281st base in the coding region of the TaMyb10-94E gene in Tuotuo wheat changed from G to A ( Figure 1 ).
[0098] Compared with other wheat TaMYB10 proteins including Chinese Spring, the 94th amino acid of the TaMYB10-94E protein in Tuotuo wheat was changed from glycine (G) to glutamic acid (E) ( Figure 2 ).
[0099] Example 2: TaMyb10-94E gene co-segregates with grain color
[0100] 1. The red-grain wheat Chinese Spring was hybridized with the white-grain wheat Suining Tuotuomai. The resulting seeds were recorded as F0 and reproduced to the F3 generation through field self-pollination.
[0101] 2. From each F3 wheat plant, leaves were collected and total DNA was extracted using the CTAB method (see: Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components [J]. Plant molecular biology reporter, 1997, 15:8-15). PCR amplification was performed using the primer pair Tamyb10-3D-F and Tamyb10-3D-R (Tamyb10-3D-F sequence: 5'-TGATGATGACGTGCATTAATTCAC-3' (SEQ ID NO:9); Tamyb10-3D-R sequence: 5'-CTGCTGGTTCCTCTTGCT-3' (SEQ ID NO:10)). The approximately 455 bp PCR amplification product was recovered and sent to Qingke Biotechnology Co., Ltd. for sequencing.
[0102] 3. Harvest the F3 generation and treat each wheat grain with 5% NaOH. NaOH reacts with flavonols and dihydroflavonoids, causing them to discolor brown or yellow (Figure 3). Corresponding to the sequencing results from Step 2, analysis revealed that both the Chinese Spring and F3 red-grain wheat varieties had the TaMYB10 genotype, while the Suining Tuotuo wheat (TTM) and F3 white-grain wheat varieties had the TaMyb10-94E genotype (Figure 4), indicating that the TaMyb10-94E gene co-segregates with white grains.
[0103] Example 3: Analysis of TaMyb10-94E gene expression pattern
[0104] 1. Cultivate Suining Tuotuo wheat in an artificial climate chamber for 3 months, and collect samples at different days (5 days, 7 days, 10 days, 12 days, 15 days, and 20 days) after flowering.
[0105] 2. Extract total RNA from samples obtained at each time point in step 1 and send them to Beijing Berry Genomics Co., Ltd. (berrygenomics.com) for next-generation transcriptome sequencing. The total data volume for each sample was 6GB. Kallisto was used to calculate the TPM of the gene to obtain the expression trend of TaMyb10-94E in Tuotuo wheat. The results are shown in Figure 5. The results show that the expression level of TaMyb10-94E reached peaks on the 5th and 10th days, and the expression dropped to zero on the 20th day.
[0106] Example 4: Application of the TaMyb10-94E gene in regulating wheat grain color and spike sprouting resistance
[0107] 1. Construction of recombinant expression vector
[0108] The fragment between the BamHI and PmlI restriction sites of the pUBI-CAMBIA3301 vector (see Zhang L, He G, Li Y, et al. PIL transcription factors directly interact with SPLs and repress tillering / branching in plants [J]. New Phytologist, 2022, 233 (3): 1414-1425) was replaced with the nucleotide sequence shown in SEQ ID NO: 2 to obtain a recombinant expression vector (and sequence verification).
[0109] 2. Obtaining recombinant Agrobacterium
[0110] The recombinant expression vector obtained in step 1 was introduced into Agrobacterium tumefaciens EHA105 using the heat shock transformation method to obtain recombinant Agrobacterium.
[0111] 3. Acquisition and identification of genetically modified wheat
[0112] Using Agrobacterium-mediated genetic transformation, the recombinant Agrobacterium obtained in Step 2 was transformed into immature embryos of the wheat variety Fielder, generating transgenic wheat plants, TaMyb10-94E-OE. Since the Fielder genome does not contain the TaMyb10-94E gene, DNA was extracted from leaves of the control Fielder (WT) and transgenic wheat plants and amplified by PCR using the primer pair consisting of TaMYB10-F and TaMYB10-R described above. The results, as shown in Figure 6, show that the TaMyb10-94E gene was amplified in the transgenic line, while no band was amplified in the WT line.
[0113] 4. Phenotypic analysis of transgenic plants
[0114] Plants to be tested: WT, TaMyb10-94E-OE transgenic lines obtained in step 3 (2# and 12#), and transgenic line 58-4# obtained by overexpressing other wheat TaMyb10 genes in the Fielder background.
[0115] Wheat ears were harvested at the waxy stage, naturally air-dried indoors, threshed after 7 days, and their moisture content was measured to 10%-12%. After disinfection and rinsing with 0.5% NaClO, they were placed in a culture dish (with moist filter paper at the bottom of the culture dish). The number of germinated seeds was counted starting from the second day of the experiment, and the germinated seeds were removed and counted continuously for 7 days. The germination rate was calculated as (number of germinated grains / total number of grains) × 100%. As shown in Figure 7, the germination rate of WT grains exceeded 80% after 7 days, while overexpression of TaMyb10-94E significantly inhibited the grain germination rate.
[0116] After harvesting, mature wheat grains were treated with vanillin and NaOH solutions, respectively. NaOH reacts with flavonols and dihydroflavonoids, resulting in a brown or yellow color. The results are shown in Figure 8. Overexpression of TaMyb10-94E (2# and 12#) resulted in white wheat grains, while overexpression of TaMyb10 in other strains (58-4#) resulted in red wheat grains.
[0117] In summary, TaMyb10-94E can regulate wheat grain color and grain germination.
[0118] Example 5: Development of a KASP marker primer set for the white grain anti-ear sprouting wheat gene TaMyb10-94E
[0119] Source of experimental materials:
[0120] Tuotuo wheat is a white-grained wheat with the genotype TaMyb10-94E, while China Spring is a red-grained wheat with the normal TaMyb10 genotype. Both are local wheat varieties. Numbers 1-20 represent white-grained lines from the Tuotuo wheat × China Spring F3 hybrid population, while numbers 21-54 represent red-grained lines. Specific wheat materials used in the examples are shown in Table 2.
[0121] Table 2: Biomaterial Information
[0122] Seeds of all the test materials listed in Table 2 were germinated at room temperature for about 7 days, and young leaves were cut. Genomic DNA was extracted using the conventional CTAB method (see Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components [J]. Plant molecular biology reporter, 1997, 15: 8-15).
[0123] Comparison of the nucleic acid sequences in Example 1 revealed that the TaMyb10-94E gene has an A at Chr3D572163094, while the normal TaMyb10 gene has a G at this site. A sequence approximately 20 bp long was artificially selected at this single nucleotide polymorphism (SNP) site as a specific primer, and a universal primer approximately 20 bp long was selected in the homologous sequence region. The artificially designed primers were then evaluated using the Ensemble Plants website (http: / / plants.ensembl.org / ).
[0124] In this example, an 18-bp sequence was selected as the core sequence of the specific primer at the SNP site, and an 18-bp sequence was selected as the universal primer in the homologous sequence region following the SNP site. One of the specific primers was prepended with the specific sequence GAAGGTGACCAAGTTCATGCT, which can bind to FAM fluorescence, to obtain the primer MYB10-FAM; the other was prepended with the specific sequence GAAGGTCGGAGTCAACGGATT, which can bind to HEX fluorescence, to obtain the primer MYB10-HEX. The primer sequences are shown in Table 2 below. These sequences were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.
[0125] The total KASP (PCR) reaction system was 10 μL, including 5 μL of 2× KASP Master Mix (Beijing Jiacheng), 1.4 μL of KASP Assay Mix, 1 μL of wheat template DNA at a concentration of 100 ng / μL, and 0.08 μL of MgCl , which was made up to 10 μL with ddH O.
[0126] Wherein, each 100 μL of the KASP Assay Mix includes: 12 μL of MYB10-FAM with a concentration of 100 μM, 12 μL of MYB10-HEX with a concentration of 100 μM, and 30 μL of the universal primer with a concentration of 100 μM, and the volume is made up to 100 μL with ddH2O;
[0127] KASP Assay Mix KASP (PCR) reaction procedure is:
[0128] 94℃15min;
[0129] 94℃ for 20s, 70-60℃ for 1min, decreasing 1℃ each time, for a total of 10 cycles;
[0130] 94°C for 20 s, 58°C for 1 min, for a total of 35 cycles.
[0131] The PCR results were scanned and analyzed using a KASP fluorescence analyzer (Bio-Rad model: CFX96 Touch Real-Time PCR Detection System).
[0132] Table 3: Primer names and sequences
[0133] Fluorescence detection results are shown in Figure 9: the homozygous TaMyb10 genotype (G / G) is blue (FAM), the homozygous TaMyb10-94E genotype (A / A) is orange (HEX), and the heterozygous genotype (G / A) is green. The results are listed in Table 2. Wheat expressing the homozygous form (AA) of the superior SNP in the TaMyb10-94E gene has white grains, so the accuracy of this KASP marker primer set is 95%. This demonstrates that this marker primer set can effectively detect the homozygous TaMyb10-94E genotype, resulting in white grains and resistance to ear sprouting.
[0134] Example 6: Development of a CAPS-labeled primer set for the white-grain, ear-sprouting-resistant wheat gene TaMyb10-94E
[0135] Source of experimental materials:
[0136] The materials used were the same as those used in Example 1. All materials were preserved and provided by the Crop Genetics and Breeding Team of the Wheat Research Institute of Sichuan Agricultural University.
[0137] Seeds of all test materials were germinated at room temperature for approximately 7 days. Leaves of TTM and CS were mixed, as well as young leaves of TTM and CS alone, and genomic DNA was extracted using the conventional CTAB method (see reference: Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components [J]. Plant molecular biology reporter, 1997, 15: 8-15).
[0138] The TaMyb10-94E gene has an A at Chr3D 572163094, while the normal TaMyb10 gene has a G at this site. When designing primers for CAPS, a 20-bp forward primer can be selected from the 200-400 bp preceding the SNP site. A 20-bp reverse primer can be selected from the homologous sequence 50-350 bp following the site. Finally, the designed primers can be evaluated using the Ensemble Plants website (http: / / plants.ensembl.org / ).
[0139] In this example, a 24 bp sequence was selected as a CAPS forward primer within the 200-400 bp interval before the SNP site, and an 18 bp sequence was selected as a CAPS reverse primer within the 50-350 bp homologous sequence region after the site. The specific sequences are shown below:
[0140] Tamyb10-3D-F: 5'-TGATGATGACGTGCATTAATTCAC-3' (SEQ ID NO: 9);
[0141] Tamyb10-3D-R: 5'-CTGCTGGTTCCTCTTGCT-3' (SEQ ID NO: 10).
[0142] The above primer sequences were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.
[0143] The total CAPS (PCR) reaction system was 25 μL, containing 12.5 μL of 2×T5 Super PCR Mix, 1 μL of wheat template DNA at a concentration of 100 ng / μL, 0.08 μL of MgCl2, and 0.5 μL of each of upstream and downstream primers, which was made up to 25 μL with ddH2O;
[0144] The CAPS (PCR) reaction procedure is:
[0145] Pre-denaturation at 98°C for 3 min;
[0146] 98°C denaturation for 10 s, 58°C annealing for 10 s, and 72°C extension for 15 s, for 35 cycles;
[0147] Finally, extend at 72°C for 5 min and keep at 12°C.
[0148] After obtaining the amplified product, the product was digested with enzymes using the following enzyme digestion system: 0.2 μL restriction endonuclease BsrBI, 1 μL 10× CutSmart Buffer, 5 μL PCR product, and the total volume was made up to 10 μL with ddH2O. The enzyme digestion was performed at 37°C for 1.5 h and inactivated at 65°C for 20 min.
[0149] After enzyme digestion, the digestion products were electrophoretically verified. The presence of only a 383bp band after digestion indicated the TaMyb10-94E genotype, a 455bp band indicated the TaMyb10 genotype, and the presence of both a 383bp band and a 455bp band indicated the TaMyb10-94E / TaMyb10 heterozygous genotype (electrophoresis results are shown in Figure 10). The results are listed in Table 2. Materials expressing the superior SNP homozygous type (AA) of the TaMyb10-94E gene had white grains, so the accuracy of this CAPS marker was 100%. This demonstrates that this marker can effectively detect the homozygous TaMyb10-94E genotype, and wheat materials exhibit white grains and resistance to ear sprouting.
[0150] Sequence Listing:
[0151] SEQ ID NO: 1 (nucleotide sequence of TaMyb10 of other wheat varieties represented by wheat Chinese Spring)
[0152] SEQ ID NO: 2 (nucleotide sequence of TaMyb10-94E of Tuotuomai)
[0153] SEQ ID NO: 3 (TaMyb10-94E amino acid sequence of Tuotuomai)
[0154] SEQ ID NO:4(TaMYB10-F)
[0155] SEQ ID NO:5(TaMYB10-R)
[0156] SEQ ID NO:6(MYB10-FAM)
[0157] SEQ ID NO:7(MYB10-HEX)
[0158] SEQ ID NO:8(MYB10-COM1)
[0159] SEQ ID NO:9(Tamyb10-3D-F)
[0160] SEQ ID NO:10(Tamyb10-3D-R)
Claims
1. A TaMyb10-94E protein or a variant thereof, wherein the TaMyb10-94E protein comprises the amino acid sequence shown in SEQ ID NO:3, and the variant is a protein that is obtained by substitution and / or deletion and / or addition of one or more amino acid residues in the TaMyb10-94E protein and is related to wheat grain color and pre-harvest sprouting resistance.
2. A gene TaMyb10-94E encoding the TaMyb10-94E protein or a variant thereof according to claim 1.
3. The gene TaMyb10-94E according to claim 2, which comprises the nucleotide sequence shown in SEQ ID NO:2 or a nucleotide sequence having a similarity of more than 90% to the nucleotide sequence shown in SEQ ID NO:
2.
4. A recombinant expression vector comprising the gene TaMyb10-94E according to claim 2 or 3.
5. The recombinant expression vector according to claim 4, wherein the recombinant expression vector is a plant expression vector, such as an Agrobacterium vector and a vector that can be used for plant microprojectile bombardment; preferably, the recombinant expression vector is a binary Agrobacterium vector; more preferably, the recombinant expression vector is the pUBI-CAMBIA3301 vector.
6. A recombinant cell comprising the gene TaMyb10-94E according to claim 2 or 3 or the recombinant expression vector according to claim 4 or 5.
7. The recombinant cell according to claim 6, wherein the recombinant cell is a eukaryotic cell such as a plant cell or a prokaryotic cell such as Agrobacterium; preferably, the recombinant cell is Agrobacterium tumefaciens EHA105.
8. Use of the TaMyb10-9X4E protein or a variant thereof according to claim 1, the gene TaMyb10-94E according to claim 2 or 3, the recombinant expression vector according to claim 4 or 5, or the recombinant cell according to claim 6 or 7 in regulating grain color and reducing grain germination rate; preferably, the use is in plant breeding.
9. A method for identifying the gene TaMyb10-94E according to claim 2 or 3, which comprises detecting a sample DNA using a marker based on a single nucleotide polymorphism (SNP) locus, so as to identify the phenotype of the sample; wherein the SNP locus is located at 572163094 of wheat Chr3D, the polymorphism is G or A, the gene TaMyb10-94E is A at this locus, and the normal TaMyb10 gene is G at this locus.
10. The method according to claim 9, wherein the marker based on the SNP locus is a KASP marker primer set, which includes a first primer, a second primer and a universal primer, wherein: The first primer consists of a first tag sequence and a first core sequence from the 5' to 3' direction, and the first core sequence comprises the base G at the SNP locus of the TaMyb10 gene and 16-24 consecutive bases before the base G. The second primer consists of a second tag sequence and a second core sequence from the 5' to 3' direction. The second core sequence contains the base A at the SNP site of the gene TaMyb10-94E and 16-24 consecutive bases before the base A. The universal primer is any 17-25 consecutive bases in the homologous sequence region of the TaMyb10 gene and the gene TaMyb10-94E. The first tag sequence and the second tag sequence are respectively combined with fluorescent probes of different colors.
11. The method according to claim 10, wherein, The fluorescent probes are selected from FAM, HEX, FITC, AMC, CY2, VIC, DY-495, SIMA. Preferably, the fluorescent probe combined with the first tag sequence is FAM, and the fluorescent probe combined with the second tag sequence is HEX.
12. The method according to claim 10 or 11, wherein the length of the first core sequence and / or the second core sequence and / or the universal primer is 20 bases. Preferably, the length of the first core sequence and / or the second core sequence and / or the universal primer is 18 bases.
13. The method according to any one of claims 10-12, wherein the first primer has the nucleotide sequence shown in SEQ ID NO:6, the second primer has the nucleotide sequence shown in SEQ ID NO:7, and the universal primer has the nucleotide sequence shown in SEQ ID NO:
8.
14. The method according to any one of claims 10-13, wherein a sample showing the corresponding fluorescence color of the fluorescent probe combined with the second tag sequence is a homozygous TaMyb10-94E genotype, a sample showing the corresponding fluorescence color of the fluorescent probe combined with the first tag sequence is a TaMyb10 genotype, and a sample showing other colors is a TaMyb10-94E / TaMyb10 heterozygous genotype.
15. The method according to claim 9, wherein the SNP-site-based marker is a CAPS marker primer set, which includes a forward primer and a reverse primer. The forward primer is any 18-24 consecutive bases in the 200-400bp interval before the base A at the SNP site of the gene TaMyb10-94E, and the reverse primer is any 18-24 consecutive bases in the 50-350bp interval after the base A at the SNP site of the gene TaMyb10-94E. The adapted restriction enzyme is BsrB I.
16. The method according to claim 15, wherein the length of the forward primer and / or the reverse primer is 20 bases; preferably, the length of the forward primer is 24 bases and the length of the reverse primer is 18 bases.
17. The method according to claim 15, wherein the forward primer has the nucleotide sequence shown in SEQ ID NO:9, and the reverse primer has the nucleotide sequence shown in SEQ ID NO:
10.
18. The method according to any one of claims 15-17, wherein a sample that forms only a band of about 383 bp after enzymatic digestion is of the homozygous TaMyb10-94E genotype, a sample that forms only a band of about 455 bp is of the TaMyb10 genotype, and a sample that forms both a band of about 383 bp and a band of about 455 bp is of the TaMyb10-94E / TaMyb10 heterozygous genotype.
Citation Information
Patent Citations
Molecular marker for detecting wheat ear sprouting resistance gene Tamyb10-D1 and application thereof
CN109811082A
SNP (Single Nucleotide Polymorphism) molecular marker related to wheat pre-harvest sprouting resistance and application of SNP molecular marker
CN114959101A
Cited By
White-grain wheat pre-harvest germination resistance gene TaMyb10-94E and application thereof
CN119841917A
White wheat ear sprouting resistance gene ta myb10-94e and application thereof
CN119841917B