248 results about "Wheat grain" patented technology

The invention belongs to the technical field of plant genetic engineering molecular breeding, and particularly relates to application of wheat TabHLH93 protein or a coding gene thereof in regulation and control of plant grain development. According to the invention, a binary expression vector capable of realizing ectopic expression of the TabHLH93 gene is constructed and is genetically transformed into common wheat to obtain a progeny with high expression of the TabHLH93 gene, so that overexpression of the TabHLH93 gene is realized, and it is verified that the TabHLH93 has a function of regulating and controlling the size of wheat grains and also has an important regulation and control effect on agronomic characters such as wheat plant height, tiller number, spike length and thousand seed weight. A candidate gene with an important application prospect is provided for wheat high-yield genetic improvement, and the gene has important significance for guaranteeing grain safety.

The invention discloses a wheat yield remote sensing prediction method combining phenological parameters, which comprises the following steps: S1, performing field observation in a key growth period of winter wheat, synchronously collecting canopy hyperspectral reflectivity data, leaf area index (LAI) and SPAD value of each observation sample point, and recording wheat grain yield of the corresponding sample point; s2, performing noise reduction preprocessing on the acquired canopy hyperspectral data, and extracting sensitive spectral parameters by combining principal component analysis (PCA) and correlation analysis methods; s3, taking the sensitive spectrum parameters, LAI and SPAD values as independent variables, taking the wheat grain yield as a dependent variable, and adopting partial least squares regression (PLSR) to construct a multivariable yield prediction model; and S4, performing wheat yield prediction on an independent test sample or regional scale remote sensing data by using the trained model. The method overcomes the defect that only yield sensitive spectrum parameters are used for predicting the effect, and accurate estimation of the model is achieved.

The invention discloses an SNP (Single Nucleotide Polymorphism) marker closely linked with the peel thickness of wheat grains and application of the SNP marker, and belongs to the technical field of biology, an SNP site closely linked with the peel thickness character of the wheat grains is excavated through genome-wide association analysis, the SNP site is located at the 672th, 214th and 121th positions of the 2A chromosome of the wheat, and the SNP site is located at the 672th, 214th and 121th positions of the 2A chromosome of the wheat and is located at the 672th, 214th and 121th positions of the 2A chromosome of the wheat. The site base has A / G polymorphism, and the AA genotype or AG genotype has higher grain peel thickness than the GG genotype. Through genotype detection of the SNP site, the wheat grain pericarp thickness character can be obviously distinguished, a KASP primer is developed based on the SNP site, and molecular marker-assisted identification or assisted breeding can be performed on the wheat grain pericarp thickness character.

The invention belongs to the technical field of gene engineering, and particularly relates to application of a TaMGD3 gene in improvement of plant starch quality and cultivation of a high-starch transgenic plant, including application of the TaMGD3 gene in promotion of wheat grain starch synthesis, application of the TaMGD3 gene in cultivation of the high-starch and / or high-amylopectin transgenic plant, and application of the TaMGD3 gene in improvement of plant starch quality and cultivation of the high-starch and / or high-amylopectin transgenic plant. The invention also discloses an application of the TaMGD3 gene in improvement of plant starch characteristics. A nucleotide sequence of the TaMGD3 gene is shown as SEQ ID NO. 1. The invention also provides a cultivation method of transgenic wheat. In wheat cultivation, wheat amylopectin quality improvement is realized through overexpression of the gene shown in SEQ ID NO.1. The TaMGD3 gene can improve the starch content of wheat grains, influence the particle size distribution of the wheat grain starch, improve the amylopectin proportion, improve the peak viscosity and the relative crystallinity of the starch, and facilitate the improvement of the cooking quality related to the wheat starch.

The invention discloses an application of a TaAP2-4 gene in regulating and controlling starch content of wheat grains, which is used for enhancing the expression quantity of the TaAP2-4 gene to improve the starch content of the wheat grains and weakening the expression quantity of the TaAP2-4 gene to reduce the starch content of the wheat grains. The TaAP2-4 gene is located on a chromosome 4 of a wheat genome, and three copies, namely TaAP2-4-A, TaAP2-4-B and TaAP2-4-D, are formed on the chromosome 4. According to the invention, a Crispr / Cas9 gene editing vector for knocking out the TaAP2-4 gene is constructed by adopting a reverse genetics method, the TaAP2-4 gene is successfully knocked out in a wheat material by adopting an agrobacterium-mediated method, and the starch content of a knocked-out mutant is reduced, so that the condition that the TaAP2-4 gene plays a positive regulation role in a wheat grain starch synthesis process is known. In practical application, directional knockout mutation of the genome level TaAP2-4 gene can be achieved through a gene transformation process, the gene knockout mutation method can be used for verifying functions of the TaAP2-4 gene, and materials are provided for mining other starch synthesis related genes.

The invention discloses a wheat grain moisture content lossless prediction method based on hyperspectral imaging and Wasserstein generative adversarial network data enhancement, which realizes accurate moisture prediction by fusing spectral feature data enhancement and deep learning modeling. Collecting spectral image data of the wheat grains by using a visible light-near infrared and short wave infrared hyperspectral imaging system; a Wasserstein generative adversarial network is adopted to generate synthetic spectrum and moisture data in a differentiated mode, data distribution consistency is verified through t-SNE, and a triple training set is expanded; noise is eliminated in combination with first-order derivative preprocessing, key characteristic wavelengths are screened by using SPA and ReliefF algorithms, and a convolutional neural network regression model is constructed; experiments show that the method achieves # imgabs0 # imgabs1 # RMSEP = 0.5717 in the visible light-near infrared band and # imgabs2 # RMSEP = 1.0009 in the short wave infrared band, and the precision is remarkably improved compared with a traditional extreme learning machine and a back propagation neural network.

The invention relates to a method for regulating and controlling the color of wheat grains and reducing the germination rate of the grains, a related TaMyb10 mutant protein, a gene, a gene editing vector and application of the TaMyb10 mutant protein. The invention discloses a method for regulating and controlling the color of wheat grains and reducing the germination rate of the grains. The method comprises the step of inhibiting or destroying the interaction of TaMyb10 protein and bHLH protein in wheat to obtain white-grain pre-harvest germination resistant wheat. The invention further discloses a functional segment which is combined with bHLH in the TaMyb10 protein and can influence the color and the pre-harvest germination resistance of wheat grains, application of a variant of the functional segment, TaMyb10 mutant protein containing substitution and / or deletion and / or addition of amino acid residues at one or more functional sites of the functional segment, and application of the TaMyb10 mutant protein. The interaction between the TaMyb10 and the bHLH protein is weakened or does not interact with the bHLH protein through the mutation of the amino acid at the functional site, so that the wheat shows the characteristic of white-grain pre-harvest sprouting resistance, and the cultivation of the white-grain pre-harvest sprouting resistance wheat variety is facilitated.

The application relates to the field of crop seeding technology, and particularly discloses a wheat-corn interplanting self-adaptive seeding width regulation method based on crop and soil parameter identification, which comprises the following steps: normalizing soil body penetration resistance data to generate soil body penetration resistance score values and dividing seeding condition grades; jointly analyzing wheat grain moisture content data and soil slope data to construct a slope moisture content correlation matrix and perform dimension expansion to obtain interference characteristic factors; inputting wheat row spacing data, the seeding condition grades and the interference characteristic factors into a decision rule library to generate seeding width values and seeding density values; converting the seeding width values into channel boundary coordinate instructions of seeding machines, and driving the seeding machines to adjust the operation width of corn seeding according to the channel boundary coordinate instructions; and synchronously regulating the single irrigation amount of wheat medium-shallow buried drip irrigation. The application can improve the seeding precision and resource utilization efficiency of wheat-corn interplanting operation.

The invention provides a wheat imperfect grain recognition method and a wheat imperfect grain recognition device. The method comprises the following steps: enabling wheat in a wheat sample to be detected to drop one by one; in the falling process of each wheat grain, at least two cameras are adopted to shoot each wheat grain so as to at least obtain images on the two sides of each wheat grain, and at least two images to be recognized are obtained; identifying the at least two to-be-identified images based on a constructed deep learning network model suitable for wheat imperfect grain images to obtain the grain type of each grain of wheat; and sorting each wheat grain to a corresponding collection area based on the grain type. According to the scheme, the recognition speed and the recognition precision of the wheat imperfect grains can be improved, the required calculation amount is small, and the method can be deployed in a resource-limited production environment.

The invention discloses a method for improving the nutritional quality of wheat and reducing vomitoxin by combining cold plasma with lactic acid bacteria fermentation. The method comprises the following specific steps: (1) putting wheat grains polluted by DON into a reaction cavity of cold plasma equipment; (2) preparing a single or compound lactic acid bacteria starter; (3) mixing the wheat subjected to cold plasma treatment with a lactic acid bacteria leavening agent for fermentation; and (4) drying, grinding and sieving the fermented wheat to prepare the wheat flour meeting the standard. Through progressive cooperative treatment of cold plasma pretreatment and compound lactobacillus fermentation, the final degradation rate of DON reaches 91.04%, functional components (resistant starch reaches 13.71% and dietary fiber reaches 13.14%) are synchronously increased, and phytic acid (lowest to 0.42%) is greatly degraded to improve the bioavailability of mineral substances. Besides, the method can optimize the wheat processing performance, the prepared noodles are moderate in hardness, good in elasticity and stretch-proof, no chemical reagent is added in the whole process, collaborative optimization of efficient detoxification, nutrient enrichment and processing performance improvement is achieved, and a green and economical solution is provided for safe utilization of polluted wheat.

The invention discloses wheat TaPAB1 protein and application of related biological materials of the wheat TaPAB1 protein in the aspect of improving the grain weight of wheat. A gene for coding the TaPAB1 protein is named as a TaPAB1 gene. According to the invention, the gene TaPAB1 is cloned from a wheat cultivation variety, Chinese spring, and is over-expressed in a wheat variety Kenong 199 (KN199) by utilizing a gene engineering technology, so that the thousand seed weight, the grain length, the plant height, the ear length and the yield of a TaPAB1 over-expressed plant are obviously increased compared with those of a wild type. The invention provides a research basis for increasing the wheat yield and breeding high-yield varieties.

This invention discloses a haplotype SNP molecular marker for identifying wheat grain starch content in the TaMYB44-4D gene and its application. Specifically, the SNP is T or C at position 1557bp of the sequence in SEQ ID NO.1. Based on this SNP, primers for detecting this haplotype SNP molecular marker have also been developed, and a kit containing these primers has been prepared. By PCR and polyacrylamide gel electrophoresis, the SNP and genotype can be accurately identified, thereby distinguishing between superior haplotypes (high starch content) and non-superior haplotypes (low starch content) in wheat.

The application provides a wheat kernel hardness major locus and a SNP marker Marker288063 and an application, belongs to the wheat breeding technical field, and mainly provides the SNP molecular markers Marker288063, Marker288023, Marker287945 and Marker288351; the SNP locus provided by the application has important significance for detecting and breeding a wheat kernel high HI variety, strain and breeding material, and a molecular marker can be developed according to the SNP locus, so that the wheat quality breeding efficiency is accelerated.

The invention relates to a method for increasing folic acid content of wheat malt seedlings through ultrasonic field and amino acid solution treatment, which belongs to the technical field of agricultural food biology and is characterized in that wheat grains with high germination rate are used as raw materials, and the wheat malt seedlings are cultivated through soaking disinfection, amino acid solution dipping and ultrasonic field treatment and regulation and control of illumination, temperature, humidity and CO2 concentration. And drying and crushing to obtain the wheat malt seedling powder rich in folic acid. According to the method disclosed by the invention, the permeability of cell membranes is enhanced by utilizing an ultrasonic cavitation effect, folic acid precursor absorption and synthetase activation are promoted, the folic acid content in the wheat malt seedlings is effectively increased, and the wheat malt seedling powder with the folic acid content of 450-550mu g / 100g is obtained.

The invention belongs to the technical field of gene engineering, and particularly relates to application of TaNAS1 protein or a coding gene thereof in regulation and control of plant nicotinamide content. The invention provides application of a TaNAS1 protein or a coding gene thereof in regulating and controlling the content of nicotinamide in plants. The amino acid sequence of the TaNAS1 protein is as shown in SEQ ID NO: 3. The TaNAS1 protein or the coding gene thereof is overexpressed in a plant, so that the nicotinamide content of the plant can be increased, the agronomic traits of wheat can be improved, and the nutrient element content of wheat grains can be increased. Specifically, overexpression of the TaNAS1 protein or the coding gene of the TaNAS1 protein increases the grain length, grain width and hundred-grain weight of wheat, and increases the contents of zinc, iron and copper elements in wheat grains.

The invention belongs to the technical field of heavy metal pollution treatment, and discloses a method for reducing soil cadmium activity and wheat grain cadmium content. According to the method, the low-cadmium-accumulation wheat variety is selected, the composite conditioner is applied, the low-cadmium-accumulation wheat variety is Jimai 22, and the composite conditioner is composed of mineral source potassium fulvate and zinc fertilizer. The complex passivation effect of humic acid components in mineral source potassium fulvate on soil heavy metal is utilized, the ion antagonism effect of zinc and cadmium and the low cadmium accumulation characteristic of Jimai 22 are combined, the cadmium content of wheat grains is synergistically reduced to 0.1 mg / kg or below, meanwhile, the cadmium content of the soil can be remarkably reduced, and the soil with cadmium exceeding the standard can be repaired. The treatment method provided by the invention has the advantages of simple operation, easily available raw materials, low cost, stable synergistic cadmium reduction effect and the like.

The invention relates to the technical field of heat energy engineering and efficient energy-saving equipment, and discloses a bionic heat exchanger based on seal beard turbulent flow and wheat grain communication configuration, the bionic heat exchanger comprises an inlet flow collecting cavity, an outlet flow collecting cavity and a plurality of heat exchange pipes, the heat exchange pipes are horizontally arrayed, the inlet flow collecting cavity is correspondingly arranged at one ends of the heat exchange pipes, and the outlet flow collecting cavity is correspondingly arranged at the other ends of the heat exchange pipes. The heat exchanger further comprises an inlet tube plate and an outlet tube plate, the inlet tube plate is fixedly installed on the side, facing the heat exchange tubes, of the inlet flow collecting cavity, and the outlet tube plate is fixedly installed on the side, facing the heat exchange tubes, of the outlet flow collecting cavity. The wavy torsion structures of the seal beard-imitating turbulent flow columns in the pipes induce generation of hairpin vortexes, a thermal boundary layer is efficiently destroyed, heat exchange in fluid is promoted, meanwhile, a three-dimensional networked flow channel is constructed by means of the hollow wheat grain-imitating communicating pipes between the pipes, transverse fluid mixing between pipe bundles is achieved, and the heat exchange efficiency is improved. Through the synergistic effect of the two structures, local heat accumulation and flowing dead zones are thoroughly eliminated, and the overall heat transfer performance is enhanced.

The invention relates to a spraying liquid for increasing the zinc and selenium content of wheat and a preparation method and a spraying method of the spraying liquid, and belongs to the field of optimization of the zinc and selenium content of the wheat. 0.0021% to 0.0024% of a selenium source substance; 0.02% of a surfactant; and the balance of water. By optimizing the concentration of Zn and Se sprayed on leaf surfaces, the antagonism between Zn and Se can be effectively compensated, and safe and synchronous enrichment of Zn and Se in wheat grains is realized; according to the present invention, the daily nutrition requirements of the human body can be met, and the Se content is controlled to be less than the Se toxicity threshold value; the proportion of organic Se is increased, and the related risk of inorganic Se is reduced, so that the food safety is improved; the Zn / Se response protein based on proteomics analysis provides a molecular marker for cultivating a wheat variety with synchronously enriched Zn-Se; the method can be compatible with traditional agricultural practice, extra large equipment or significant cost input is not needed, yield loss is avoided, and a feasible scheme is provided for solving the hidden hunger problem.

The application discloses a wheat kernel length molecular marker and application thereof, and solves the technical problem of how to provide a wheat kernel length molecular marker. The application specifically discloses the following application of any one of an InDel molecular marker or a substance for detecting the InDel molecular marker: A1) application in identification or auxiliary identification of wheat kernel length; A2) application in preparation of a product for identification or auxiliary identification of wheat kernel length; A3) application in preparation of a wheat breeding product; the InDel molecular marker is a DNA molecule with a nucleotide sequence of sequence 5. The kernel length of the deletion type wheat is longer than or longer than the kernel length of the insertion type or heterozygous type wheat, and can be used in industrial production.

The application discloses a genetic marker linked with a wheat kernel nickel ion accumulation QTL qNi.hnaas-6BS, adopts a Wheat Breeders 660K microarray chip to identify genotype data of a natural population, combines phenotype data of kernel nickel ion content of the wheat natural population, carries out whole genome association analysis (GWAS), identifies that a quantitative trait locus (QTL) qNi.hnaas-6BS for controlling wheat kernel nickel ion accumulation exists on a short arm of a 6B chromosome of the wheat, the QTL is closely linked with SNP6872, is located at the 125,482,475th nucleotide of the 6B chromosome, and the SNP6872 has C / T polymorphism. Haplotype analysis results on a population level show that when the nucleotide of the site is CC, the wheat kernel has lower nickel ion content, and is a favorable allelic genotype for limiting the accumulation of the wheat kernel nickel ion.

The application relates to the technical field of wheat kernel type genes, and provides a wheat kernel type gene TaCYT-5A TaCYT-5A The application of the molecular marker is KASP-TaCYT-5A, the marker is a SNP site (C / T) detected at 495818646 bp in a QTL cluster for controlling the wheat kernel type and kernel length traits of a 5A chromosome 484432128-495883712 bp, that is, a 4-hydroxyphenylacetaldehyde oxime monooxygenase gene TaCYT-5A The coding region is 124 bp away from the start codon. The functional KASP molecular marker of the wheat 4-hydroxyphenylacetaldehyde oxime monooxygenase gene TaCYT-5A provided by the application can be used for identifying whether an TaCYT-5A excellent allele exists in a wheat variety / strain, and applied in assisted selection breeding and breeding in combination with other known kernel type related genes.

The invention discloses a wheat alkyl resorcinol content molecular marker and application thereof. The invention provides an application of a substance for detecting the genotype of an SNP site AX-109949078 in a wheat genome in any one of the following products or preparation of any one of the following products: A1) identifying or assisting in identifying the content of alkylresorcinol in wheat grains; a2) screening or auxiliary screening of wheat with high alkyl resorcinol grains; a3) breeding wheat with high alkylresorcinol grains; a4) wheat genetic breeding, and the SNP site AX-109949078 is the 81st site of SEQ ID NO.4. Experiments prove that a wheat alkyl resorcinol content site is determined, the SNP marker closely linked with the wheat alkyl resorcinol content site is AX-109949078, a KASP primer is developed according to the corresponding marker, and molecular marker-assisted screening can be carried out on the alkyl resorcinol content.

The invention belongs to the technical field of biology, and discloses application of a KASP molecular marker related to the wet gluten content of wheat grains. One technical scheme of the invention protects the application of the composition for detecting the polymorphism or genotype of the SNP1 site in the wheat genome in any one of A1-A3: A1, the application in identification or auxiliary identification of the wet gluten content of wheat grains; a2, application in preparation of products for identification or auxiliary identification of the wet gluten content of the wheat grains; a3, application in wheat breeding or application in preparation of wheat breeding products; the SNP1 site is an SNP site in a wheat genome, the nucleotide variety of the SNP1 site is T or C, and the SNP1 site is the 251th nucleotide of SEQ ID No.1. The composition for detecting SNP1 site polymorphism and genotype can be used for preparing products for high-throughput identification of the wet gluten content of wheat grains.

The invention belongs to the technical field of agricultural remote sensing monitoring, and discloses a saline-alkali soil wheat grain total phenol content remote sensing monitoring method and system. Based on multi-source remote sensing data, meteorological and vegetation characteristics are extracted through phenological matching, and a protein content estimation model containing a salt stress nonlinear inhibition item is constructed; and establishing a quantitative relationship between the protein and the total phenol content, and finally, performing inversion by using an optimization algorithm to obtain the high-precision total phenol content, thereby realizing effective monitoring on the quality of the wheat grains in the wide-range saline-alkali soil. A'protein content-total phenol content 'secondary inversion framework is created for the first time, total phenol content monitoring is indirectly achieved through a protein remote sensing inversion technology, and the technical problem that direct spectrum inversion is low in precision is effectively solved; the saline-alkali soil specificity stress response model is creatively established, the non-linear inhibition effect of salinity on the crop physiological process is considered in the inversion process, the monitoring precision and the model adaptability are remarkably improved, and the method has the advantages of being high in monitoring precision, high in practicability, wide in application range and the like.

The application discloses a SNP marker related to wheat kernel alpha-tocopherol content and application thereof. The application provides application of a substance for detecting a SNP site Ta-6A-SNP haplotype in a wheat genome in any one of the following: A1) identifying or assisting in identifying wheat kernel alpha-tocopherol content; A2) screening or assisting in screening wheat with high alpha-tocopherol content in kernels; A3) breeding wheat with high alpha-tocopherol content in kernels; A4) wheat genetic breeding. The application finds a SNP site Ta-6A-SNP on a 6A chromosome of wheat, and develops a molecular marker according to the SNP, which is a KASP marker, has good repeatability, low cost, is beneficial to screening wheat varieties with high alpha-tocopherol content, and has important significance for cultivating new wheat varieties with high alpha-tocopherol content.

The present invention provides a use of a GAL-5B protein and a coding gene therefor in plant breeding, wherein the loss of function of the GAL-5B protein can significantly promote the accumulation of raffinose in plant seeds, while simultaneously increasing the protein content and reducing the starch content in the seeds; moreover, overexpression of GAL-5B reduces the raffinose content in the plant seeds.

The present invention discloses a KASP molecular marker significantly associated with the copper content of wheat grains and its application. The KASP molecular marker has the following nucleotide sequence: TATGCTACTGAATGTTTGCCATCATATCAAACCTC[G / T]GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG. The KASP molecular marker of the present invention can be used to identify the main effect QTL locus related to the copper (Cu) content of wheat grains. QCu.yaas‑7A Molecular marker-assisted selection breeding is a major QTL locus related to wheat copper (Cu) content. QCu.yaas‑7A Effective use in breeding provides a good tool to quickly screen wheat grain copper (Cu) content.

The invention relates to a rice and wheat in-situ yield measurement device, system and method, and relates to the technical field of yield measurement, the rice and wheat in-situ yield measurement device comprises a mounting assembly, a separation assembly, a detection assembly and a display module, feeding, threshing, impurity removal and detection structures are integrated into a whole, the structure is compact, an operation handle is held by hand to move to any point in the field, and operation is convenient. Rice and wheat crops are inserted into the feeding opening, the separation assembly can discharge impurities such as glume shells, stems and leaves to the periphery of the roots of the plants, a covering layer is formed, water evaporation is reduced, organic matter is supplemented, additional collection bags are not needed, and zero-material-consumption and zero-waste green operation is achieved; particle parameters and position parameters are obtained and displayed through the display screen immediately, a traditional threshing machine, a traditional cleaning machine and a traditional table type metering device do not need to be carried for dispersed operation, multiple times of detection can be carried out at the same place, and the accuracy of yield indexes is improved.

The application discloses a wheat TaCKS1 protein, a coding gene and application of a mutant sequence thereof in regulation of wheat kernel development, belongs to the technical field of biology, and the amino acid sequence of the TaCKS1 protein is shown as SEQ ID NO. 7. The application clones SUC1 / CKS1 homologous gene TaCKS1 from Arabidopsis thaliana to wheat, and a tacks1 mutant is screened in a EMS mutagenized population of Jimai 20, and it is found through analysis of kernel phenotypes of the tacks1 mutant and the wild type JM20 that the kernel length, kernel width, 1000-grain weight and yield per plant of the mutant are all increased compared with the wild type. The TaCKS1 gene of wheat is identified for the first time, the function of the TaCKS1 gene in negatively regulating the kernel length, kernel width, 1000-grain weight and yield per plant of wheat is verified through the EMS mutant, and new gene resources are provided for wheat breeding.

The invention belongs to the technical field of food engineering, and discloses a wheat processing parameter determination method based on multi-modal vision, which comprises the following steps: step 1, determining three-dimensional morphological characteristics of wheat grains; 2, measuring the wheat suspension speed; step 3, extracting wheat color features; and step 4, determining wheat processing parameters. The method breaks through the limitation of two-dimensional image analysis, and adopts a multi-vision three-dimensional reconstruction technology to accurately obtain three-dimensional morphological parameters such as particle volume, sphericity and surface roughness.