Micropeptide and use thereof
By identifying and manipulating micropeptide microRPG1 and its related genes, the water content and dehydration rate of corn grains are regulated by using gene editing technology, the problem of difficulty in controlling the water content of corn grains in the prior art is solved, and the effect of adapting to different harvesting purposes and delaying aging is achieved.
Patent Information
- Application Number
- PCT/CN2025/074456
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-25
- Filing Date
- 2025-01-23
- Publication Date
- 2025-07-31
AI Technical Summary
The prior art is difficult to effectively control the moisture content and dehydration rate of corn grains, which affects the quality of mechanical harvest, storage and economic benefits, and different harvesting purposes require different moisture content of grains.
By identifying and manipulating micropeptide microRPG1 and its related genes, the water content and dehydration rate of corn kernels are regulated using gene editing technology, including overexpression or knockout of specific genes, genetic modification using promoters and vectors, and corn material improvement combined with molecular marker screening and gene editing tools such as CRISPR-Cas9.
Accurate control of the moisture content and dehydration rate of corn grains is achieved, and corn varieties with low water content or high water content can be cultivated to adapt to different harvesting needs and delay the aging process of plants and animals.
Smart Images

Figure CN2025074456_31072025_PF_FP_ABST
Abstract
Description
Micropeptide and its application
[0001] The present application claims the following four priorities: the invention entitled “A micropeptide and its application”, application number 202410103198.X (application date 2024-01-25), the invention entitled “Promoter and ethylene signaling pathway gene for controlling corn kernel dehydration and its application”, application number 202410102817.3 (application date 2024-01-25), the invention entitled “QTL for controlling corn kernel dehydration rate and its application”, application number 202410103155.1 (application date 2024-01-25) and the gene for controlling corn kernel dehydration rate and grain moisture content and its application, application number 202410341982.4 (application date 2024-03-25). The full texts of the four prior applications are incorporated into the present application by reference. Technical Field
[0002] The invention relates to a molecular element for controlling corn kernel dehydration rate and kernel moisture content and application thereof, and belongs to the field of genetic engineering. Background Art
[0003] Kernel moisture is a key factor affecting the quality, safe storage, and economic benefits of mechanical corn harvesting. Kernel moisture content at harvest significantly impacts corn harvesting, drying, storage, transportation, and processing. Excessive moisture content often causes economic losses to corn growers and operators, reduces economic benefits, and easily causes kernel mold, affecting corn quality. In addition, the most critical step in mechanical corn harvesting is that the kernel moisture content at harvest does not reach the standard moisture content of ≤25% for mechanical harvesting (Wang Z, Wang X, Zhang L, Liu X, Di H, Li T, Jin X. QTL underlying field grain drying rate after physiological maturity in maize (Zea Mays L.) [J]. Euphytica, 2012, 185(3): 521-528.). Therefore, it is very important to breed corn varieties with low kernel moisture content at harvest.
[0004] On the other hand, the optimal harvest moisture content varies depending on the purpose of harvesting. For example, corn kernels harvested for silage require a high moisture content, generally above 30%. For fresh corn, the moisture content can be as high as 75% to maintain good taste and nutritional value. Therefore, QTLs or functional genes that can control corn kernel moisture content and dehydration rate have important industrial value.
[0005] Summary of the Invention
[0006] Specific aspects of the present invention include:
[0007] The present invention first provides a micropeptide, wherein the amino acid sequence of the micropeptide is as shown in SEQ ID NO.4 or any one of SEQ ID NO.11 to SEQ ID NO.18, or a micropeptide having an amino acid sequence with more than 90% sequence identity with the above sequence.
[0008] The present invention also provides a nucleotide sequence encoding the micropeptide.
[0009] The present invention also provides a vector or construct for expressing the micropeptide, comprising an operably linked promoter and a nucleotide sequence encoding the micropeptide; preferably, the nucleotide sequence encoding the micropeptide is SEQ ID NO.3.
[0010] The present invention also provides a method for producing the above-mentioned micropeptide, which is a chemical method or a biological method; the chemical method includes the steps of liquid phase synthesis or solid phase synthesis, and the biological method includes the following steps: 1) constructing a vector, the vector including an operably linked promoter and a nucleotide sequence encoding the micropeptide; 2) transfecting host cells and screening positive clones; 3) culturing the host cells and isolating the micropeptide product.
[0011] The present invention also provides a preparation comprising the above-mentioned micropeptide or nucleotide encoding the micropeptide at a concentration of 1 μM to 50 μM; optionally, the preparation further comprises: water, bacterial liquid, cell culture fluid, plant culture medium, physiological saline, food excipients, cosmetic excipients or pharmaceutical excipients.
[0012] The present invention also provides an anti-aging method, which comprises applying the above-mentioned micropeptide or a nucleotide encoding the micropeptide to prepare an anti-aging product, or a product related to the treatment of aging-related diseases, or an antioxidant product; preferably, the product comprises a preparation, a probe, a reagent, a kit, a health product, a medicine or a drug combination.
[0013] The present invention also provides a method for delaying aging, prolonging lifespan or reducing the generation of reactive oxygen species in animals or human subjects, comprising providing the above-mentioned micropeptide or nucleotide encoding the micropeptide to the animal or human subject; preferably, providing the micropeptide by topical, oral or intravenous injection.
[0014] The present invention also provides a method for regulating the moisture content of plant seeds or delaying fruit ripening, which comprises overexpressing a nucleotide sequence encoding the micropeptide in a plant; or applying a reagent comprising the micropeptide or a nucleotide encoding the micropeptide to the plant; preferably, the reagent further comprises water, bacterial liquid, cell culture fluid, plant culture medium or physiological saline; preferably, the application comprises spraying in vitro or adding to the soil; preferably, the plant is a grass plant; preferably, the plant is rice, teosinte and corn.
[0015] The present invention first provides a method for cultivating a corn material having low grain moisture content or fast dehydration rate, the method comprising the following steps:
[0016] 1) Providing corn materials to be improved;
[0017] 2) genetically modifying or hybridizing the material to be improved in step 1);
[0018] 3) selecting or selecting among progeny corn materials that exhibit low kernel moisture content or fast dehydration rate;
[0019] Wherein step 2) is selected from at least one of the following steps:
[0020] i) reducing the expression level of the microRPG1 micropeptide represented by SEQ ID NO. 4 in the material to be improved;
[0021] ii) increasing the expression levels of the ZmEIL1 gene as shown in SEQ ID NO. 19 and the ZmEIL3 gene as shown in SEQ ID NO. 20 in the material to be improved;
[0022] iii) increasing the expression levels of ZmMYBST1 and ZmMYBR43 transcription factors having amino acid sequences as shown in SEQ ID NO.35 or SEQ ID NO.36 in the material to be improved; preferably, the nucleotide coding sequences of the transcription factors are as shown in SEQ ID NO.33 to SEQ ID NO.34;
[0023] iv) selecting corn materials exhibiting low kernel moisture content or fast dehydration rate traits based on at least one of the following molecular markers and hybridizing them with the material to be improved in step 1), wherein the molecular markers include:
[0024] Indel6181: Based on the sequence shown in SEQ ID NO. 50, positions 722-779 contain a 6181 bp insertion;
[0025] Inde50: Based on the sequence shown in SEQ ID NO. 50, positions 729-778 contain a 50 bp deletion;
[0026] Inde234: Based on the sequence shown in SEQ ID NO. 50, positions 1131-1377 contain a 234 bp insertion;
[0027] Or based on the sequence shown in SEQ ID NO. 50, position 67; or position 70; or position 473; or position 513; or position 597; or position 599; or position 605 contains a SNP mutation.
[0028] In a specific embodiment of the present invention, in step i), the coding sequence of microRPG1 is knocked out by gene editing, or the expression of the coding sequence of microRPG1 is reduced by RNA interference.
[0029] In a specific embodiment of the present invention, the nucleotide sequence encoding microRPG1 is SEQ ID NO.3.
[0030] In a specific embodiment of the present invention, the increasing expression in step ii) or iii) comprises gene overexpression or strong promoter replacement.
[0031] In a specific embodiment of the present invention, in step 3), the selection is performed by detecting the molecular marker. Preferably, the material with a fast dehydration rate is a haplotype that does not contain Indel-234, Indel-50 or Indel6181.
[0032] The present invention also provides a method for cultivating a corn material having a high grain moisture content or a slow dehydration rate, the method comprising the following steps:
[0033] 1) Providing corn materials to be improved;
[0034] 2) genetic modification or hybridization;
[0035] 3) selecting or selecting among progeny corn materials that exhibit high kernel moisture content or a slow dehydration rate;
[0036] Wherein step 2) is selected from at least one of the following steps:
[0037] i) increasing the expression level of the microRPG1 micropeptide represented by SEQ ID NO. 4 in the material to be improved;
[0038] ii) reducing the expression levels of the ZmEIL1 gene as shown in SEQ ID NO. 19 and the ZmEIL3 gene as shown in SEQ ID NO. 20 in the material to be improved;
[0039] iii) reducing the expression levels of ZmMYBST1 and ZmMYBR43 transcription factors having amino acid sequences as shown in SEQ ID NO.35 or SEQ ID NO.36 in the material to be improved; preferably, the nucleotide coding sequences of the transcription factors are as shown in SEQ ID NO.33 to SEQ ID NO.34;
[0040] iv) deleting any fragment between positions 1049-1417 of the material to be improved based on SEQ ID NO. 50;
[0041] v) selecting corn materials showing high kernel moisture content or slow dehydration rate based on at least one of the following molecular markers and hybridizing them with the materials to be improved in step 1), wherein the molecular markers include:
[0042] Indel6181: Based on the sequence shown in SEQ ID NO. 50, positions 722-779 contain a 6181 bp insertion;
[0043] Inde50: Based on the sequence shown in SEQ ID NO. 50, positions 729-778 contain a 50 bp deletion;
[0044] Inde234: Based on the sequence shown in SEQ ID NO. 50, positions 1131-1377 contain a 234 bp insertion;
[0045] Or based on the sequence shown in SEQ ID NO. 50, position 67; or position 70; or position 473; or position 513; or position 597; or position 599; or position 605 contains a SNP mutation.
[0046] In a specific embodiment of the present invention, increasing expression in step i) comprises introducing an expression cassette, wherein the expression cassette comprises a promoter, the ZmRPG gene shown in SEQ ID NO. 1 or 2 or the microRPG1 coding sequence shown in SEQ ID NO. 3 and a terminator; preferably, the promoter is a high-activity promoter such as the maize ubiquitin promoter.
[0047] In a specific embodiment of the present invention, the reducing expression in step ii) or iii) comprises gene editing or RNA interference.
[0048] In a specific embodiment of the present invention, the deletion in step iv) is carried out using a gene editing method.
[0049] In a specific embodiment of the present invention, step 3) is selected by detecting the molecular marker. Preferably, the material with a slow dehydration rate is a haplotype comprising Indel-234 and Indel-50, or a haplotype comprising Indel6181 but not Indel-234 and Indel-50. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] Fig. 1 Fine mapping and cloning of qKDR1. A: Preliminary QTL linkage analysis results (curves of different colors represent different degrees of AUDDC index of BLUP); B: Genotype of HIF material segment; C: Fine mapping of qKDR1, phenotype is the AUDDC value between two water measurements; D: NIL material plant and ear.
[0051] Figure 2. Distribution of 17 differentially expressed genes in four NIL populations (R1–R4). A: Downregulated genes; B: Upregulated genes. Numbers in circles represent the number of genes in the intersection.
[0052] Figure 3. qKDR1 regulates ZmRPG gene expression. A: Schematic diagram of the genotypes of four NIL populations; B: ZmRPG gene expression levels in the four NIL populations.
[0053] Figure 4. Distribution of the 12 open reading frames (ORFs) of the ZmRPG gene. ORF1 encodes the micropeptide microRPG1.
[0054] Figure 5: Overexpression of ZmRPG slows down the dehydration rate of maize kernels. A: ZmRPG overexpression cassette structure; B: ZmRPG expression level in two transgenic overexpression lines; C: Kernel dehydration rate of the ZmRPG overexpression lines at the Hainan trial site in 2021 (expressed as the AUDDC value between two moisture measurements); D: Kernel dehydration rate of the ZmRPG overexpression lines at the Jilin trial site in 2021 (expressed as the AUDDC value between two moisture measurements).
[0055] Figure 6 Overexpression of microRPG1 slows corn kernel dehydration. A: MicroRPG1 overexpression cassette structure; B: MicroRPG1 expression levels in two transgenic overexpression lines; C: Results from the Hainan trial site in 2021; D: Results from the Beijing trial site in 2022; E: Results from the Jilin trial site in 2022. The phenotype is the AUDDC value between two moisture measurements. Figure 7 Knockout of microRPG1 accelerates corn kernel dehydration. A: Results from the Beijing trial site in 2020; B: Results from the Hainan trial site in 2021; C: Results from the Beijing trial site in 2022; D: Results from the Jilin trial site in 2022. Data are expressed as the AUDDC value between two moisture measurements.
[0056] Figure 8. MicroRPG1 micropeptide delays Arabidopsis silique maturation. A: Plant phenotype after micropeptide treatment; B: Silique phenotype after micropeptide treatment; C: Seed phenotype after micropeptide treatment; D: Phenotype at the beginning of silique maturation; D: Phenotype at 50% silique maturity; F: Seed moisture content; G: Phenotype at flowering.
[0057] Figure 9 Effects of exogenous application of microRPG1 at different concentrations on silique ripening. A: Phenotype of treatment when siliques begin to mature; B: Phenotype of treatment when 50% of siliques are mature. n represents the number of plants.
[0058] Figure 10. The microRPG1 micropeptide can be absorbed by Arabidopsis roots. Image under FAM-ORF1 fluorescence; Bright-field: image under bright-field; Merge: overlay of fluorescence and bright-field images.
[0059] Figure 11. microRPG1 micropeptide can enhance human cell viability (left) and reduce the production of reactive oxygen species at the cellular level (right).
[0060] Figure 12 Intestinal particles of nematodes after feeding ORF1 (N2 / OP50+ORF1) and control (N2 / OP50).
[0061] Day15 / 18 / 21 / 24 indicates the days after feeding.
[0062] FIG13 is a statistical analysis of the survival days of nematodes after feeding with ORF1 (N2+ORF1) and the control (N2).
[0063] Figure 14: MicroRPG1 micropeptide inhibits EIL gene expression. A: ZmEIL1 expression is increased in knockout lines and decreased in overexpression lines. ORF1-KO represents microRPG1 knockout, and ORF1-OE represents microRPG1 overexpression. B: ZmEIL3 expression is increased in knockout lines and decreased in overexpression lines. ORF1-KO represents microRPG1 knockout, and ORF1-OE represents microRPG1 overexpression.
[0064] Figure 15: Knockout of ZmEIL1 and ZmEIL3 slows down the dehydration rate. A: ZmEIL1, KO1, and KO2 represent different knockout lines; B: ZmEIL3, KO1, KO2, and KO3 represent different knockout lines. WT: receptor control; n: number of samples. AUDDC (water content variation index) was used to measure grain moisture content; the evaluation method is based on: Yang J, Carena M, and Uphaus J. Area under the dry down curve (AUDDC): a method to evaluate the dry down rate in maize [J]. Crop Sci., 2010, 50(6): 2347-2354.
[0065] Figure 16 Kernel moisture content in ethylene-treated materials. A: F1 cells of SK and KN5585 treated with ethylene; B: F1 cells of SK and Zheng58 treated with ethylene; C: KN5585 treated with ethylene. Pre-tre: before treatment; Post-tre: after treatment; Control: equal amount of water treatment; Ethylene: ethylene treatment; NS: no significant difference; *: degree of significant difference.
[0066] Figure 17 PCR verification of ZmRPG gene expression in grains. *: P < 0.05, NS.: not significantly different.
[0067] Figure 18 shows the dry weight, fresh weight and moisture content of kernels in near-isogenic lines (NILs). MC: kernel moisture content; FW: fresh weight; DW: dry weight.
[0068] Figure 19: Expression of the ZmRPG, ZmEIL1, and ZmEIL3 genes in different tissues at different maize developmental stages. From top to bottom, the expression of the ZmRPG, ZmEIL1, and ZmEIL3 genes is shown. The horizontal axis represents different tissues, and the vertical axis represents expression levels.
[0069] Figure 20. Expression patterns of ZmMYBST1, ZmMYBR43, and RPG genes in maize tissues at different growth stages. The horizontal axis represents different tissue samples, and the vertical axis represents expression levels.
[0070] Figure 21 Schematic diagram of the effector and reporter structures in LUC experiments.
[0071] Figure 22 Inhibitory effect of ZmMYBST1 or ZmMYBR43 on the LUC reporter gene.
[0072] Figure 23 Desiccation rate of maize kernels in ZmMYBST1 and ZmMYBR43 knockout lines. KO1, KO2, and KO3 represent different knockout lines. WT: receptor control; n: number of samples. Kernel moisture content was measured using the AUDDC (water content variation index); the evaluation method is based on: Yang J, Carena M, and Uphaus J. Area under the dry down curve (AUDDC): a method to evaluate the dry down rate in maize [J]. Crop Sci., 2010, 50(6): 2347-2354.
[0073] Figure 24. Kernel moisture content at harvest in ZmMYBST1 and ZmMYBR43 knockout lines. KO1, KO2, and KO3 represent different knockout lines. WT: recipient control; n: number of samples.
[0074] Figure 25 Fine mapping and cloning of qKDR1. A: Preliminary QTL linkage analysis results (curves of different colors represent different degrees of AUDDC index in BLUP); B: Chromosome location of the qKDR1 segment; C: Fine mapping of qKDR1, phenotype is the AUDDC value between two water measurements; D: NIL DAN340 Relative NIL K22 Insertion 6181bp.
[0075] Figure 26 qKDR1 segment association analysis. Arrows indicate Indel6181, Indel50, and Indel234 markers, and the horizontal line indicates the threshold (P=0.01).
[0076] Figure 27 shows haplotype analysis of the KDR1 region. Genotypes with different dehydration rates were screened using a combination of markers: Indel6181, Indel50, and Indel234. Hap1 to Hap5 represent different haplotypes.
[0077] Figure 28. Editing qKDR1 alters the desiccation rate of maize kernels. A: Target location and sequence of qKDR1 editing in maize inbred line B104; B: Target location and sequence of qKDR1 editing in maize inbred line Zheng 58; C: Phenotypic results from a pilot site in Beijing; D: Phenotypic results from a pilot site in Jilin. Z58-KO1 and B104-KO2 represent knockout lines, while Z58-WT1 and B104-WT2 represent wild-type lines. Light font indicates the target sequence.
[0078] Figure 29. Activity testing of different qKDR1 fragments. A: Schematic diagram of the positions and sizes of the fragments; B: Schematic diagram of the GUS reporter gene expression cassette; C: GUS activity; different letters indicate significant differences.
[0079] Figure 30 Regulatory network of the molecular elements of the present invention.
[0080] Figure 31 shows the egg production of wild-type Caenorhabditis elegans (treated or not with micropeptide) on day 4 (day 1, day 2, day 3, day 4) after becoming adults.
[0081] Figure 32 shows the total egg production of wild-type Caenorhabditis elegans (treated or not with micropeptide) 4 days after becoming adults.
[0082] Figure 33: A 293 cell aging model was constructed using hydrogen peroxide, and ROS reactive oxygen species were photographed and detected after treatment with microRPG1 micropeptide.
[0083] Figure 34 uses hydrogen peroxide to construct a 293 cell aging model, and the ROS signal intensity is detected by flow cytometry after treatment with microRPG1 micropeptide and random sequence small peptide.
[0084] Figure 35. Cells were first treated with microRPG1 micropeptide, random sequence small peptides and positive control NAC (acetylcysteine) at a concentration of 50 μM for 24 hours, and then a 293 cell aging model was constructed using hydrogen peroxide. Finally, the ROS signal intensity was detected by flow cytometry.
[0085] Detailed Description of the Invention
[0086] The present invention first identified a gene, ZmRPG, that controls the moisture content and dehydration rate of maize kernels through various genetic and molecular biological methods. It also identified the micropeptide microRPG1 encoded by the ZmRPG gene and a similar micropeptide found in zea mays. The ZmRPG gene or microRPG1 micropeptide can be used to breed maize varieties with varying moisture content and dehydration rates as needed. The present invention provides the following technical solutions in its first aspect:
[0087] The present invention provides a micropeptide, the amino acid sequence of the micropeptide is shown in SEQ ID NO.4 or any one of SEQ ID NO.11 to SEQ ID NO.18.
[0088] The present invention also provides a preparation, wherein the micropeptide is dissolved in a specific reagent at a concentration of 1 μM to 50 μM; in some embodiments, the above-mentioned reagent includes: water, bacterial liquid, cell culture fluid, plant culture medium, and physiological saline.
[0089] The present invention also provides uses of the above-mentioned micropeptide or preparation, which include any of the following:
[0090] 1) Regulate the water content of plant seeds; 2) Delay fruit ripening; 3) Delay aging; 4) Prolong lifespan; 5) Reduce the generation of reactive oxygen species.
[0091] The present invention also provides an application of a nucleic acid molecule in improving the moisture content or dehydration rate of corn kernels, wherein the nucleotide sequence or reverse complementary sequence of the nucleic acid is shown in any one of SEQ ID NO.1 to SEQ ID NO.3.
[0092] The present invention also provides a method for reducing the moisture content of corn kernels or increasing the dehydration rate, which inhibits the expression and / or activity of a micropeptide with a sequence shown in SEQ ID NO.4 or a nucleic acid molecule with a sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.3 in corn, and selects corn plants with reduced moisture content or increased dehydration rate.
[0093] In some embodiments, the method of inhibiting the expression and / or activity of a protein or nucleic acid molecule comprises gene editing or RNA interference.
[0094] In some embodiments, the target DNA sequence for gene editing is shown as SEQ ID NO.5.
[0095] The present invention also provides a kit for reducing the moisture content of corn kernels or increasing the dehydration rate, comprising any one of the following:
[0096] (1) an RNA molecule capable of recognizing the target sequence; in some embodiments, the sequence of the RNA molecule is as shown in SEQ ID NO. 6;
[0097] (2) a DNA molecule encoding the RNA described in (1);
[0098] (3) A vector for expressing the RNA described in (1).
[0099] The present invention also provides a mutant gene, the nucleic acid sequence of the mutant gene is shown in any one of SEQ ID NO.7 to SEQ ID NO.9.
[0100] The present invention also provides a method for increasing the moisture content of corn kernels or reducing the dehydration rate, wherein the expression and / or activity of a micropeptide having a sequence shown in SEQ ID NO. 4 or a nucleic acid molecule having a sequence shown in any one of SEQ ID NO. 1 to SEQ ID NO. 3 that inhibits corn is increased in the corn material to be improved, and plants having increased moisture content in corn kernels or reduced dehydration rate are selected.
[0101] In some embodiments, the method for increasing expression is to use a high-activity promoter to drive expression of the nucleic acid molecule.
[0102] In some embodiments, the high-activity promoter is a maize ubiquitin promoter.
[0103] In some embodiments, the maize ubiquitin promoter sequence is shown as SEQ ID NO.10.
[0104] The present invention also provides the use of the above method, kit, mutant gene and method in improving the moisture content or dehydration rate traits of corn kernels.
[0105] The present invention further discovered that the expression levels of the ZmEIL1 and ZmEIL3 genes in corn are inhibited by the microRPG1 micropeptide, thereby providing the following second technical solution:
[0106] The present invention provides an application of a corn gene in improving the moisture content or dehydration rate of corn kernels, wherein the LOC number of the corn gene in the B73 reference genome is Zm00001d047563 or Zm00001d028974;
[0107] In some embodiments, the nucleotide sequence of the corn gene is shown as SEQ ID NO. 19 or SEQ ID NO. 20.
[0108] The present invention also provides a method for reducing the moisture content of corn kernels or increasing the dehydration rate, wherein ethylene is used to treat the corn kernels in the late stage of corn kernel development.
[0109] The present invention also provides a method for increasing the moisture content of corn kernels or reducing the dehydration rate, which comprises inhibiting the above-mentioned gene in corn and selecting corn plants with increased moisture content of corn kernels or reduced dehydration rate;
[0110] In some embodiments, the target sequence for gene editing is shown as any one of TCGCCTGGTTCGCCAGTCCA (SEQ ID NO. 102), CGCAGTGACTACAGCTACGG (SEQ ID NO. 103), GAGCTGCAGGACACCACACT (SEQ ID NO. 104), and CCCTACAAGAAGCCCCATGA (SEQ ID NO. 105);
[0111] In some embodiments, the above-mentioned methods of inhibiting gene expression and / or activity include gene editing or RNA interference.
[0112] The present invention also provides a kit for increasing the moisture content of corn kernels or reducing the dehydration rate, comprising a Cas9 protein and any of the following RNA molecules:
[0113] (1) an RNA molecule capable of recognizing the target sequence; optionally, the sequence of the RNA molecule is shown in any one of SEQ ID NOs. 21 to 24;
[0114] (2) a DNA molecule encoding the RNA described in (1);
[0115] (3) A vector for expressing the RNA described in (1).
[0116] The present invention also provides a mutant gene, the nucleic acid sequence of the mutant gene is shown in any one of SEQ ID NO.25 to SEQ ID NO.29.
[0117] The present invention also provides a promoter, the nucleotide sequence of the promoter is shown in any one of SEQ ID NO.30 to SEQ ID NO.32.
[0118] The present invention also provides an expression cassette, which contains the above promoter.
[0119] The present invention also provides an expression vector comprising the above expression cassette.
[0120] The present invention also provides a host cell, which contains the above expression vector.
[0121] In some embodiments, the host cell is a prokaryotic cell or a non-renewable plant cell.
[0122] In some embodiments, the prokaryotic cell is an Escherichia coli or Agrobacterium cell.
[0123] The present invention also provides an application of the above method, kit, mutant gene, promoter, expression cassette, expression vector and host cell in improving the moisture content or dehydration rate trait of corn kernels.
[0124] The present invention obtains the genes ZmMYBST1 and ZmMYBR43 that control the dehydration rate and moisture content of corn kernels by analyzing and screening transcription factors bound to the qKDR1 segment, and further discloses a method for manipulating ZmMYBST1 and ZmMYBR43 using genetic engineering means to change the moisture content or dehydration rate of corn kernels.
[0125] The third aspect of the present invention provides:
[0126] The present invention provides an application of a corn gene in improving the moisture content or dehydration rate of corn kernels, wherein the LOC number of the corn gene in the B73 reference genome is Zm00001d000184 or Zm00001d029875;
[0127] In some embodiments, the nucleotide sequence of the corn gene is shown in any one of SEQ ID NO. 33 to SEQ ID NO. 36.
[0128] The present invention also provides a use of a protein in improving the moisture content or dehydration rate of corn kernels, wherein the amino acid sequence of the protein is shown in either SEQ ID NO.37 or SEQ ID NO.38.
[0129] The present invention also provides a method for increasing the moisture content of corn kernels or reducing the dehydration rate, which comprises inhibiting the expression of the above-mentioned gene in corn and / or knocking out the gene, and selecting corn plants with increased moisture content of corn kernels or reduced dehydration rate.
[0130] In some embodiments, the above-mentioned method of inhibiting gene expression and / or knocking out the gene comprises gene editing or RNA interference.
[0131] In some embodiments, the target sequences for the above-mentioned gene editing are shown as SEQ ID NO.39 and SEQ ID NO.40.
[0132] The present invention also provides a kit for increasing the moisture content of corn kernels or reducing the dehydration rate, comprising a Cas9 protein and any of the following RNA molecules:
[0133] (1) an RNA molecule capable of recognizing the target sequence; in some embodiments, the sequence of the RNA molecule is as shown in SEQ ID NO. 41 and SEQ ID NO. 42;
[0134] (2) a DNA molecule encoding the RNA described in (1);
[0135] (3) A vector for expressing the RNA described in (1).
[0136] The present invention also provides a mutant gene, the nucleic acid sequence of the mutant gene is shown in any one of SEQ ID NO.43 to SEQ ID NO.48.
[0137] The invention also located a major QTL controlling the moisture content and dehydration rate of corn kernels - qKDR1 - through map-based cloning, and identified 10 molecular markers within the segment. The qKDR1 segment and molecular markers can be used to screen for the moisture content or dehydration rate traits of corn kernels, and qKDR1 can also be manipulated by genetic engineering to change the moisture content or dehydration rate of corn kernels.
[0138] The fourth aspect of the present invention provides the following technical solutions:
[0139] The present invention provides an application of a corn genome segment in improving corn grain moisture content or dehydration rate traits, wherein the segment position corresponds to Chromosome 1: 20,007,756 to 20,009,147 of the B73 genome V4 version.
[0140] In some embodiments, the nucleotide sequence or reverse complementary sequence of the above fragment is shown as either SEQ ID NO.49 or SEQ ID NO.50.
[0141] The present invention also provides a molecular marker, which corresponds to position 67; or position 70; or position 473; or position 513; or position 597; or position 599; or position 605; or positions 722-779; or positions 729-778; or positions 1131-1377 of the sequence shown in SEQ ID NO.50.
[0142] The present invention also provides a method for identifying or assisting in identifying the moisture content or dehydration rate trait of corn kernels, comprising the following steps: (1) detecting the above-mentioned molecular marker in the test material; (2) if the test result shows that the above-mentioned marker is contained, the test material will exhibit the trait of low kernel moisture content or fast dehydration rate; if the test result shows that the above-mentioned marker is not contained, the test material will exhibit the trait of high kernel moisture content or slow dehydration rate.
[0143] The present invention also provides a method for cultivating corn materials with low grain moisture content or fast dehydration rate traits, wherein a nucleic acid molecule with the sequence shown in SEQ ID NO. 50 is introduced into the corn material to be improved, and the above-mentioned molecular marker in the test material is detected according to the above-mentioned method to screen materials containing the above-mentioned molecular marker.
[0144] The present invention also provides a method for increasing the moisture content of corn kernels or reducing the dehydration rate, which comprises deleting the genomic fragments corresponding to bases 501-1272 or 1049-1417 of SEQ ID NO. 50 in the corn material to be improved, and selecting plants with increased moisture content of corn kernels or reduced dehydration rate.
[0145] In some embodiments, the above-mentioned method of deleting fragments adopts gene editing methods.
[0146] In some embodiments, the target DNA sequences for the above-mentioned gene editing are shown as SEQ ID NO.51 and SEQ ID NO.52.
[0147] The present invention also provides a kit for increasing the moisture content of corn kernels or reducing the dehydration rate, comprising any one of the following:
[0148] (1) an RNA molecule capable of recognizing the target sequence; in some embodiments, the sequence of the RNA molecule is as shown in SEQ ID NO. 53 and SEQ ID NO. 54;
[0149] (2) a DNA molecule encoding the RNA described in (1);
[0150] (3) A vector for expressing the RNA described in (1).
[0151] The present invention also provides a mutant gene, characterized in that the nucleic acid sequence of the mutant gene is shown as SEQ ID NO.55 or SEQ ID NO.56.
[0152] The present invention also provides the use of the above molecular markers, methods, kits, and mutant genes in improving the moisture content or dehydration rate traits of corn kernels.
[0153] Definition of terms
[0154] The following definitions and methods are provided to better define this application and to guide those skilled in the art in practicing this application. Unless otherwise noted, terms are to be understood according to conventional usage by those skilled in the relevant art. All patent documents, academic papers, industry standards, and other publications cited herein are hereby incorporated by reference in their entirety.
[0155] As used herein, "corn" refers to any corn plant and includes all plant varieties that can be bred with corn, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino to carboxyl orientation. Amino acids can be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides can be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the terms "encoding" or "encoded" are used in the context of a specific nucleic acid to refer to a nucleic acid that contains the necessary information to direct the translation of the nucleotide sequence into a specific protein. Codons are used to represent information encoding proteins. As used herein, "full-length sequence" relating to a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence with a natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid and, unless otherwise limited, can include known analogs of a naturally occurring amino acid that can function in a manner similar to the naturally occurring amino acids.
[0156] The term "trait" refers to a physiological, morphological, biochemical or physical characteristic of a plant or a specific plant material or cell. In some cases, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch or oil content of seeds or leaves, or by observing metabolic or physiological processes, for example, by measuring tolerance to water deprivation or specific salt or sugar or nitrogen concentrations, or by observing the expression level of one or more genes, or by agronomic observations such as osmotic stress tolerance or yield.
[0157] "Plant" includes reference to whole plants, plant organs, plant tissues, seeds, and plant cells, as well as their progeny. Plant cells include, but are not limited to, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. "Progeny" includes any subsequent generation of a plant.
[0158] In this application, the words "comprises," "comprising," or variations thereof are to be understood as including, in addition to the described elements, numbers, or steps, other elements, numbers, or steps. A "test plant" or "test plant cell" refers to a plant or plant cell in which a genetic modification has been effected, or a progeny of a plant or cell so modified that contains the modification. A "control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell.
[0159] Negative or control plants can include, for example: (a) wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically modified starting material that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but that have been transformed with an empty construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) plants or plant cells that are non-transformed segregants of the test plant or plant cell; (d) plants or plant cells that are genetically identical to the test plant or plant cell but that have not been exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the test plant or plant cell itself, which is under conditions where the gene of interest is not expressed.
[0160] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.
[0161] In some embodiments, the nucleotide sequences of the present application can be altered to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the present application can be substituted without changing the amino acid sequence according to the disclosed monocot codon preferences, for example, codons encoding the same amino acid sequence can be replaced with codons preferred by monocots without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, part of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode the amino acid sequence of one of the proteins of the embodiments due to the degeneracy of the genetic code. In some embodiments, part of the nucleotide sequence in the present application is replaced according to the monocot codon preference. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of the amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituents. Exemplary amino acid substitution groups with various aforementioned properties are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. The identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, which are present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment, or other oligonucleotides, and can be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling the synthetic oligonucleotides based on the embodiment sequence. The method for preparing hybridization probes and constructing cDNA and genomic libraries is generally known in the art. The hybridization of the sequence can be carried out under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means conditions under which, relative to hybridization with other sequences, the probe will hybridize to its target sequence to a greater extent (e.g., at least 2 times, 5 times, or 10 times the background) that can be detected.Stringent conditions are sequence-dependent and vary in different environments. By controlling hybridization stringency and / or controlling washing conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are those in which the salt concentration is less than about 1.5 M Na ions, typically about 0.01 M to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is: when used for short probes (e.g., 10 to 50 nucleotides), at least about 30°C; when used for long probes (e.g., greater than 50 nucleotides), at least about 60°C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate), and washing in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate) at 50°C to 55°C. Exemplary moderate stringency conditions include hybridization at 37°C in 40% to 45% formamide, 1.0M NaCl, 1% SDS, and washing in 0.5× to 1× SSC at 55°C to 60°C. Exemplary high stringency conditions include hybridization at 37°C in 50% formamide, 1M NaCl, 1% SDS, and a final wash in 0.1× SSC at 60°C to 65°C for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Duration of hybridization is typically less than about 24 hours, typically about 4 hours to about 12 hours. Specificity generally depends on post-hybridization washes, with the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L, where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "% formamide" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washes are typically performed at least until equilibrium is reached and low background levels of hybridization are achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mismatch should reduce the Tm by about 1°C; thus, the Tm, hybridization, and / or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≥90% identity are desired, the Tm can be reduced by 10°C.Generally, stringent conditions are selected to be about 5°C lower than the Tm of the specific sequence and its complement at a defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C below the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C below the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C below the Tm.
[0162] In some embodiments, fragments of nucleotide sequences and the amino acid sequences they encode are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. Fragments of nucleotide sequences can encode protein fragments that retain the biological activity of a native or corresponding full-length protein and thus have protein activity. Mutant proteins include biologically active fragments of native proteins that contain contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants that contain the nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector that contains the nucleotide sequence of at least one embodiment and a promoter that drives expression in plant cells operably linked thereto. Transformed plant cells and transgenic plants refer to plant cells or plants that contain heterologous polynucleotides in their genomes. Generally speaking, the heterologous polynucleotides are stably integrated in the genome of the transformed plant cells or transgenic plants so that the polynucleotides are passed on to future generations. The heterologous polynucleotides can be integrated into the genome individually or as part of an expression vector. In some embodiments, the plants involved in the present application include plant cells, plant protoplasts, plant cell tissue cultures that can regenerate plants, plant calli, plant masses and plant cells, which are complete plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, cobs, shells, stalks, roots, root tips, anthers, etc. The present application also includes plant cells, protoplasts, tissues, calli, embryos, flowers, stems, fruits, leaves and roots derived from the transgenic plants of the present application or their progeny, and thus at least partially comprising the nucleotide sequence of the present application.
[0163] The term "amplification" in the context of nucleic acid amplification is any process in which additional copies of a selected nucleic acid (or its transcribed form) are produced. Common amplification methods include various polymerase-based replication methods, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification (e.g., by transcription) methods.
[0164] An allele is "associated with a trait" when the allele is linked to the trait and when the presence of the allele is an indicator that the desired trait or form of the trait will occur in a plant containing the allele.
[0165] As used herein, the term "quantitative trait locus" or "QTL" refers to a polymorphic locus having at least one allele that is associated with differential expression of a phenotypic trait in at least one genetic background (e.g., in at least one breeding population or progeny). A QTL can function through a single gene mechanism or a multigene mechanism.
[0166] The term "QTL mapping" used herein refers to the use of a method similar to single gene mapping to locate QTL on a genetic map and determine the distance between the QTL and the genetic marker (expressed as the recombination rate). Depending on the number of markers, it can be divided into single marker, double marker and multi-marker methods. Depending on the statistical analysis method, it can be divided into variance and mean analysis, regression and correlation analysis, moment estimation and maximum likelihood method, etc. According to the number of marker intervals, it can be divided into zero interval mapping, single interval mapping and multiple interval mapping. In addition, there are comprehensive analysis methods that combine different methods, such as QTL composite interval mapping (CIM), multiple interval mapping (MIM), multi-QTL mapping, multi-trait mapping (MTM), etc.
[0167] The term "molecular marker" used herein refers to a specific DNA fragment that can reflect certain differences in the genome between biological individuals or populations.
[0168] The term "major gene" as used herein refers to a single gene that determines a trait. The term "minor gene" as used herein refers to a gene in which several non-allelic genes each have only a partial effect on the phenotype of the same trait. Such genes are called additive genes or polygenes. In additive genes, each gene has only a small phenotypic effect, so they are also called minor genes.
[0169] The term "inbred line" used in this article refers to a line with more uniform agronomic traits and a simpler genetic basis obtained by continuously eliminating poor ear rows and selecting individual plants with better agronomic traits for self-pollination over several generations under artificially controlled self-pollination.
[0170] As used herein, the term "backcrossing" refers to a process in which a progeny line is crossed with either of two parents.
[0171] As used herein, the term "cross" or "hybridized" refers to the fusion of gametes (e.g., cells, seeds, or plants) through pollination to produce progeny. The term includes sexual crossing (one plant being pollinated by another plant) and selfing (self-pollination, e.g., when the pollen and ovules are from the same plant). The term "cross" refers to the act of fusing gametes through pollination to produce progeny.
[0172] As used herein, the term "backcross" refers to a process in which hybrid progeny are repeatedly backcrossed to one of the parents. In a backcross protocol, the "donor" parent refers to the parent plant that has the desired gene or locus to be introgressed. The "recipient" parent (used once or multiple times) or the "recurrent" parent (used twice or multiple times) refers to the parent plant into which the gene or locus is introgressed. The initial cross produces the F1 generation; then, the term "BC1" refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on.
[0173] The term "genotype" is the genetic makeup of an individual (or group of individuals) at one or more loci, which is contrasted with observable traits (phenotypes). Genotype is defined by the alleles of one or more known loci that the individual has inherited from their parents. The term genotype can be used to refer to the genetic makeup of an individual at a single locus, the genetic makeup at multiple loci, or more generally, the term genotype can be used to refer to the genetic makeup of all genes in an individual's genome.
[0174] "Geroplasm" refers to the genetic material of or derived from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety, or family), or a clone of a line, variety, species, or culture. Germplasm can be part of an organism or cell, or can be isolated from an organism or cell. Germplasm generally provides the genetic material and specific molecular makeup that provides the physical basis for some or all of the heritable traits of an organism or cell culture. As used herein, germplasm includes cells, seeds, or tissues from which new plants can be grown, or plant parts such as leaves, stems, pollen, or cells that can be cultured into whole plants.
[0175] A "recombinant expression vector" comprises a polynucleotide encoding a micropeptide as described above, operably linked to a control sequence capable of directing expression of the micropeptide in a suitable host. The control sequence may be derived from the host organism or from another organism. The expression vector may also contain a marker gene for selecting transformants, or the selectable marker may be introduced into the host by co-transformation in another vector construct.
[0176] "Construct" refers to a host cell comprising a gene encoding a micropeptide or the recombinant expression vector, wherein the host cell is a bacterium, fungus, plant cell or animal cell.
[0177] As used herein, the term "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a certain position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (for example, a certain position in each of the two DNA molecules is occupied by adenine, or a certain position in each of the two polypeptides is occupied by lysine), then each molecule is identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if 6 out of 10 positions of the two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT have a total of 50% identity (3 out of a total of 6 positions match). Typically, two sequences are compared when aligned to produce maximum identity. Such an alignment can be performed, for example, by a computer program such as the Align program (DNAstar, Inc.). The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4: 11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
[0178] The micropeptide provided by the present invention includes a micropeptide having a sequence identity of 90% or more, 95% or more, or 99% or more to SEQ ID NO. 4 or any one of SEQ ID NO. 11 to SEQ ID NO. 18.
[0179] In some aspects of the present invention, the micropeptide comprises a variant of an amino acid conservative replacement, and the term "conservative substitution" means an amino acid replacement that does not adversely affect or change the expected properties of the protein / polypeptide comprising the amino acid sequence. For example, conservative replacements can be introduced by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid replacements include replacements of amino acid residues with amino acid residues having similar side chains, such as replacements of residues physically or functionally similar to the corresponding amino acid residues (e.g., having similar size, shape, charge, chemical properties, including the ability to form covalent bonds or hydrogen bonds, etc.). Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, it is preferred to replace the corresponding amino acid residue with another amino acid residue from the same side chain family. Methods for identifying conservative amino acid substitutions are well known in the art.
[0180] As used herein, an "individual" or "subject" in need refers to a human or non-human animal, without being limited by any theory. The microRPG1 micropeptide provided by the present invention can significantly prolong the aging process of the individual, improve aging-related changes in appearance, improve the physical functions of aging individuals, prolong the lifespan of the individual, and prevent or treat aging-related diseases after being administered to the individual topically, orally or by injection.
[0181] In this article, aging-related diseases include aging-related cardiovascular diseases, neurodegenerative diseases, bone diseases, and chronic metabolic diseases. Aging-related cardiovascular diseases include hypertension and atherosclerosis; neurodegenerative diseases include Parkinson's disease and Alzheimer's disease; bone diseases include osteoporosis, osteoarthritis, and skeletal deformities; and chronic metabolic diseases include type II diabetes, non-alcoholic fatty liver disease, and liver fibrosis. Other aging symptoms include memory loss, cognitive decline, behavioral deterioration, age-related weight gain, decreased mitochondrial function, hair loss, loss of subcutaneous fat, and skin wrinkles.
[0182] As used herein, anti-aging treatments include, but are not limited to, treatments that prevent, ameliorate, or mitigate the effects of aging, reduce or delay the increase in biological age, or delay aging; treatment, prevention, amelioration, or mitigation of frailty or aging-related diseases and conditions or the effects of decline, slowing the progression of such decline, conditions, or diseases, extending health span or lifespan, restoring vitality, increasing stress or resilience, improving recovery rate or other enhancement after surgery, radiation therapy, illness, and / or any other stress, preventing and / or treating menopausal symptoms, restoring reproductive function, eliminating or reducing the spread of senescent cells, reducing all or multiple risk of death or all or multiple causes of death associated with at least one or at least two age-related diseases or conditions, or delaying such increased risk, or reducing the risk of developing a disease. Treatments that modulate at least one biomarker of aging to a younger state or slow its transition to an "old" state are also considered anti-aging treatments, including but not limited to biomarkers of aging that show visible signs of aging, such as wrinkles, gray hair, etc.
[0183] In this context, the non-human animals include companion animals, such as dogs or cats; in other embodiments, the non-human animals are experimental animals such as nematodes, fruit flies, mice or rats.
[0184] In this article, anti-aging includes delaying aging, prolonging life, and improving the manifestations of aging-related changes; maintaining homeostasis includes maintaining redox homeostasis, glucose and lipid homeostasis, and endocrine homeostasis.
[0185] As used herein, "topical application" refers to the pharmaceutical or cosmetic treatment of the skin, primarily understood as pharmaceutical (or dermatological) treatment of pathological skin conditions, whereas cosmetic treatment and / or prevention of undesirable oxidative damage to the skin primarily involves healthy skin. Without being bound by theory, the microRPG1 provided herein, at an effective dose, provides improvements in pathological skin conditions or protection of healthy skin by ameliorating oxidative stress.
[0186] In this article, improving and alleviating oxidative stress includes increasing the reserve of antioxidant factors and clearing oxidative substances in the body; antioxidant factors include superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-px); oxidative substances in the body include reactive oxygen species (ROS), superoxide anion O 2- , hydrogen peroxide H2O2 and hydroxyl radical OH - .
[0187] The micropeptides described herein can be formulated for topical, oral or injection administration. The micropeptides can be combined with one or more pharmaceutically acceptable carriers and / or excipients that are considered safe and effective and can be administered to individuals without causing undesirable biological side effects or unwanted interactions. A carrier is any component of a pharmaceutical formulation other than one or more active ingredients.
[0188] Suitable oral dosage forms herein include tablets, capsules, solutions, suspensions, syrups, and lozenges. Tablets can be prepared using compression or molding techniques known in the art. Gelatin or non-gelatin capsules can be prepared as hard or soft capsule shells that can encapsulate liquid, solid, and semisolid fill materials using techniques known in the art.
[0189] Suitable injection preparations herein, for example, can be solutions or suspensions. Suitable for preparing solid forms of solutions or suspensions after adding a reconstitution medium before injection; emulsions, such as water-in-oil (w / o) emulsions, oil-in-water (o / w) emulsions and their microemulsions, liposomes or emulsions. Carriers can be solvents or dispersion media comprising, for example, water, ethanol, one or more polyols (such as glycerol, propylene glycol and liquid polyethylene glycol), oils, such as vegetable oils (such as peanut oil, corn oil, sesame oil, etc.) and combinations thereof. For example, suitable fluidity can be maintained by using a coating such as lecithin, by maintaining the desired particle size and / or by using a surfactant in the case of dispersion. In many cases, it is preferred to include isotonic agents, such as sugar or sodium chloride.
[0190] Suitable cosmetic or dermatological preparations herein contain 0.000001% to 10% by weight, in particular 0.0001% to 3% by weight, and even more particularly 0.001% to 1% by weight of one or more micropeptides used according to the invention, relative to the total weight of the preparation. The cosmetic or dermatological preparations according to the invention can be in different forms. Thus, they can be solutions, anhydrous preparations, emulsions or microemulsions of the water-in-oil (W / O) type or oil-in-water (O / W) type, for example multiple emulsions of the water-in-oil-in-water (W / O / W) type, gels, solid sticks, ointments or aerosols. The micropeptides can also be added to aqueous systems or surfactant preparations for cleaning skin and hair.
[0191] The micropeptides of the present invention can also be formulated as compositions for animal foods, dietary supplements or human foods.
[0192] As used herein, "therapeutically effective" or "effective amount" means that the amount of the composition used is sufficient to ameliorate one or more causes or symptoms of a disease or condition. Such amelioration requires only a reduction or alteration, not necessarily elimination. As used herein, the terms "therapeutically effective amount," "therapeutic amount," and "pharmaceutically effective amount" are synonymous. One skilled in the art can readily determine an appropriate therapeutic amount.
[0193] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the invention. Modifications or substitutions to the methods, steps, or conditions of the present invention are intended to be within the scope of this application without departing from the spirit and substance of the invention. Unless otherwise specified, the examples are based on conventional experimental conditions, such as those described in Sambrook et al. (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or the conditions recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are conventional commercially available reagents, and the techniques used in the examples are conventional means familiar to those skilled in the art.
[0194] Example 1: microRPG1 micropeptide
[0195] Example 1.1 Identification of the QTL qKDR1 for maize kernel moisture content
[0196] A QTL for maize kernel dehydration rate was identified using 201 recombinant inbred line populations derived from hybrids between the maize inbred lines DAN340 and K22. The DAN340 / K22 recombinant inbred line populations were planted in a randomized block design at five locations in China: Hainan (Sanya; 109.19°E, 18.38°N) in 2013; and Hubei (Wuhan; 114.32°E, 30.58°N), Henan (Xinxiang; 113.81°E, 35.20°N), Liaoning (Shenyang; 123.47°E, 41.68°N), and Jilin (Gongzhuling; 124.83°E, 43.51°N) in 2014. Kernel moisture content was measured at five consecutive stages: 34, 40, 46, 52, and 58 days after pollination (dpa). The area under the moisture content curve (AUDDC) was calculated to measure kernel dehydration rate. The best linear unbiased prediction value (BLUP) was calculated using a mixed linear model to eliminate the influence of environmental effects. The BLUP value of each line was used as a phenotype for QTL positioning. Finally, a major QTL, qKDR1, was detected on the left arm of chromosome 1, which can explain 9.81% of the phenotypic variation. At the fine mapping stage of qKDR1, heterozygous individuals were planted to screen for new recombination events, flanking markers of the qKDR1 region were used to identify new recombinants, and new molecular markers were developed to determine the breakpoints of the identified recombinants. For new recombinants, the NIL of the progeny was analyzed using the Student's test. DAN340 and NIL K22 The dehydration rates of homozygous individuals were compared. By integrating the QTL mapping information from all recombinants, the QTL was narrowed down to a 1417 bp noncoding region (Figure 1). This region corresponds to Chromosome 1: 20,007,756-20,009,147 of the B73 V4 genome. The markers and sequences used for qKDR1 fine mapping are shown in Table 1.
[0197] Table 1 Sequences of markers used for fine mapping
[0198] Name_F and Name_R represent the forward and reverse primer names, respectively.
[0199] Because this segment is located in an intergenic region and is neither transcribed nor translated, it will affect the expression levels of other genes and thus affect the changes in grain moisture content.
[0200] Example 1.2 ZmRPG gene identification
[0201] The inventors further used two NIL materials (named R1 to R4, genotype information is shown in Figure 3A) that were separated and not separated in the target segment, selected grains in the late maturity stage, performed RNAseq analysis, and identified differentially expressed genes. After joint analysis of multiple sets of RNAseq data, a total of 17 differentially expressed genes were identified (Figure 2). Among them, R1 and R3 did not separate in the qKDR1 segment, and the differentially expressed genes they produced should not be the target genes; R2 and R4 separated in the qKDR1 segment, and the differentially expressed genes they produced should include genes regulated by qKDR1. Therefore, in this way, the differentially expressed gene ZmRPG was identified, which was located about 10kb downstream of qKDR1 (Figure 1). The qPCR method was further used to verify the expression level of ZmRPG in the R1 to R4 populations, and it was found that in the R2 and R4 populations, ZmRPG was expressed in NIL DAN340 The expression level in genotype materials was higher than that in NIL K22 This indicates that the qKDR1 fragment affects the expression of the ZmRPG gene (Figure 3). K22 than NIL DAN340 The higher the expression level of ZmRPG, the slower the grain dehydration rate; the lower the expression level, the faster the grain dehydration rate. DAN340 The full length of the ZmRPG gene in NIL is 2010 bp (SEQ ID NO.1). K22 The full length of the ZmRPG gene in is 2013 bp (SEQ ID NO. 2). The two sequences only have a few base mutations, but these base mutations will not affect the function of the gene.
[0202] The ZmRPG gene is located in Chromosome 1: 20,019, 106-20,021, 118 in the B73 V4 genome, with a total length of 2013bp. The ZmRPG gene has not been annotated on the B73-V4.0 reference genome, but there is a transcription signal. The inventors further performed sRNA-seq and Ribo-seq on late-mature grains and found that there was no small RNA coverage in this segment. Combined with the ORF annotation of unknown sequences, it was found that ZmRPG can be annotated into 12 ORFs, all of which are small peptides of only dozens of amino acids (Figure 4), and it was found that the positions of ORF1, ORF2, and ORF3 were covered by Ribo-seq reads, indicating that they can be translated into proteins. Further analysis and verification in the associated population showed that only ORF1 (named microRPG1) was a small peptide protein that affects the dehydration rate of corn kernels. The nucleotide sequence encoding microRPG1 is 96 bp long (SEQ ID NO. 3), and the amino acid sequence is 31 amino acids long (SEQ ID NO. 4).
[0203] Example 1.3 Manipulation of ZmRPG to alter corn kernel dehydration rate
[0204] Because different ZmRPG expression levels can regulate different maize kernel dehydration rates, the inventors further attempted to overexpress ZmRPG (SEQ ID NO. 1 and SEQ ID NO. 2) in the maize inbred line B104 using the maize ubiquitin promoter to verify its effect, using the commonly used nos terminator. Two overexpression lines, RPG-OE1 and RPG-OE2, were generated. Compared to the wild-type control, both RPG-OE1 and RPG-OE2 exhibited slower dehydration rates (Figure 5), indicating that increasing ZmRPG expression can reduce the dehydration rate of maize kernels.
[0205] A similar approach was used to overexpress microRPG1 in the maize inbred line B104 (using the same promoter and terminator as in the previous paragraph), generating two overexpression lines, ORF1-OE1 and ORF1-OE2. Compared to the wild-type control, ORF1-OE1 and ORF1-OE2 also exhibited slower dehydration rates (Figure 6), indicating that increasing microRPG1 expression can also reduce the dehydration rate of maize kernels.
[0206] This invention further uses CRISPR-Cas9 technology to knock out microRPG1 in the maize inbred line B104. The designed target sequence is shown in SEQ ID NO. 5, and the gRNA sequence that recognizes the target is shown in SEQ ID NO. 6. For the remaining maize gene editing procedures, please refer to Example 2 of CN112646013A.
[0207] After gene editing, three mutant types were generated: KO-1bp (SEQ ID NO. 7), KO-2bp (SEQ ID NO. 8), and KO-4bp (SEQ ID NO. 9). Compared with the wild type, KO-1bp, KO-2bp, and KO-4bp knockouts all exhibited faster dehydration rates (Figure 7), indicating that knocking out microRPG1 can increase the dehydration rate of maize kernels.
[0208] Example 1.4 Effects of microRPG1 micropeptide in other plant species
[0209] To further investigate the function of microRPG1, microRPG1 (designated ORF1p) was chemically synthesized based on the amino acid sequence of the micropeptide (SEQ ID NO. 4). A 2 μM aqueous solution was prepared and applied to the model plant Arabidopsis thaliana by spraying in vitro or directly incorporating it into the soil. Treatments were performed at the onset of silique maturation and when 50% of siliques were mature. A randomized sequence peptide (designated scORF1p) with the same amino acid composition as the microRPG1 micropeptide was used as a control peptide. The results showed that ORF1p delayed silique maturation (but did not affect flowering time) and significantly increased seed water content, regardless of whether treatment was initiated or when 50% of siliques were mature. However, treatment with scORF1p and water did not affect silique maturation or water content (Figure 8).
[0210] The present invention also set up a concentration gradient experiment (from 0.01 μM to 2 μM) to test the effect of ORF1p on Arabidopsis silique ripening. The treatment method is similar to the previous paragraph. The results showed that 1 μM and 2 μM ORF1p micropeptide can delay Arabidopsis silique ripening (Figure 9).
[0211] In addition, the present invention further synthesized a fluorescently labeled microRPG1 micropeptide (named FAM-ORF1p). FAM-ORF1p was applied to Arabidopsis thaliana in vitro at a concentration of 2 μM. Observation under a fluorescence microscope revealed that FAM-ORF1p could be absorbed by Arabidopsis roots and transported to the aboveground cotyledons (Figure 10). This suggests that the microRPG1 micropeptide can be absorbed by plant roots to affect plant growth and development and can enter plant cells.
[0212] These results suggest that microRPG1 can affect plant growth, development, and maturation across species. Therefore, manipulation of microRPG1 or in vitro application of microRPG1 can alter growth and development, particularly delaying maturation.
[0213] Example 1.5 Anti-aging effects of microRPG1 micropeptide in other species
[0214] The present invention further tests the anti-aging effects of microRPG1 micropeptide on other non-plant species.
[0215] The chemically synthesized micropeptide ORF1p was co-cultured with 293T cells (a human embryonic kidney cell-derived cell line) in cell culture medium at concentrations of 20 μM and 50 μM. Cell viability was measured using a CCK-8 assay (BCCK1000). ORF1p significantly increased 293T cell viability. The 293T cells were then treated with 200 μM H2O2 (hydrogen peroxide) and 50 μM ORF1p. The 293T cells were stimulated with 200 μM H2O2 for 4 hours and then cultured for an additional 24 hours to establish a cellular oxidative stress model. ORF1p was then added to the culture medium (final concentration of 50 μM) in the experimental group, while the control group received an equal amount of double-distilled water or nothing, and the cells were cultured for 24 hours. Reactive oxygen species (ROS) levels were then measured using a reactive oxygen species (ROS) detection kit. ORF1p was found to have the potential to reduce ROS production at the cellular level, alleviating oxidative stress, compared to the control group (Figure 11). This result indicates that microRPG1 micropeptide also has the function of delaying aging in human cells.
[0216] C. elegans shares approximately 60%-80% of its human homologous genes and contains at least 42% of human disease-related genes (Sugi et al., 2016). These advantages make C. elegans a widely used animal model for anti-aging research.
[0217] The model animal was further treated with ORF1p at a concentration of 50 μM, which was a hermaphroditic N2 wild-type Caenorhabditis elegans (C. elegans). A treatment group and a control group were set up, with 7 replicates in each group and 20 worms in each replicate. The treatment method was to thoroughly mix the Escherichia coli OP50 solution and the microRPG1 micropeptide and then apply it on the culture dish. The bacteria were shaken and repeated weekly to ensure the effectiveness of the microRPG1 micropeptide. The culture was cultured at 20°C for more than 40 days. Direct observation found that the intestinal granular matter aggregation of nematodes fed ORF1 appeared later than that of the control group (Figure 12, intestinal granular matter aggregation is an important indicator related to nematode aging). The investigation of nematode lifespan showed that the average lifespan of nematodes in the ORF1p-treated group was about 13.2% higher than that of nematodes in the control group (Figure 13).
[0218] The effect of ORF1p treatment on egg production in wild-type C. elegans was also studied. Egg production was counted over four days after adulthood (day 1, day 2, day 3, and day 4). The number of eggs laid was counted over a four-hour period, with both the number of eggs laid without and with ORF1p added. The results showed that the addition of ORF1 reduced egg production on day 1. Egg production increased slightly on days 2 and 3 (Figure 31), while there was no significant difference in the total egg production over the four days (Figure 32). These results indicate that the addition of ORF1 can delay egg laying in C. elegans, but the total egg production does not change, indirectly demonstrating that ORF1 delays aging in C. elegans.
[0219] Further, 100 μL of physiological saline (0.9%) containing 0.2 μg to 20 μg of ORF1p was intravenously injected into mice, and the performance of the mice after injection of the micropeptide was observed. It was found that ORF1p can also increase the lifespan of mice. In addition, 3 different concentrations (2 μM, 10 μM, 50 μM) of micropeptides were added to the culture medium to feed fruit flies, and it was found that micropeptides can also prolong the lifespan of fruit flies. The culture medium for feeding fruit flies contains the following ingredients: 66.825g corn flour, 9.18g soybean flour, 6g agar, 40g sucrose, 42.4g maltose, 25g yeast, 6.85mL propionic acid, 1g sodium benzoate, 0.25g methyl parahydroxybenzoate, and different amounts of micropeptides, and the final volume is 1L.
[0220] Example 1.6 Identification of microRPG1 homologous proteins in Z. macrophylla
[0221] The inventors searched for homologous sequences of microRPG1 micropeptides in zea through sequence alignment, and identified eight similar micropeptides (sequences shown in SEQ ID NOs. 11 to 18) in eight different wild zea species (Zea luxurians-RIL003, Zea nicaraguensis-PI615697, Zea diploperennis-Gigi, Zea diploperennis-Momo, Zea perennis, Zea mays subspecies huehuetenangensis-RIMHU001, Zea mays subspecies parviglumis, Zea mays subspecies mexicana-TIL25).
[0222] The inventors further synthesized homologous micropeptides found in teosinte and tested their functions according to the methods of Examples 4 and 5. They found that these eight micropeptides, like microRPG1 in corn, can also affect the moisture content of plant seeds and have the effect of delaying aging in animals and plants.
[0223] Example 1.7 Effect of microRPG1 micropeptide on cellular ROS production
[0224] A cell senescence model was induced using hydrogen peroxide (H2O2). Cells were seeded at a density of 70%-80% in a 6-well plate. After attachment, the cells were treated with hydrogen peroxide at a concentration of 200uM for 4 hours. The medium was then replaced and cultured for 24 hours to successfully establish the senescence model. Small peptides and random sequence small peptides were added at a concentration of 50uM, and a blank control group with an equal amount of dd water was set up. After 24 hours of co-culture, ROS reactive oxygen species (ROS) content was measured using the fluorescent probe DCFH-DA. Images were taken using an inverted fluorescence microscope and detected by flow cytometry.
[0225] The experimental results showed that microRPG1 micropeptide has the potential to reduce the production of reactive oxygen species in aging cells (Figures 33-35) and alleviate oxidative stress.
[0226] Therefore, these microRPG1 micropeptides can be developed into cosmetic raw materials, medicines, health products, plant nutrient solutions and other products, and used in areas such as increasing the water content of plant seeds and anti-aging.
[0227] Example 2: Promoter and ethylene signaling pathway genes controlling corn kernel dehydration
[0228] Example 2.1 MicroRPG1 micropeptide affects the expression of EIL gene
[0229] RNA-seq analysis of differentially expressed genes in response to microRPG1 micropeptide knockout, overexpression, and exogenous micropeptide application (2 μM concentration of chemically synthesized microRPG1, designated ORF1p) identified 505 differentially expressed genes. Among these 505 differentially expressed genes, screening for genes co-expressed with ZmRPG genes in the grain revealed 11 genes co-expressed with ZmRPG genes, with Zm00001d047563 having the highest expression level. Therefore, the microRPG1 micropeptide may regulate the expression of Zm00001d047563 (designated ZmEIL1). Zm00001d047563 is a key gene in the ethylene signaling pathway and has four homologous genes in maize. ZmEIL1 (Zm00001d047563) and ZmEIL3 (Zm00001d028974) are highly expressed in the grain. These two genes were selected for further analysis.
[0230] The nucleic acid sequences of ZmEIL1 and ZmEIL3 are shown in SEQ ID NO. 19 and SEQ ID NO. 20.
[0231] The inventors further analyzed the expression levels of ZmEIL1 and ZmEIL3 genes in corn materials with microRPG1 micropeptide knockout and overexpression, and found that the expression levels of ZmEIL1 and ZmEIL3 increased in the knockout materials and decreased in the overexpression materials ( Figure 14 ), indicating that the expression levels of ZmEIL1 and ZmEIL3 genes in corn are inhibited by microRPG1 micropeptide.
[0232] Example 2.2 Cloning of the corn kernel moisture content gene
[0233] Since the expression of the EIL gene is suppressed by the microRPG1 micropeptide, the inventors used the CRISPR-Cas9 tool to knock out the ZmEIL1 and ZmEIL3 genes in maize to clarify their specific functions. The target sequences for ZmEIL1 are TCGCCTGGTTCGCCAGTCCA (SEQ ID NO. 102) and CGCAGTGACTACAGCTACGG (SEQ ID NO. 103), and the gRNA sequences are SEQ ID NOs. 21 and 22. The target sequences for ZmEIL3 are GAGCTGCAGGACACCACACT (SEQ ID NO. 104) and CCCTACAAGAAGCCCCATGA (SEQ ID NO. 105), and the gRNA sequences are SEQ ID NOs. 23 and 24. The ZmEIL1-edited plants ZmEIL1-KO1 and ZmEIL1-KO2 were obtained, and their sequences are shown in SEQ ID NOs. 25 to 26, respectively; the ZmEIL3-edited plants ZmEIL3-KO1, ZmEIL3-KO2 and ZmEIL3-KO3 were obtained, and their sequences are shown in SEQ ID NOs. 27 to 29, respectively.
[0234] Investigation of the phenotypes of maize materials after ZmEIL1 and ZmEIL3 gene knockout showed that the dehydration rate of maize kernels was slowed down after ZmEIL1 and ZmEIL3 gene knockout (Figure 15), indicating that ZmEIL1 and ZmEIL3 control the dehydration rate of maize kernels. Knocking out ZmEIL1 and ZmEIL3 can slow down maize kernel dehydration.
[0235] Example 2.3 Effect of ethylene treatment on corn kernel dehydration
[0236] Because ZmEIL1 and ZmEIL3 are key genes in the ethylene signaling pathway, we further investigated the effects of kernel dehydration by exogenously applying ethylene to corn kernels. Specifically, 277 mM ethephon (5-10 mL per ear) was sprayed directly onto corn ears during late kernel development. Ethylene treatment accelerated kernel dehydration in all three corn samples (Figure 16).
[0237] Example 2.4 Identification of three kernel-specific expression promoters
[0238] In the process of studying the above three genes (ZmRPG, ZmEIL1, and ZmEIL3), the inventors found that they all have the characteristics of high expression in the kernels and specifically high expression in the late stage of kernel development. To further clarify their expression patterns, the inventors used qPCR experiments to detect the expression of genes in corn kernels from 5 to 45 days after pollination. It was found that the expression level of the ZmRPG gene began to express 35 days after pollination (Figure 17). To further study the effect of the ZmRPG gene on kernel development, the inventors took the corn near-isogenic line NIL from 15 days after pollination (15DAP) to 45 days after pollination (45DAP) to observe the expression of the genes. DAN340 and NIL K22 The fresh weight, dry weight and moisture content of the grains were analyzed. The results showed that at harvest (45DAP), NIL DAN340 and NIL K22 There was no difference in dry weight, but there was a significant difference in water content (Figure 18). Therefore, knocking out the microRPG1 micropeptide did not affect grain yield because the ZmRPG gene begins to express in the late stage of grain development, when the dry matter of the grain has already accumulated. Therefore, knocking out the microRPG1 micropeptide will not affect grain yield. This also shows that genes expressed in the late stage of grain development and capable of controlling the dehydration rate of corn kernels are more important for improving the dehydration rate. The ZmEIL1 and ZmEIL3 genes also have the characteristic of high expression in grains. The expression of the three genes in different developmental stages and tissues of corn is shown in Figure 19.
[0239] The properties of the ZmRPG, ZmEIL1, and ZmEIL3 genes allow their knockout to accelerate dehydration without affecting flowering time, agronomic traits, and yield-related traits. Therefore, using the promoters of these genes to drive the expression of other genes affecting dehydration during late grain development is crucial for improving dehydration rates. The inventors cloned and determined the promoter sequences of these three genes, which are shown in SEQ ID NOs. 30 to 32, respectively.
[0240] Example 3: Genes ZmMYBST1 and ZmMYBR43 that control corn kernel dehydration rate and kernel moisture content
[0241] Example 3.1 Screening of qKDR1-binding proteins
[0242] The inventors first analyzed the published chromatin immunoprecipitation sequencing data (see Tu X, Mejía-Guerra MK, Valdes Franco JA, et al. Reconstructing the maize leaf regulatory network using ChIP-seq data of 104 transcription factors. Nat Commun, 2020, 11: 5089) and found that 43 transcription factors can bind to the qKDR1 (see Example 4) fragment position. The expression levels of these transcription factors in B73 and in the knockout materials of another gene RPG regulated by the qKDR1 fragment (see Example 1 for details) were further analyzed, and a total of 26 genes with low or no expression in the grain were eliminated (Table 2). In-depth analysis of the remaining 17 genes in B73 tissues throughout their growth period revealed that the expression patterns of two genes, Zm00001d000184 and Zm00001d029875, in maize kernels, embryos, and endosperms were similar to those of RPGs (Figure 20). The inventors named Zm00001d000184 and Zm00001d029875 ZmMYBST1 and ZmMYBR43, respectively (genomic sequences are shown in SEQ ID NOs. 33 and 34, respectively), to further validate their functions.
[0243] Table 2 Transcription factors that may bind to qKDR1
[0244] KO-1 to KO-3 are the expression data of three times in RPG gene knockout materials, and KO-1 to KO-3 are the expression data of three times in wild-type B73 materials.
[0245] Example 3.2 Verification of the binding function of ZmMYBST1 and ZmMYBR43
[0246] The inventors designed a transient transcriptional activity assay based on the LUC (Firefly luciferase) system to verify the binding of ZmMYBST1 and ZmMYBR43 proteins to the qKDR1 fragment. Specifically:
[0247] The protein coding sequences of ZmMYBST1 and ZmMYBR43 driven by the CaMV 35S promoter (shown in SEQ ID NO.35 and SEQ ID NO.36, respectively) were used as effectors, and pRPG3D and pRPG3K with qKDR1 fragments were used as reporters. The structures of the effectors and reporters are shown in ( FIG21 ). The LUC promoter in the reporter used the promoter of the RPG gene (sequence shown in SEQ ID NO.30 of Example 2.4). ZmMYBST1 and ZmMYBR43 were co-expressed with pRPG3D or pRPG3K as experimental groups, and the control group without the coding gene was co-expressed with pRPG3D (with qKDR1 fragment). 3D fragment) or pRPG3K (containing qKDR1 3K fragment), qKDR1 3D fragment and qKDR1 3K The fragment sequence is shown in Example 4.2. Co-expression was performed separately as a control group. Protoplasts were extracted from etiolated seedling leaves of maize inbred line B73 and transformed with the plasmid. After transformation and culture, cellular proteins were extracted and LUC and REN signals were collected using the Dual-Luciferase Reporter Assay System (Promega, Cat. No. E1980) according to the protocol provided in the kit. Finally, the relative LUC activity, i.e., the LUC / REN value, was calculated.
[0248] The experimental results showed that compared with the control group, the experimental group co-expressing ZmMYBST1 or ZmMYBR43 led to a strong inhibition of the LUC activity of the reporter genes of the two reporters (Figure 22). This experimental result shows that both ZmMYBST1 and ZmMYBR43 transcription factors bind to the qKDR1 region and inhibit the expression of RPG genes.
[0249] Example 3.3 Gene knockout experiment
[0250] The inventors further used the CRISPR-Cas9 tool to knock out the ZmMYBST1 and ZmMYBR43 genes in corn to verify the extent of their effects on the dehydration traits of corn kernels.
[0251] Maize B104 was selected as the receptor, with the designed target sequences shown in SEQ ID NOs. 39 and 40, and the gRNA sequences that bind to the targets shown in SEQ ID NOs. 41 and 42. For the remaining maize gene editing procedures, please refer to Example 2 of CN112646013A.
[0252] The results showed that after knocking out the ZmMYBST1 and ZmMYBR43 genes using CRISPR-Cas9 technology, three strains were obtained (named KO1, KO2, and KO3). Field test results showed that the dehydration rate of corn kernels in KO1, KO2, and KO3 was significantly slowed down compared with the non-knockout recipient control plants (Figure 23). Further evaluation of the water content at harvest revealed that KO1 increased the water content by 1.78%, KO2 increased the water content by 1.05%, and KO3 increased the water content by 3.31% (Figure 24). These results indicate that the ZmMYBST1 and ZmMYBR43 genes and the proteins they encode have the effect of promoting the dehydration of corn kernels, and inhibiting or knocking out these two genes can reduce the dehydration rate of the kernels and increase the water content of the kernels.
[0253] Analysis of the edited ZmMYBST1 and ZmMYBR43 gene sequences in KO1, KO2, and KO3 revealed that the ZmMYBST1 and ZmMYBR43 genes in KO1 mutated to (SEQ ID NO. 43 and SEQ ID NO. 44), respectively; the ZmMYBST1 and ZmMYBR43 genes in KO2 mutated to (SEQ ID NO. 45 and SEQ ID NO. 46), respectively; and the ZmMYBST1 and ZmMYBR43 genes in KO3 mutated to (SEQ ID NO. 47 and SEQ ID NO. 48). Introducing these mutant genes into other maize varieties through backcrossing has been shown to improve kernel dehydration and moisture content, resulting in maize varieties with slower dehydration rates and higher moisture contents.
[0254] Example 4 QTL controlling the dehydration rate of maize kernels
[0255] Example 4.1 QTL identification for maize kernel moisture content
[0256] Through fine mapping over several seasons, the QTL was located in a 1417bp segment on maize chromosome 1, which corresponds to Chromosome 1: 20,007,756-20,009,147 of the B73 V4 genome. This segment is located in a non-coding region between genes and has no functional annotation. The sequence analysis results of this segment in the near-isogenic lines showed that NIL DAN340 7592 bp (as shown in SEQ ID NO.49), NIL K22 1417 bp (as shown in SEQ ID NO.50), NIL DAN340 than NIL K22 There is an additional 6181 bp insertion fragment between positions 722-779 of SEQ ID NO.50 (Figure 25). DAN340 In contrast, NILK22 The two NILs had a faster grain dehydration rate, but there was basically no difference in other agronomic traits (Table 3), indicating that qKDR1 controlled the dehydration rate without affecting yield and other agronomic traits. Further analysis of 399 population materials from different genetic backgrounds by sequencing and PCR detection methods revealed 9 loci significantly associated with the dehydration rate of grains, located at Chr1: 20007822 (N1), Chr1: 20007825 (N2), Chr1: 20008218 (N3), Chr1: 20008258 (N4), Chr1: 20008336 (N5), Chr1: 20008338 (N6), Chr1: 20008344 (N7), Chr1: 20008466-20008515 (Indel50), and Chr1: 20008872-20009107 (Indel234) ( Figure 26 ). The markers correspond to positions 67, 70, 473, 513, 597, 599, 605, 729-778, and 1131-1377 of the sequence shown in SEQ ID NO. 50, respectively.
[0257] Table 3 NIL DAN340 and NIL K22 Agronomic traits and yield-related traits
[0258] 18HN represents the phenotypic experiment conducted in Hainan in 2018; N represents the number of samples; and P values were evaluated using a two-tailed T-test.
[0259] Example 4.2 Cloning of the corn kernel moisture content gene
[0260] The above 10 trait-associated loci can be used as detection targets to assist in identifying or screening corn materials with different grain moisture contents or dehydration rates.
[0261] In this example, the sites located at Chr1: 20008493, Chr1: 20008878 (named Indel50, Indel234, respectively) and NIL DAN340 Compared to NIL K22 The inserted fragment (named Indel6181) was used as a screening marker to design a detection method.
[0262] The primer pair MCK57_3F: GTGGTGCATGCATTGTTCAT (SEQ ID NO. 101) and MCK57_R: GTCTACAGCCACGAACACGA (SEQ ID NO. 92) were designed to detect the Indel6181 marker. K22 The genotype was used as a reference. The 6181bp insertion band was used to screen for the genotype with slow dehydration, and the band without insertion was used to screen for the genotype with fast dehydration. The primer pair QDR1_F: TCACACGGGACAATCTGTAG (SEQ ID NO.106) and QDR1_R: AGGAAGCTTGTGCGAATTTG (SEQ ID NO.107) were designed to detect the Indel50 marker. K22 The genotype was used as a reference. The band with a 50 bp deletion (corresponding to bases 729-778 of the sequence shown in SEQ ID NO.50) was screened for the genotype with slow dehydration, and the band without deletion was screened for the genotype with fast dehydration. The primer pair MCK57_7F: CGCACTGCAGCTTCGTAGTC (SEQ ID NO.93) and MCK57_R: GTCTACAGCCACGAACACGA (SEQ ID NO.92) were designed to detect the Indel234 marker. K22The genotype was used as a reference, the 234 bp insertion band was used to screen the genotype with slow dehydration, and the band without insertion was used to screen the genotype with fast dehydration; Indel234 corresponds to the sequence of positions 1131-1377 of the sequence shown in SEQ ID NO.50 "GATATATATAGCCGCGCGCAATACGCACATGCATCATGCATGGGGGACAGGTTGCTCTTATGATCTATCGGCAAGCTGGAGATGCTAGCTGCTGCTGCGTCCATGCGTTGTTCTTCTTTAGCCGTCAGGCATGGACCTGACTGGAACCAACCGAATTCCTGAGTTTCTTCTCTTTTTTTCCCCCTCGCGTACCTGCGCTGCGCTGCGCAGGGCATGTGACGCAGCCACATCTCGAACTTAACGAGAG" (SEQ ID NO.57) Replace with the sequence "CATGGACCTGACTGGAAACCAACCGAATTCCTGAGTTTCTTCTCTTTTTTCCCCTCGCGTACGTACCTGCGCTGCGCAGGGCATGTGAGGCTACCCGCAGTGATATACGG TAAAGAAGACCGCCACCAATATAAGGCTAGGTATAGAGTAAAATTTTACTGCAGTGGAGTACTCTATAGGTAGCTGTAAACTTATGGGGGGCAAACAAAACGCTATTTACAGCGTCGATGCTTTTT "TACTCTATCAGTCCACACGTCCATGCAGCAGGTACGGTGCCGAGCGCCATCAGCCGGTGTGGCAGTAGGGGACAAAAAAAGATATATAATATATGTAGTGATTGATATAGAGTTGATGTATGGAGTAAATATGACTGCAGTAGATTATGATATAGGGTAGAGAATCTTGATGATGAGGATAGAATATTTCTTTTAGAGTAGAAATTTAGAGTAGAATGACTGCAGATAGCCTGACGCAGCCCAT" (SEQ ID NO.58, 234 bp more than the original sequence SEQ ID NO.57). The remaining 7 marker sites can also be used as screening markers based on the relevant sequences of the genes. The combination of Indel6181, Indel50, and Indel234 markers was used to screen genotypes with different dehydration rates, and the associated population was divided into 5 haplotypes, among which Hap1 and NIL K22Similar genotypes, dehydration fastest; Hap2 and NIL DAN340 The genotypes were similar and dehydrated more slowly; the Hap5 genotype dehydrated the slowest ( FIG. 27 ).
[0263] The specific molecular marker detection operation is a conventional step, for example, refer to the content of Example 3 of CN114989281A.
[0264] Example 4.3 Editing the qKDR1 segment to regulate grain dehydration rate
[0265] This study further investigated the efficacy of this approach by using CRISPR-Cas9 technology to knock out the qKDR1 region in maize inbred lines Zheng 58 and B104. The qKDR1 region in Zheng 58 and B104 shares the same genotype as K22 and DAN340, respectively. The designed target location and sequence are shown in Figure 28.
[0266] In this example, gene editing generated two mutants, Z58-KO1 and B104-KO2, in Zheng 58 and B104. Compared to wild-type plants, both Z58-KO1 and B104-KO2 knockout lines exhibited slower dehydration rates (Figure 28), demonstrating that manipulation of qKDR1 can alter the dehydration rate of maize kernels. Furthermore, knocking out qKDR1 only slightly affected individual agronomic traits (Table 4), while most other agronomic traits remained unaffected. Therefore, manipulation of qKDR1 can improve the dehydration rate of maize kernels and create maize germplasms with varying moisture content and dehydration rates.
[0267] Table 4 Agronomic and yield-related traits of qKDR1 knockout
[0268] 22BJ and 22JL represent phenotypic experiments conducted in Beijing in 2022 and Jilin in 2022, respectively; P values were evaluated by two-tailed T-test.
[0269] The present invention further uses a dual reporter gene vector to truncate qKDR1 into different fragments and connect them to the back of the GUS gene, wherein NIL DAN340 The fragment is qKDR1 2D and qKDR1 3D , NIL K22 The fragment is qKDR1 2K ,qKDR1 2K ,qKDR1 4K ,qKDR1 5K (Figure 29) After connecting to the vector, the expression level of the reporter gene was detected, and it was found that qKDR1 3D ,qKDR1 2K ,qKDR1 3K,qKDR1 4K ,qKDR1 5K Both can inhibit the expression of GUS gene (Figure 29), indicating that the core region of qKDR1 is the 5K , i.e., the 369 bp region located at positions 1049-1417 of SEQ ID NO. 50. Therefore, deleting the fragment between positions 1049-1417 can achieve the technical effect of reducing the dehydration rate and increasing the moisture content of the grain.
[0270] Based on the above embodiments, the interaction network of molecular elements controlling the dehydration rate and moisture content of corn kernels can be obtained as shown in FIG30 .
[0271] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
[0272] Sequence Listing
Claims
1. A micropeptide, characterized in that The amino acid sequence of the micropeptide is as shown in SEQ ID NO.4 or any one of SEQ ID NO.11 to SEQ ID NO.18, or a micropeptide having an amino acid sequence with more than 90% sequence identity with the above sequence.
2. A nucleotide sequence encoding the micropeptide according to claim 1.
3. A vector or construct for expressing the micropeptide according to claim 1, comprising an operably linked promoter and a nucleotide sequence encoding the micropeptide; preferably, the nucleotide sequence encoding the micropeptide is SEQ ID NO.
3.
4. A method for synthesizing the micropeptide according to claim 1, wherein the method is a chemical method or a biological method; the chemical method comprises the steps of liquid phase synthesis or solid phase synthesis, and the biological method comprises the following steps: 1) constructing a vector comprising an operably linked promoter and a nucleotide sequence encoding the micropeptide; 2) transfecting host cells and screening positive clones; 3) culturing the host cells and isolating the micropeptide product.
5. A preparation, characterized in that The preparation comprises the micropeptide according to claim 1 or the nucleotide encoding the micropeptide at a concentration of 1 μM to 50 μM; optionally, the preparation further comprises: water, bacterial liquid, cell culture fluid, plant culture medium, physiological saline, cosmetic excipients or pharmaceutical excipients.
6. An anti-aging method, comprising using the micropeptide according to claim 1 or a nucleotide encoding the micropeptide to prepare an anti-aging product, or a product related to the treatment of aging-related diseases, or an antioxidant product; preferably, the product includes a preparation, a probe, a reagent, a kit, a health product, a cosmetic, a medicine or a drug combination.
7. A method for delaying aging, extending lifespan, or reducing reactive oxygen species generation in an animal or human subject, the method comprising providing the micropeptide of claim 1 or a nucleotide encoding the micropeptide to the animal or human subject; preferably, providing the micropeptide topically, orally, or intravenously.
8. A method for regulating the moisture content of plant seeds or the dehydration rate of plant seeds or delaying fruit ripening, the method comprising overexpressing a nucleotide sequence encoding the micropeptide in a plant; or applying to the plant a reagent comprising the micropeptide according to claim 1 or a nucleotide encoding the micropeptide; preferably, the reagent further comprises water, bacterial solution, cell culture fluid, plant culture medium or physiological saline; preferably, the application comprises spraying in vitro or adding to the soil; preferably, the plant is a grass plant.
9. A method for cultivating corn materials having low kernel moisture content or fast dehydration rate traits, the method comprising the following steps: 1) Providing corn materials to be improved; 2) genetically modifying or hybridizing the material to be improved in step 1); Wherein step 2) is at least one step selected from the following steps: i) reducing the expression level of the micropeptide according to claim 1 in the material to be improved; ii) increasing the expression levels of the ZmEIL1 gene as shown in SEQ ID NO. 19 and the ZmEIL3 gene as shown in SEQ ID NO. 20 in the material to be improved; iii) increasing the expression levels of ZmMYBST1 and ZmMYBR43 transcription factors having amino acid sequences as shown in SEQ ID NO.35 or SEQ ID NO.36 in the material to be improved; preferably, the nucleotide coding sequences of the transcription factors are as shown in SEQ ID NO.33 to SEQ ID NO.34; iv) selecting corn materials exhibiting low kernel moisture content or fast dehydration rate traits based on at least one of the following molecular markers and hybridizing them with the material to be improved in step 1), wherein the molecular markers include: Inde16181: Based on the sequence shown in SEQ ID NO. 50, it contains a 6181 bp insertion between positions 722-779; Inde50: Based on the sequence shown in SEQ ID NO. 50, it contains a 50 bp deletion between positions 729-778; Inde234: Based on the sequence shown in SEQ ID NO. 50, it contains a 234 bp insertion between positions 1131-1377; Or based on the sequence shown in SEQ ID NO. 50, a SNP mutation is included at position 67; or position 70; or position 473; or position 513; or position 597; or position 599; or position 605.
10. The method according to claim 9, wherein in step i), the coding sequence of the micropeptide is knocked out by gene editing, or the expression of the micropeptide coding sequence is reduced by RNA interference. The method according to claim 9 , wherein the nucleotide sequence encoding the micropeptide is SEQ ID NO.
3.
12. The method according to claim 9, wherein the increasing expression in step ii) or iii) comprises gene overexpression or high-activity promoter expression.
13. The method of claim 9, further comprising step 3), selecting or selecting among progeny corn materials exhibiting low kernel moisture content or fast dehydration rate; preferably, the selection in step 3) is performed by detecting the molecular markers Inde1-234, Inde1-50, or Inde16181; preferably, the material with a fast dehydration rate is a haplotype that does not contain Inde1-234, Inde1-50, or Inde16181.
14. A method for cultivating corn material having high kernel moisture content or slow dehydration rate, the method comprising the steps of: 1) Providing corn materials to be improved; 2) genetically modifying or hybridizing the material of step 1; Wherein step 2) is selected from at least one of the following steps: i) increasing the expression level of the micropeptide according to claim 1 in the material to be improved; ii) reducing the expression levels of the ZmEIL1 gene as shown in SEQ ID NO. 19 and the ZmEIL3 gene as shown in SEQ ID NO. 20; iii) reducing the expression of ZmMYBST1 and ZmMYBR43 transcription factors having amino acid sequences as shown in SEQ ID NO.35 or SEQ ID NO.36; preferably, the nucleotide sequence encoding the transcription factors is as shown in SEQ ID NO.33 to SEQ ID NO.34; iv) deleting any fragment between positions 1049-1417 of the material to be improved based on SEQ ID NO. 50; v) selecting corn materials showing high kernel moisture content or slow dehydration rate based on at least one of the following molecular markers and hybridizing them with the materials to be improved in step 1), wherein the molecular markers include: Inde16181: Based on the sequence shown in SEQ ID NO. 50, positions 722-779 contain a 6181 bp insertion; Inde50: Based on the sequence shown in SEQ ID NO. 50, positions 729-778 contain a 50 bp deletion; Inde234: Based on the sequence shown in SEQ ID NO. 50, positions 1131-1377 contain a 234 bp insertion; Or based on the sequence shown in SEQ ID NO. 50, position 67; or position 70; or position 473; or position 513; or position 597; or position 599; or position 605 contains a SNP mutation.
15. The method according to claim 14, wherein increasing expression in step i) comprises introducing an expression cassette, wherein the expression cassette comprises a promoter, a nucleotide sequence encoding the ZmRPG gene shown in SEQ ID NO. 1 or 2 or the micropeptide shown in SEQ ID NO. 3, and a terminator; preferably, the promoter is a high-activity promoter such as the maize ubiquitin promoter.
16. The method of claim 14, wherein the reducing expression in step ii) or iii) comprises gene editing or RNA interference.
17. The method of claim 14, wherein the deletion in step iv) is performed using a gene editing method.
18. The method of claim 14, further comprising step 3), selecting or selecting among progeny corn materials exhibiting high kernel moisture content or slow dehydration rate; preferably, the selection is performed by detecting the molecular marker; preferably, the material with a slow dehydration rate is a haplotype comprising Inde1-234 and Inde1-50, or a haplotype comprising Inde16181 instead of Inde1-234 and Inde1-50.
Citation Information
Patent Citations
Corn flowering period gene and application thereof
CN112646013A
Gene for controlling water content of Zea mays L. kernels, molecular marker, and application of gene and molecular marker
CN112521471A
Gene ZmEIN2-1 for controlling water content of corn kernels and molecular marker of gene ZmEIN2-1
CN114989281A
Grain development regulation gene m249, coding protein thereof, InDel1 marker, expression vector and application of gene m249 in grain character improvement
CN116515851A
Gene for controlling corn kernel dehydration rate and kernel water content and application thereof
CN118147205A