T-cell specific RNA constructs

Artificial RNA constructs with tailored UTRs enhance T-cell expression and functionality, addressing the limitations of current immunotherapies by improving T-cell therapies' efficacy in treating cancers and other conditions.

WO2025158437A1PCT designated stage Publication Date: 2025-07-31SHEBA IMPACT LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/IL2025/050081
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-24
Filing Date
2025-01-23
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

Current immunotherapeutic approaches, such as adoptive T-cell therapies, face challenges in effectively expressing genes of interest in T-cells due to dysfunctional or exhausted T-cells, leading to limited efficacy in treating solid tumors and other conditions like autoimmune diseases and viral infections.

Method used

Development of artificial RNA constructs, specifically mRNA constructs, with tailored 5' and 3' untranslated regions (UTRs) and a poly A tail, which allow for high and efficient expression of genes of interest in T-cells, enhancing T-cell properties and functions, and can be delivered safely and cost-effectively using methods like electroporation or lipid nanoparticles.

Benefits of technology

The mRNA constructs enable specific and robust expression of genes in T-cells, improving T-cell therapies by enhancing T-cell functionality, persistence, and reducing tonic signaling, thereby increasing the efficacy of treatments for cancers and other conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IL2025050081_31072025_PF_FP_ABST
    Figure IL2025050081_31072025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are artificial mRNA constructs (modRNA) for specific introduction and expression of gene of interest in T-cells. Further provided are uses of the transfected T-cells in various T-cell based cellular therapies.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] T-CELL SPECIFIC RNA CONSTRUCTS

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to artificial RNA constructs for enhanced and / or specific expression of gene of interest (GOI) in T-cells. Further provided are compositions including the same and uses of the T-cells in various T-cell based cellular therapies.

[0004] BACKGROUND OF THE INVENTION

[0005] Although exhibiting antitumor activity in some cancers, adoptive T-cell therapies (ACT) are still ineffective in most solid tumors. Improving the quality and properties of the T-cell product given to patients is highly important in developing new and more effective cell therapy approaches.

[0006] Immune checkpoint blockade therapy (ICB) has revolutionized both cancer therapy. However, as only a fraction of patients respond, adoptive cell therapy (ACT) with autologous tumorinfiltrating lymphocytes (TILs) is considered as a parallel approach and has proven clinical benefit. Other cell-based immunotherapy approaches such as T-cell receptor (TCR) and chimeric antigen receptor (CAR) engineered T-cells are also widely used in some hematologic cancers but show limited efficacy in solid tumors. One of the pitfalls in such treatments affecting the efficacy of cell therapies is the T-cell intrinsic properties of sternness. Such properties are not present in most cell therapy applications due to the origin of the cells (TIL) and repeated stimulation done to expand and transfect TCR and CAR products.

[0007] Dysfunctional or "exhausted" T cells are characterized by decreased proliferative potential, decreased effector cytokine production, and reduced cytotoxicity. Two subsets of TILs are distinguished: “stem-like” TILs, which possess certain naive-like or stem cell-like properties and can proliferate and differentiate into effector cells while maintaining a pool of daughter cells that carry the stem-like state, and "terminally exhausted" TILs which are hardwired epigenetically to be profoundly dysfunctional and cannot revert to their stem-like state.

[0008] In addition, the stem-like signature is heavily controlled epigenetically, as exhausted T cells display a stable epigenetic state following immunotherapy which blocks their ability to rejuvenate and retain a more effector state.

[0009] The metabolic state of TILs also plays a significant role in their antitumor efficacy, as naive T cells boost up their glycolysis, oxidative phosphorylation, and mitochondria biogenesis upon TCR activation. Excessive exposure to antigen yields altered metabolism and dysfunctional mitochondria when TILs become exhausted. mRNA is a gene delivery platform for vaccines, cell engineering, and regenerative medicine. As a gene transfer platform, mRNA offers several advantages over other methods such as DNA transfection and viral transduction. mRNA is considered safe due to the lack of target gene integration into the host genome and off-target effects. mRNA offers a highly flexible platform, allowing the delivery and high expression of genes simultaneously to drive cellular reprogramming, or serve as vaccine antigens for both infectious diseases and cancer. mRNA can rapidly drive high expression levels of selected genes. Nevertheless, such mRNA molecules, do not readily express in various types of cells, in particular in T-cells.

[0010] There is thus a need in the art for specific and robust expression of desired gene of interest(s) in T-cells, using specific RNA constructs, to thereby affect T-cells properties, in a cost effective, safe and efficient manner, wherein the T-cells introduced with the RNA constructs can be used for various T-cell based therapies.

[0011] SUMMARY OF THE INVENTION

[0012] According to some embodiments, there are provided herein advantageous artificial (non- naturally occurring) RNA constructs (in particular, mRNA constructs), facilitating an effective introduction and specific expression in T-cells, of one or more genes of interest encoded by said mRNA molecules. In some embodiments, the constructs disclosed herein include one or more 5’ untranslated region(s) (5’ UTR), coding region(s), 3’ untranslated region(s) (3’ UTR) and Poly A tail.

[0013] In some embodiments, the RNA constructs (also referred to herein as “RNA molecules” or “modRNA”) encode for a gene of interest (GOI), wherein upon introduction of the mRNA construct into the T-cells, the corresponding GOI can be expressed (as a protein or peptide) in the cells. In some embodiments, the expression of the GOI In the T-cells may affect the T-cell state, T-cell fate, T-cell function and / or any T-cell property.

[0014] In some embodiments, the RNA molecules have an advantageous backbone to allow high and efficient protein expression in T-cells. The T-cell- specific RNA molecules disclosed herein can allow specific and efficient expression of the RNA in the cells, allowing in-vivo delivery and cellspecific expression in T-cells. According to some embodiments, there is provided a T-cell tailored, mRNA expressing system to allow high and efficient mRNA expression in human T-cells.

[0015] In some embodiments, the modRNA-based T-cell engineering method disclosed herein is advantageous, as it safe, exhibiting low immuno toxicity, with no off / on target side effects; it is easily to deliver to target T-cells (for example, by electroporation or use of lipid nanoparticles (LNP)); cost and time effective; transient; does not rely on HLA restriction, can be specifically adjusted to specific T-cells (for example by adjusting the 5’UTR and / or 3’UTR sequences); and can allow expression of a plurality of genes in the target cells, by introducing a plurality of modRNA molecules to the cells.

[0016] In some embodiments, the modRNA-based T-cell engineering method disclosed herein is advantageous as it allows adjusting mRNA constructs of choice to specific T cells by including untranslated regulatory regions (UTRs), microRNA and SiRNA sites into the constructs, which are activated only within specific T cell or specific T-cell states. Using this method, genes of interest can be introduced efficiently and specifically into T cells for uses in various therapies.

[0017] According to some embodiments, as the majority of current immunotherapeutic approaches against cancer relies on the functionality of T cells, mRNA delivery of genes of interest (GOIs) into T cells can thus vastly improve T-cell based cellular therapies. For instance, melanoma patients receiving ACT after anti-PDl therapy do not respond well to treatment (thus, the patients are anti- PD1 refractory), and the success rates for ACT drop dramatically. The early treatment with anti-PDl or PDL1 antibodies selects patients less likely to have durable tumor regressions following TIL administration. The TIL infusion product given to such patients potentially includes exhausted cells and has limited antitumor activity. Thus, the method disclosed herein can provide enhanced TIL and T-cell products for solid cancers and checkpoint inhibitors refractory patients.

[0018] In further embodiments, the modRNA can be used for all T-cell based cellular therapies against cancer, including, for example, CAR-T cells, TCR-transduced cells, and as a complementary approach to CRISPR-CAS9 engineered T cells. In addition, this modRNA can also be used for other therapeutical needs other than cancer, such as autoimmune diseases (multiple sclerosis, colitis, and the like) or viral infections, by inducing T-cell reprogramming using specific modRNA molecules.

[0019] According to some embodiments, there is thus provided a non-naturally occurring modified RNA (modRNA) molecule for expressing a gene of interest (GOI) in a target T-cell, the modRNA molecule comprising: a 5’UTR nucleotide sequence configured to confer specificity of expression to the T-cell, a nucleotide sequence encoding for the GOI and a 3’ UTR nucleotide sequence. According to some embodiments, the modRNA may further include a CAP motif at a5’ end thereof, and a poly A sequence at a 3’ end thereof.

[0020] According to some embodiments, the modRNA may further include a Kozak sequence interposed between the 5’UTR and the sequence encoding for the GOI.

[0021] According to some embodiments, one or more nucleotides of the modRNA may include a modification.

[0022] According to some embodiments, the modification may include a pseudo-UTP.

[0023] According to some embodiments, the 5’UTR may be selected from a 5’UTR of gene selected from: TOX, GznB, PD1, TIGIT, LAG3, CD39, CD69, CD3e, CD3t, IL-2, TNFa, IFNy, TIM-3, or any combination thereof. Each possibility is a separate embodiment.

[0024] According to some embodiments, the 5’UTR may have or include a nucleotide sequences as denoted by any one of SEQ ID Nos: 1-13. Each possibility is a separate embodiment.

[0025] In some embodiments, the 5’UTR may have or include a nucleotide sequences as denoted by SEQ ID NO: 3.

[0026] According to some embodiments, the 3’UTR may be of a globin gene, such as, beta-globin gene.

[0027] According to some embodiments, the GOI may be an engineered T-cell receptor (TCR) or a chimeric antigen receptor (CAR).

[0028] According to some embodiments, the GOI is CD- 19 CAR.

[0029] According to some embodiments, the modRNA is an isolated molecule. In some embodiments, the modRNA is non-naturally occurring. In some embodiments, the 5’UTR is different from the endogenous 5’UTR of the GOI.

[0030] According to some embodiments, there is provided a composition comprising the modRNA as disclosed herein.

[0031] According to some embodiments, the introducing may be performed in-vivo (i.e., within a body of a subject) or in-vitro.

[0032] According to some embodiments, there is provided a vector which includes or encodes for the mRNA construct. According to some embodiments, the T-cell may be used in adoptive cell therapy (ACT).

[0033] According to some embodiments the T-cell may be a tumor infiltrating lymphocyte (TIL). In some embodiments, the T-cell is an engineered T-cell, such as, from CAR-T cell and TCR-T cell.

[0034] According to some embodiments, there is provided a host T-cell including, harboring or expressing the modRNA as disclosed herein.

[0035] According to some embodiments, there is provided a host T-cell introduced with the modRNA or the composition comprising the same.

[0036] According to some embodiments, the T-cell is for use in adoptive cell therapy.

[0037] According to some embodiments, the T-cell is for use in treating cancer in subject in need thereof.

[0038] According to some embodiments, there is provided a method of treating cancer in a subject in need thereof, the method includes introducing the T-cell or a combustion including the same, to the subject.

[0039] Further embodiments, features, advantages and the full scope of applicability of the present invention will become apparent from the detailed description and drawings given hereinafter. However, it should be understood that the detailed description, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0040] BRIEF DESCRIPTION OF THE FIGURES

[0041] Figs. 1A-E show schematic illustrations of exemplary mRNA constructs, according to some embodiments;

[0042] Fig. 2 shows a schematic illustration of identification and selection of specific mRNA constructs for T-cells, according to some embodiments;

[0043] Figs 3A-C show expression of gene of interest (GFP) in T-cells following electroporation with increasing amounts of a modRNA (having a globin 5’UTR), according to some embodiments. Fig. 3A- FACS analysis, Figs 3B and 3C- images of the transfected cells;

[0044] Fig. 4A show bar graphs of quantification of expression of gene of interest (GFP) in T- cells following electroporation with increasing amounts of various modRNAs, including the indicated 5’UTRs. The results are presented as percent change relative to a modRNA construct having alpha-globin 5’UTR.

[0045] Fig. 4B show line graphs of kinetics of GFP expression in T-cells introduced with the modRNAs.

[0046] Fig 5A show bar graphs of luminescence of gene of interest (luciferase) in blood derived T-cells following introduction with various modRNAs, including the indicated 5’UTRs. The results are presented as percent change relative to a modRNA construct having alpha-globin 5’UTR.

[0047] Fig 5B shows bar graphs of luminescence of gene of interest (luciferase) in Tumor infiltrating lymphocytes (TIL), following introduction with various modRNAs, including the indicated 5’UTRs. The results are presented as percent change relative to a modRNA construct having alpha-globin 5’UTR;

[0048] Figs 6A-C show graphs of luminescence of gene of interest (GFP (Figs. 6A-6B) or Luciferase (Fig. 6C)), in HEK 293 cells (non-T-cells), after introduction with increasing amounts of various modRNAs, including the indicated 5’UTRs. The results are presented as percent change relative to a modRNA construct having alpha-globin 5’UTR.

[0049] Figs. 7A-C show graphs of expression of CD19-CAR-T as measured by flow cytometry of T-cells electroporated with CD19-CART encoding mRNA constructs using the various indicated 5’-UTRs. Fig. 7A- histograms of CD19-CAR-T expression (as determined by FACS analysis); Fig. 7B show bar graphs of percentages of CAR+ cells; and Fig. 7C shows bar graphs of the normalized mean fluorescent intensity (MFI) under various constructs. It is noted that while the percentages of CAR+ cells are similar among various UTRs (Fig. 7B), the normalized mean fluorescent intensity (MFI) varies among constructs (Fig. 7C).

[0050] Figs. 8A-F show tonic signalling in T cells introduced (by electroporation) with CD 19- CAR-T encoding mRNA constructs using various 5 ’-UTRs. Figs. 8A-8B show bar graphs of exhaustion markers (41BB, TIM3, 0X40, PD1) as measured by flow cytometry, 24 and 48h post electroporation, relative to a modRNA construct having alpha-globin 5’UTR; Figs. 8C-8F show bar graphs of tonic cytokine release 24 hours post electroporation as measured by a Meso Scale Discovery machine (MSD). Fig. 8C- IFNy, Fig. 8D- IL6; Fig. 8E- Granozyme B; and Fig. 8F- Granozyme A.

[0051] DETAILED DESCRIPTION OF THE INVENTION

[0052] The principles, uses, and implementations of the teachings herein may be better understood with reference to the accompanying description and figures. Upon perusal of the description and figures present herein, one skilled in the art will be able to implement the teachings herein without undue effort or experimentation. In the figures, same reference numerals refer to same parts throughout.

[0053] Definitions

[0054] To facilitate an understanding of the present invention, a number of terms and phrases are defined below. It is to be understood that these terms and phrases are for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art.

[0055] As referred to herein, the terms "polynucleotide molecules", “oligonucleotide”, "polynucleotide", "nucleic acid" and "nucleotide" sequences may interchangeably be used. The terms are directed to polymers of deoxyribonucleotides (DNA), ribonucleotides (RNA), and modified forms thereof in the form of a separate fragment or as a component of a larger construct, linear or branched, single stranded (ss), double stranded (ds), triple stranded (ts), or hybrids thereof. The polynucleotides may be, for example, RNA. The RNA molecules may be, for example, messenger RNA (mRNA). The terms further include oligonucleotides composed of naturally occurring bases, sugars, and covalent inter nucleoside linkages, as well as oligonucleotides having non-naturally occurring portions (i.e., “modified”), which function similarly to respective naturally occurring portions.

[0056] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues.

[0057] The term gene of interest (GOI) relates to a protein or peptide encoded by an RNA molecule of the present disclosure, in particular, encoded by the coding region of the construct. The gene of interest may include any protein or peptide that is capable of being translated from the RNA construct, when introduced into a cell, such as, T-cell. In some embodiments, the GOI may be a reporter protein (such as, a fluorescent protein). The term "construct", as used herein refers to an artificially assembled or isolated nucleic acid molecule which may be comprised of one or more nucleic acid sequences, wherein the nucleic acid sequences may be coding sequences / coding region (that is, sequence which encodes for an end product (gene of interest)), regulatory sequences, such as, 5’ and 3’ UTRs. Poly A, and the like, or any combination thereof. The term construct includes, for example, a single strand nucleic acid molecule, but should not be seen as being limited thereto. The term construct can include, in some instances, vectors and plasmids.

[0058] The term “recombinant” is used herein to describe molecules (such as, for example, nucleic acid molecules or polypeptide molecules) which have been synthetically constructed or genetically engineered by any method or are derived from or expressed from a molecule which has been synthetically constructed or genetically engineered, and to cells including these molecules. This term also encompasses molecules which have a sequence identical to a natural sequence.

[0059] As used herein, the terms "introducing" and "transfection" may interchangeably be used and refer to the transfer of nucleic acids, polynucleotide molecules, such as, RNA molecules, and the like, into target T-cell(s), and more specifically into the interior of a membrane-enclosed space of the target T-cell(s). The molecules can be "introduced" into the target cell(s) by any means known to those of skill in the art, for example as taught by Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (2001), the contents of which are incorporated by reference herein. Means of "introducing" RNA molecules into a cell include, for example, but are not limited to: heat shock, calcium phosphate transfection, PEI transfection, electroporation, lipofection, transfection reagent(s), viral-mediated transfer, injection, and the like, or combinations thereof. The transfection of the cell may be performed on any type of T-cell, of any origin, such as, for example, human cells, animal cells, plant cells, and the like. The cells may be isolated cells, tissue cultured cells, cell lines, cells present within an organism body, and the like.

[0060] The terms "upstream" and "downstream", as used herein refers to a relative position in a nucleotide sequence. As well known, a nucleotide sequence has a 5' end and a 3' end, so called for the carbons on the ribose sugar ring of the nucleotide backbone. Hence, relative to the position on the nucleotide sequence, the term downstream relates to the region towards the 3' end of the sequence. The term upstream relates to the region towards the 5' end of the strand.

[0061] In some embodiments, there is provided herein an RNA nucleic acid molecule (also referred to as “modRNA”) capable of specifically expressing of a gene of interest in T-cells. In some embodiments, the RNA molecule is an mRNA molecule including one or more of the followings regions / sequences: a 5 ’-CAP region, a 5' untranslated region (5'-UTR), a Kozak sequences, a coding region (an open reading frame (ORF)), a 3' untranslated region (3'-UTR), a poly(A) sequence and / or a poly adenylation signal. In some embodiments, the mRNA may include any number of base pairs, one or more of which may be modified.

[0062] According to some embodiments, a 5' cap structure may include two nucleoside moi eties joined by a linker and may be selected from a naturally occurring cap, a non-naturally occurring cap or cap analog, an anti-reverse cap analog (ARCA), or any combination thereof. A cap may include one or more modified nucleosides and / or linker moieties. For example, a natural mRNA cap may include a guanine nucleotide and a guanine (G) nucleotide methylated at the 7-position joined by a triphosphate linkage at their 5' positions, (for example, m7G(5')ppp(5')G, m7GpppG). A cap may also be an anti-reverse cap analog. Exemplary CAP may include, but not limited to: m7GpppG, m7Gpppm7G, m73'dGpppG, m27’O3'GpppG, m27’O3'GppppG, m27’O2'GppppG, m7Gpppm7G, m73dGpppG, m27’O3'GpppG, m27,O3'GppppG, and m27,O2'GppppG. Each possibility is a separate embodiment. According to some embodiments, adding a CAP may be performed by co-transcriptional (e.g., ARCA or CleanCap) or post-transcriptional enzymatic capping.

[0063] In some embodiments, the 5’ UTR is specific for T-cells expression, and may dictate the extent, timing and / or type of gene to be expressed in a specific T-cell. In some embodiments, the 5’UTR may be selected from, but not limited to a 5’UTR obtained from the gene TOX, GznB, PD1, TIGIT, LAG3, CD39, CD69, CD3s, CD3r, IL-2, TNFa, IFNy (IFNG), TIM-3, or any combinations thereof. Each possibility is a separate embodiment. In some embodiments, the 5’UTR may be obtained from TIGIT. In some embodiments, the 5’UTR may be obtained from LAG3. In some embodiments, the 5’UTR may be obtained from TIGIT. In some embodiments, the 5’UTR may be obtained from IFNy.

[0064] In some embodiments, the 3 ’UTR may be specific for T-cells. In some embodiments, the 3 ’UTR may be similar or different between different RNA constructs. In some embodiments, the 3 ’UTR may be, for example, a 3 ’UTR of a globin gene, for example, hBa2.

[0065] In some embodiments, the poly A sequence may include entirely or mostly adenine nucleotides or analogs or derivatives thereof. In some embodiments, the PolyA (pA) sequence may include a stretch of adenines (A), for example, 2-500. In some embodiments, the pA tail may include a stretch of adenines, separated by one or more guanine (G) nucleotides. In some exemplary embodiments, the poly A tail may include two stretches of about 30-120 adenines, separated by 1-20 Guanines.

[0066] In some embodiments, the mRNA may include, separately, or as part of the 5’UTR, a Kozak sequence. In some embodiments, the Kozak sequence may be a Kozak sequence of the gene of interest. In some embodiments, the Kozak sequence may be a consensus Kozak sequence. In some embodiments, the Kozak sequence may be a Kozak sequence of a gene from which the 5’ UTR is derived. In some embodiments, Kozak sequences may increase the efficiency of translation of the RNA when introduced into the target cell.

[0067] In some embodiments, the RNA molecule may include one or more modifications. In some embodiments, the modification includes a nucleobase or nucleoside modification. In some embodiments, the modified nucleobase in a modified guanine. In some embodiments, the modified nucleobase is a modified cytosine. In some embodiments, the modified nucleobase is a modified adenine. In some embodiments, the modified nucleobase is a modified Uracil. In some embodiments, the modified uracil may include, for example, but not limited to: include pseudouridine (y), pyridin-4-one ribonucleoside, 5 -aza-uridine, 6-aza-uridine, 2-thio-5-aza- uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5 -halo -uridine (e.g., 5-iodo-uridineor 5-bromo- uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1- carboxymethyl-pseudouridine, 5 -carboxy hydroxymethyl-uridine (chm5U), 5- carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2- thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (ncm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(ncm5s2U), 1- taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, i.e., having the nucleobase deoxy thy mine), 1-methyl-pseudouridine 5-methyl-2-thio-uridine (m5s2U), l-methyl-4- thio-pseudouridine (m1pseudouridine4\| / ), 4-thio- 1-methyl-pseudouridine, 3-methyl- pseudouridine 2-thio- 1-methyl-pseudouridine, 1 -methyl- 1-deaza-pseudouridine, 2-thio-l- methyl-l-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5- methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy- uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp | / ), 5-(isopentenylaminomethyl)uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ym), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O- methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'- O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1- thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2- carbomethoxyvinyl) uridine, and 5-[3-(l-E-propenylamino)]uridine.

[0068] As used herein, the term "T cell" refers to any type of T cell, including cells expressing CD3 (CD3+), CD8 (CD8+), CD4 (CD4+), and / or other relevant T cells markers. According to some embodiments, the T lymphocyte or T-cell may include any type of T-cell, including, for example, Cytotoxic T-cells (CTL), Tumor infiltrating T-cells (TIL), CD8+ cells, CD4+ cells, CD3+ cells, and the like, or any combinations thereof. In some embodiments, the T-cell may be an engineered T-cell, such as a CAR-T cell.

[0069] As used herein the term “vector” refers to constructs engineered to deliver into, or encode or express in, a target cell the nucleic acid molecules of the invention. Vectors may include, e.g., viral and non- viral vectors, y-retroviral or lentiviral vectors. The term "Expression vector" refers to vectors that have the ability to incorporate and express heterologous nucleic acid fragments in a cell. In other words, an expression vector comprises nucleic acid sequences / fragments (such as DNA, mRNA, tRNA, rRNA), capable of being transcribed or expressed in a target cell. Many viral, prokaryotic and eukaryotic expression vectors are known and / or commercially available. Selection of appropriate expression vectors is within the knowledge of those having skill in the art. Vectors may include functional elements required for the desired function of the nucleic acid in the cells, including, for example, a promoter suitable for expression in the target cell, targeting elements, and replication sequences for replicating the vector.

[0070] In some embodiments, the vector is suitable for delivery of the nucleic acids of the invention into T cells, and optionally for expressing or aiding in expression of one or more gene(s) of interest in the T cells. According to some embodiments, the modRNA constructs disclosed herein may be prepared by any methods known in the art, such as, for example, In Vitro Transcription (IVT), Direct chemical synthesis using, for example, solid-phase oligonucleotide synthesis, Enzymatic ligation of shorter RNA oligonucleotides, self-cleaving ribozymes (such as hammerhead or HDV ribozymes), RNA editing enzymes (to modify precursor RNA to produce the modRNA or portions thereof), plasmid DNA (pDNA) or viral vectors to express the modRNA in host cells, cell-free expression system, and the like, or any combinations thereof.

[0071] Reference is now made to Figs. 1A-1E, which schematically illustrate exemplary RNA molecules, according to some embodiments. Fig. 1A illustrates a general scheme of an RNA molecule of the invention, including (from 5’ to 3’): a cap sequence at the 5’ end, a 5’UTR sequence, an optional Kozak sequence, a sequence encoding for a gene of interest (GOI), followed by a 3’ UTR sequence, and a polyA sequence. Fig. IB schematically illustrates a general mRNA molecule, having a 5’ ARCA CAP sequence, a 5’UTR sequence, followed by a coding region (i.e., sequence encoding for the gene of interest), a 3 ’UTR and a poly A tail (having, for example, 170 adenines). As shown in Fig. IB, at least some of the nucleotide of the mRNA may be modified (for example, by inclusion of pseudouridine-5'-triphosphate (pseudo-UTP)). Figs. 1C-1E illustrate structures of specific mRNA molecules, having a 5 ’CAP sequence, followed by the indicated specific 5’ UTR (TIGIT (Fig. 1C), IFNy (Fig. ID) and EAG3 (Fig. IE), followed by a consensus Kozak sequence, a region encoding for the gene of interest (“GOI”), and a 3 ’UTR (for example, of hBa2 gene), followed by a polyA tail comprised of two stretches of 60 adenines, separated by guanine residue.

[0072] Reference is now made to Fig. 2, which illustrates a schematic illustration of the identification and selection of specific mRNA constructs for T-cells, according to some embodiments. As shown in Fig. 2, T-cell specific 5’UTR and / or 3’UTR sequences are selected for the construction of modRNAs. Next, the selected UTRs are used to construct modRNA molecules encoding for a reporter GOI, such as GFP. The generated modRNA are introduced into T-cells and based on the expression of the reporter gene, modRNA backbone (template), i.e., those including the best combination of regulatory sequences (such as, 5’UTR, 3’UTR, CAP and / or pA sequence) are identified and used for expression of various other genes of interest.

[0073] According to some embodiments, the gene of interest may include any protein or peptide capable of affecting one or more properties of a T-cell. According to some embodiments, the GOI is not endogenously or naturally expressed in a T-cell. In some embodiments, the GOI is a naturally expressed protein.

[0074] In some embodiments, the GOI is a chimeric protein. In some embodiments, the GOI is an engineered protein. In some embodiments, the GOI is a TCR. In some embodiments, the TCR is an engineered TCR. In some embodiments, the GOI is a chimeric antigen receptor (CAR). In some embodiments, the GOI is a TCR or a CAR directed against a CD expressed or is a marker of cancer cells. In some exemplary embodiments, the GOI is CD- 19 CAR or TCR (i.e., a TCR or CAR directed against CD19). In some embodiments, the GOI may be a TCR or GOI directed against one or more of: CD19, CD22, CD20, CD28, 4-1BB (CD137), PD-1 (CD279) CTLA-4 (CD152), CD5, CD7, CD123, IL13Ra2, and the like. Each possibility is a separate embodiment.

[0075] In some embodiments, 5’UTR of the modRNA is different than the naturally occurring (endogenous) 5’UTR of the corresponding gene of interest.

[0076] In some embodiments, the modRNA may be introduced to T-cells, by any suitable method, including, for example, but not limited to: electroporation, viral vectors (such as, lentiviral vectors, retroviral vectors, Adeno viral vectors, Adeno-associated viral vectors) transfection agents (such as Lipofectamine), lipid nanoparticles (LNP), Polymeric Nanoparticles (including, for example, PEG and PLA), and the like, or any combinations thereof. Each possibility is a separate embodiment. In some embodiments, the introduction to the T-cells may be performed in-vitro. In some embodiments, the introduction to T-cells may be performed in-vivo or in-situ (for example, using targeted nanoparticles (LNPs or viral vectors)). .

[0077] In some embodiments, one or more different types of modRNA (i.e., each encoding for a different GOI) may be introduced to the T-cells, to provide a combined effect on the cells.

[0078] In some embodiments, the GOI encoding for T-cell(s) regulator(s) can be incorporated into T-cells (such as, for example, TILs, or any other type of T-cell) as single genes, a combination of genes, or in combination with a module (for example, up to four genes at a time).

[0079] In some embodiments, the modRNA may affect tonic signaling, for example, by reducing or diminishing such signaling. As used herein, tonic signaling refers to low-level, constitutive activation of T-cell receptor (TCR) or chimeric antigen receptor (CAR) signaling pathways, even in the absence of antigen engagement. Unlike full activation, tonic signaling does not result in immediate T-cell proliferation, effector function, or cytokine release but may influence T-cell survival, differentiation, and exhaustion. In CAR-T therapies, excessive tonic signaling can lead to exhaustion and loss of function. Accordingly, the modRNA disclosed herein can modulate tonic signaling, improve cancer immunotherapy, autoimmune treatments, and T-cell persistence in adoptive cell therapies.

[0080] In some embodiments, the modRNA molecules, may be used to construct a library of mRNA constructs encoding for key sternness, epigenetic, and metabolic regulators. According to some exemplary embodiments, the library may be constructed, inter alia, by RNA-seq analysis of differentially expressed genes between an in-house set of TILs derived from responder Vs. nonresponder ACT-treated patients.

[0081] According to some embodiments, there is provided a T-cell harboring or expressing a modRNA as disclosed herein. In some embodiments, there is provided a T-cell harboring or comprising the nucleic acid molecule of the invention (i.e. modRNA).

[0082] According to some embodiments, there is provided a composition (also referred to herein in some embodiments, as pharmaceutical composition) which includes the modRNA as disclosed herein. In some embodiments, the composition may include one or more suitable excipients, according to the purpose, type and / or use of the composition. In some embodiments, excipient is a pharmaceutical excipient which may include or a pharmaceutical carrier, vehicle, buffer and / or diluent.

[0083] In some embodiments, the composition disclosed herein may be used as a medicament for expressing a gene of interest in a T-cell and for affecting one or more properties of the T-cell.

[0084] In some embodiments, the modRNA or a composition including the same may be used for T-cell based cellular therapies against cancer or other conditions, such as, autoimmune diseases, infections, such as, viral infections, and the like.

[0085] In some embodiments, T-cell based therapies may include, for example, Chimeric Antigen Receptor T-Cell (CAR-T) therapy, TCR-T (T-Cell Receptor) therapy, Tumor-Infiltrating Lymphocyte (TIL) therapy, Regulatory T-Cell (Treg) therapy, y6 T-Cell therapy, and the like.

[0086] In some embodiments, the T-cells are autologous (patient-derived cells). In some embodiments, the T-cells are allogeneic (donor-derived cells). In some embodiments, the T-cells are fresh cells. In some embodiments, the T-cells are cryopreserved cells. In some embodiments, the T-cells are expanded in-vitro.

[0087] According to some embodiments, the T-cells harboring the modRNAs disclosed herein (or a composition including these T-cells) may be used for treating cancer in a subject in need thereof. In some embodiments, the GOI may be selected so as to affect the cancer.

[0088] In some embodiments, the cancer may include, for example, Hematologic Malignancies (such as Acute Lymphoblastic Leukemia (ALL), Chronic Lymphocytic Leukemia (CLL), Diffuse Large B-Cell Lymphoma (DLBCL), Hodgkin’s Lymphoma, Multiple Myeloma); Solid Tumors (such as, Melanoma, Non-Small Cell Lung Cancer (NSCLC), Sarcomas (e.g., Synovial Sarcoma); Glioblastoma (GBM) and Brain Tumors; Ovarian Cancer; Pancreatic Cancer; Gastric and Colorectal Cancer; Metastatic and Rare Cancers, (such as, Neuroblastoma and Adrenocortical Carcinoma), and the like. Each possibility is a separate embodiment.

[0089] According to some embodiments, the modRNA, modRNA compositions, T-cells including the modRNA, or composition including such T-cells may be administered to a subject. Such administration may include, for example, but not limited to: (Intravenous infusion or injection, Intratumorally injection, Intraperitoneal infusion or injection, Subcutaneous injection, and the like, or any combinations thereof. Each possibility is a separate embodiment.

[0090] Listed below are nucleic acid sequences of exemplary 5’UTRs disclosed herein:

[0091] TIGIT 5'UTR (SEQ ID NO: 1)

[0092] ACATCTGCTTCCTGTAGGCCCTCTGGGCAGAAGC

[0093] LAG3 5'UTR (SEQ ID NO: 2)

[0094] AGAGACCAGCAGAACGGCATCCCAGCCACGACGGCCACTTTGCTCTGTCT GCTCTCCGCCACGGCCCTGCTCTGTTCCCTGGGACACCCCCGCCCCCACC TCCTCAGGCTGCCTGATCTGCCCAGCTTTCCAGCTTTCCTCTGGATTCCG GCCTCTGGTCATCCCTCCCCACCCTCTCTCCAAGGCCCTCTCCTGGTCTC CCTTCTTCTAGAACCCCTTCCTCCACCTCCCTCTCTGCAGAACTTCTCCT TTACCCCCCACCCCCCACCACTGCCCCCTTTCCTTTTCTGACCTCCTTTT GGAGGGCTCAGCGCTGCCCAGACCATAGGAGAG

[0095] IFNy 5'UTR (SEQ ID NO: 3)

[0096] AC AT TGTTCTGATCATCT GAAGAT GAG C T AT T AGAAGAGAAAGAT GAG T T

[0097] AAG T C C T T T G GAG C T GAT C AG C T T GAT AC AAGAAC T AC T GAT T T C AAC T T

[0098] CTTTGGCTTAATTCTCTCGGAAACG

[0099] TOX 5'UTR (SEQ ID NO: 4)

[0100] C T C T T C T T C T T AAAC AAAC C AC AAAC G GAT G T GAG G GAAG GAAGG T G T T T CTTTTACTCCTGAGCCCAGACACCTCACTCTGTTCCGTCTAAGCTTGTTT T GC T GAACAC T T T T T T T TAAAAAAGGAAAAAGAAAAGGAGT T GCT T GAT G TGAGAGTGAA

[0101] GznB 5'UTR (SEQ ID NO: 5)

[0102] AGCCTTCCTGAGAAGATGCAACCAATCCTGCTTCTGCTGGCCTTCCTCCTG CTGCCCAGGGCAG

[0103] PD1 5'UTR (SEQ ID NO: 6)

[0104] GCTCACCTCCGCCTGAGCAGTGGAGAAGGCGGCACTCTGGTGGGGCTGCT CCAGGC

[0105] CD39 5'UTR (SEQ ID NO: 7)

[0106] ACGGAGACGGACCACAGCAAGCAGAGGCTGGGGGGGGGAAAGACGAGGAA AGAGGAGGAAAACAAAAGC T GC TAG T T

[0107] CD69 5'UTR (SEQ ID NO: 8)

[0108] AGAC T C AAC AAGAG C T C GAG C AAAGAC T T T GAG T G T AG C T T GAG T T GAG C T GAGAT TAAC TAGGGAAT C T T GAGAATAAAG

[0109] CD3s 5'UTR (SEQ ID NO: 9)

[0110] AGAAACCCTCCTCCCCTCCCAGCCTCAGGTGCCTGCTTCAGAAAATGAAG TAGTAAGTCTGCTGGCCTCCGCCATCTTAGTAAAGTAACAGTCCCATGAA ACAAAG

[0111] CD3< 5'UTR (SEQ ID NO: 10)

[0112] AACCGTCCCGGCCACCGCTGCCTCAGCCTCTGCCTCCCAGCCTCTTTCTG AGGGAAAGGACAAG

[0113] IL-2 5'UTR (SEQ ID NO: 11)

[0114] CTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATTTCACCTACATC GATT GAG T GAG TCTTTGGGGGTT T AAAGAAAT T C C AAAGAG T CAT C AGAA GAG GAAAAAT GAAG GTAATGTTTTTT C AGAC AG G T AAAG T C T T T GAAAAT ATGTGTAATATG T AAAAC AT T T T GAC AC CCCCATAATATTTTTC C AGAAT TAACAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTT

[0115] AAT C AC TACT C AC AG TAAC C T C AAC T C C T G C C AC A

[0116] TN Fa 5'UTR (SEQ ID NO: 12)

[0117] AGCAGACGCTCCCTCAGCAAGGACAGCAGAGGACCAGCTAAGAGGGAGAG AAG C AAC T AC AGAC C C C C C C T GAAAAC AAC C C T C AGAC G C GAG AT C C C C T GACAAGCTGCCAGGCAGGTTCTCTTCCTCTCACATACTGACCCACGGCTC CACCCTCTCTCCCCTGGAAAGGACACC

[0118] TIM3 5'UTR (SEQ ID NO: 13)

[0119] ATTTGGAGAGTTAAAACTGTGCCTAACAGAGGTGTCCTCTGACTTTTCTT CTGCAAGCTCC

[0120] In the description and claims of the application, the words “include” and “have”, and forms thereof, are not limited to members in a list with which the words may be associated. As used herein, the term comprising includes the term consisting of.

[0121] As used herein, the term “about” may be used to specify a value of a quantity or parameter (e.g. the length of an element) to within a continuous range of values in the neighborhood of (and including) a given (stated) value. According to some embodiments, “about” may specify the value of a parameter to be between 80 % and 120 % of the given value. According to some embodiments, “about” may specify the value of a parameter to be between 90 % and 110 % of the given value. According to some embodiments, “about” may specify the value of a parameter to be between 95 % and 105 % of the given value.

[0122] As used herein, according to some embodiments, the terms “substantially” and “about” may be interchangeable.

[0123] While a number of exemplary aspects and embodiments have been discussed above, those of skill in the art will recognize certain modifications, permutations, additions and subcombinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced be interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.

[0124] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention. EXAMPLES

[0125] Example 1: Expression of Gene of interest encoded by modRNA in T-cells and non-T-cells

[0126] Various modRNA constructs including a variety of 5’UTR sequences were prepared. GFP was used as a reporter gene of interest (GOI).

[0127] Table 1 below lists various constructs tested of expression in T-cells.

[0128] Table 1

[0129] The sequence of modRNA construct further include a 5’ CleanCap (Capl), 5’ untranslated region (UTR) derived from hemoglobin al (HBal) (served as control in some experiments), or any one of the 5 ’ UTRs in Table 1 ; Open Reading Frame (ORF) encoding for GFP, 3 ’ UTR (derived from hemoglobin a2 (HBa2)), and 3 ’ poly A tail composed of 120 A with a single G insertion (60 A- G-60A)). The modRNA molecules were synthesized with pseudouridine-5'-triphosphate (Pseudo- UTP) instead of regular uridine. The constructs were introduced by electroporation into primary human T cells in a range of dosages (0.6-5 pg).

[0130] As shown in the results presented in Figs. 3A-C, a high transfection rate (97%) and robust EGFP expression was exhibited when the cells were introduced with a control modRNA (i.e., including beta globin 5 ’UTR). As shown, as little as 0.6 pg of EGFP mRNA, can be utilized, allowing combining the introduction of a plurality of different modRNAs in one electroporation.

[0131] Next, the modRNA constructs harboring 5 ’UTRs as listed in Table 1 were introduced into primary human T-cells by electroporation. The results are presented in Figs. 4A-B. As shown in Fig. 4A and Fig. 4B, the 5’-UTRs of the genes TIGIT, IFNy and LAG3 produced a GFP signal which is stronger (in terms of mean fluorescent intensity) and more durable (in terms of kinetics) than the original control construct, while constructs that exploit the 5’-UTR of GNZM, TNF and TOX did not improve the GFP expression. In particular, the TIGIT and IFNy constructs boosted GFP expression by 100% by day 2 following electroporation, which was prolonged to 50% elevated expression by day 6, indicating sustained longevity of the mRNA encoding GFP.

[0132] Additionally, the modRNA constructs harboring various 5’UTRs and Luciferase (LUC) or CD 19 CART as the GOI, were introduced into primary human T-cells by electroporation. The results are presented in Figs. 5A-B, respectively. As shown in Fig. 5A, the IFNy 5’UTR construct produced a robust (stronger and more durable) Luciferase signal (i.e. expression of the LUC GOI), as compared to the control construct (including the a-globin 5’UTR) or other constructs including the indicated 5’ UTRs. As shown in Fig. 5B, the IFNy 5’UTR construct resulted in expression of a membranal protein (CART protein CD 19), at levels which are at least comparable to the levels of the control construct.

[0133] Further, the modRNA constructs harboring various 5’UTRs and GFP or Luciferase (LUC) as the GOI, were introduced into HEK293 cells, as a representative non-T-Cell. The aim of the results was to evaluate whether the hierarchical expression pattern of 5’ UTRs exemplified above, in T-cells is consistent in non-T cells.

[0134] The cells were transfected with the modRNA constructs using Lipofecamine transfection agent, according to the following general protocol:

[0135] Cell Seeding: HEK293 cells (0.1-0.2 million per well) were seeded in a 24-well plate one day before transfection to reach 70-80% confluency.

[0136] Lipofectamine was prepared according to manufacturer instructions. Briefly, 25 pL Opti- MEM was mixed with 0.75-1.5 pL Lipofectamine MessengerMAX and incubated at room temperature for 10 minutes. Ipg modRNA construct(s) were diluted in 50 pL Opti-MEM. 25 pL of the diluted mRNA constructs was added to the Lipofectamine mix and incubated at room temperature for 5 minutes.

[0137] 50 pL of the mRNA-Lipofectamine complex was added to each well.

[0138] Cells were incubated at 37°C. GFP expression was analyzed via flow cytometry, and luciferase assay was performed as pre the manufacturer instructions. The results are presented in Figs. 6A-C: As shown in Fig 6A, GFP expression was analysed in HEK293.

[0139] Fig. 6B shows Bar graphs representing GFP fluorescence levels as measured by mean fluorescence intensity (MFI) in HEK293 cells transfected with the modRNAs containing the indicated 5’ UTRs. Results are presented as MFI ± SEM (n=2), expressed as a percent change relative to a modRNA construct containing the alpha-globin 5’ UTR.

[0140] Fig. 6C. Show results of HEK293 cells transfected with modRNA constructs encoding luciferase reporters modified with the same 5’ UTRs as in Fig. 6A and Fig. 6B. Luciferase activity was measured 24 hours post-transfection using a luciferase assay. Bar graphs display luminescence levels relative to a control construct containing the alpha-globin 5’ UTR.

[0141] The results clearly indicate that the expression of the GOI in non-T-cells is markedly different, as compared to the respective expression in T-cells (as shown in Figs 4-5).

[0142] Example 2; Expression of CD19-CART by modRNA in T-cells

[0143] Different CD-19-CART encoding modRNA constructs (including various 5 ’UTRs), were introduced into the T-cells by electroporation, as detailed above. The expression of the CD 19- CAR-T was measured by flow cytometry of T cells. The expression results are presented in Fig. 7A.

[0144] As shown in Fig. 7B, percentages of CAR+ cells (i.e., cells expression CAR), are similar among the various UTRs. However, as shown in Fig. 7C, the normalized mean fluorescent intensity (MFI) varies among constructs, indicating the specificity of 5 ’UTRs to various T-cells and conditions.

[0145] Example 3: Tonic signaling of CD19-CART by modRNA in T-cells

[0146] Different CD-19-CART encoding modRNA constructs (including various 5’UTRs), were introduced into the T-cells by electroporation, as detailed above.

[0147] Tonic signaling in the T cells electroporated with CD19-CART was measured. The results shown in Figs. 8A-8B show expression of exhaustion markers 41BB, TIM3, 0X40 and PD1, as measured by flow cytometry, 24 and 48h post electroporation. The results shown in Figs. 8C-8F show Tonic cytokine (IFNy, IL6; Granozyme B; and Granozyme A) release 24 hours post electroporation as measured by the Meso Scale Discovery machine (MSD).

[0148] The results demonstrate the tonic signalling effect of various tested 5’UTRs. Example 4- forming a library of modRNA constructs for expression of genes of interest in T-cells modRNA constructs with the backbone as described in Example 1 are used to express various other genes of interest in various types of T-cells.

[0149] These regulators are introduced into TILs as single genes, in combination of genes or in combination with a module (up to four genes at a time). Each mRNA is transfected into human TILs or PBMCs by electroporation, and protein expression levels are tested by western-blot and flow cytometry on days 1, 3, 5, 7, 10 post electroporation.

[0150] Example 5- Functional assays of the selected engineered T-cells

[0151] Selected T-cells are tested for their functionality. Selected cells are stimulated in vitro either in a non-specific manner or in an antigen-specific manner by co-culture with a patient- derived matched cell line. The proliferation rate of the cells is assessed by CellTracker violet stain and intracellular Ki67 stain.

[0152] In addition, the cell number and effector function are determined by measuring the activation profile against patient-matched tumors, such as melanoma.

[0153] Example 6- Killing Efficiency of target cells by T-cells harboring various modRNAs

[0154] The aim of this experiment was to assess the killing efficiency of T cells transfected with five different CD19-CAR constructs (including 5’UTRS of Globin, IFNy, TIGIT, LAG3 or TNFa) and Mock-transfected T cells against NALM6 cells, obtained from two different donors.

[0155] To this aim, cytokine levels in the supernatant using MSD was performed, and the killing efficiency percentages using FACS analysis was performed.

[0156] Experimental Protocol

[0157] T cells obtained from two donors were thawed. The cells were previously isolated from PBMCs, selected using bead columns, and cryopreserved immediately after.

[0158] The T cells were left overnight in T2 medium (10% FBS, 1% Glutamine, 1% Pen-Strep) with 300 IU of IL-2.

[0159] Transfection of T cells: T cells were transfected with 5 pg of each of the indicated modRNA CD19CAR constructs and incubated for 16 hours in T2 medium with 100 IU of IL-2. Seeding T cells and NALM6 cells in 96-well plates: After 16 hours, T cells were seeded into U-bottom 96-well plates with NALM6 cells. Ratios of T cells to NALM6 cells were: 2:1, 1:1, 1:2, and 1:5, corresponding to the following cell counts: 60k:30k, 30k:30k, 15k:30k, 6k:30k.

[0160] NALM6 cells were prepared separately, with a constant number of 30k cells per well (100 pL). Final volume per well: 200 pL in T2 medium.

[0161] Incubation: The plate was incubated at 37°C for 24 hours.

[0162] Sample collection and analysis: Supernatant was Collected from each well and stored at - 80°C for MSD analysis.

[0163] Cell counts: An equal sample from each well was stained with CD3 / CD10 markers for analysing live and dead cell percentages using FACS.

[0164] Results

[0165] Killing of the cells was detected across all constructs at high T-cell concentrations, with the effect diminishing proportionally as T cell concentrations decreased.

[0166] The hierarchy of killing efficiency was determined as: 5’UTR of Globin and 5’UTR of IFNy modRNA constructs showed the highest killing efficiency.

[0167] LAG3 demonstrated lower killing efficiency compared to the other constructs, and the TNF-alpha construct exhibited the lowest killing efficiency among all constructs.

Claims

CLAIMSWhat we claim is:

1. A non-naturally occurring modified RNA (modRNA) molecule for expressing a gene of interest (GOI) in a target T-cell, the modRNA molecule comprises: a 5’UTR nucleotide sequence configured to confer specificity of expression to the T-cell, a nucleotide sequence encoding for the GOI and a 3’ UTR nucleotide sequence.

2. The modRNA according to claim 1, further comprising a CAP motif at a 5’ end thereof, and a poly A sequence at a 3 ’ end thereof.

3. The modRNA according to claim 1 or 2, further comprising a Kozak sequence interposed between the 5’UTR and the sequence encoding for the GOI.

4. The modRNA according to any one of claims 1-3, wherein one or more nucleotides comprise a modification.

5. The modRNA according to claim 4, wherein the modification comprises pseudo-UTP.

6. The modRNA according to any one of claims 1-5, wherein the 5’UTR is selected from a 5’UTR of a gene selected from: TOX, GznB, PD1, TIGIT, LAG3, CD39, CD69, CD3s, CD3T, IL-2, TNFa, IFNy, TIM-3, or any combination thereof.

7. The modRNA according to any one of claims 1-5, wherein the 5’UTR is selected from a 5’UTR of TIGIT, LAG3, IFNy, or any combination thereof.

8. The modRNA according to any one of claims 1-6, wherein the 5’UTR comprises a 5’UTR of IFNy.

9. The modRNA according to any one of claims 1-8, wherein the 5’ UTR has or comprises a nucleotide sequence as denoted by any one of SEQ ID NOs: 1-13.

10. The modRNA according to any one of claims 1-9, wherein the 5’ UTR has or comprises a nucleotide sequence as denoted by SEQ ID NO: 3.

11. The modRNA according to any one of claims 1-10, wherein the 3’UTR is of a beta-globin gene.

12. The modRNA according to any one of claims 1-11, wherein the GOI comprises an engineered T-cell receptor (TCR) or a chimeric antigen receptor (CAR).

13. The modRNA according to any one of claims 1-12, wherein the GOI is CD-19 CAR.

14. A composition comprising the modRNA according to any one of claims 1-13.

15. The modRNA according to any one of claims 1-13, or the composition according to claim 14, for use in affecting one or more properties of a T-cell.

16. A method of affecting one or more properties of a T-cell, the method comprising introducing to the T-cell the modRNA according to any one of claims 1-13, or the composition according to claim 14.

17. The method according to claim 16, wherein introducing is facilitated in-vivo or in-vitro.

18. The method according to any one of claims 16-17, wherein the T-cell is used in adoptive cell therapy.

19. A vector comprising the modRNA of any one of claims 1-13.

20. A host T-cell comprising the modRNA according to any one of claims 1-13.

21. A host T-cell introduced with the modRNA according to any one of claims 1-13, or the composition according to claim 14.

22. The host T-cell according to any one of claims 20-21, for use in adoptive cell therapy.

23. The host T-cell according to claim 22, for use in treating cancer in subject in need thereof.

24. A method of treating cancer in a subject in need thereof, the method comprising introducing the T-cell according to any one of claims 20-21, or a composition comprising the same, to the subject.

Citation Information

Patent Citations

  • RNA engineered t cells for the treatment of cancer

    US20200087659A1

  • Anti-BCMA chimeric antigen receptors

    WO2020190737A1