Compositions and methods comprising small nuclear RNA (SNRNA) for the treatment of pompe disease
SnRNA molecules targeting GAA and GYSI RNA sequences alter RNA splicing to enhance GAA expression and reduce GYSI activity, providing a multi-target therapy for Pompe disease that improves glycogen metabolism and delays disease progression.
Patent Information
- Application Number
- PCT/US2025/012909
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-28
- Filing Date
- 2025-01-24
- Publication Date
- 2025-07-31
AI Technical Summary
Current treatments for Pompe disease, such as enzyme replacement therapy, provide only modest improvements in disease progression and there is a need for more potent therapeutic approaches to manage glycogen storage and improve patient function.
The use of small nuclear RNA (snRNA) molecules targeting the acid alpha-glycosidase (GAA) and glycogen synthase 1 (GYSI) RNA sequences to alter RNA splicing, promoting exon skipping or inclusion, thereby increasing GAA protein expression and reducing GYSI activity, administered via vectors like adeno-associated virus (AAV) to treat Pompe disease.
This approach potentially delays disease progression and improves glycogen metabolism, offering a more effective treatment for Pompe disease by simultaneously promoting glycogen breakdown and preventing synthesis.
Smart Images

Figure US2025012909_31072025_PF_FP_ABST
Abstract
Description
COMPOSITIONS AND METHODS COMPRISING SMALL NUCLEAR RNA (SNRNA) FOR THE TREATMENT OF POMPE DISEASERELATED APPLICATIONS
[0001] This application claims the priority to, and benefit of, U.S. Provisional Application No. 63 / 625,530, filed on January 26, 2024, and U.S. Provisional Application No. 63 / 652,411, filed on May 28, 2024, the contents of each of which are incorporated by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (REGE_038_001WO_SeqList_ST26.xml; Size: 255,686 bytes; and Date of Creation: January 24, 2025) are herein incorporated by reference in its entirety.FIELD OF THE DISCLOSURE
[0003] The disclosure is directed to molecular biology, gene therapy, and compositions and methods for modifying expression and activity of RNA molecules.BACKGROUND
[0004] Small nuclear RNA (snRNA) is one of the smallest types of RNA with an average size of about 150 nucleotides. snRNAs are functional non-coding RNAs. Eukaryotic genomes code for a variety of non-coding RNA such as snRNA, a class of highly abundant RNA, localized in the nucleus with important functions in intron splicing and RNA processing. snRNA, in the pre-mRNA splicing process, are capable of forming ribonucleoprotein particles (snRNPs) along with other proteins. These snRNPs and additional proteins form a large particulate complex (spliceosome) bound to the unspliced pre-mRNA transcripts. In addition to splicing, snRNAs function in nuclear maturation of nascent transcripts, gene expression regulation, as a splice donor in non-canonical systems, and in 3’ end processing of replication-dependent histone mRNAs. U7 snRNA can be programmed to bind and modulate mRNA without exogenous protein expression, which can ultimately decrease the risk of immunogenicity observed with other protein-based gene therapy approaches. Furthermore, the small size of these programmed snRNAs creates an opportunity to develop single vector,highly specific (e.g., allele-specific), single target and multi-targeting gene therapy approaches.
[0005] Pompe disease, also known as glycogen storage disease type II or acid maltase deficiency, is a rare genetic disorder characterized as a lysosomal storage disorder and a glycogen storage disorder that is caused by mutations in the acid alpha-glycosidase (GAA) gene. GAA is an enzyme that is essential for breaking down glycogen, a complex sugar, into glucose. When there are mutations in the GAA enzyme, glycogen accumulates in various tissues, particularly in the muscles. This buildup of glycogen impairs the normal function of cells. Pompe disease can affect various organs and systems, but it often has a significant impact on the heart and respiratory muscles. The severity of the disease can vary widely, with some individuals experiencing symptoms early in life (infantile-onset), while others may develop symptoms later in adulthood (late-onset).
[0006] Common symptoms of Pompe disease include muscle weakness, respiratory difficulties, heart problems, and in severe cases, it can lead to respiratory failure and premature death. Without treatment, babies usually experience fatal heart or respiratory failure between 1 and 2 years of age. The age of onset and the rate of disease progression can vary, making the management and treatment of Pompe disease complex. Pompe disease is also an autosomal recessive disorder, requiring two mutated copies of the GAA gene (one from each parent). Due to its rarity and the complexity of its genetic basis, Pompe disease often requires specialized medical care and multidisciplinary management involving geneticists, neurologists, cardiologists, and other healthcare professionals.
[0007] Accordingly, the GAA RNA targeting snRNA molecules of the disclosure can alter RNA splicing by promoting exon skipping or inclusion, and can be used to control GAA protein expression in those with Pompe disease or at risk of developing Pompe disease. Moreover, the GAA snRNA molecules of the disclosure can be administered in combination with GYSI (glycogen synthase 1) snRNA molecules in order to decrease glycogen build up in cells.
[0008] GYSI is a key enzyme involved in glycogenesis, which is the process of glycogen synthesis. Glycogen is a complex carbohydrate that serves as a form of stored glucose in the body, particularly in the liver and muscles. It acts as a readily mobilizable storage form of energy.
[0009] When used in combination, GAA RNA targeting snRNA molecules of the disclosure and GYSI RNA targeting molecules of the disclosure provide a multi-target approach to simultaneously promote glycogen breakdown and to prevent glycogen synthesis.
[0010] There is no cure for Pompe disease. Management focuses on treating symptoms and providing supportive care, with the goal of improving quality of life and prolonging survival. Current treatments of Pompe disease are limited to enzyme replacement therapy (ERT) involving the administration of a synthetic form of GAA. To date, studies show a modest improvement in disease progression in Pompe disease patients following ERT. However, multi-targeting treatments that can more potently delay disease progression and improve function in Pompe disease patients are needed. Accordingly, there remains an unmet need for new therapeutic approaches for Pompe disease.SUMMARY
[0011] The present disclosure provides an RNA-targeting nucleic acid molecule comprising a small nuclear RNA (snRNA), wherein the snRNA comprises a targeting sequence that binds an acid alpha-glycosidase (GAA) RNA sequence (GAA targeting sequence).
[0012] In some aspects, the GAA RNA sequence comprises a sequence of GAA intron 1 or exon 2. In some aspects, the GAA targeting sequence comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-24.
[0013] The disclosure provides an RNA-targeting nucleic acid molecule comprising an snRNA, wherein the snRNA comprises a targeting sequence that binds a glycogen synthase 1 (GYSI) RNA sequence (GYSI targeting sequence).
[0014] In some aspects, the GYSI RNA sequence comprises a sequence of GYSI Exon 5 or Exon 6. In some aspects, the GYSI targeting sequence comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 25-73.
[0015] In some aspects, the snRNA comprises an engineered stem loop (eSL). In some aspects, the eSL comprises one or more nucleic acid sequences at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 74-114.
[0016] In some aspects, the GAA or GYSI RNA sequence comprises a pre-mRNA or mRNA sequence.
[0017] In some aspects, the snRNA comprises an Sm binding domain (SmBD). In some aspects, the SmBD is a Ul, U2, U4, or U5 SmBD. In some aspects, the SmBD comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 111 or 112.
[0018] In some aspects, the snRNA comprises a 5’ interaction stabilizer domain (5’ISD). In some aspects, the 5’ISD comprises the nucleotide sequence GGAGT, CCTCT, GGAGGT, CCTCCT, AGCCAG, GGAAG, GAAGAAG, GTTG, CCGAA, TAAGGAG, GAAG, OR GGCTT.
[0019] The disclosure provides a vector comprising or encoding one or more RNA-targeting nucleic acid molecules of any embodiment of the disclosure. In some aspects, the vector is an adeno-associated virus (AAV) vector.
[0020] In some aspects, the snRNA is operably linked to a promoter. In some aspects, the snRNA is operably linked to a U7 promoter or a Ul promoter. In some aspects, the snRNA is operably linked to a downstream terminator (DT). In some aspects, the snRNA is operably linked to a U7 downstream terminator or a Ul downstream terminator.
[0021] In some aspects, the vector comprises at least one, at least two, at least three, at least four, or at least five snRNA.
[0022] In some aspects, the least one, at least two, at least three, at least four, or at least five snRNA each target the same target RNA sequences.
[0023] In some aspects, each snRNA is separated by a buffer sequence. In some aspects, the buffer sequence comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one SEQ ID NOs: 143-149.
[0024] In some aspects, the vector comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-169, 185, 190, 192, 194, 196, 199, or 200.
[0025] In some aspects, provided herein is a GAA RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 1-24.
[0026] In some aspects, provided herein is a GYSI RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 25-73.
[0027] In some aspects, provided herein is a combination RNA-targeting nucleic acid molecule comprising the GAA RNA-targeting nucleic acid molecule of the above aspects and the GYSI RNA-targeting nucleic acid molecule of the above aspects.
[0028] In some aspects, provided herein is a polynucleotide or vector comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-169, 199, or 200.
[0029] In some aspects, provided herein is a polynucleotide or vector comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 185, 190, 192, 194, or 196.
[0030] In some aspects, provided herein is a recombinant AAV (rAAV) comprising: an AAV capsid comprising an AAV capsid protein; and a vector genome comprising a sequence encoding the RNA-targeting nucleic acid molecule, the GAA RNA-targeting nucleic acid molecule, the GYSI RNA-targeting nucleic acid molecule, the combination RNA-targeting nucleic acid molecule, and / or the polynucleotide.
[0031] In some aspects, the vector genome further comprises a 5' inverted terminal repeat (ITR) sequence and a 3 ' ITR.
[0032] In some aspects, the vector genome comprises, in the 5' to 3' direction, a 5' ITR sequence, the snRNA or the RNA-targeting nucleic acid molecule, and a 3' ITR sequence.
[0033] In some aspects, provided herein is a recombinant AAV (rAAV) comprising: an AAV capsid comprising an AAV capsid protein; and a vector genome comprising the polynucleotide of claim 28.
[0034] In some aspects, the AAV capsid comprises an AAV capsid protein of an AAV serotype selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, and variants thereof.
[0035] In some aspects, the vector genome is single-stranded or self-complementary.
[0036] In some aspects, the rAAV is replication incompetent.
[0037] In some aspects, provided herein is a lentiviral particle comprising the polynucleotide or vector.
[0038] In some aspects, provided herein is a pharmaceutical composition comprising an RNA-targeting nucleic acid molecule, a vector, a GAA RNA-targeting nucleic acid molecule,a GYSI RNA-targeting nucleic acid molecule, a combination RNA-targeting nucleic acid molecule, a polynucleotide or vector, a rAAV, or a lentiviral particle.
[0039] In some aspects, the disclosure further provides a method of targeting one or more target RNAs of interest and exon-skipping the one or more target RNAs, comprising contacting the snRNA of any embodiment of the disclosure with an RNA-targeting nucleic acid molecule, a vector, a GAA RNA-targeting nucleic acid molecule, a GYSI RNA-targeting nucleic acid molecule, a combination RNA-targeting nucleic acid molecule, a polynucleotide or vector, a rAAV, or a lentiviral particle, a pharmaceutical composition, or a cell comprising the one or more target RNAs.
[0040] In some aspects, the disclosure provides a GAA RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 1-24.
[0041] In some aspects, the disclosure provides a GYSI RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 25-73.
[0042] In some aspects, the disclosure provides a method of treating a disease or disorder in a subject comprising administering to the subject an RNA-targeting nucleic acid molecule, a vector, a GAA RNA-targeting nucleic acid molecule, a GYSI RNA-targeting nucleic acid molecule, a combination RNA-targeting nucleic acid molecule, a polynucleotide or vector, a rAAV, or a lentiviral particle, or a pharmaceutical composition.
[0043] In some aspects, the disease or disorder is Pompe disease.
[0044] In some aspects, the administration is systemic, intravenous, or intracerebroventricular.
[0045] In some aspects, the GAA RNA sequence is a wild-type GAA RNA sequence or a mutant GAA RNA sequence.
[0046] In some aspects, the GAA mutation comprises c.-32-13T>G.
[0047] In some aspects, further provided is a kit comprising an RNA-targeting nucleic acid molecule, a vector, a GAA RNA-targeting nucleic acid molecule, a GYSI RNA-targeting nucleic acid molecule, a combination RNA-targeting nucleic acid molecule, a polynucleotide or vector, a rAAV, or a lentiviral particle, or a pharmaceutical composition, and instructions for use.
[0048] In some aspects, further provided is use of an RNA-targeting nucleic acid molecule, a vector, a GAA RNA-targeting nucleic acid molecule, a GYSI RNA-targeting nucleic acid molecule, a combination RNA-targeting nucleic acid molecule, a polynucleotide or vector, arAAV, or a lentiviral particle, or a pharmaceutical composition in the manufacture of a medicament for treating a disease or disorder in a subject.
[0049] In some aspects, the disease or disorder is Pompe disease.BRIEF DESCRIPTION OF THE DRAWINGS
[0050] FIG. 1A shows the mechanism of action for GAA exon 2 inclusion using engineered U7 snRNAs. 40-70% of late-onset Pompe disease (LOPD) patients carry a mutation c.-32- 13T>G (*) disrupting the polypyrimidine tract in GAA intron 1 leading to mis-splicing and the exclusion of exon 2- with or without the presence of a pseudo-exon (asterisk in the intron between exons 1 and 2). This mis-splicing event leads to a frameshift with a premature termination codon (PTC) and subsequent nonsense mediated decay (NMD) and degradation. The SV2 and SV3 variants are the most common products from the mis-splicing that occurs as a result of the c.-32-13T>G mutation in intron 1 of the GAA gene. U7 snRNAs were engineered to bind and block those sites in the polypyrimidine track of GAA intron 1 and regulatory elements (like splice donor or acceptor sites) to promote inclusion of exon 2 and restoration of the GAA open reading frame, leading to normal expression and function.
[0051] FIG. IB shows a timeline for fibroblast (GM00443- derived from an LOPD patient) transduction with lentiviral vectors and analysis 1-week post treatment.
[0052] FIG. 1C depicts a tapestation image of the RT-PCR products after U7 snRNA treatments using lentiviruses expressing dual snRNAs (under the mouse U7 and mouse U1 promoters) with single spacers (L05641 and L05642) or fusion spacers (L05643 and L05644), showing the normal isoform (Normal, top band, containing exon 2) and the misspliced isoforms (SV3 and SV2, mid and bottom bands). Lentiviruses expressing GFP only were used as a negative control.
[0053] FIG. ID shows the quantification of the tapestation image in FIG. 1C for the normal isoform after treatment.
[0054] FIG. IE depicts the qRT-PCR results for GAA RNA expression post-treatment with multiple U7 snRNAs with single and fusion spacers. The y-axis shows levels of endogenous GAA RNA expression normalized to the GAPDH reference gene and the x-axis depicts the lentiviral treatment. NMD: nonsense mediated decay; GFP: lentivirus expressing only GFP; UNT: untreated cells; L05641 : lentivirus with 2x z5 single spacers; L05642: lentivirus with lx z8 and lx z5 single spacers; L05643: lentivirus with 2x z5 / z7 fusion spacers; L05644:lentivirus with 2x z5 / z8 fusion spacers; SV2: GAA splice variant absent exon 2. SV3: GAA splice variant including a pseudo-exon in place of exon 2.
[0055] FIG. 2A shows capillary immunoblot image of endogenous GAA protein expression in LOPD patient fibroblasts transduced with lentiviruses expressing a GFP control or 2 snRNA cassettes (with single or fusion spacers) 1-week post treatment. The bottom bands show the GAPDH loading control.
[0056] FIG. 2B shows the quantification of the image in FIG. 2A indicating the levels of endogenous GAA protein in LOPD patient fibroblasts 1-week post treatment. GAA protein expression was normalized to the GAPDH loading control.
[0057] FIG. 2C depicts the enzymatic activity of GAA protein 1-week post lentiviral transduction. Untreated wild type fibroblasts (WT Fibro) from a healthy individual were used as a positive control. GFP: lentivirus expressing only GFP; UNT: untreated LOPD fibroblasts; WT Fibro: untreated WT fibroblast control from a healthy individual; L05641 : lentivirus with 2x z5 single spacers; L05642: lentivirus with lx z8 and lx z5 single spacers; L05643: lentivirus with 2x z5 / z7 fusion spacers; L05644: lentivirus with 2x z5 / z8 fusion spacers.
[0058] FIG. 3A shows the predicted mechanism of action for GYSI knockdown using engineered U7 snRNAs. U7 snRNAs were engineered to bind splicing regulatory sequences to promote skipping of a constitutive exon (exon 6) which ultimately leads to a frameshift and the generation of a premature termination codon (PTC) to promote RNA degradation by nonsense mediated decay (NMD).
[0059] FIG. 3B shows the qRT-PCR quantification of GYSI RNA expression 48-hours posttransfection in HEK-293T cells after U7 snRNA treatments using pcDNA-lx snRNA containing singles or fusion spacers. The y-axis shows the levels of GYSI RNA expression normalized to the GAPDH reference gene and non-targeting (NT) snRNA and the x-axis depicts the treatments.
[0060] FIG. 3C shows a tapestation image of the RT-PCR products after different U7 snRNA treatments, expressing a single snRNA cassette (z30) or 2x snRNA cassettes (z30, z30 and z30, z30 and z29), with single spacers. HEK-293T cells were treated with U7 snRNAs for 48-hours before harvesting. The top band denotes the PCR product for GYSI with exon 6 included and the bottom band denotes the PCR product for GYSI with exon 6 absent.
[0061] FIG. 3D depicts the qRT-PCR quantification of GYSI RNA as denoted in FIG. 3C. The y-axis shows the levels of GYSI RNA expression normalized to GAPDH reference gene and non-targeting (NT) snRNA and the x-axis depicts the treatment.
[0062] FIG. 3E shows capillary immunoblot image of endogenous GYSI protein expression in HEK-293T cells transfected with 1 or 2 snRNA cassettes (with single spacers) for 48- hours. The bottom band denotes the GAPDH loading control.
[0063] FIG. 3F shows the quantification of image in FIG. 3E for the levels of endogenous GYSI protein 48-hours post treatment. Expression was normalized to GAPDH loading control. PTC: premature termination codon; NMD: nonsense mediated decay; NT: nontargeting snRNA negative control; U: untreated cells.
[0064] FIG. 4A shows the predicted mechanism of action for multi-targeting in Pompe disease using snRNAs, which promotes GYSI knockdown to decrease glycogen synthesis and GAA restoration of expression and function to improve glycogen breakdown.
[0065] FIG. 4B depicts a tapestation image of the RT-PCR products after U7 snRNA treatments. LOPD differentiated myotubes were transduced with IE6vg / cell of AAV9 expressing dual snRNA cassettes (under mouse U7 and mouse U1 promoters), to target GAA exon 2 (A06069) or to target GAA exon 2 and GYSI exon 6 (A06070). Cells were harvested for analysis 10-days post-transduction. AAV Ctrl (AAV9 empty capsid) and untreated LOPD myotubes (UNT) were used as negative control. Healthy (H) untreated myotubes were used as positive control. The top bands depict the normal (N) (exon 2 present) GAA isoform, and the bottom band indicates the mis-spliced isoform (SV2; exon 2 absent).
[0066] FIGS. 4C-4D depict the qRT-PCR quantification of the GAA RNA expression levels (FIG. 4C) and the qRT-PCR quantification of the GYSI RNA expression (FIG. 4D). Both FIG. 4C and FIG. 4D were normalized to the GAPDH reference gene and referent to healthy control (FIG. 4C) or AAV Ctrl (FIG. 4D).
[0067] FIGS. 4E-4F show capillary immunoblot images and quantification of endogenous GAA protein expression (FIG. 4E) and of endogenous GYSI protein expression (FIG. 4F) after the indicated treatments. Results were normalized to total protein loaded per lane and relative to the levels expressed in the healthy myotubes (FIG. 4E) or AAV Ctrl (FIG. 4F).
[0068] FIG. 4G shows the quantification of glycogen levels in LOPD myotubes transduced with AAV9 expressing dual snRNA cassettes (under mouse U7 and mouse U1 promoters), targeting GAA exon 2 (A06069) and targeting GAA exon 2 as well as GYSI exon 6 (A06070).Cells were harvested for analysis 10 days post-transduction. Glycogen levels were normalized to AAV Ctrl (AAV9 empty capsid). N: normal isoform of GAA (exon 2 present); SV2: mis-spliced variant of GAA (exon 2 absent); AAV Ctrl: empty AAV capsid control; A06069: AAV containing dual snRNA cassettes of 2x GAA z5 / z8; A06070: AAV containing dual snRNA cassettes of GYSI z30 and GAA z5 / z8; UNT: untreated cells; H: healthy cells.DETAILED DESCRIPTION
[0069] The present disclosure provides gene therapy compositions comprising a therapeutic RNA-targeting platform comprised of small nuclear RNA (snRNA) targeting precursor mRNA (pre-mRNA) or mRNA sequences encoding acid alpha-glucosidase 1 (GAA) and / or snRNA targeting pre-mRNA or mRNA sequences encoding glycogen synthase (GYSI). The targeted pre-mRNA or mRNA sequences can include exonic and / or intronic regions of GAA, and / or exonic regions of GYSI, and / or splicing regulatory sequences of GAA, and / or splicing regulatory sequences of GYSI.
[0070] Disclosed herein are compositions comprising RNA-targeting nucleic acid molecules comprising one or more snRNA, and vectors comprising the RNA-targeting molecules or constructs targeting GAA. In some embodiments, compositions comprise the snRNA targeting GAA also comprise one or more snRNA targeting GYSI. The snRNA molecules of the disclosure can be non-natural, modified and / or engineered snRNA (esnRNA). In some embodiments, snRNA or esnRNA targeting GAA or GYSI of the disclosure comprise a mutated snRNA stem loop. In some embodiments, snRNA targeting GAA or GYSI of the disclosure comprise a native stem loop.
[0071] Small nuclear ribonucleic acids (snRNAs) are essential components of small nuclear ribonucleoprotein complexes (snRNPs) which, when assembled with additional proteins, form the large ribonucleoprotein complex known as the spliceosome, the cell machinery appointed to mediate the entire mRNA maturation process. The spliceosome is responsible for precursor mRNA splicing, which is the process that removes introns from RNA transcripts before protein production. An individual snRNA is generally about 250 nucleotides or less in size. For example, U1 snRNA is 164 nucleotides in length and is encoded by genes that occur in several copies within the human genome. U1 snRNA represents the ribonucleic component of the nuclear particle U1 snRNP. The U1 snRNA has a stem and loop tridimensional structure and within the 5’ region there is a single-stranded sequence, generally about 9 nucleotides in length, capable of binding by complementary basepairing to the splicing donor site on the pre-mRNA molecule. (Horowitz et al., 1994, Trends Genet., 10(3): 100-6.) The various spliceosomal snRNAs have been designated as Ul, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, Ul 1 and U12, due to the generous amount of uridylic acid they contain. (Mattaj etal., 1993, FASEB J, 15, 7:47-53.)
[0072] snRNA systems can be used for treating toxic mutations. For example, antisense oligonucleotides that interfere with splice sites and regulatory elements within an exon containing toxic mutations can induce skipping of specific exons at the pre-mRNA level. Such antisense sequences can be packaged in an snRNA sequence delivered using viral vectors carrying a nucleic acid sequence from which the snRNA can be transcribed. U7 snRNA is endogenously involved in histone pre-mRNA 3 ’-end processing but can be converted into a versatile tool for splicing modulation by a small change in the binding site for Sm / Lsm proteins.
[0073] Most U-rich snRNPs are complexes that mediate the splicing of pre-mRNAs. U7 snRNP is an exception. U7 is not involved in splicing, but rather is a key factor in the unique 3 ’-end processing of replication-dependent histone mRNAs. By modifying the U7 snRNA histone binding sequence and the Sm motif, U7 can be modified to no longer be involved in processing the histone pre-mRNA and instead target pre-mRNAs or mRNA for blocking or splicing modulation. In this manner, U7 snRNA can be used as an effective gene therapy platform. The U7 snRNA platform also has the additional advantages of being a compact size, having the capability to accumulate in the nucleus without causing cellular toxicity, and possesses little to no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4): e3321.). The U7 snRNA platform is described in more detail in International Patent Application Publication No. WO 2023 / 168458, which is incorporated herein by reference in its entirety.
[0074] In some aspects, disclosed herein are engineered snRNA (esnRNA) comprising a modified stem loop (SL). Compensatory modifications made to the native stem loop sequence can create an engineered stem loop (eSL) which more effectively communicates (folds and anneals) with the snRNA interaction stabilization domain (ISD) compared to the native stem loop sequence, which in turn creates an snRNA platform with increased stability. U7 snRNAs have been previously shown to be programmable to modulate mRNAs.Disclosed herein are programmed engineered snRNA improvements which are capable of being used as a gene therapy tool.
[0075] snRNA systems disclosed herein are configured to bind target GAA and / or GYSI RNA sequences to modulate RNA splicing, which can lead to single or multiple exon skipping or exon inclusion of targeted sequences of the GAA or GYSI RNA. GAA or GYS1- targeting snRNAs are configured to bind to GAA or GYSI pre-mRNA molecules at sites that regulate RNA splicing. Splicing regulatory sites can include splice acceptor sequences, splice donor sequences, intron splice enhancer sequences, intron splice silencing sequences, exon splice silencing sequences, and exon splice enhancer sequences. snRNA sequences of the disclosure can induce exon skipping (of single or multiple exons) or exon inclusion (of single or multiple exons) of targeted exonic, intronic, or regulatory sequences.
[0076] GAA targeting snRNAs of the disclosure can be configured to target GAA mutants such as GAA c.-32-13T>G present in most Late-Onset Pompe Disease (LOPD) patients, or any other potential mutations on GAA intron 1 that would lead to mis-splicing of exon 2. GAA mutations associated with Pompe Disease are known to persons of ordinary skill in the art, and described for example, by de Faria, D.O.S. et al. Update of the Pompe variant database for the prediction of clinical phenotypes: Novel disease-associated variants, common sequence variants, and results from newborn screening. Human Mutation. 2021; 42: 119-134.
[0077] GYSI targeting snRNAs of the disclosure can be configured to target wild-type GYSI or any GYSI mutant.
[0078] GAA targeting snRNAs of the disclosure can be configured to induce inclusion of one or more constitutive exons of GAA, such as exon 2. Mutations in intron 1 of GAA results in mis-splicing events, resulting in an abnormally spliced exon 2, causing frameshifting and nonsense mediated decay of the RNA. As such, exon inclusion can be configured to prevent the mis-splicing events in the GAA mRNA molecule. Transcription of the mRNA comprising exon 2 of GAA results in normal GAA transcription. Without wishing to be bound by theory, it is hypothesized that by promoting inclusion of an exonic region of GAA, such as exon 2, from the GAA pre-mRNA so as to induce normal splicing of the GAA mRNA using the U7 snRNA platform, GAA RNA and protein levels would be increased.
[0079] GYSI targeting snRNAs of the disclosure can be configured to induce the exclusion of one or more constitutive exons of GYSI such as exon 5 or exon 6. Such exon exclusion can be configured to introduce a premature termination codon (PTC) into the resulting spliced GYSI mRNA molecule. Transcription of the mRNA comprising the PTC results in nonsensemediated decay of the mRNA. Without wishing to be bound by theory, it is hypothesized that by promoting the exclusion (skipping) of a constitutive exon of GYSI, such as exon 5 or exon 6, from the GYSI pre-mRNA so as to introduce a PTC into the processed mRNA using the U7 snRNA platform, whereby GYSI protein levels would be reduced.
[0080] In some embodiments, the GAA targeting snRNAs of the disclosure and the GYSI targeting snRNAs of the disclosure can be used in conjunction with each other to provide a multi-targeting strategy utilizing the U7 snRNA platform. Without wishing to be bound by theory, it is hypothesized that utilizing the GAA targeting snRNAs of the disclosure to increase the protein levels of GAA promotes glycogen breakdown and utilizing the GYSI targeting snRNAs of the disclosure to decrease the protein levels of GYSI prevents glycogen synthesis, thereby providing a tool for the treatment / prevention of glycogen storage disorders, such as Pompe disease.
[0081] In one embodiment, these snRNAs are human snRNAs. In another embodiment, these snRNAs are mouse snRNAs. In another embodiment, the snRNAs are of any species. In another embodiment, the snRNAs are a combination of human and mouse snRNAs. In one embodiment, the U7 snRNA is a human U7 snRNA or a mouse U7 snRNA. In another embodiment disclosed herein, snRNA is chimeric, i.e., comprises varying types of snRNAs (U1-U12, etc.) by combining domains of endogenous snRNAs to fine tune stabilization of the platform and / or to reduce off-target effects. For example, in one embodiment, the snRNA system of the present disclosure comprises a combination of human or mouse U7 snRNA and human or mouse U1 snRNA components.
[0082] Additional elements that can tune the processing and abundance of the RNA can be further engineered into the snRNAs or esnRNAs comprising eSLs. In one embodiment, additional elements that can tune the processing, stability, and abundance of the esnRNA can be further engineered into the esnRNAs at the 5’ or 3’ ends. In another embodiment, such elements may include but are not limited to stem loops, hairpins, G-C clamps, kissing loops, triplexes, quadruplexes, and protein binding sites.
[0083] The snRNA platform and portions thereof can be used in a therapeutic setting and context so long as a suitable spacer(s) or target sequence (s) TS(s) is included in the design of the therapeutic composition. In certain embodiments, a therapeutic snRNA composition is used to treat a disease associated with dysregulated, mutated, or non-functional GAA. In some aspects, the disease or disorder is Pompe disease.Targeting Sequences
[0084] The snRNA systems can be programmed to comprise a targeting sequence (TS) (also referred to herein as a “spacer”) that targets an RNA of interest. The snRNA systems can be programmed with one or more targeting sequences targeting one or more RNAs of interest. In some aspects, the targeting sequence is a 5’ targeting sequence (5’TS) that targets one or more RNAs of interest. In this context, 5’ is in reference to the snRNA insert’s 5’ end and not necessarily to the overall vector configuration comprising the snRNA insert or inserts. The TS can be located in or near the 5’ end of the snRNA. In an alternative embodiment, the targeting sequence(s) (TS) can be located in or near a 3’ position in the snRNA construct, thereby generating a 3’ targeting sequence (3’ TS), particularly if the snRNA construct is not a U7-based snRNA.
[0085] Targeting sequences of the disclosure, including 5’ TS, and 3’TS can be between about 1 and about 200 nucleotides in length. In some aspects, targeting sequences of the disclosure are between about 10 and about 150 nucleotides in length. In some aspects, targeting sequences of the disclosure are between about 10 and about 100 nucleotides in length. In some aspects, targeting sequences of the disclosure are between about 20 and about 60 nucleotides in length. In some aspects, targeting sequences of the disclosure are at least about 10, 20, 30, 40, 50, 60, or about 70 nucleotides in length.
[0086] snRNA compositions of the disclosure can comprise more than one targeting sequence, wherein each targeting sequence binds a distinct RNA sequence. In some aspects, snRNA of the disclosure comprise a fusion targeting sequence. In some aspects, a fusion targeting sequence is a nucleic acid sequence comprising two or more targeting sequences directly connected to each other, or connected by one or more linker nucleic acid sequences, or a combination thereof. In some embodiments, each targeting sequence binds a distinct RNA sequence. In some embodiments, the distinct RNA sequences are within the same target sequence, z.e., a GAA or GYSI RNA sequence, as described herein. In some embodiments, each targeting sequence binds a different target RNA sequence.
[0087] In one non-limiting example, U7 snRNA can be programmed by replacing the histone mRNA binding sequence with a sequence complementary to a target of interest. In some aspects, snRNA systems of the disclosure bind a target mRNA or pre-mRNA sequence of interest. The exemplary snRNA systems shown herein lead to exon skipping or exon inclusion for treating Pompe disease. Of late-onset Pompe disease (LOPD) patients, 40-70%carry a mutation c.-32-13T>G disrupting the polypyrimidine tract in GAA intron 1 leading to mis-splicing and the exclusion of exon 2 with or without the presence of a pseudo-exon. This mis-splicing event leads to a frameshift with a premature termination codon (PTC) and subsequent nonsense mediated decay. The SV2 and SV3 variants are the most common products from the mis-splicing that occurs as a result of the c.-32-13T>G mutation in intron 1 of the GAA gene. U7 snRNAs were engineered to bind and block those sites in the polypyrimidine track of GAA intron 1 or core regulatory elements (splice acceptor and donor sites) to promote inclusion of exon 2 and restoration of the GAA frame, leading to normal expression and function.
[0088] In some embodiments, snRNAs of the disclosure target a pre-mRNA or mRNA sequence encoding the GAA protein. GAA is a gene encoding acid alpha-glucosidase (also known as acid maltase). Mutations in GAA are associated with Pompe disease. In some embodiments, the GAA RNA sequence targeted by snRNA compositions of the disclosure can be any exonic or intronic GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by snRNA compositions of the disclosure is an intron 1 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by the snRNA compositions of the disclosure is an intronic pseudo-exon GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by the snRNA compositions of the disclosure is a pseudo-exon located in intron 1 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by snRNA compositions of the disclosure is a human intron 1 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by snRNA compositions of the disclosure is a murine intron 1 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by the snRNA compositions of the disclosure is an exon 2 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by the snRNA compositions of the disclosure is a human exon 2 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by the snRNA compositions of the disclosure is a murine exon 2 GAA RNA sequence. In some embodiments, the GAA RNA sequence targeted by the snRNA of the disclosure is a splice acceptor sequence, a splice donor sequence, or an exon splice enhancer sequence. In some embodiments, the snRNAs of the disclosure target any combination of a splice acceptor sequence, a splice donor sequence, and an exon splice enhancer sequence.
[0089] In some embodiments, snRNAs of the disclosure target a pre-mRNA or mRNA sequence encoding the GYSI protein. GYSI is a gene encoding muscle glycogen synthase. GYSI is associated with glycogen synthesis. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure can be any exonic or intronic GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure is an exon 6 GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure is a human exon 6 GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure is a murine exon 6 GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure is an exon 5 GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure is a human exon 5 GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by snRNA compositions of the disclosure is a murine exon 5 GYSI RNA sequence. In some embodiments, the GYSI RNA sequence targeted by the snRNA of the disclosure is a splice acceptor sequence, a splice donor sequence, or an exon splice enhancer sequence. In some embodiments, the snRNAs of the disclosure target any combination of a splice acceptor sequence, a splice donor sequence, and an exon splice enhancer sequence.
[0090] In some embodiments, the GAA or GYSI RNA sequence targeted by snRNA compositions of the disclosure is a mutant GAA or GYSI.
[0091] In some embodiments, the nucleic acid sequence encoding wild-type human GAA mRNA comprises or consists of SEQ ID NO: 197. In some embodiments, the nucleic acid sequence encoding wild-type human GAA mRNA comprises a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO: 197. In some embodiments, the nucleic acid sequence encoding wild-type human GAA mRNA comprises a sequence having 1, 2, 3, or 4 substitutions, insertions or deletions relative to SEQ ID NO: 197.
[0092] In some embodiments, the target sequence binds human GAA intron 1, wherein GAA maps to 78,075,332-78,093,680 in GRCh37 coordinates. In some embodiments, the GAA gene comprises Ensembl Gene ID ENSG00000171298.15.
[0093] Targeting sequences that bind human GAA intron 1 can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%,96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences set forth in Table 1, which follows:Table 1: GAA Intron 1 Targeting Sequences
[0094] In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 1. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 2. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 3. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 4. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 5. In some embodiments, the targeting sequence that binds humanGAA intron 1 comprises the sequence set forth in SEQ ID NO: 6. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 9. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 10. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 11. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 12. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 14.
[0095] In some embodiments, the targeting sequence comprises, consists of, or consists essentially of the sequence set forth in any one of SEQ ID NOs: 1-14, or a sequence having 1, 2, 3, or 4 substitutions, insertions or deletions relative thereto.
[0096] The sequences set forth in Table 1 may be combined to generate fusion spaces. Any first sequence set forth in Table 1 may combined with any second sequence set forth in Table 1. Illustrative fusion spacers are set forth in Table 2. Targeting sequences that bind human GAA intron 1 or exon 2 can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences set forth in Table 2, which follows.Table 2: GAA Intron 1 and Exon 2 Fusion Spacer Targeting Sequences
[0097] In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 15. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 16. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 18. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 19. In some embodiments, the targeting sequence that binds human GAA intron 1 comprises the sequence set forth in SEQ ID NO: 20. In some embodiments, the targeting sequence that binds human GAA exon 2 comprises the sequence set forth in SEQ ID NO: 21. In some embodiments, the targeting sequence that binds human GAA exon 2 comprises the sequence set forth in SEQ ID NO: 22. In some embodiments, the targeting sequence that binds human GAA exon 2 comprises the sequence set forth in SEQ ID NO: 23. In some embodiments, the targeting sequence that binds human GAA exon 2 comprises the sequence set forth in SEQ ID NO: 24.
[0098] In some embodiments, the targeting sequence comprises, consists of, or consists essentially of the sequence set forth in any one of SEQ ID NOs: 15-24, or a sequence having 1, 2, 3, or 4 substitutions, insertions or deletions relative thereto.
[0099] In some embodiments, the nucleic acid sequence encoding wild-type human GYSI SmRNA comprises or consists of SEQ ID NO: 198. In some embodiments, the nucleic acid sequence encoding wild-type human GYSI mRNA comprises a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence set forth in SEQ ID NO: 198. In some embodiments, the nucleic acid sequence encoding wild-type human GYSI mRNA comprises a sequence having 1, 2, 3, or 4 substitutions, insertions or deletions relative to SEQ ID NO: 198.
[0100] In some embodiments, the target sequence binds human GYSI exon 5 or exon 6, wherein GYSI maps to 49,471,387-49,496,567 in GRCh37 coordinates. In some embodiments, the GYSI gene comprises Ensembl Gene ID ENSG00000104812.15.
[0101] Targeting sequences that bind human GYSI exon 5 or exon 6 can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences set forth in Table 3, which follows:Table 3: GYSI Exon 5 and Exon 6 Targeting Sequences
[0102] In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 25. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 26. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 27. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 28. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 29. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 30. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 31. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 32. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 33. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 34. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 35. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 36. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 37. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 38. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 39. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 40. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 41. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 42. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 43. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 44. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 45. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 46. In some embodiments, the targetingsequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 47. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 48. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 49. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 50. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 51. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 52. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 53. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 54. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 55.
[0103] In some embodiments, the targeting sequence comprises, consists of, or consists essentially of the sequence set forth in any one of SEQ ID NOs: 25-55, or a sequence having 1, 2, 3, or 4 substitutions, insertions or deletions relative thereto.
[0104] Individual sequences set forth in Table 3 may be combined to generate fusion spaces. Any first sequence set forth in Table 3 may combined with any second sequence set forth in Table 3.
[0105] Illustrative fusion spacers are set forth in Table 4. Targeting sequences that bind human GYSI exon 5 or exon 6 can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences set forth in Table 2, which follows.Table 4: GYSI Exon 5 and Exon 6 Fusion Spacer Targeting Sequences
[0106] In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 56. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 57. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 58. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 59. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 60. In some embodiments, the targeting sequence that binds human GYSI exon 5 comprises the sequence set forth in SEQ ID NO: 61. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 62. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 63. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 64. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 65. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 66. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 67. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 68. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 69. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 70. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 71. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 72. In some embodiments, the targeting sequence that binds human GYSI exon 6 comprises the sequence set forth in SEQ ID NO: 73.
[0107] In some embodiments, the targeting sequence comprises, consists of, or consists essentially of the sequence set forth in any one of SEQ ID NOs: 56-73, or a sequence having 1, 2, 3, or 4 substitutions, insertions or deletions relative thereto.Stem Loops
[0108] The engineered snRNA (esnRNA) system and snRNA systems disclosed herein can comprise a stem loop (SL) which includes compensatory modifications to a native snRNA stem loop (sometimes referred to herein as an “engineered stem loop” or “eSL”). These modifications result in increased stability of the engineered small nuclear ribonuclear protein complex (esnRNP) compared to snRNP comprising an unmodified stem loop. An SL disclosed herein can be derived from any snRNP such as U1-U12. In one embodiment, the SL is a human or mouse U7 SL. In one embodiment, the SL is a human SL. In one embodiment, the SL is a mouse SL. In some embodiments, the SL is a human and mouse SL. In some embodiments, the SL is a non-human SL, e.g., a mouse SL, a pig SL, a sheep SL, a goat SL, a cow SL, a dog SL, a cat SL, a horse SL, or a combination thereof. In some embodiments, the SL sequence is not a native stem loop sequence. In some embodiments, the nucleic acid sequence of the SL is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) is not a native stem loop sequence. Engineered stem loops are described in WO2023168458, the contents of which are incorporated herein by reference in its entirety for examples of SL sequences that may be used in the constructs described herein.
[0109] In some embodiments, a human SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGCTTTCTGGCTCCTTACCGGAAAGCC (SEQ ID NO: 74),• GGCTTTCTGGGAGGTTACCGGAAAGCC (SEQ ID NO: 75),• GGCTTTCTGGCCTCCTTACCGGAAAGCC (SEQ ID NO: 76),• GGCTTTCTGGGGAGGTTACCGGAAAGCC (SEQ ID NO: 77),• GGCTTTCTGGCTGGCTACCGGAAAGCC (SEQ ID NO: 78),• GGCTTTCTGGCTTCCCCGGAAAGCC (SEQ ID NO: 79),• GGCTTTCTGGCTTCTTCCCGGAAAGCC (SEQ ID NO: 80),• GGCTTTCTGGCAACTTACCGGAAAGCC (SEQ ID NO: 81),• GGCTTTCTGGTTCGGTACCGGAAAGCC (SEQ ID NO: 82),• GGCTTTCTGGAAGCCTTACCGGAAAGCC (SEQ ID NO: 83),• GGCTTTCTGGCTTCTTACCGGAAAGCC (SEQ ID NO: 84), or• GGCTTTCTGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 85).
[0110] In some embodiments, a human SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 74-85. In some embodiments, a human SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 74-85, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0111] In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 74. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 75. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 76. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 77. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 78. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 79. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 80. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 81. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 82. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 83. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 84. In some embodiments, a human SL comprises the sequence set forth in SEQ ID NO: 85.
[0112] In some embodiments, a murine SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGCTTTCTGGCTCCTTACCGGAAAGCCCCT (SEQ ID NO: 86)• GGTTTTCTGACCTCCGTCGGAAAACCCCT (SEQ ID NO: 87),• GGTTTTCTGACCTCCTTCGGTCGGAAAACCCCT (SEQ ID NO: 88),• GGTTTTCTGACCTCCGTCGGAAAACC (SEQ ID NO: 89),• GGTTTTCTGACACTCCGTCGGAAAACCCCT (SEQ ID NO: 90),• GGTTTTCTGATCTCCATCGGAAAACCCCT (SEQ ID NO: 91), or• GGTTTTCCGACCTCCGTCGGAAAACCCCT (SEQ ID NO: 92).
[0113] In some embodiments, a murine SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 86-92. In some embodiments, a murine SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 86-92, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0114] In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 86. In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 87. In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 88. In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 89. In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 90. In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 91. In some embodiments, a murine SL comprises the sequence set forth in SEQ ID NO: 92.
[0115] In some embodiments, a human or murine SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGCTTTCTGGCACTCCACCGGAAAGCCCCT (SEQ ID NO: 93),• GGCTTTCTGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 94), or• GGCTTTCTGGCCTCCACCGGAAAGCCCCT (SEQ ID NO: 95).
[0116] In some embodiments, a human or murine SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93- 95. In some embodiments, a human or murine SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93- 95, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0117] In some embodiments, a human or murine SL comprises the sequence set forth in SEQ ID NO: 93. In some embodiments, a human or murine SL comprises the sequence set forth in SEQ ID NO: 94. In some embodiments, a human or murine SL comprises the sequence set forth in SEQ ID NO: 95.
[0118] In some embodiments, a dog or cat SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,99% or 100% (or any percentage in between) identical to the nucleotide sequence GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO: 96).
[0119] In some embodiments, a dog or cat SL comprises, consists essentially of, or consists of the nucleic acid sequence of SEQ ID NO: 96. In some embodiments, a dog or cat SL comprises, consists essentially of, or consists of the nucleic acid of SEQ ID NO: 96, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0120] In some embodiments, a cow, sheep, or goat SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGCTTTCCGGTCTCCACCGGAAAGCCCCT (SEQ ID NO: 97), or• GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 98).
[0121] In some embodiments, a cow, sheep, or goat SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 97 and 98. In some embodiments, a cow, sheep, or goat SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 97 and 98, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0122] In some embodiments, a cow, sheep, or goat SL comprises the sequence set forth in SEQ ID NO: 97. In some embodiments, a cow, sheep, or goat SL comprises the sequence set forth in SEQ ID NO: 98.
[0123] In some embodiments, a pig SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGTTTTCCGGTCTCCACCGGAAAACCCTT (SEQ ID NO: 99),• GGTTTTCCGTGCTCCCACGGAAAACCCTT (SEQ ID NO: 100),• GGTTTTCCGGCCTCCGCCGGAAAACCCTT (SEQ ID NO: 101),• GGTTTTCCGTGACTCCCACGGAAAACCCTT (SEQ ID NO: 102), or• GGTTTTCCGGCACTCCGCCGGAAAACCCTT (SEQ ID NO: 103).
[0124] In some embodiments, a pig SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 99-103. In some embodiments, a pig SL comprises, consists essentially of, or consists of the nucleic acidsequence selected from the group consisting of SEQ ID NOs: 99-103, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0125] In some embodiments, a pig SL comprises the sequence set forth in SEQ ID NO: 99. In some embodiments, a pig SL comprises the sequence set forth in SEQ ID NO: 100. In some embodiments, a pig SL comprises the sequence set forth in SEQ ID NO: 101. In some embodiments, a pig SL comprises the sequence set forth in SEQ ID NO: 102. In some embodiments, a pig SL comprises the sequence set forth in SEQ ID NO: 103.
[0126] In some embodiments, a horse SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGTCTTCCGGTCTCCTCCGGAAGGCCCCC (SEQ ID NO: 104), or• GGTCTTCCGGCTCCCCGGAAGGCCCCC (SEQ ID NO: 105).
[0127] In some embodiments, a horse SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 104 and 105. In some embodiments, a horse SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 104 and 105, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0128] In some embodiments, a horse SL comprises the sequence set forth in SEQ ID NO: 104. In some embodiments, a horse SL comprises the sequence set forth in SEQ ID NO: 105.
[0129] In some embodiments, a sheep SL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGCTTTCCGTGCTCCCACGGAAAGCCCCT (SEQ ID NO: 106),• GGCTTTCCGTGACTCCCACGGAAAGCCCCT (SEQ ID NO: 107), or• GGCTTTCCGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 108).
[0130] In some embodiments, a sheep SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 106-108. In some embodiments, a sheep SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 106-108, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0131] In some embodiments, a sheep SL comprises the sequence set forth in SEQ ID NO: 106. In some embodiments, a sheep SL comprises the sequence set forth in SEQ ID NO: 107. In some embodiments, a sheep SL comprises the sequence set forth in SEQ ID NO: 108.
[0132] Any of the above embodiments may be engineered stem loops.
[0133] In some embodiments, engineered stem loops provide for enhanced stability of an snRNA relative to an snRNA comprising a native stem loop. In some embodiments is a native snRNA stem loop comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:• GGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 109),• GGTTTTCTGACTTCGGTCGGAAAACC (SEQ ID NO: 110),• GGCTTTCTGGCTTTTTACCGGAAAGCC (SEQ ID NO: 111),• GGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 112),• GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 113), or• GGCTTTCCGGCCTCCGCCGGAAAGCC (SEQ ID NO: 114).
[0134] In some embodiments, a native SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 109-114. In some embodiments, a native SL comprises, consists essentially of, or consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 109-114, or a sequence having 1, 2, 3 or 4 substitutions, insertions or deletions relative thereto.
[0135] In some embodiments a native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 109. In some embodiments a native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 110. In some embodiments a native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 111. In some embodiments a native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 112. In some embodiments a native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 113. In some embodiments, a native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 114.5’ Interaction stability domain
[0136] The SL disclosed herein can possess more effective folding and annealing properties with a 5’ interaction stability domain (5’ISD) and this in turn results in increased stability of the esnRNA compared to a non-engineered snRNA. The 5’ ISD has nucleotides that arecomplementary to the nucleotides within the SL, and without wishing to be bound by theory, an interaction between the 5’ISD and SL is predicted to form secondary structure that protects the 5’ end of an snRNA. In some aspects, the 5’ ISD anneals and / or hybridizes to an SL of the disclosure. In some aspects, the 5’ISD is a sequence having complementarity and / or reverse complementarity to a sequence present in an SL of the disclosure. In some aspects, a 5’ISD disclosed herein can comprise or consist of one of the following nucleotide sequences:• GGAGT,• CCTCT,• GGAGGT,• CCTCCT,• AGCCAG,• GGAAG,• GAAGAAG,• GTTG,• CCGAA,• TAAGGAG,• GAAG, or• GGCTT.Sm Binding Domains
[0137] The snRNA systems disclosed herein can utilize an Sm binding domain (SmBD). The Sm protein ring that assembles around the Sm binding domain (SmBD) to form an snRNP includes SmB / B’, SmDl, SmD2, SmD3, SmE, SmF, and SmG. The U7 Sm binding site recruits endogenous RNA binding factors and can be replaced with a non-U7 snRNA to make the esnRNA more stable. In one embodiment, the SmBD a U1 SmBD, a U2 SmBD, a U4 SmBD, or a SmBD. In another embodiment, the SmBD is derived from a pseudo snRNA. In another embodiment, the SmBD is a nucleotide sequence comprising ATTTTT. In another embodiment, the SmBD comprises the nucleotide sequence AATTTTTGG, AATTTGTGG, AATTTGTGG, AATTTCTGG, GATTTTTGG, AATTTTTGA, AATTTTTTG, AATTTTTGGAGCA (SEQ ID NO: 115), or AATTTTTGGAGTA (SEQ ID NO: 116). In some embodiments, the SmBD comprises the nucleotide sequence AATTTTTGG, AATTTGTGG, AATTTGTGG, AATTTCTGG, GATTTTTGG, AATTTTTGA,AATTTTTTG, AATTTTTGGAGCA (SEQ ID NO: 115), or AATTTTTGGAGTA (SEQ ID NO: 116), or a sequence having 1, 2 or 3 insertions, deletions or substitutions relative thereto.Promoter Sequences
[0138] Gene therapy and RNA-targeting snRNA gene therapy compositions of the disclosure can comprise promoter sequences derived from an snRNA. For example, polynucleotides and vectors comprising the RNA-targeting nucleic acid molecules described herein can comprise a promoter operably linked to the snRNA, or operably linked to more than one snRNA. As a further example, polynucleotides and vectors comprising the RNA-targeting nucleic acid molecules described herein can comprise more than one promoter operably linked to an snRNA.
[0139] A “promoter” is a regulatory sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors.
[0140] The snRNA systems disclosed herein may comprise an snRNA promoter from any one of U1-U12. In one embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U7 promoter is an endogenous human U7 promoter at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 117: TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTGTGACTGGC TGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTT CGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCT ACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAA GTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTC CAAACACATACGCA. In some embodiments, the promoter comprises the sequence of SEQ ID NO: 117, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 insertions, substitutions or deletions relative thereto.
[0141] In one embodiment, the snRNA promoter is a U1 promoter. In another embodiment, the U1 promoter is a human U1 promoter or a mouse U1 promoter.
[0142] In another embodiment, for example those embodiments in which a polynucleotide comprises multiple snRNAs, the same snRNA promoter drives expression of individual hsnRNA inserts. In another embodiment, each snRNA insert is the same sequence. In another embodiment, one or more snRNA inserts are different sequences. In another embodiment, different snRNA promoters drive individual snRNA inserts. In one embodiment, a 2x snRNA comprises a mouse U7 promoter driving one copy of an snRNA insert and a mouse U1 promoter drives the other copy of an snRNA insert.
[0143] In other aspects, the snRNA promoter is a PolII promoter or a PolIII promoter.
[0144] In other aspects, the snRNA promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to a promoter and / or promoter sequence listed in Table 5, which follows:Table 5: Illustrative Promoter Sequences
[0145] In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 117. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 118. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 119. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 120. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 121. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 122. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 123. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 124. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 125. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 126. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 127. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 128. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 129. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 130. In some embodiments, the snRNApromoter comprises the sequence set forth in SEQ ID NO: 131. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 152. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 154. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 156. In some embodiments, the snRNA promoter comprises the sequence set forth in SEQ ID NO: 158. In some embodiments, the snRNA promoter comprises the sequence set forth in in any one of SEQ ID NOs: 117-131, 152, 154, 156 or 158, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 insertions, substitutions or deletions relative thereto.Terminator Sequences
[0146] The snRNA systems (z.e., snRNAs, as well as vectors, polynucleotides and complexes comprising or encoding same) disclosed herein may comprise an snRNA downstream terminator (DT). Downstream terminators define the end of a transcriptional unit, such as an esnRNA or snRNA. In another embodiment, the snRNA DT is a U7 DT comprising the sequence CCTCTTATGATGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGG GTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAG (SEQ ID NO: 139). In another embodiment, the snRNA DT is a U7 DT comprising the sequence of SEQ ID NO: 139, or a sequence having 1, 2, 3, 4 or 5 insertions, substitutions or deletions relative thereto.
[0147] In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises the SL or eSL, one or more promoters, the TS targeting a GAA or GYSI RNA molecule, the SmBD, the 5’ISD, and the DT. In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises the SL or eSL, one promoter, the TS targeting a GAA RNA molecule, the SmBD, the 5’ISD, and the DT. In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises the SL or eSL, more than one promoter, the TS targeting a GAA RNA molecule, the SmBD, the 5’ISD, and the DT. In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises the SL or eSL, one promoter, the TS targeting a GSY1 RNA molecule, the SmBD, the 5’ISD, and the DT. In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises the SL or eSL, more than one promoter, the TS targeting a GSY1 RNA molecule, the SmBD, the 5’ISD, and the DT.
[0148] In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises a native stem loop, one or more promoters, the TS targeting GAA or GYSI, the SmBD, and the DT. In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises a native stem loop, one promoter, the TS targeting GAA, the SmBD, and the DT. In some embodiments, the snRNA comprises a native stem loop, more than one promoter, the TS targeting GAA, the SmBD, and the DT. In some embodiments, the snRNA or RNA-targeting nucleic acid molecule comprising same comprises a native stem loop, one promoter, the TS targeting GSY1, the SmBD, and the DT. In some embodiments, the snRNA comprises a native stem loop, more than one promoter, the TS targeting GSY1, the SmBD, and the DT.
[0149] The promoter and DT sequences provided herein may be mixed and matched in any combination.
[0150] In some embodiments, the DT comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to a DT sequence listed in Table 6, which follows:Table 6: Illustrative DT Sequences
[0151] In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 132.In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 133. In someembodiments, the DT comprises the sequence set forth in SEQ ID NO: 134. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 135. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 136. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 137. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 138. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 139. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 140. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 141. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 142. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 153. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 155. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 157. In some embodiments, the DT comprises the sequence set forth in SEQ ID NO: 159. In some embodiments, the DT comprises the sequence of TTTTTT. In some embodiments, the DT comprises, consists essentially of, or consists of the nucleic acid sequence set forth in any one of SEQ ID NOs: 132-142, 153, 155, 157, or 159, or a sequence having 1, 2, 3, 4 or 5 insertions, substitutions or deletions relative thereto.
[0152] In one embodiment, the snRNA or RNA-targeting nucleic acid molecule comprising same is delivered by an AAV vector. In one embodiment, the snRNA is delivered by a lentiviral vector.
[0153] In some embodiments, the AAV vector or lentiviral vector comprises multiple sequences encoding snRNA molecules of the disclosure. In some embodiments, the multiple sequences of snRNA are 2, 3, 4, 5, 6, 7, 8, 9, or 10 snRNA sequences. In some embodiments, the multiple sequences of snRNA are 4 or more snRNA sequences. In some embodiments, the AAV comprises sequences encoding multiple snRNA (z.e., two or more snRNA), and the two or more of the snRNA are not the same. For example and without limitation, snRNA that do not have the same targeting sequence are not the same. As a further example, snRNA that comprise different features other than the targeting sequence, e.g. different SL, are also not the same. In some embodiments, the AAV comprises sequences encoding two snRNA, and the two snRNA are not the same. In some embodiments, the AAV comprises sequences encoding three snRNA, and the three snRNA are not the same. In some embodiments, the AAV comprises sequences encoding four snRNA, and the four snRNA are not the same. Insome embodiments, the AAV comprises sequences encoding five snRNA, and the five snRNA are not the same.
[0154] In some embodiments, each sequence encoding the snRNA of the multiple snRNA or / or multiple distinct sequences are separated by a nucleic acid buffer sequence derived from human non-coding genomic sequences downstream of an snRNA. In one embodiment, the buffer sequence is derived from human genomic sequences downstream of U7.
[0155] In some embodiments, the buffer sequence is one of the following nucleic acid sequences:• buffer 1 (30bp): CAAACTACAGAGCCAAGTGCTATCCACAGA (SEQ ID NO:143),• buffer 2 (30bp): GAGCTTTCTGGGTTGCCATCTCAAGCAGAC (SEQ ID NO:144),• buffer 3 (30bp): TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO:145), or• a combination thereof.
[0156] In another embodiment, the buffer sequence is one of the following nucleic acid sequences:• buffer 1 (lOObp):CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAG CAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAG (SEQ ID NO:146),• buffer 2 (lOObp):TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAAC TGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTC (SEQ ID NO:147), or• a combination thereof.
[0157] In another embodiment, the buffer sequence is one of the following nucleic acid sequences:• buffer 1 (500bp):CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAGTCATTTTCCAATGCTCCTACACACCCCTTCTTCACAATCCCCAACAAATCTGAGGCTGGAACTTGGTACCATAACAATCATTACATTATTTCACCAGAAGTACACCTTGCCTGGAAGATT GGCATTATAGCATCTTCTAACATTGTGAAAGTTAGTGACCAATGAGGAGATCCAA GTCAGTTCCAGTTGGATTTCTCTATACTCTATAATAAATATATATGGTGTCTTCAA CAATAGGACTTTGCCATCCAGTGATGCTAAAAATCAATAACAATGGCAATAACC TGCCCTGTTTGGAAAGCCTCTGGCTTCCATGACTAACAATTCAAGGCAGGTCTCC TATACCTAGTACTGAGATTTTTATTTGATAAACTATATCTTCTGGGAGGAGAAGC ATTGT (SEQ ID NO: 148),• buffer 2 (5OObp): TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAAC TGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTCTCTGAAATAGT TTTGCTTTCTCTCTCTAGGTCTGTTCTATACTCCTAACTCTCCAGGAGTTTACAAG GAATAAAATCTCTTCCAAATGCTTTCTGTTGCAACAACTGGACCATACTGAAAGC TGAGGCCCACAATTGCAATCTAGGTTAGCAGGTAATCATTGTTGGTGAGGTCCTC CCTTTCCCCAGGCTCGTGTTTGTATTGGGGAGCAGGAAATTTTTGCTAGAGCAGC ACTGCCATCTCTCTACACTCCACCTGATTGGTGGGATGGACCAGAGAAATGGACA TTCCCAACACAGTCCCTCCTTTCACATCTGCTCACCTGCCCACAGGATACTTTCCA CCATGCATACTGGGCTCTGCACCAACCATTCAGCAGTGATGAAGAGGAAACTTG AAC (SEQ ID NO: 149), or• a combination thereof.
[0158] In some embodiments, the buffer sequence comprises, consists of, or consists essentially of the sequence selected from the group consisting of SEQ ID NOs: 143-149, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 insertions, substitutions or deletions relative thereto. In some embodiments, the buffer sequence comprises, consists of, or consists essentially of the sequence selected from the group consisting of SEQ ID NOs: 143-149, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% identity thereto.
[0159] The lOObp and 500bp buffer 1 sequences are derived from a sequence starting lOObp downstream of the mus musculus U7 pseudogene 8 (Location Chromosome 14: 4,409,359- 4,409,421 reverse strand. GRCm39 :CM001007.3). The lOObp and 500bp buffer 2 sequences are derived from the sequence starting 130bp downstream of human U7 pseudogene 5 (Chromosome X: 140,451,148-140,451,208 forward strand.GRCh38:CM000685.2). BothlOObp buffers are the first lOObp of the corresponding 5OObp buffer (e.g., “buffer 1 (100 bp)” consists of the first 100 bp of “buffer 1 (500 bp”). The 30bp buffers 1, 2, and 3, are sequential 30bp sequences within “lOObp buffer 1”, downstream of the mus musculus U7 pseudogene 8. These downstream sequences were selected due to the lack of any known regulatory sites or genes within or nearby to the sequence (using Gencode / Ensembl), in addition to lack of repetitive sequence, 40-60% GC content for total buffer, 40-60% GC content in the 20bp region at both ends of the buffer, and minimal sequence complexity.Exemplary snRNA Sequences
[0160] The snRNA sequences of the disclosure can comprise any combination of esnRNA or snRNA features described herein.
[0161] In some embodiments, the snRNA comprises a targeting sequence that binds a GAA RNA sequence and a SL. In some embodiments, the GAA targeting sequence comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-24. In some embodiments, the SL comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 74-114. In some embodiments, the SL comprises or consists of the nucleic acid sequence set forth in SEQ ID NO: 87 or SEQ ID NO: 89.
[0162] In some embodiments, the snRNA comprises a targeting sequence that binds an GAA RNA sequence comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-24, and a SL comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 74-114. In some embodiments, the snRNA comprises a targeting sequence that binds a GAA RNA sequence comprising the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-24, and the SL comprises the nucleic acid sequence set forth in SEQ ID NO: 87 or SEQ ID NO: 89.
[0163] In some embodiments, the GAA targeting sequence is positioned 5’ of the SL.
[0164] In some embodiments, the snRNA comprises a targeting sequence that binds a GYSI RNA sequence and a SL. In some embodiments, the GYSI targeting sequence comprises anucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 25-73. In some embodiments, the SL comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 74-114. In some embodiments, the SL comprises or consists of the nucleic acid sequence set forth in SEQ ID NO: 87 or SEQ ID NO: 89.
[0165] In some embodiments, the snRNA comprises a targeting sequence that binds an GYSI RNA sequence comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 25-73, and a SL comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 74-114. In some embodiments, the snRNA comprises a targeting sequence that binds an GYSI RNA sequence comprising the nucleic acid sequence set forth in any one of SEQ ID NOs: 24-73, and the SL comprises the nucleic acid sequence set forth in SEQ ID NO: 87 or SEQ ID NO: 89.
[0166] In some embodiments, the GYSI targeting sequence is positioned 5’ of the SL.Polynucleotides and Vectors
[0167] Also provided herein are polynucleotides and vectors (e.g., recombinant expression vectors) comprising snRNA(s) targeting GAA and / or GYSI or RNA-targeting nucleic acid molecules comprising same.
[0168] In some embodiments of the compositions and methods of the disclosure, a polynucleotides or vector comprises or encodes an snRNA system targeting GAA and / or GYSI provided herein. In some embodiments, the vector is a single or unitary vector.
[0169] Provided herein is a polynucleotide or vector comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-169, 185, 190, 192, 194, 196, 199, or 200. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 160. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 161. In some embodiments, the polynucleotide or vector comprises thenucleic acid sequence set forth in SEQ ID NO: 162. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 163. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 164. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 165. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 166. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 167. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 168. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 169. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 185. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 190. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 192. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 194. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 196. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 199. In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in SEQ ID NO: 200.
[0170] In some embodiments, the polynucleotide or vector comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-169, 185, 190, 192, 194, 196, 199, or 200, or a sequence having 1, 2, 3, 4 or 5 insertions, deletions or substitutions relative thereto.
[0171] In some embodiments of the compositions and methods of the disclosure, a polynucleotide or vector comprises or encodes an snRNA system targeting GAA and / or GYSI provided herein. In some embodiments, the vector is a single or unitary vector. For example, a polynucleotide or vector comprises or encodes one or more snRNA comprising a targeting sequences that bind GAA and comprises or encodes one or more snRNA comprising a targeting sequence that binds GYSI. Alternatively, the polynucleotide or vector comprises or encodes one or more snRNA comprising a targeting sequences that bind GAA (and no snRNA comprising targeting sequences that bind GYSI . As a still further example, thepolynucleotide or vector comprises or encodes one or more snRNA comprising a targeting sequences that bind GYSI (and no snRNA comprising targeting sequences that bind GAA).
[0172] In some embodiments, snRNA system is capable of targeting one or more GAA and / or GYSI RNA sequences. In some aspects, the GAA and / or GYSI RNA sequence is a GAA and / or GYSI pre-mRNA sequence. In some aspects, the snRNA systems are capable of targeting multiple (z.e., two or more) RNAs of interest. In some embodiments, the two or more RNAs of interest can be the same pre-mRNA molecule but different sequences within the pre-mRNA molecule, e.g. different exons, exon and untranslated region, and the like. In some embodiments, the two or more RNAs of interest can be different pre-mRNA molecules, e.g. GAA and GYSI.
[0173] One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which DNA segments in addition to the nucleotide of interest can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. In some embodiments, the vector is a lentiviral (such as an integration-deficient lentiviral vector) or adeno-associated viral (AAV) vector. Vectors may be capable of autonomous replication in a host cell into which they are introduced such as e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors and other vectors such as, e.g., non-episomal mammalian vectors, are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
[0174] In some embodiments, vectors such as e.g., expression vectors, are capable of directing the expression of genes they contain. Common expression vectors are often in the form of plasmids. In some embodiments, recombinant expression vectors comprise or encode a nucleic acid provided herein such as e.g., an snRNA or esnRNA or RNA-targeting nucleic acid molecule comprising same in a form suitable for expression of an RNA molecule in a host cell. Recombinant expression vectors can include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively linked to the nucleic acid sequence to be expressed.
[0175] Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence such as e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell. In some embodiments, the regulatory element is a promoter described herein. In some embodiments, the regulatory element is a terminator provided herein.
[0176] Certain embodiments of a vector depend on factors such as the choice of the host cell to be transformed, and the level of expression desired. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein such as, e.g., snRNAs, esRNAs, RNA- targeting nucleic acid molecules, CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.
[0177] In some embodiments of the compositions and methods of the disclosure, an expression vector, viral vector or non-viral vector provided herein, includes without limitation, an expression control element. An “expression control element” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene. Exemplary expression control elements include but are not limited to promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements may be constitutive, inducible, repressible, or tissuespecific, for example. A “promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. An “enhancer” is a region of DNA that can be bound by activating proteins to increase the likelihood or frequency of transcription.
[0178] In some embodiments of the compositions and methods of the disclosure, an expression vector, viral vector or non-viral vector provided herein, includes without limitation, vector elements such as a buffer sequence derived human genomic sequences downstream from an snRNA and as such have the capability of encoding multiple snRNAs from a single construct.
[0179] In some embodiments, the snRNA constructs disclosed herein comprise bidirectional snRNA promoters to express snRNAs.
[0180] In another embodiment, the vector configurations can comprise linker(s), signal sequence(s), and / or tag(s).Viral Vectors
[0181] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenoviral / retroviral chimera vector, a herpes simplex viral I or II vector, a parvoviral vector, a reticuloendotheliosis viral vector, a polioviral vector, a papillomaviral vector, a vaccinia viral vector, or any hybrid or chimeric vector incorporating favorable aspects of two or more viral vectors.
[0182] In some embodiments, the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the vector has low toxicity. In some embodiments, the vector does not incorporate into the host genome, thereby having a low probability of causing insertional mutagenesis.
[0183] In some embodiments, the vector is an AAV vector. In some embodiments, the AAV vector can encode a range of total polynucleotides from 4.5 kb to 4.75 kb. In some embodiments, exemplary AAV vectors that may be used in any of the herein described compositions, systems, methods, and kits can include an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV2-Tyr mutant vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAVrh8 vector, an AAV9 vector, an AAV.rhlO vector, a modified AAV.rhlO vector, an AAVrh.74, an AAV.rh32 / 33 vector, a modified AAV.rh32 / 33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, an AAV.rh64Rl vector, and a modified AAV.rh64Rl vector, an AAV-Tyr mutant vector, AAV- Tyr-Ser mutant vector, AAV-Tyr-Ser-Thr mutant vector and any combinations or equivalents thereof.
[0184] In some embodiments, the vector is a lentiviral vector. In some embodiments, the lentiviral vector can encode a range of total polynucleotides from 8 kb to 10 kb. In some embodiments, exemplary lentiviral vectors that may be used in any of the herein described compositions, systems, methods, and kits can include a human immunodeficiency virus (HIV) 1 vector, a modified human immunodeficiency virus (HIV) 1 vector, a humanimmunodeficiency virus (HIV) 2 vector, a modified human immunodeficiency virus (HIV) 2 vector, a sooty mangabey simian immunodeficiency virus (SIVSM) vector, a modified sooty mangabey simian immunodeficiency virus (SIVSM) vector, a African green monkey simian immunodeficiency virus (SIVAGM) vector, a modified African green monkey simian immunodeficiency virus (SIVAGM) vector, an equine infectious anemia virus (EIAV) vector, a modified equine infectious anemia virus (EIAV) vector, a feline immunodeficiency virus (FIV) vector, a modified feline immunodeficiency virus (FIV) vector, a Visna / maedi virus (VNV / VMV) vector, a modified Visna / maedi virus (VNV / VMV) vector, a caprine arthritisencephalitis virus (CAEV) vector, a modified caprine arthritis-encephalitis virus (CAEV) vector, a bovine immunodeficiency virus (BIV), or a modified bovine immunodeficiency virus (BIV) and any combination or equivalents thereof. In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, the lentiviral vector can refer to the transgene plasmid vector as well as the transgene plasmid vector in conjunction with related plasmids (e.g., a packaging plasmid, a rev expressing plasmid, an envelope plasmid) as well as a lentiviral-based particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.
[0185] In some embodiments, the viral vector comprises a sequence isolated or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence isolated or derived from a lentivirus. In some embodiments, the viral vector comprises a sequence isolated or derived from an adenovirus. In some embodiments, the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is replication incompetent. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.
[0186] In some embodiments, the vector further comprises one or more expression control elements operably linked to the polynucleotide comprising or encoding the snRNA or esnRNA described herein. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the vector has low toxicity. In some embodiments, the vector does not incorporate into the host genome, thereby having a low probability of causing insertional mutagenesis.Lentiviral Vectors
[0187] Lentiviral vectors are well-known in the art (see, e.g., Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses3(2): 132-159 doi: 10.3390 / v3020132). In some embodiments, exemplary lentiviral vectors that may be used in any of the herein described compositions, systems, methods, and kits can include a human immunodeficiency virus (HIV) 1 vector, a modified human immunodeficiency virus (HIV) 1 vector, a human immunodeficiency virus (HIV) 2 vector, a modified human immunodeficiency virus (HIV) 2 vector, a sooty mangabey simian immunodeficiency virus (SIVSM) vector, a modified sooty mangabey simian immunodeficiency virus (SIVSM) vector, a African green monkey simian immunodeficiency virus (SIVAGM) vector, a modified African green monkey simian immunodeficiency virus (SIVAGM) vector, an equine infectious anemia virus (EIAV) vector, a modified equine infectious anemia virus (EIAV) vector, a feline immunodeficiency virus (FIV) vector, a modified feline immunodeficiency virus (FIV) vector, a Visna / maedi virus (VNV / VMV) vector, a modified Visna / maedi virus (VNV / VMV) vector, a caprine arthritis-encephalitis virus (CAEV) vector, a modified caprine arthritis-encephalitis virus (CAEV) vector, a bovine immunodeficiency virus (BIV), or a modified bovine immunodeficiency virus (BIV).
[0188] A lentiviral vector described herein may comprise, consist essentially of, or consist of one or more nucleic acid molecules and one or more lentiviral LTRs. In some aspects, the nucleic acid molecule encodes one or more snRNA, esnRNA or RNA-targeting nucleic acid molecule comprising same of the disclosure. Such lentiviral vectors can be replicated and packaged into infectious viral particles when present in a host cell that provides the functionality of rep and cap gene products, for example, by transfection of the host cell. In some aspects, lentiviral vectors contain a promoter, at least one nucleic acid that may encode at least one protein or RNA, and / or an enhancer and / or a terminator within the flanking LTRs that is packaged into the infectious lentiviral particle. The encapsidated nucleic acid portion may be referred to as the lentiviral vector genome. Plasmids containing lentiviral vectors may also contain elements for manufacturing purposes, e.g., antibiotic resistance genes, origin of replication sequences etc., but these are not encapsidated and thus do not form part of the lentiviral particle.
[0189] In some aspects, a lentiviral vector can comprise at least one nucleic acid encoding one or more snRNA, esnRNA or RNA-targeting nucleic acid molecule comprising same of the disclosure. In some aspects, a lentiviral vector can comprise at least one regulatory sequence. In some aspects, a lentiviral vector can comprise at least one lentiviral long terminal repeat (LTR) sequence. In some aspects, a lentiviral vector can comprise a first LTRsequence and a second LTR sequence. In some aspects, a lentiviral vector can comprise at least one promoter sequence. In some aspects, a lentiviral vector can comprise at least one enhancer sequence. In some aspects, a lentiviral vector can comprise at least one terminator sequence. In some aspects, a lentiviral vector can comprise at least one polyA sequence. In some aspects, a lentiviral vector can comprise at least one linker sequence. In some aspects, a lentiviral vector can comprise at least one buffer sequence. In some aspects, a lentiviral vector of the disclosure can comprise at least one nuclear localization signal, or nuclear export signal and / or both.
[0190] In some aspects, a lentiviral vector can comprise a first lentiviral LTR sequence, a promoter sequence, an snRNA or esnRNA sequence, a terminator sequence and a second lentiviral LTR sequence. In some aspects, a lentiviral vector can comprise, in the 5’ to 3’ direction, a first lentiviral LTR sequence, a promoter sequence, an snRNA or esnRNA sequence, a terminator sequence, and a second lentiviral LTR sequence.
[0191] In some aspects, a lentiviral vector can comprise a first lentiviral LTR sequence, a first promoter sequence, a first snRNA or esnRNA sequence, a termination sequence, a second promoter sequence, second snRNA or esnRNA sequence, a second termination sequence and a second lentiviral LTR sequence. In some aspects, a lentiviral vector can comprise a first lentiviral LTR sequence, a first promoter sequence, a first snRNA or esnRNA sequence, a termination sequence, a second promoter sequence, a second snRNA or esnRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA or esnRNA sequence, a third termination sequence, and a second lentiviral LTR sequence. In some aspects, a lentiviral vector can comprise a first lentiviral LTR sequence, a first promoter sequence, a first snRNA or esnRNA sequence, a termination, a second promoter sequence, a second snRNA or esnRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA or esnRNA sequence, a third termination sequence, a fourth promoter sequence, a fourth snRNA or esnRNA sequence, a fourth termination sequence, and a second lentiviral LTR sequence.Lentiviral LTR Sequences
[0192] In some embodiments of the compositions and methods of the disclosure, a lentiviral long terminal repeat sequence can comprise any lentiviral LTR sequence known in the art. In some aspects, a lentiviral LTR sequence can comprise or consist of a human immunodeficiency virus (HIV) 1 LTR sequence, a modified human immunodeficiency virus(HIV) 1 LTR sequence, a human immunodeficiency virus (HIV) 2 LTR sequence, a modified human immunodeficiency virus (HIV) 2 LTR sequence, a sooty mangabey simian immunodeficiency virus (SIVSM) LTR sequence, a modified sooty mangabey simian immunodeficiency virus (SIVSM) LTR sequence, an African green monkey simian immunodeficiency virus (SIVAGM) LTR sequence, a modified African green monkey simian immunodeficiency virus (SIVAGM) LTR sequence, an equine infectious anemia virus (EIAV) LTR sequence, a modified equine infectious anemia virus (EIAV) LTR sequence, a feline immunodeficiency virus (FIV) LTR sequence, a modified feline immunodeficiency virus (FIV) LTR sequence, a Visna / maedi virus (VNV / VMV) LTR sequence, a modified Visna / maedi virus (VNV / VMV) LTR sequence, a caprine arthritis-encephalitis virus (CAEV) LTR sequence, a modified caprine arthritis-encephalitis virus (CAEV) LTR sequence, a bovine immunodeficiency virus (BIV) LTR sequence, or a modified bovine immunodeficiency virus (BIV) LTR sequence.
[0193] In some aspects, the LTR sequence can comprise a modified lentiviral LTR sequence.
[0194] In some aspects, a lentiviral LTR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 170 or SEQ ID NO: 171. In some aspects, a lentiviral LTR sequence can comprise, consist essentially of, or consist of the nucleic acid sequence of SEQ ID NO: 170 or 171, or a sequence having 1, 2, 3, 4 or 5 insertions, deletions or substitutions relative thereto.
[0195] In some embodiments, a lentiviral vector provided herein comprises a first and a second lentiviral LTR sequence. In some aspects, a first lentiviral LTR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 170 or SEQ ID NO: 171 and a second lentiviral LTR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 170 or SEQ ID NO: 171. In some aspects, the first lentiviral LTR sequence is positioned at the 5’ end of a lentiviral vector. In some aspects, the second lentiviral LTR sequence is positioned at the 3’ end of a lentiviral vector.
[0196] In some aspects, a first lentiviral LTR sequence comprises the sequence set forth in SEQ ID NO: 170 or SEQ ID NO: 171. In some aspects, a second lentiviral LTR sequencecomprises the sequence set forth in SEQ ID NO: 170 or SEQ ID NO: 171. In some embodiments, a lentiviral vector provided herein comprises a first lentiviral LTR sequence comprising the sequence set forth in SEQ ID NO: 170 and a second lentiviral LTR sequence comprising the sequence set forth in SEQ ID NO: 171. In some aspects, the first lentiviral LTR sequence is positioned at the 5’ end of a lentiviral vector. In some aspects, the second lentiviral LTR sequence is positioned at the 3’ end of a lentiviral vector.
[0197] In some embodiments of the compositions and methods of the disclosure, the viral vector comprises a sequence isolated or derived from a lentivirus.
[0198] In some embodiments of the compositions and methods of the disclosure, a vector of the disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or a lipoplex, a polymersome, a polyplex or a dendrimer. In some embodiments, the nanoparticle comprises a lipid nanoparticle. In some embodiments, the vector is an expression vector or recombinant expression system. As used herein, the term “recombinant expression system” refers to a genetic construct for the expression of certain genetic material formed by recombination.Adeno-associated Virus Vectors
[0199] In some aspect, a vector described herein is an AAV viral vector. The term “adeno- associated virus” or “AAV” as used herein refers to a member of the class of viruses associated with this name and belonging to the genus Dependoparvovirus, family Parvoviridae. Adeno-associated virus is a single-stranded DNA virus that grows in cells in which certain functions are provided by a co-infecting helper virus. General information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169- 228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). It is fully expected that the same principles described in these reviews will be applicable to additional AAV serotypes characterized after the publication dates of the reviews because it is well known that the various serotypes are quite closely related, both structurally and functionally, even at the genetic level. See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J. R. Pattison, ed.; and Rose, Comprehensive Virology 3 : 1-61 (1974)). For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all bear three related capsid proteins such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis which reveals extensive cross-hybridization between serotypes along the length ofthe genome; and the presence of analogous self-annealing segments at the termini that correspond to “inverted terminal repeat sequences” (ITRs). The similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from various tissue types.
[0200] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells, allowing the possibility of targeting many different tissues in vivo. AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA in plasmids, which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA to generate AAV vectors. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV- infected cells are not resistant to superinfection.
[0201] Recombinant AAV (rAAV) genomes of the invention may comprise, consist essentially of, or consist of a nucleic acid molecule encoding at least one snRNA or esnRNA, or RNA-targeting nucleic acid molecule comprising same, and one or more AAV ITRs flanking the nucleic acid molecule. Production of pseudotyped rAAV is disclosed in, for example, W02001083692. Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, e.g., Marsic et al., Molecular Therapy, 22(11): 1900- 1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.
[0202] An AAV vector described herein may comprise, consist essentially of, or consist of one or more nucleic acid molecules and one or more AAV ITRs. In some aspects, the nucleic acid molecule encodes an snRNA, esnRNA or RNA-targeting nucleic acid moleculecomprising same of the disclosure. Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that provides the functionality of rep and cap gene products, for example, by transfection of the host cell. In some aspects, AAV vectors contain a promoter, at least one nucleic acid that may encode at least one protein or RNA, and / or an enhancer and / or a terminator within the flanking ITRs that is packaged into the infectious AAV particle. The encapsidated nucleic acid portion may be referred to as the AAV vector genome. Plasmids containing AAV vectors may also contain elements for manufacturing purposes, e.g., antibiotic resistance genes, origin of replication sequences etc., but these are not encapsidated and thus do not form part of the AAV particle.
[0203] In some aspects, an AAV vector can comprise at least one nucleic acid encoding an snRNA, esnRNA or RNA-targeting nucleic acid molecule comprising same of the disclosure. In some aspects, an AAV vector can comprise at least one regulatory sequence. In some aspects, an AAV vector can comprise at least one AAV inverted terminal (ITR) sequence. In some aspects, an AAV vector can comprise a first ITR sequence and a second ITR sequence. In some aspects, an AAV vector can comprise at least one promoter sequence. In some aspects, an AAV vector can comprise at least one enhancer sequence. In some aspects, an AAV vector can comprise at least one terminator sequence. In some aspects, an AAV vector can comprise at least one polyA sequence. In some aspects, an AAV vector can comprise at least one linker sequence. In some aspects, an AAV vector can comprise at least one buffer sequence. In some aspects, an AAV vector of the disclosure can comprise at least one nuclear localization signal, nuclear export signal, or both.
[0204] In some aspects, an AAV vector can comprise a first AAV ITR sequence, a promoter sequence, an snRNA sequence, esnRNA sequence, a terminator sequence and a second AAV ITR sequence. In some aspects, an AAV vector can comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, an snRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some aspects, an AAV vector can comprise, in the 5' to 3' direction, a first AAV ITR sequence, a promoter sequence, an snRNA sequence, esnRNA sequence, a terminator sequence, and a second AAV ITR sequence.
[0205] Exemplary ITR sequences are provided as SEQ ID NOs: 150 and 151, and additional suitable ITR sequences will be known to persons of ordinary skill in the art.
[0206] In some aspects, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promotersequence, second snRNA sequence, a second termination sequence and a second AAV ITR sequence. In some aspects, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, and a second AAV ITR sequence. In some aspects, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, a fourth promoter sequence, a fourth snRNA sequence, a fourth termination sequence, and a second AAV ITR sequence. In some embodiments, all snRNA sequences (e.g., first, second, and optionally third and fourth) comprise targeting sequences that bind to the same target nucleic acid molecule, e.g. a GAA target sequence or a GYSI target sequence. In alternative embodiments, the snRNA sequences (e.g., first, second, and optionally third and fourth) comprise targeting sequences that bind to the different target nucleic acid molecules, e.g. one or more snRNA comprise GAA targeting sequences and one or more snRNA comprise GYSI targeting sequences. The packaging of multiple esRNA, snRNA or RNA-targeting nucleic acid molecule comprising same, or other repetitive elements is described in more detail in International Patent Application Publication No. WO2024119102A1, which is incorporated herein by reference in its entirety.
[0207] In some embodiments of the compositions and methods of the disclosure, the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector comprises an ITR sequence or a capsid sequence that is isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11 or AAV12. In some embodiments, the AAV serotype is AAVrh.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment the AAV vector is an AAV2-Tyr mutant vector. In one embodiment the AAV vector comprises a capsid with a non-tyrosine amino acid at a position that corresponds to a surface-exposed tyrosine residue in position Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730 or Tyr673 of wild-type AAV2. See also WO 2008 / 124724 incorporated herein in its entirety. In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors comprising engineered capsids include withoutlimitation, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F). In some embodiments, the capsid is a ubiquitination resistant capsid. In another embodiment, the ubiquitination capsid is an AAV2 capsid comprising tyrosine (Y) and serine (S) mutations. In another embodiment, the AAV2 capsid comprises Y, S and threonine (T) mutations. In another embodiment, the AAV2 capsid includes, without limitation, AAV2 capsid mutants such as T455V, T491V, T550V, T659V, Y444+500+730F, and / or Y444+500+730F+T491V. In some embodiments, the viral vector is replication incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self- complementary (scAAV). In some embodiments, the viral vector is single-stranded (ssAAV).
[0208] In some embodiments, the sequences encoding the snRNAs, esnRNAs or RNA- targeting nucleic acid molecule comprising same provided herein are comprised within a single-stranded AAV (ssAAV). In some embodiments, the sequences encoding the snRNAs, esnRNAs or RNA-targeting nucleic acid molecule comprising same provided herein are comprised within a self-complementary AAV (scAAV). The single-stranded nature of the parvoviral genome requires the use of cellular mechanisms to provide a complementary- strand for gene expression. This cellular recruitment activity is considered a rate-limiting factor in the efficiency of transduction and gene expression in parvoviruses and parvoviral particles. The use of an scAAV versus an ssAAV remedies this well-known issue by packaging both strands as a single duplex DNA molecule (or inverted repeat genome) that can fold into dsDNA as a result of a self-complementary viral genome sequence. In this regard, the requirement for DNA synthesis or base-pairing between multiple viral genomes is eliminated.AAV ITR Sequences
[0209] In some embodiments of the compositions and methods of the disclosure, an AAV inverted terminal repeat sequence can comprise any AAV ITR sequence known in the art. In some aspects, an AAV ITR sequence can comprise or consist of an AAV1 ITR sequence, an AAV2 ITR sequence, an AAV3 ITR sequence, an AAV4 ITR sequence, an AAV5 ITR sequence, an AAV6 ITR sequence, an AAV7 ITR sequence, an AAV8 ITR sequence, an AAV9 ITR sequence, an AAV10 ITR sequence, an AAVrhlO ITR sequence, an AAV11 ITR sequence, an AAV12 ITR sequence, an AAV13 ITR sequence, or an AAVrh74 ITR sequence.
[0210] In some aspects the ITR sequence can comprise a modified AAV ITR sequence.
[0211] In some aspects, an AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 150 or SEQ ID NO: 151. In some aspects, an AAV ITR sequence can comprise, consist essentially of, or consist of the nucleic acid sequence of SEQ ID NO: 150 or 51. In some aspects, an AAV ITR sequence can comprise, consist essentially of, or consist of the nucleic acid sequence of SEQ ID NO: 150 or 151, or a sequence having 1, 2, 3, 4 or 5 insertions, deletions or substitutions relative thereto.
[0212] In some embodiments, an AAV vector provided herein comprises a first and a second AAV ITR sequence. In some aspects, a first AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 150 or SEQ ID NO: 151 and a second AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 150 or SEQ ID NO: 151. In some aspects, the first AAV ITR sequence is positioned at the 5’ of an AAV vector. In some aspects, the second AAV ITR sequence is positioned at the 3’ of an AAV vector.
[0213] In some aspects, a first AAV ITR sequence comprises the sequence set forth in SEQ ID NO: 150 or SEQ ID NO: 151. In some aspects, a second AAV ITR sequence comprises the sequence set forth in SEQ ID NO: 150 or SEQ ID NO: 151. In some embodiments, an AAV vector provided herein comprises a first AAV ITR sequence comprising the sequence set forth in SEQ ID NO: 150 and a second AAV ITR sequence comprising the sequence set forth in SEQ ID NO: 151. In some aspects, the first AAV ITR sequence is positioned at the 5’ of an AAV vector. In some aspects, the second AAV ITR sequence is positioned at the 3’ of an AAV vector.
[0214] In some embodiments of the compositions and methods of the disclosure, the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
[0215] In some embodiments of the compositions and methods of the disclosure, a vector of the disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex or a dendrimer. In some embodiments, the nanoparticle comprises a lipid nanoparticle. In some embodiments,the vector is an expression vector or recombinant expression system. As used herein, the term “recombinant expression system” refers to a genetic construct for the expression of certain genetic material formed by recombination. snRNA Vector Constructs
[0216] Also provided herein are vector constructs targeting GAA and / or GYSI comprising the snRNA, esnRNA or RNA-targeting nucleic acid molecule comprising same described herein.
[0217] An illustrative AAV vector of the disclosure targeting GYSI exon 6 is A05549. In some aspects, a nucleic acid sequence encoding AAV vector A05549 comprises SEQ ID NO: 199. In some aspects, vector A05549 encodes an snRNA sequence targeting GYSI exon 6 comprising the sequence set forth in ggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggttttc tgacctccgtcggaaaacc (SEQ ID NO: 201).
[0218] A05549 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctTccctggctcgctacagacgcacttccgcaaggagtCTTCACATTCAGCCCATTGGGGGTCACAA TATCTGGAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaatttcactggtctacaatgaaagcaaaac agttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaacgcgtatgtgTTGTTCCTCTT AGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTACATTTATGAAAGTAAA TGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAAACAAAGCGAAATACCA TCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGGGAGGCGGGTTTTTGGGT ACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAGATGAGAATTCAGGTGCA AACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGG AAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTAC ACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATTTACCGTAACTATGAAA TGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTCggagtCTTCACAT TCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggttttctgacctccgtcggaaaac cGTTTACTTGGTTTTAAAAATAGCTTGCACTAGCGATACGGAATATGGTTATTAGG TTTGTTAGGCATCATGTCGTGTCTTACTATAGAAAAATAACGTAGTGTTCATTTTA GCCTGCCTGTATGTGTTAATTTGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAAACTGTCAGTCTGAGAGCAGAATTCGATATCTAGAT CTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttggccactccctct ctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgag cgagcgcgcagctgcctgcagg (SEQ ID NO: 199).
[0219] A further illustrative AAV vector of the disclosure targeting GYSI exon 6 is A05550.In some aspects, a nucleic acid sequence encoding AAV vector A05550 comprises SEQ ID NO: 200. In some aspects, vector A05550 encodes an snRNA sequence targeting GYSI exon 6 comprising the sequence set forth in ggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggttttc tgacctccgtcggaaaacc (SEQ ID NO: 202).
[0220] In some aspects, vector A05550 encodes an snRNA sequence targeting GYSI exon6 comprising the sequence set forth in ggagtATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggttttctgacctccgt cggaaaacc (SEQ ID NO: 203).
[0221] A05550 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctTccctggctcgctacagacgcacttccgcaaggagtCTTCACATTCAGCCCATTGGGGGTCACAA TATCTGGAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaatttcactggtctacaatgaaagcaaaac agttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaacgcgtatgtgTTGTTCCTCTT AGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTACATTTATGAAAGTAAA TGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAAACAAAGCGAAATACCA TCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGGGAGGCGGGTTTTTGGGT ACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAGATGAGAATTCAGGTGCA AACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGG AAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTAC ACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATTTACCGTAACTATGAAA TGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTCggagtATTCAGCC CATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTA CTTGGTTTTAAAAATAGCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTGTCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCT GCCTGTATGTGTTAATTTGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAA GGAGTTGCGGGTTTCAAACTGTCAGTCTGAGAGCAGAATTCGATATCTAGATCTC GAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttggccactccctctctgc gcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgag cgcgcagctgcctgcagg (SEQ ID NO: 200).
[0222] An illustrative AAV vector of the disclosure targeting GAA intron 1 is A06069. The elements of A06069 are set forth in Table 7. In some aspects, a nucleic acid sequence encoding AAV vector A06069 comprises SEQ ID NO: 160.Table 7: A06069: scAAV-2x_mU7p-GAAz5 / z8 -mU7term mU Ip-GAAz 57z8 -mUlterm; 5' ISD and Mouse eSLNucleotide sequences of plasmid elements in order N-terminal to C-terminal
[0223] A06069 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctT ccctggctcgctacagacgcacttccgcaaggagtCGGGGC TC T C A A AGC AGC TCTGAGAC GC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAGATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCAGAATTCGATATCTAGATCTCGAGGTAACCACGTGCG GACCCAACGGCCGCaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccggg cgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 160).
[0224] An illustrative AAV vector of the disclosure targeting GYSI exon 6 and GAA intron 1 is A06070. The elements of A06070 are set forth in Table 8. In some aspects, a nucleic acid sequence encoding AAV vector A06070 comprises SEQ ID NO: 161.Table 8: A06070 vector - scAAV-2x mU7p-GYSlz30 -mU7term mU Ip-GAAz 57z8 - mUlterm; 5' ISD and Mouse eSLNucleotide sequences of plasmid elements in order N-terminal to C-terminal
[0225] A06070 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctTccctggctcgctacagacgcacttccgcaaggagtCTTCACATTCAGCCCATTGGGGGTCACAA TATCTGGAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaatttcactggtctacaatgaaagcaaaac agttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaacgcgtatgtgTTGTTCCTCTT AGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTACATTTATGAAAGTAAA TGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAAACAAAGCGAAATACCA TCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGGGAGGCGGGTTTTTGGGT ACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAGATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATTTACCGTAACTATGAAA TGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTCggagtCGGGGCTC TCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAG caggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATAGCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTGTCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATTTGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAAACTGTCAGTCTGAGAG CAGAATTCGATATCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCagga acccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgg gctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 161).
[0226] An illustrative AAV vector of the disclosure targeting GAA intron 1 and GYSI exon 6 is A06071. The elements of A06071 are set forth in Table 9. In some aspects, a nucleic acid sequence encoding AAV vector A06071 comprises SEQ ID NO: 162.Table 9: A06071 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term mU Ip-GAAz 57z8 - mUlterm ratUlp-GYSlz30 -ratUlterm; 5' ISD andMouse eSLNucleotide sequences of plasmid elements in order 5’ to 3’
[0227] A06071 Nucleotide Sequence (whole transgene from ITR to ITR):Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgag cgagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaa tcagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaa ccgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttg atgtcctTccctggctcgctacagacgcacttccgcaaggagtCGGGGCTCTCAAAGCAGCTCTGAGACGC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCATTACTTCATACTAAAGGCTGTGCATCCGACTCCTAAG TTGATGAAGGAAAATGCCTAGTGTTCTTGGAGGCTACAAAACAAAAGACAAAGC TAACTACCATCTGCTTATGGGTTCATTGGTATTTTCCAGCTGGCAGGGAGGCGGG TTTCCGAGTACAGGAAATGAGTCTCTATGGAGGCGGTGCTATGTAGATGAGAATT CAGGAGCAAACTGGGAAAAGCAGCTGCTTCCAAATATTTGTGATTTTTGGAGTGT AGTTTTGGGGAAACTCGCAGCCTACCAATTCTCCTAAGTGCTTTAGAATATGGAG AGACACTGTACATAAAGATATAGAGCTTTTTAATGGAGGCTTAAATTTATACCGT ATCTACAAAATGCTACATTCACAATGCAGTTCAGGCTCTGTGGCATTGCAACTCggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggttttctga cctccgtcggaaaaccATTTGTTTGGTACTAAAGATAGTTATCAGCCGAACCAGAAGGCTA AAATGGCTTCTGATACTTACTTGGCCAATGCCTTTTCCCTTTATACTGCTATTGCT TTGTATTCTGAAAAGCATCTTAGTGGTTTTTAACTTTCTCTACGTTCCCTCTGCAC GTTGAGTCTTGAGTTATGTTAAATGGTACGGTACCTAGGATTGGAATTCGATATC TAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttggcc actccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagt gagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 162).
[0228] An illustrative AAV vector of the disclosure targeting GAA intron 1 and GYSI exon 6 is A06072. The elements of A06072 are set forth in Table 10. In some aspects, a nucleic acid sequence encoding AAV vector A06072 comprises SEQ ID NO: 163.Table 10: A06072 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD andMouse eSL) mU lp-GAAz5 / z8 -mUlterm (5' ISD andMouse eSL) ratUlp-GYSlz30 -ratUlterm (5 ’ ISD and Human eSL)Nucleotide sequences of plasmid elements in order 5’ to 3’
[0229] A06072 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctT ccctggctcgctacagacgcacttccgcaaggagtCGGGGC TC T C A A AGC AGC TCTGAGAC GC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCATTACTTCATACTAAAGGCTGTGCATCCGACTCCTAAG TTGATGAAGGAAAATGCCTAGTGTTCTTGGAGGCTACAAAACAAAAGACAAAGC TAACTACCATCTGCTTATGGGTTCATTGGTATTTTCCAGCTGGCAGGGAGGCGGG TTTCCGAGTACAGGAAATGAGTCTCTATGGAGGCGGTGCTATGTAGATGAGAATT CAGGAGCAAACTGGGAAAAGCAGCTGCTTCCAAATATTTGTGATTTTTGGAGTGT AGTTTTGGGGAAACTCGCAGCCTACCAATTCTCCTAAGTGCTTTAGAATATGGAG AGACACTGTACATAAAGATATAGAGCTTTTTAATGGAGGCTTAAATTTATACCGT ATCTACAAAATGCTACATTCACAATGCAGTTCAGGCTCTGTGGCATTGCAACTCggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggctttctg gctccttaccggaaagccATTTGTTTGGTACTAAAGATAGTTATCAGCCGAACCAGAAGGC TAAAATGGCTTCTGATACTTACTTGGCCAATGCCTTTTCCCTTTATACTGCTATTG CTTTGTATTCTGAAAAGCATCTTAGTGGTTTTTAACTTTCTCTACGTTCCCTCTGC ACGTTGAGTCTTGAGTTATGTTAAATGGTACGGTACCTAGGATTGGAATTCGATA TCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttg gccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctc agtgagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 163).
[0230] An illustrative AAV vector of the disclosure targeting GAA intron 1 is A06073. The elements of A06073 are set forth in Table 11. In some aspects, a nucleic acid sequence encoding AAV vector A06073 comprises SEQ ID NO: 164.Table 11: A06073 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD andMouse eSL) mUlp-GAAz5 / z8-mUlterm (5' ISD andMouse eSL) ratUlp-GYSlz30 -ratUlterm (5' ISD and Sheep eSL)Nucleotide sequences of plasmid elements in order 5 ’ to 3 ’
[0231] A06073 Nucleotide Sequence (whole transgene from ITR to ITR):Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgag cgagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaa tcagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaa ccgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttg atgtcctTccctggctcgctacagacgcacttccgcaaggagtCGGGGCTCTCAAAGCAGCTCTGAGACGC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCATTACTTCATACTAAAGGCTGTGCATCCGACTCCTAAG TTGATGAAGGAAAATGCCTAGTGTTCTTGGAGGCTACAAAACAAAAGACAAAGC TAACTACCATCTGCTTATGGGTTCATTGGTATTTTCCAGCTGGCAGGGAGGCGGG TTTCCGAGTACAGGAAATGAGTCTCTATGGAGGCGGTGCTATGTAGATGAGAATT CAGGAGCAAACTGGGAAAAGCAGCTGCTTCCAAATATTTGTGATTTTTGGAGTGT AGTTTTGGGGAAACTCGCAGCCTACCAATTCTCCTAAGTGCTTTAGAATATGGAG AGACACTGTACATAAAGATATAGAGCTTTTTAATGGAGGCTTAAATTTATACCGT ATCTACAAAATGCTACATTCACAATGCAGTTCAGGCTCTGTGGCATTGCAACTCggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaGGCTT TCCGGCCTCCGCCGGAAAGCCATTTGTTTGGTACTAAAGATAGTTATCAGCCGAA CCAGAAGGCTAAAATGGCTTCTGATACTTACTTGGCCAATGCCTTTTCCCTTTATACTGCTATTGCTTTGTATTCTGAAAAGCATCTTAGTGGTTTTTAACTTTCTCTACGTTCCCTCTGCACGTTGAGTCTTGAGTTATGTTAAATGGTACGGTACCTAGGATTGGAATTCGATATCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccct agtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgc ccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 164).
[0232] An illustrative AAV vector of the disclosure targeting GAA intron 1 and GYSI exon 6 is A06074. The elements of A06074 are set forth in Table 12. In some aspects a nucleic acid sequence encoding AAV vector A06074 comprises SEQ ID NO: 165.Table 12: A06074 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD andMouse eSL) mU lp-GAAz5 / z8 -mUlterm (5' ISD andMouse eSL) cowU7p-GYSlz30 -cowU7term (5 ’ ISD and Human eSL)Nucleotide sequences of plasmid elements in order 5 ’ to 3 ’
[0233] A06074 Nucleotide Sequence (whole transgene from ITR to ITR):Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgag cgagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaa tcagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaa ccgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttg atgtcctTccctggctcgctacagacgcacttccgcaaggagtCGGGGCTCTCAAAGCAGCTCTGAGACGC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCAGCGCAGGAGCCGCCGAGCTCTTGCTGCGAAGCCTTG TCTGCGTTCTTAAAAACTAAAGGGGGCGTGACTGGCTTCCTTATCAGCCAATCGG CATCGGGTCATTTGCATAGGGCCCCATCCACCGTTCGTAAACTCTAGCCGCGAAG GATTTAAGAGAGTTCCTTAGAACACGGTCTTCCCCTCCGAAAGTCGCAGTCTGCC TCGTTATCTGTAGAGCAATAGGAGCTAGGAACCGGCCGTCGGGGCTCACCCTCA CTGACAGCGGGGTTGGTGGCTATGCCGTGCGATCTCCGGGTGCTACGTCTGggagtC TTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggctttctggctcc ttaccggaaagccCCCACACAAGTGTTTATGAACAATAGAATAATATGTGGGTGGGAAG CTTGGTTTTTTTTGATACGGGTTTTTTTTTTTTTTTTGGTCTACGTGTTTAGTCCGTT CTTGACGGAGAAGACCCGGGAGGTTGGGATTCTTGTCTGGAAATTTCCGGCTCTG TCTGATGTAGTTTCCCGTTCGCCTCCCTTCTTTGCTGCGAGGAATTCGATATCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttggccactcc ctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagc gagcgagcgcgcagctgcctgcagg (SEQ ID NO: 165).
[0234] An illustrative AAV vector of the disclosure targeting GAA intron 1 is A06075. The elements of A06075 are set forth in Table 13. In some aspects, a nucleic acid sequence encoding AAV vector A06075 comprises SEQ ID NO: 166.Table 13: A06075 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD andMouse eSL) mUlp-GAAz5 / z8 -mUlterm (5’ ISD andMouse eSL) sheepUlp-GYSlz30 - sheepUlterm (5' ISD and Human eSL)Nucleotide sequences of plasmid elements in order 5 ’ to 3 ’
[0235] A06075 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctT ccctggctcgctacagacgcacttccgcaaggagtCGGGGC TC T C A A AGC AGC TCTGAGAC GCCAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCACGCCGTGCCCTGCTCTGCCCTCCGCACGCTGCTCAGA CTCCACACCCGTAACGAAGCTCCACCGAATTTTTCGTCTGTCTGTGAAGACGAAG AATTGAAAAATCTCAGCTACACTTGGTCTTTGGGGTCGGCGCCAGGCAGAGCTA GAACGAACTAGACGCTTGTCCGAAAGCAGTGACGTCAAATGACAAGGGACAAG AGGTGGGGATATGTAGATGAGGGGAGCGGTGGCTGCTGGCTGGATTTCGTCTTTC GCCGGGTAGAATTTCCCCTGAACGTCCAAAGGATGTATCTTGGTCACTGTGAAAT AAATAATCCTTCAGGTTCCCATCGAAGGCCGAAATAGCTTGGAATATAATTGACC ATAACTCTGTTGTGTGCTGAGTTCGAGGGTGACGTCCCAGACTAAGCTTACAACT CggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggctt tctggctccttaccggaaagccGCGTGGTTTGTGCAAGGAAAGACATAGATGCTAAGTTTGGA GCTCTGCTAATTTCCTGTTTTTGTAGTCGTTTTCGGGTTTATGAGGCAGAGGCAGT AAGCAGTTTTCCTGCAACATGGATAAGCTAGTTTGGACTTTTGGTAAAGGATTTT TTTGTAATGTGGGAGACTTGCTTTTGATCCCTGGTTTGGGAAATTCTCGAATTCGA TATCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggag ttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggc ctcagtgagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 166).
[0236] An illustrative AAV vector of the disclosure targeting GAA intron 1 and GYSI exon 6 is A06076. The elements of A06076 are set forth in Table 14. In some aspects, a nucleic acid sequence encoding AAV vector A06076 comprises SEQ ID NO: 167.Table 14: A06076 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD andMouse eSL) mUlp-GAAz5 / z8 -mUlterm (5 ’ ISD andMouse eSL) horseUlp-GYSlz30 -horseUl- 3term (5' ISD and Human eSL)Nucleotide sequences of plasmid elements in order 5 ’ to 3 ’
[0237] A06076 Nucleotide Sequence (whole transgene from ITR to ITR): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaat cagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaac cgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttga tgtcctT ccctggctcgctacagacgcacttccgcaaggagtCGGGGC TC T C A A AGC AGC TCTGAGAC GC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTACATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAAACTGTCAGTCTGAGAGCATGCCGCGCAGAATGCAGACTCATCCTGACAAGTCCACGCCAGAACCTTTGCGTCTGCCCGGAAAGGCAAGGAAGTTTAAAGCCTTTCCAG ATACCCCTATGGATGATTGTCTTTTAGATCGTCCTGAGGGCTAGCTAGAGCGAAT TCACCGCTTCTCCGAGAAGCAGAATGACGTCGAGTGACGACAGTGATGACAAGA GGCGGGGATATGTAGATGAAAGACACGGTGACTGCCGGTTGGAGTGAGTTCTTCATGGGGAACACTTTCCACTGAATATCCAAAAGGATGTACCCTGATCTCTGTCATA TAAATAACCCTTCAATTTCGAACTTAAGGCCTAAAGAACTCGGAATATAATTGAC CATGACTTTATAGTGTGTTGAAGACGATGGTGAGGTGCCAGGCGAGGGGAGCAA CTCggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcag gctttctggctccttaccggaaagccACAAACTTGGTCTTAAAAGAAGACTACTTGTTTATGTTCTTCTTTCTCTAACTTTTATTTGGGGTTTAGTGGCTTTCTAACATGGTCATTATGAGG TAAGACCTTGGGGTTGGCCTATTAATTAACACCTTGGGGCTGGCCGTATGGCTGA GTGGTTAAGTTTGTGTGCTCTGCTTCGGGTTTGGCCTGTTCTAATTCTGGAATTCG ATATCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatgg agttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcg gcctcagtgagcgagcgagcgcgcagctgcctgcagg (SEQ ID NO: 167).
[0238] An illustrative AAV vector of the disclosure targeting GAA intron 1 and GYSI exon 6 is A06109. The elements of A06109 are set forth in Table 15. In some aspects, a nucleic acid sequence encoding AAV vector A06109 comprises SEQ ID NO: 168.Table 15: A06109 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD andMouse eSL) mUlp-GAAz5 / z8 -mUlterm (5' ISD andMouse eSL) humanU7 p-GYSlz30 -humanU7 term (5' ISD and Human eSL)Nucleotide sequences of plasmid elements in order 5 ’ to 3 ’
[0239] A06109 Nucleotide Sequence (whole transgene from ITR to ITR):Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgag cgagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaa tcagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaa ccgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttg atgtcctTccctggctcgctacagacgcacttccgcaaggagtCGGGGCTCTCAAAGCAGCTCTGAGACGC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATTTGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCATACTGCCGAATCCAGGTCTCCGGGCTTAACAACAAC GAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTA ATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTT TATATCCCATCTTCTCTCCAAACACATACGCAggagtCTTCACATTCAGCCCATTGGGGGTCACAATATCTGGAATTTTTGGAGcaggctttctggctccttaccggaaagccCCTCTTATGA TGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGGGTAGTTTTGG TGGTCTTGATGCAGTTGTAAGCTTGGAGAATTCGATATCTAGATCTCGAGGTAACCACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctc actgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcct gcagg (SEQ ID NO: 168).
[0240] An illustrative AAV vector of the disclosure targeting GAA intron 1 and GYSI exon 6 is A06110. The elements of A06110 are set forth in Table 16. In some aspects, a nucleic acid sequence encoding AAV vector A06110 comprises SEQ ID NO: 169.Table 16: A06110 vector - scAAV-3x_mU7p-GAAz5 / z8 -mU7term (5' ISD and Mouse eSL) _mUl-GAAz5 / z8 -mUlterm (5' ISD andMouse eSL) humanU7 p-GYSlz30 -humanU7 term (5' ISD andMouse eSL)Nucleotide sequences of plasmid elements in order 5 ’ to 3 ’
[0241] A06110 Nucleotide Sequence (whole transgene from ITR to ITR):Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgag cgagcgcgcagagagggagtggggttCTTCGAAACACCGGTtaacaacataggagctgtgattggctgttttcagccaa tcagcactgActcatttgcatagcctttacaagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatattgtttatcgaa ccgaataaggaactgtgctttgtgattcacatatcagtggaggggtgtggaaatggcaccttgatctcaccctcatcgaaagtggagttg atgtcctTccctggctcgctacagacgcacttccgcaaggagtCGGGGCTCTCAAAGCAGCTCTGAGACGC CAGAAGGAAGGGCGAGAAAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaacccccaa tttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttcctaggaaa cgcgtatgtgTTGTTCCTCTTAGTGTTAATTCACACTAAAGACTGTGCATCCGACTCCTA CATTTATGAAAGTAAATGCCTGTTGTTAGAACAAAAAAGGCTACAGAACAAAAA ACAAAGCGAAATACCATCTGCTTTAGGTTCAGTGTGGTATTTTCCCGCTGACAGG GAGGCGGGTTTTTGGGTACAGGAAACGAGTCACTATGGAGGCGGTACTATGTAG ATGAGAATTCAGGTGCAAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTT TTACAGTGTAGTTTTGGAAAAACTCTTAGCCTACCAATTCTTCTAAGTGTTTTAAA ATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGGCTTAAATATT TACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGC AACTCggagtCGGGGCTCTCAAAGCAGCTCTGAGACGCCAGAAGGAAGGGCGAGA AAAGCTAATTTTTGGAGcaggttttctgacctccgtcggaaaaccGTTTACTTGGTTTTAAAAATA GCTTGCACTAGCGATACGGAATATGGTTATTAGGTTTGTTAGGCATCATGTCGTG TCTTACTATAGAAAAATAACGTAGTGTTCATTTTAGCCTGCCTGTATGTGTTAATT TGTCCTTATTGCGCATTGTTCTTGTTAAGTCTTCTGTAAGGAGTTGCGGGTTTCAA ACTGTCAGTCTGAGAGCATACTGCCGAATCCAGGTCTCCGGGCTTAACAACAAC GAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCAT GGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCC TTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTA ATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCAggagtCTTCACATTCAGCCCATTGG GGGTCACAATATCTGGAATTTTTGGAGcaggttttctgacctccgtcggaaaaccCCTCTTATGAT GTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAGAATTCGATATCTAGATCTCGAGGTAACC ACGTGCGGACCCAACGGCCGCaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctca ctgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctg cagg (SEQ ID NO: 169).
[0242] An illustrative lentiviral vector of the disclosure targeting GAA intron 1 is L05641.The elements of L05641 are set forth in Table 17. In some aspects, a nucleic acid sequence encoding AAV vector L05641 comprises SEQ ID NO: 185.Table 17: L05641: plvx-mU7 GAAz5 mUl GAAz5 SV40 GFP PURONucleotide sequences of plasmid elements in order N-terminal to C-terminal
[0243] L05641 Nucleotide Sequence (whole transgene from LTR to LTR):GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTTGGTTACCTCGAGATCTAGATATCGAATTCTGCTCTCAGACTGACAGTTTGAAACCCGCAACTCCTTACAGAAGACTTAACAAGAACAATGCGCAATAAGGACAAATTAACACATACAGGCAGGCTAAAATGAACACTACGTTATTTTTCTATAGTAAGACACGACATGATGCCTAACAAACCTAATAACCATATTCCGTATCGCTAGTGCAAGCTATTTTTAAAACCAAGTAAACggttttccgacggaggtcagaaaacctgCTCCAAAAATTGTCTCAGAGCTGCTTTGAGAGCCCCGactccGAGTTGCGTGGCCACGGAGCCTGAACAGCATGATATGCGTAGCATTTCATAGTTACGGTAAATATTTAAGCCTCATTAAAACACTCTATAACTTCATGTGTACTGGCTCCCACATTTTAAAACACTTAGAAGAATTGGTAGGCTAAGAGTTTTTCCAAAACTACACTGTAAAAATCACAAATATTTGGAAGCAGTTGCTTTTCCCAGTTTGCACCTGAATTCTCATCTACATAGTACCGCCTCCATAGTGACTCGTTTCCTGTACCCAAAAACCCGCCTCCCTGTCAGCGGGAAAATACCACACTGAACCTAAAGCAGATGGTATTTCGCTTTGTTTTTTGTTCTGTAGCCTTTTTTGTTCTAACAACAGGCATTTACTTTCATAAATGTAGGAGTCGGATGCACAGTCTTTAGTGTGAATTAACACTAAGAGGAACAAcacatacgcgtttcctaggaaaccagagaagga tcaaagcccctctcacacaccggggagcggggaagagaactgttttgctttcattgtagaccagtgaaattgggggttttccgacggag gtcagaaaacctgCTCCAAAAATTGTCTCAGAGCTGCTTTGAGAGCCCCGactccttgcggaagtgcgtctgtagcgagccagggAaggacatcaactccactttcgatgagggtgagatcaaggtgccatttccacacccctccactgatatg tgaatcacaaagcacagttccttattcggttcgataaacaatattctaaaagactattaaaaccgctcgtttcttgagtttgtgaccgcttgta aaggctatgcaaatgagTcagtgctgattggctgaaaacagccaatcacagctcctatgttgttaACCGGTTATGGCCAC AACCACTAGTGTTTAAACGCGGCCGCGTTAACACGCGCGAATGTGTGTCAGTTAG GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATC TCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAA GTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCC GCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGA CTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCA GAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAACGCGGCGCTA CCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCC ATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGC GAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACC ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCG TGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTC CGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGG CAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCG CATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAA GCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAA GAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGT GCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCT GCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAA CGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCAC TCTCGGCATGGACGAGCTGTACAAGTAGgcggccgcggatcccgcccctctccctcccccccccctaacg ttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggccc ggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaagg aagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggt gcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtgg aaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggg gcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaa aacacgatgataaACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACG ACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGA ACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGA CGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGT GTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGC GCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTG GTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAG CGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTT CCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACC GTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGC AAGCCCGGTGCCTGACAACTTTATTATACATAGTTGATCAATTCCGATAATCAAC CTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCT TTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCG TATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGA GTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCA ACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCG CTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGC TGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAG CTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGA CGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGC CTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCG GATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGA CCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGG GGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTA CTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGG GAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGT GCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAG TGTGGAAAATCTCTAGCA (SEQ ID NO: 185).
[0244] An illustrative lentiviral vector of the disclosure targeting GAA intron 1 is L05642. The elements of L05642 are set forth in Table 18. In some aspects, a nucleic acid sequence encoding lentiviral vector L05642 comprises SEQ ID NO: 190.Table 18: L05642: plvx-mU7 GAAz8 mUl GAAz5 SV40 GFP PURONucleotide sequences of plasmid elements in order N-terminal to C-terminal
[0245] L05642 Nucleotide Sequence (whole transgene from LTR to LTR):GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACC TCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGA GAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGC TAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACA AAAATTCAAAATTTTTGGTTACCTCGAGATCTAGATATCGAATTCTGCTCTCAGA CTGACAGTTTGAAACCCGCAACTCCTTACAGAAGACTTAACAAGAACAATGCGC AATAAGGACAAATTAACACATACAGGCAGGCTAAAATGAACACTACGTTATTTT TCTATAGTAAGACACGACATGATGCCTAACAAACCTAATAACCATATTCCGTATC GCTAGTGCAAGCTATTTTTAAAACCAAGTAAACggttttccgacggaggtcagaaaacctgCTCC AAAAATTAGCTTTTCTCGCCCTTCCTTCTGGCactccGAGTTGCGTGGCCACGGAGC CTGAACAGCATGATATGCGTAGCATTTCATAGTTACGGTAAATATTTAAGCCTCA TTAAAACACTCTATAACTTCATGTGTACTGGCTCCCACATTTTAAAACACTTAGA AGAATTGGTAGGCTAAGAGTTTTTCCAAAACTACACTGTAAAAATCACAAATATT TGGAAGCAGTTGCTTTTCCCAGTTTGCACCTGAATTCTCATCTACATAGTACCGCC TCCATAGTGACTCGTTTCCTGTACCCAAAAACCCGCCTCCCTGTCAGCGGGAAAA TACCACACTGAACCTAAAGCAGATGGTATTTCGCTTTGTTTTTTGTTCTGTAGCCT TTTTTGTTCTAACAACAGGCATTTACTTTCATAAATGTAGGAGTCGGATGCACAG TCTTT AGTGT GAATT AAC ACT AAGAGGA AC AAcacatacgcgtttcctaggaaaccagagaaggatca aagcccctctcacacaccggggagcggggaagagaactgttttgctttcattgtagaccagtgaaattgggggttttccgacggaggtc agaaaacctgCTCCAAAAATTAGCTTTTCTCGCCCTTCCTTCTGGCactccttgcggaagtgcgtctg tagcgagccagggAaggacatcaactccactttcgatgagggtgagatcaaggtgccatttccacacccctccactgatatgtgaatc acaaagcacagttccttattcggttcgataaacaatattctaaaagactattaaaaccgctcgtttcttgagtttgtgaccgcttgtaaaggc tatgcaaatgagTcagtgctgattggctgaaaacagccaatcacagctcctatgttgttaACCGGTTATGGCCACAACCACTAGTGTTTAAACGCGGCCGCGTTAACACGCGCGAATGTGTGTCAGTTAGGGT GTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCA ATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTA TGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCC CATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTA ATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGA AGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAACGCGGCGCTACCG GTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAG GGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGC CATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAA CTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCT GGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAA CGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCA GCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCT GCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGA GAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTC GGCATGGACGAGCTGTACAAGTAGgcggccgcggatcccgcccctctccctcccccccccctaacgttactg gccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaa acctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagc agttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctc tgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaaga gtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctc ggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacac gatgataaACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACG TCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCG CCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGG CGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCA GCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTT CCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGC CGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCT GGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTC ACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAG CCCGGTGCCTGACAACTTTATTATACATAGTTGATCAATTCCGATAATCAACCTC TGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTAT GGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTT GTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACC CCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTT CCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGG ACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTG ACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGT CCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTG CTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGA TCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACC AATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGG ACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACT GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGA ACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGC CCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGT GGAAAATCTCTAGCA (SEQ ID NO: 190).
[0246] An illustrative lentiviral vector of the disclosure targeting GAA intron 1 is L05643. The elements of L05643 are set forth in Table 19. In some aspects, a nucleic acid sequence encoding lentiviral vector L05643 comprises SEQ ID NO: 192.Table 19: L05643: plvx-mU7 GAAz5+z7 Fusion _mU 1 GAAz5+z7Fusion SV40 GFP PURONucleotide sequences of plasmid elements in order N-terminal to C-terminal
[0247] L05643 Nucleotide Sequence (whole transgene from LTR to LTR):GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTTGGTTACCTCGAGATCTAGATATCGAATTCTGCTCTCAGACTGACAGTTTGAAACCCGCAACTCCTTACAGAAGACTTAACAAGAACAATGCGCAATAAGGACAAATTAACACATACAGGCAGGCTAAAATGAACACTACGTTATTTTTCTATAGTAAGACACGACATGATGCCTAACAAACCTAATAACCATATTCCGTATCGCTAGTGCAAGCTATTTTTAAAACCAAGTAAACggttttccgacggaggtcagaaaacctgCTCCAAAAATTCAGACTGTGCAAGTGCTCTGCACTCGTCTCAGAGCTGCTTTGAGAGCCCCGactccGAGTTGCGTGGCCACGGAGCCTGAACAGCATGATATGCGTAGCATTTCATAGTTACGGTAAATATTTAAGCCTCATTAAAACACTCTATAACTTCATGTGTACTGGCTCCCACATTTTAAAACACTTAGAAGAATTGGTAGGCTAAGAGTTTTTCCAAAACTACACTGTAAAAATCACAAATATTTGGAAGCAGTTGCTTTTCCCAGTTTGCA CCTGAATTCTCATCTACATAGTACCGCCTCCATAGTGACTCGTTTCCTGTACCCAA AAACCCGCCTCCCTGTCAGCGGGAAAATACCACACTGAACCTAAAGCAGATGGT ATTTCGCTTTGTTTTTTGTTCTGTAGCCTTTTTTGTTCTAACAACAGGCATTTACTT TCATAAATGTAGGAGTCGGATGCACAGTCTTTAGTGTGAATTAACACTAAGAGG AACAAcacatacgcgtttcctaggaaaccagagaaggatcaaagcccctctcacacaccggggagcggggaagagaactgttt tgctttcattgtagaccagtgaaattgggggttttccgacggaggtcagaaaacctgCTCCAAAAATTCAGACTGTG CAAGTGCTCTGCACTCGTCTCAGAGCTGCTTTGAGAGCCCCGactccttgcggaagtgcgtctg tagcgagccagggAaggacatcaactccactttcgatgagggtgagatcaaggtgccatttccacacccctccactgatatgtgaatc acaaagcacagttccttattcggttcgataaacaatattctaaaagactattaaaaccgctcgtttcttgagtttgtgaccgcttgtaaaggc tatgcaaatgagTcagtgctgattggctgaaaacagccaatcacagctcctatgttgttaACCGGTTATGGCCACAAC CACTAGTGTTTAAACGCGGCCGCGTTAACACGCGCGAATGTGTGTCAGTTAGGGT GTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCA ATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTA TGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCC CATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAACGCGGCGCTACCG GTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATC CTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAG GGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACC GGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGC CATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAA CTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCT GGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAA CGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCT GCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTC GGCATGGACGAGCTGTACAAGTAGgcggccgcggatcccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaa acctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagc agttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctc tgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaaga gtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctc ggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacac gatgataaACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACAACTTTATTATACATAGTTGATCAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGC CCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGT GGAAAATCTCTAGCA (SEQ ID NO: 192).
[0248] An illustrative lentiviral vector of the disclosure targeting GAA intron 1 is L05644. The elements of L05644 are set forth in Table 20. In some aspects, a nucleic acid sequence encoding lentiviral vector L05644 comprises SEQ ID NO: 194.Table 20: L05644: plvx-mU7 _GAAz5+z8 Fusion mUl GAAz5+z8Fusion SV40 GFP PURONucleotide sequences of plasmid elements in order N-terminal to C-terminalIll
[0249] L05644 Nucleotide Sequence (whole transgene from LTR to LTR):GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTTGGTTACCTCGAGATCTAGATATCGAATTCTGCTCTCAGACTGACAGTTTGAAACCCGCAACTCCTTACAGAAGACTTAACAAGAACAATGCGCAATAAGGACAAATTAACACATACAGGCAGGCTAAAATGAACACTACGTTATTTTTCTATAGTAAGACACGACATGATGCCTAACAAACCTAATAACCATATTCCGTATCGCTAGTGCAAGCTATTTTTAAAACCAAGTAAACggttttccgacggaggtcagaaaacctgCTCC AAAAATTAGCTTTTCTCGCCCTTCCTTCTGGCGTCTCAGAGCTGCTTTGAGAGCCCCGactccGAGTTGCGTGGCCACGGAGCCTGAACAGCATGATATGCGTAGCATTTCATAGTTACGGTAAATATTTAAGCCTCATTAAAACACTCTATAACTTCATGTGTACTGGCTCCCACATTTTAAAACACTTAGAAGAATTGGTAGGCTAAGAGTTTTTCCAAAACTACACTGTAAAAATCACAAATATTTGGAAGCAGTTGCTTTTCCCAGTTTGCACCTGAATTCTCATCTACATAGTACCGCCTCCATAGTGACTCGTTTCCTGTACCCAAAAACCCGCCTCCCTGTCAGCGGGAAAATACCACACTGAACCTAAAGCAGATGGTATTTCGCTTTGTTTTTTGTTCTGTAGCCTTTTTTGTTCTAACAACAGGCATTTACTTTCATAAATGTAGGAGTCGGATGCACAGTCTTTAGTGTGAATTAACACTAAGAGGAACAAcacatacgcgtttcctaggaaaccagagaaggatcaaagcccctctcacacaccggggagcggggaagagaactgttttg ctttcattgtagaccagtgaaattgggggttttccgacggaggtcagaaaacctgCTCCAAAAATTAGCTTTTCTCG CCCTTCCTTCTGGCGTCTCAGAGCTGCTTTGAGAGCCCCGactccttgcggaagtgcgtctgtag cgagccagggAaggacatcaactccactttcgatgagggtgagatcaaggtgccatttccacacccctccactgatatgtgaatcaca aagcacagttccttattcggttcgataaacaatattctaaaagactattaaaaccgctcgtttcttgagtttgtgaccgcttgtaaaggctatg caaatgagTcagtgctgattggctgaaaacagccaatcacagctcctatgttgttaACCGGTTATGGCCACAACCA CTAGTGTTTAAACGCGGCCGCGTTAACACGCGCGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAAT TAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATG CAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATT TTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAACGCGGCGCTACCGGTC GCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTG GTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGC GAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGC AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGT GCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCAT GCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGA GCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGA GTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGG CATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCT CGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCC CGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGC ATGGACGAGCTGTACAAGTAGgcggccgcggatcccgcccctctccctcccccccccctaacgttactggccga agccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctgg ccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcct ctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggc caaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaat ggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcac atgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataa ACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCC AGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCAC ACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTC CTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCC GCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTG GCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTC GTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAG ACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCG CCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCG GTGCCTGACAACTTTATTATACATAGTTGATCAATTCCGATAATCAACCTCTGGA TTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGC TATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCT TTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTG GCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCC ACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCC CCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACA GGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGT CCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTC TGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCC GGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCC TTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGAC TTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA AGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCT CTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCAC TGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCT GTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAA ATCTCTAGCA (SEQ ID NO: 194).
[0250] An illustrative lentiviral vector of the disclosure targeting GYSI exon 6 is L05767. The elements of L05767 are set forth in Table 21. In some aspects, a nucleic acid sequence encoding lentiviral vector L05767 comprises SEQ ID NO: 196.Table 21: L05767 plvx-mU7 GYSlz30 mUl GYSlz30 SV40 GFP PURONucleotide sequences of plasmid elements in order N-terminal to C-terminal
[0251] L05767 Nucleotide Sequence (whole transgene from LTR to LTR):GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTTGGTTACCTCGAGATCTAGATATCGAATTCTGCTCTCAGACTGACAGTTTGAAACCCGCAACTCCTTACAGAAGACTTAACAAGAACAATGCGCAATAAGGACAAATTAACACATACAGGCAGGCTAAAATGAACACTACGTTATTTT TCTATAGTAAGACACGACATGATGCCTAACAAACCTAATAACCATATTCCGTATC GCTAGTGCAAGCTATTTTTAAAACCAAGTAAACggttttccgacggaggtcagaaaacctgCTCC AAAAATTCCAGATATTGTGACCCCCAATGGGCTGAATGTGAAGactccGAGTTGCGTGGCCACGGAGCCTGAACAGCATGATATGCGTAGCATTTCATAGTTACGGTAAAT ATTTAAGCCTCATTAAAACACTCTATAACTTCATGTGTACTGGCTCCCACATTTTA AAACACTTAGAAGAATTGGTAGGCTAAGAGTTTTTCCAAAACTACACTGTAAAA ATCACAAATATTTGGAAGCAGTTGCTTTTCCCAGTTTGCACCTGAATTCTCATCTA CATAGTACCGCCTCCATAGTGACTCGTTTCCTGTACCCAAAAACCCGCCTCCCTG TCAGCGGGAAAATACCACACTGAACCTAAAGCAGATGGTATTTCGCTTTGTTTTT TGTTCTGTAGCCTTTTTTGTTCTAACAACAGGCATTTACTTTCATAAATGTAGGAG TCGGATGCACAGTCTTTAGTGTGAATTAACACTAAGAGGAACAAcacatacgcgtttcctag gaaaccagagaaggatcaaagcccctctcacacaccggggagcggggaagagaactgttttgctttcattgtagaccagtgaaattg ggggttttccgacggaggtcagaaaacctgCTCCAAAAATTCCAGATATTGTGACCCCCAATGGGC TGAATGTGAAGactccttgcggaagtgcgtctgtagcgagccagggAaggacatcaactccactttcgatgagggtgaga tcaaggtgccatttccacacccctccactgatatgtgaatcacaaagcacagttccttattcggttcgataaacaatattctaaaagactatt aaaaccgctcgtttcttgagtttgtgaccgcttgtaaaggctatgcaaatgagTcagtgctgattggctgaaaacagccaatcacagctc ctatgttgttaACCGGTTATGGCCACAACCACTAGTGTTTAAACGCGGCCGCGTTAACAC GCGCGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCA GAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCC CAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAA CCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGC CCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCG CCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGG CTTTTGCAAAACGCGGCGCTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAG CTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTG ACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCG TGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAA GCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCAC CATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA TATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCA CAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCC CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTC GTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAGgcggccgcg gatcccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttcc accatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgcca aaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgc aggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaac cccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgccca gaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccc cccgaaccacggggacgtggttttcctttgaaaaacacgatgataaACCATGACCGAGTACAAGCCCACGGT GCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGC GTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGA GCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGG CAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGA GAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTT GAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCA CCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCAC CAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAG CGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCT ACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGC GCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACAACTTTATTATACATAGTT GATCAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGT ATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTT GTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTG TGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTC AGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATC GCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATT CCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCA GCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCG CCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAA TTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCC ACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGAC AAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGG GAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTT GAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATC CCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 196).Nucleic Acids
[0252] An NOI (nucleotide sequence of interest) includes, without limitation, any nucleotide sequence or transgene capable of being delivered by a vector. NOIs can be synthetic, derived from naturally occurring DNA or RNA, codon optimized, recombinant RNA / DNA, cDNA, partial genomic DNA, and / or combinations thereof. The NOI can be a coding region or partial coding region but need not be a coding region. An NOI can be RNA / DNA in a sense or anti-sense orientation. An NOI can be an snRNA. NOIs are also referred herein, without limitation, as transgenes, heterologous sequences, genes, therapeutic genes. An NOI may also encode an RNA (ribonucleoprotein complex) a POI (protein of interest, e.g., GAA or GYSI), a partial POI, a mutated version or variant of a POI. A POI may be analogous to or correspond to a wild-type protein. A POI may also be a fusion protein or ribonucleoprotein complex such as an snRNP. In some aspects RNA sequences disclosed herein may be represented as DNA sequences and it is within the ability of the skilled artisan to derive the sequence of an RNA sequence from a DNA sequence. For example, spacer (targeting) sequences of the disclosure can represent uracil bases as either a U or T. The skilled artisan would readily understand that an RNA sequence can interchangeably use a T or U to indicate uracil.Codon Optimization
[0253] In some embodiments, NOIs or transgenes such as nucleic acid sequences encoding protein sequences of the disclosure are codon optimized nucleic acid sequences.
[0254] Codon-optimization is a technique well known in the art. Codon optimization refers to the fact that different cells differ in their usage of particular codons. This codon biascorresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. It is also possible to decrease expression by deliberately choosing codons for which the corresponding tRNAs are known to be rare in a particular cell type. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. Based on the genetic code, nucleic acid sequences can be generated. In some embodiments, such a sequence is optimized for expression in a host or target cell, such as a host cell used to express the snRNA or vector components to package the snRNA or nucleic acids comprising or encoding same, or a cell in which the disclosed methods are practiced (such as in a mammalian cell, e.g., a human cell). Codon preferences and codon usage tables for a particular species can be used to engineer isolated nucleic acid molecules that take advantage of the codon usage preferences of that particular species. In some embodiments, an isolated nucleic acid molecule (which can be part of a vector) includes at least one coding sequence that is codon optimized for expression in a eukaryotic cell, or at least one coding sequence codon optimized for expression in a human cell. In one embodiment, such a codon optimized coding sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding wildtype or originating sequence. In another embodiment, a variety of clones containing functionally equivalent nucleic acids may be routinely generated, such as nucleic acids which differ in sequence, but which encode the same sequence. Silent mutations in the coding sequence result from the degeneracy (ie., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue. Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3. sup. rd Edition, W.H. 5 Freeman and Co., NY).
[0255] In some embodiments, the codon optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, atleast 300%, at least 500%, or at least 1000% increased transcription or translation in a human subject relative to a wild-type or non-codon optimized nucleic acid sequence.
[0256] In some aspects, a codon optimized nucleic acid sequence exhibits increased stability. In some aspects, a codon optimized nucleic acid sequence exhibits increased stability through increased resistance to hydrolysis. In some embodiments, the codon optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased stability relative to a wild-type or non-codon optimized nucleic acid sequence. In some embodiments, the codon optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased resistance to hydrolysis in a human subject relative to a wild-type or non- codon optimized nucleic acid sequence.
[0257] In some aspects, a codon optimized nucleic acid sequence can comprise no donor splice sites. In some aspects, a codon optimized nucleic acid sequence can comprise no more than about one, or about two, or about three, or about four, or about five, or about six, or about seven, or about eight, or about nine, or about ten donor splice sites. In some aspects, a codon optimized nucleic acid sequence comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten fewer donor splice sites as compared to a non-codon optimized nucleic acid sequence.
[0258] Without wishing to be bound by theory, the removal of donor splice sites in the codon optimized nucleic acid sequence can unexpectedly and unpredictably increase expression of protein of interest in vivo, as cryptic splicing is prevented. Moreover, cryptic splicing may vary between different subjects, meaning that the expression level of a protein comprising donor splice sites may unpredictably vary between different subjects. Such unpredictability is unacceptable in the context of human therapy. Accordingly, the codon optimized nucleic acid sequences which lacks donor splice sites, unexpectedly and surprisingly allows for increased expression of the protein in human subjects and regularizes expression of the protein across different human subjects.
[0259] In some aspects, a codon optimized nucleic acid sequence can have a GC content that differs from the GC content of the non-codon optimized nucleic acid sequence. In some aspects, the GC content of a codon optimized nucleic acid sequence is more evenlydistributed across the entire nucleic acid sequence, as compared to the non-codon optimized nucleic acid sequence.
[0260] Without wishing to be bound by theory, by more evenly distributing the GC content across the entire nucleic acid sequence, the codon optimized nucleic acid sequence exhibits a more uniform melting temperature (“Tm”) across the length of the transcript. The uniformity of melting temperature results unexpectedly in increased expression of the codon optimized nucleic acid in a human subject, as transcription and / or translation of the nucleic acid sequence occurs with less stalling of the polymerase and / or ribosome.
[0261] In some aspects, a codon optimized nucleic acid sequence can have fewer repressive microRNA target binding sites as compared to the non-codon optimized nucleic acid sequence. In some aspects, a codon optimized nucleic acid sequence can have at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or at least ten fewer repressive microRNA target binding sites as compared to the non-codon optimized nucleic acid sequence.
[0262] Without wishing to be bound by theory, by having fewer repressive microRNA target binding sites, the codon optimized nucleic acid sequence unexpectedly exhibits increased expression in a human subject.
[0263] It should be understood, although not always explicitly stated that the sequences provided herein can be used to provide the expression product as well as substantially identical sequences that encode an RNA or express and produce a protein that has the same biological properties. These “biologically equivalent” or “biologically active” or “equivalent” polypeptides are encoded by equivalent polynucleotides as described herein. They may possess at least 60%, or alternatively, at least 65%, or alternatively, at least 70%, or alternatively, at least 75%, or alternatively, at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95% or alternatively at least 98%, identical primary amino acid sequence to the reference polypeptide when compared using sequence identity methods run under default conditions. Specific polypeptide sequences are provided as examples of particular embodiments. Modifications to the sequences to amino acids with alternate amino acids that have similar charge. Additionally, an equivalent polynucleotide is one that hybridizes under stringent conditions to the reference polynucleotide or its complement or in reference to a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes to the reference encoding polynucleotide under stringent conditions or itscomplementary strand. Alternatively, an equivalent polypeptide or protein is one that is expressed from an equivalent polynucleotide.
[0264] “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi -stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
[0265] Examples of stringent hybridization conditions include: incubation temperatures of about 25°C to about 37°C; hybridization buffer concentrations of about 6x SSC to about lOx SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4x SSC to about 8x SSC. Examples of moderate hybridization conditions include: incubation temperatures of about 40°C to about 50°C; buffer concentrations of about 9x SSC to about 2x SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5x SSC to about 2x SSC. Examples of high stringency conditions include: incubation temperatures of about 55°C to about 68°C; buffer concentrations of about lx SSC to about O. lx SSC; formamide concentrations of about 55% to about 75%; and wash solutions of about lx SSC, O.lx SSC, or deionized water. In general, hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes. SSC is 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be employed.
[0266] “Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention. To determine sequence identity, sequences can be aligned using the methods and computer programs thatare known in the art, including BLAST, available over the world wide web at ncbi.nlm.nih.gov / BLAST.
[0267] As used herein, the terms “about” and “approximately” refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, z.e., the limitations of the measurement system. For example, “about” or “approximately” can mean within one or more than one standard deviation per the practice in the art. Alternatively, “about” or “approximately” can mean a range of up to 10% (z.e., ±10%) or more depending on the limitations of the measurement system. For example, about 5 mg can include any number between 4.5 mg and 5.5 mg. Furthermore, particularly with respect to biological systems or processes, the terms can mean up to an order of magnitude or up to 5-fold of a value. When particular values or compositions are provided in the instant disclosure, unless otherwise stated, the meaning of “about” or “approximately” should be assumed to be within an acceptable error range for that particular value or composition. Also, where ranges and / or subranges of values are provided, the ranges and / or subranges can include the endpoints of the ranges and / or subranges.
[0268] The term “operably linked” and “operably joined” or related terms as used herein refers to the juxtaposition of components. The components can be linked together covalently. For example, two nucleic acids can be linked together via a phosphodiester linkage. Alternatively, a first component that confers a function on a second component without being directly physically linked can be considered to be operably linked.Cells
[0269] Also provided herein are cells comprising the RNA targeting systems, polynucleotides and vectors described herein, compositions comprising same, and methods of making same. In some embodiments of the compositions and methods of the disclosure, a cell of the disclosure is a prokaryotic cell. In some embodiments of the compositions and methods of the disclosure, a cell of the disclosure is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell. In some embodiments, the cell is a non-human mammalian cell such as a non-human primate cell. In some embodiments, the cell is a human cell.
[0270] In some embodiments, a cell of the disclosure is a somatic cell. In some embodiments, a cell of the disclosure is a germline cell. In some embodiments, a germline cell of the disclosure is not a human cell.
[0271] In some embodiments of the compositions and methods of the disclosure, a cell of the disclosure is a stem cell. In some embodiments, a cell of the disclosure is an embryonic stem cell. In some embodiments, an embryonic stem cell of the disclosure is not a human cell. In some embodiments, a cell of the disclosure is a multipotent stem cell or a pluripotent stem cell. In some embodiments, a cell of the disclosure is an adult stem cell. In some embodiments, a cell of the disclosure is an induced pluripotent stem cell (iPSC). In some embodiments, a cell of the disclosure is a hematopoietic stem cell (HSC).
[0272] In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is a muscle cell. In some embodiments, a muscle cell of the disclosure is a myoblast or a myocyte. In some embodiments, a muscle cell of the disclosure is a cardiac muscle cell, skeletal muscle cell or smooth muscle cell. In some embodiments, a muscle cell of the disclosure is a striated cell. In one embodiment, a cell or cells of a patient treated with compositions disclosed herein include, without limitation, skeletal muscle (developing and mature muscle fibers and satellite cells), neuromuscular junction, cardiomyocytes, smooth muscle cells, peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons.
[0273] In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is a neuronal cell. In one embodiment, a cell or cells of a patient treated with compositions disclosed herein include, without limitation, central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, sensory neuron, cortical or GABAergic inhibitory interneurons. In one embodiment, a neuronal cell is a glial cell.
[0274] In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is a fibroblast or an epithelial cell. In some embodiments, an epithelial cell of the disclosure forms a squamous cell epithelium, a cuboidal cell epithelium, a columnar cell epithelium, a stratified cell epithelium, a pseudostratified columnar cell epithelium or a transitional cell epithelium. In some embodiments, an epithelial cell of the disclosure forms a gland including, but not limited to, a pineal gland, a thymus gland, a pituitary gland, a thyroid gland, an adrenal gland, an apocrine gland, a holocrine gland, amerocrine gland, a serous gland, a mucous gland and a sebaceous gland. In some embodiments, an epithelial cell of the disclosure contacts an outer surface of an organ including, but not limited to, a lung, a spleen, a stomach, a pancreas, a bladder, an intestine, a kidney, a gallbladder, a liver, a larynx or a pharynx. In some embodiments, an epithelial cell of the disclosure contacts an outer surface of a blood vessel or a vein.
[0275] In some embodiments of the disclosure, a somatic cell is an ocular cell. An ocular cell includes, without limitation, corneal epithelial cells, keratyocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, nonpigmented ciliary epithelial cells, trabecular meshwork cells, ocular choroid fibroblasts, conjunctival epithelial cells. In some embodiments, an ocular cell is a retinal cell or a corneal cell. In one embodiment, a retinal cell is a photoreceptor cell or a retinal pigment epithelial cell. In another embodiment, a retinal cell is a ganglion cell, an amacrine cell, a bipolar cell, a horizontal cell, a Muller glial cell, a rod cell, or a cone cell. In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is a primary cell.
[0276] In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is a cultured cell.
[0277] In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is in vivo, in vitro, ex vivo or in situ.
[0278] In some embodiments of the compositions and methods of the disclosure, a somatic cell of the disclosure is autologous or allogeneic.Methods of Use
[0279] The disclosure provides a method of encoding an RNA or expressing an NOI in a cell using the snRNA systems disclosed herein. In one embodiment, the disclosure provides a method of modifying an RNA encoding GAA or GYSI or the activity of a GAA or GYSI protein encoded by an RNA molecule, comprising contacting the composition of the disclosure and the target RNA molecule under conditions suitable for binding to the RNA molecule. In one embodiment, the disclosure provides a method of modifying an RNA encoding GAA or the activity of a GAA protein encoded by an RNA molecule comprising contacting the composition of the disclosure and the target RNA molecule under conditions suitable for binding to the RNA molecule. In one embodiment, the disclosure provides a method of modifying an RNA encoding GYSI or the activity of a GYSI protein encoded byan RNA molecule comprising contacting the composition of the disclosure and the target RNA molecule under conditions suitable for binding to the RNA molecule.
[0280] The disclosure provides a method of modifying the level of expression of a GAA or GYSI RNA molecule of the disclosure or a GAA or GYSI protein encoded by the GAA or GYSI RNA molecule comprising contacting the composition of the disclosure and a cell comprising the GAA or GYSI RNA molecule under conditions suitable for binding the targeting sequence to the GAA or GYSI RNA molecule. The disclosure provides a method of modifying the level of expression of a GAA RNA molecule of the disclosure or a GAA protein encoded by the GAA RNA molecule comprising contacting the composition of the disclosure and a cell comprising the GAA RNA molecule under conditions suitable for binding to the GAA RNA molecule by a GAA targeting sequence. The disclosure provides a method of modifying the level of expression of a GYSI RNA molecule of the disclosure or a GYSI protein encoded by the GYSI RNA molecule comprising contacting the composition of the disclosure and a cell comprising the GYSI RNA molecule under conditions suitable for binding to the GYSI RNA molecule by a GYSI targeting sequence. In some embodiments, the cell is in vivo, in vitro, ex vivo or in situ. In some embodiments, the composition of the disclosure comprises a vector comprising or encoding snRNA sequences, or an RNA- targeting nucleic acid molecule comprising same. In some embodiments, the vector is an AAV. In some embodiments, the vector is a lentiviral vector.
[0281] The disclosure provides a method of modifying the level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting a composition of the disclosure and the RNA molecule under conditions suitable for knocking down, blocking, splicing, multi-targeting, restore frame, or editing the target RNA. In some embodiments, the composition of the disclosure comprises a vector comprising snRNA sequences, or an RNA-targeting nucleic acid molecule comprising same. In some embodiments, the vector is an AAV. In some embodiments, the vector is a lentiviral vector.
[0282] The disclosure provides a method of modifying a target RNA or an activity of a protein encoded by a target RNA molecule comprising contacting a composition of the disclosure and a cell comprising the RNA molecule under conditions suitable knocking down, blocking, splicing, multi-targeting, restore frame, or editing the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo or in situ. In some embodiments, thecomposition comprises a vector comprising the snRNA sequences disclosed herein. In some embodiments, the vector is an AAV. In some embodiments, the vector is a lentiviral vector.
[0283] The disclosure provides a method of treating a disease or disorder in a subject comprising administering to the subject a therapeutically effective amount of an snRNA composition of the disclosure. In some embodiments, the disease comprises a glycogen storage disorder. In some embodiments, the disease comprises Pompe disease. The disclosure provides a method of treating a disease in a patient in need of such treatment comprising administering to the patient a therapeutically effective amount of an snRNA composition of the disclosure. In some embodiments, the composition comprises a vector comprising or encoding one or more esRNA or snRNA disclosed herein, wherein the composition alters (decreases or increases) a level of expression of a targeted RNA such as GAA and / or GYSI RNA, and mutations thereof (compared to the level of expression of a targeted RNA treated with a non-targeting (NT) control or compared to no treatment). In some embodiments, the level of decrease is 1-fold or greater. In another embodiment, the level of decrease is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold. In another embodiment, the level of decrease is 10-fold or greater. In another embodiment, the level of decrease is between 10-fold and 20-fold. In another embodiment, the level of decrease is 11-fold, 12- fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold. In another embodiment, the level of increase is 1-fold or greater. In another embodiment, the level of increase is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold. In another embodiment, the level of increase is 10-fold or greater. In another embodiment, the level of increase is between 10-fold and 20-fold. In another embodiment, the level of increase is 11 - fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold. In another embodiment, the gene therapy compositions disclosed herein, when administered to a patient, lead to 20%-100% decrease in expression of the RNA. In one embodiment, the % decrease and is any of 20-99%, 25%-99%, 50%-99%, 80%-99%, 90%-99%, 95%-99%. In one embodiment, the % decrease is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the GAA RNA whose expression is decreased comprises GAA exons 1 and 3, and does not comprise GAA exon 2. In some embodiments, the GAA RNA whose expression is decreased comprises exons 1 and 3, and a pseudo-exon derived from intron 1. In some embodiments, the GYSI RNA whose expression is decreased comprises GYSI exons 5 and 6. In another embodiment the gene therapy, sequences disclosed herein,promotes a decreases level of expression of the RNA transcript, decreasing protein expression and function. In another embodiment, % down-regulation is 1.5-fold or higher of the targeted RNA. In some embodiments, the targeted RNA is GAA. In some embodiments, the targeted RNA comprises GAA intron 1. In some embodiments, the targeted RNA is GYSI. In some embodiments, the targeted RNA comprises GYSI exon 5. In some embodiments, the targeted RNA comprises GYSI exon 6.
[0284] In another embodiment, the gene therapy compositions disclosed herein when administered to a patient lead to 20%-100% increase in expression of the RNA. In one embodiment, the % increase and is any of 20-99%, 25%-99%, 50%-99%, 80%-99%, 90%- 99%, 95%-99%. In one embodiment, the % decrease is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In another embodiment the gene therapy, sequences disclosed herein, promotes an increased level of expression of the RNA transcript, increasing protein expression and function. In another embodiment, % up-regulation is 1.5-fold or higher of the targeted RNA. In some embodiments, the targeted RNA is GAA. In some embodiments, the targeted RNA comprises GAA intron 1. In some embodiments, the targeted RNA comprises a pseudo-exon in GAA intron 1. In some embodiments, the targeted RNA comprises GAA exon 2. In some embodiments, the RNA whose expression is increased by the compositions and methods of the disclosure comprises GAA exons 1, 2 and optionally 3, and does not include GAA intron 1 or a pseudo-exon from GAA intron 1. In some embodiments, the targeted RNA is GYSI. In some embodiments, the targeted RNA comprises GYSI exon 5. In some embodiments, the targeted RNA comprises GYSI exon 6. In some embodiments the RNA whose expression is increased by the compositions and methods of the disclosure comprises GYSI exons 5 and 7, and does not comprise GYSI exon 6. In some embodiments, for example those embodiments when the RNA is targeted for non-sense mediated decay, the increase in expression is transient.
[0285] The disclosure further provides a method of treating a disease or disorder in a subject comprising administering an RNA-targeting nucleic acid molecule (i.e. an snRNA of the disclosure), a lentiviral vector comprising or encoding an snRNA of the disclosure, or an AAV vector comprising or encoding an snRNA of the disclosure.
[0286] In some aspects, the disease or disorder is Pompe disease.
[0287] In some aspects, the RNA-targeting nucleic acid molecule, lentiviral vector, or AAV vector targets an RNA sequence encoding GAA and / or GYSI. In some aspects the RNAsequence encoding GAA and / or GYSI comprises an intronic or exonic sequence. In some aspects, the exonic sequence comprises exon 2 or a flanking region thereof of GAA. In some aspects, the exonic sequence comprises exon 5 and / or exon 6 or a flanking region thereof of GYSI.
[0288] In some embodiments of the methods of the disclosure, a subject of the disclosure has been diagnosed with a disease to be treated. In some embodiments, the subject of the disclosure presents at least one sign or symptom of a disorder or disease to be treated. In some embodiments, the subject of the disclosure presents at least one sign or symptom of a disease.
[0289] In some embodiments of the methods of the disclosure, a subject of the disclosure is female. In some embodiments of the methods of the disclosure, a subject of the disclosure is male. In some embodiments, a subject of the disclosure has two XX or XY chromosomes. In some embodiments, a subject of the disclosure has two XX or XY chromosomes and a third chromosome, either an X or a Y.
[0290] In some embodiments of the methods of the disclosure a subject of the disclosure is a neonate, an infant, a child, an adult, a senior adult, or an elderly adult. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28, 29, 30 or 31 days old. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months old. In some embodiments of the methods of the disclosure a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or any number of years or partial years in between of age.
[0291] In some embodiments of the methods of the disclosure a subject of the disclosure is a mammal. In some embodiments, a subject of the disclosure is a non-human mammal.
[0292] In some embodiments of the methods of the disclosure a subject of the disclosure is a human.
[0293] In some embodiments of the methods of the disclosure, a therapeutically effective amount comprises a single dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises at least one dose of a composition of the disclosure. In some embodiments, a therapeuticallyeffective amount comprises a therapeutically effective amount comprises one or more dose(s) of a composition of the disclosure.
[0294] In some embodiments of the methods of the disclosure, a therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount reduces a severity of a sign or symptom of the disease or disorder.
[0295] In some embodiments of the methods of the disclosure a therapeutically effective amount eliminates the disease or disorder e.g., Pompe disease).
[0296] In some embodiments of the methods of the disclosure, a therapeutically effective amount prevents an onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder.
[0297] In some embodiments, a therapeutically effective amount improves a prognosis for the subject.
[0298] In some embodiments of the methods of the disclosure, a composition of the disclosure is administered to the subject via intracerebral administration. In some embodiments of the methods of the disclosure, a composition of the disclosure is administered to the subject by intracerebroventricular injection. In some embodiments, the composition of the disclosure is administered to the subject by an intrastriatal route. In some embodiments, the composition of the disclosure is administered to the subject by a stereotaxic injection or an infusion. In some embodiments, the composition is administered intravenously. In some embodiments, the composition is administered to the brain. In some embodiments of the methods of the disclosure a composition of the disclosure is administered to the subject locally.
[0299] In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions. Briefly, pharmaceutical compositions for use as disclosed herein may comprise a protein(s) or a polynucleotide encoding the protein(s), optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.Compositions of the disclosure may be formulated for routes of administration, such as e.g., oral, enteral, topical, transdermal, intranasal, and / or inhalation; and for routes of administration via injection or infusion such as, e.g., intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral administration. In certain embodiments, the compositions of the present disclosure are formulated for intracerebral or intrastriatal administration.EXAMPLES
[0300] The examples described herein are intended for illustration only and are not intended to limit the inventions claimed.Example 1: GAA exon 2 inclusion and GYSI exon 6 exclusion via GAA and GYSI targeting snRNAsMaterial and MethodsMaterial and Methods
[0301] Splicing assays to evaluate GAA exon 2 inclusion: 250 ng of RNA was used for cDNA synthesis with SuperScript IV Reverse Transcriptase (ThermoFisher Scientific) following manufacturer’s recommendations. PCR was performed on cDNA with KOD Xtreme Hot Start DNA Polymerase (Novagen). PCR products were run on 4200 TapeStation (Agilent) with DI 000 ScreenTape (Agilent).
[0302] qRT-PCR: Multiplexed TaqMan qRT-PCR was performed with Ultraplex 1-Step Toughmix (QuantaBio) and commercially available probes targeting GAA and GYSI with custom hGAPDH probe. Each sample was plated in duplicates and relative GAA or GYSI mRNA levels were calculated with the delta-delta Ct method.
[0303] Western blot: GAA and GYSI protein analysis was performed on a Jess system (ProteinSimple) according to the manufacturer’s instructions. Relative GAA and GYSI protein levels were calculated by dividing area under the curve (AUC) of the GAA or GYSI peak by AUC of the GAPDH peak or total protein as indicated, then normalizing to nontargeting negative control condition or healthy control as indicated.
[0304] Functional Assays: GAA enzymatic activity kit (Abeam) and glycogen assay kit (Abeam) were performed according to the manufacturer’s instructions.ResultsIn vitro evaluation of U7 snRNAs targeting GAA intron 1
[0305] U7 snRNAs were engineered to bind splicing regulatory sequences within GAA pre- mRNA to promote inclusion of a constitutive exon (exon 2) that is skipped as a result of mutations in intron 1, which will prevent a frameshift and nonsense mediated decay (NMD) resulting in normal GAA transcription (FIG. 1A).
[0306] FIG. 1A shows the mechanism of action for GAA exon 2 inclusion using engineered U7 snRNAs. 40-70% of late-onset Pompe disease (LOPD) patients carry a mutation c.-32- 13T>G (*) disrupting the polypyrimidine tract in GAA intron 1 leading to mis-splicing and the exclusion of exon 2- with or without the presence of a pseudo-exon (shown as the box between exon 1 and exon 3, FIG. 1A, right side at top). This mis-splicing event leads to a frameshift with a premature termination codon (PTC) and subsequent nonsense mediated decay. The SV2 and SV3 variants are the most common products from the mis-splicing that occurs as a result of the c.-32-13T>G mutation in intron 1 of the GAA gene. U7 snRNAs were engineered to bind and block those sites in the polypyrimidine track of GAA intron 1 and adjacent splicing regulatory sites to promote inclusion of exon 2 and restoration of the GAA frame, leading to normal expression and function. FIG. IB shows a timeline for fibroblast (GM00443- derived from a LOPD patient) lentiviral transduction and analysis 1-week post treatment. FIG. 1C depicts a tapestation image of the RT-PCR products after U7 snRNA treatments using lentiviruses expressing dual snRNAs (under the mouse U7 and mouse U1 promoters) with single spacers (L05641 and L05642) or fusion spacers (L05643 and L05644), showing the normal isoform (Normal, top band, containing exon 2) and the misspliced isoforms (SV3 and SV2, mid and bottom bands). Lentiviruses expressing GFP only were used as a negative control. FIG. ID shows the quantification of the tapestation image (FIG. 1C) for the normal isoform after treatment. FIG. IE depicts the qRT-PCR results for GAA RNA expression post-treatment with multiple U7 snRNAs with single and fusion spacers. The y axis shows levels of endogenous GAA RNA expression normalized to the GAPDH reference gene and x axis depicts the lentiviral treatment.
[0307] FIG. 2A shows western blot images of endogenous GAA protein expression in LOPD patient fibroblasts transduced with lentiviruses expressing a GFP control or 2 snRNA cassettes (with single or fusion spacers) 1-week post treatment. The bottom bands show the GAPDH loading control. FIG. 2B shows the quantification of the western blot (FIG. 2A)indicating the levels of endogenous GAA protein in LOPD patient fibroblasts 1-week post treatment. GAA protein expression was normalized to the GAPDH loading control. FIG. 2C depicts the enzymatic activity of GAA protein 1-week post lentiviral transduction. Untreated wild type (WT) fibroblasts from a healthy individual were used as a positive.
[0308] Conclusions: Multiple snRNA spacers promote GAA exon 2 inclusion and upregulation of endogenous GAA mRNA in late-onset Pompe disease patient fibroblast cells. Combination of 2 fusion spacers show slightly more potent GAA exon 2 inclusion.In vitro evaluation of U7 snRNAs targeting GYSI exon 6
[0309] U7 snRNAs were engineered to bind splicing regulatory sequences within GYSI pre- mRNA to promote exclusion of a constitutive exon (exon 6), which promotes a frameshift and nonsense mediated decay (NMD) resulting in decreased GYSI transcription (FIG. 3A).
[0310] FIG. 3 A shows the mechanism of action for GYSI knockdown using engineered U7 snRNAs. U7 snRNAs were engineered to bind splicing regulatory sequences to promote skipping of a constitutive exon (exon 6) which ultimately leads to a frameshift and the generation of a premature termination codon (PTC) to promote RNA degradation by nonsense mediated decay (NMD). FIG. 3B shows the qRT-PCR quantification of GYSI RNA expression 48-hours post-transfection in HEK-293T cells after U7 snRNA treatments using pcDNA-lx snRNA containing singles or fusion spacers. The y-axis shows the levels of GYSI RNA expression normalized to the GAPDH reference gene and the x-axis depicts the treatments. FIG. 3C shows a tapestation image of the RT-PCR products after different U7 snRNA treatments, expressing a single snRNA cassette (z30) or 2x snRNA cassettes (z30, z30 and z30, z30 and z29), with single spacers. HEK-293T cells were treated with U7 snRNAs for 48-hours before harvesting. The top band denotes the PCR product for GYSI with exon 6 present, and the bottom band denotes the PCR product for GYSI with exon 6 absent. FIG. 3D depicts the qRT-PCR quantification of GYSI RNA expression posttreatment. The y-axis shows the levels of GYSI RNA expression normalized to GAPDH reference gene and the x-axis depicts the treatment. FIG. 3E shows western blot images of endogenous GYSI protein expression in HEK-293T cells transfected with 1 or 2 snRNA cassettes (with single spacers) for 48-hours. The bottom, red band denotes the GAPDH loading control. FIG. 3F shows the western blot quantification of the levels of endogenousGYSI protein 48-hours post treatment. Expression was normalized to GAPDH loading control.
[0311] Conclusions: Multiple snRNA spacers promote GYSI exon 6 exclusion and downregulation of endogenous GYSI mRNA HEK-293T cells. Single spacers show robust exon 6 skipping and down regulation of endogenous GYSI RNA and protein.Multi-targeting strategy targeting GAA intron 1 and GYSI exon 6 with a single therapy
[0312] Multi-targeting snRNAs promotes GYSI knockdown to decrease glycogen synthesis, and GAA restoration of expression and function to improve glycogen breakdown in order to remedy aberrant glycogen storage characteristic of Pompe disease (FIG. 4A)
[0313] FIG. 4A shows the mechanism of action for multi -targeting snRNAs, which promotes GYSI knockdown to decrease glycogen synthesis, and GAA restoration of expression and function to improve glycogen breakdown. FIG. 4B depicts a tapestation image of the RT- PCR products after U7 snRNA treatments. LOPD differentiated myotubes were transduced with AAV9 expressing dual snRNA cassettes (under mouse U7 and mouse U1 promoters), to target GAA exon 2 (A06069) or to target GAA exon 2 and GYSI exon 6 (A06070). Cells were harvested for analysis 10-days post-transduction. The top bands depict normal (N; exon 2 present) GAA isoform, and the bottom band indicates the mis-spliced isoform (SV2; exon 2 absent). FIG. 4C depicts the qRT-PCR quantification of the GAA samples shown in FIG. 4B. FIG. 4D depicts the qRT-PCR quantification of the GYSI samples shown in FIG. 4B. As shown, multi -targeting AAV (A06070) promotes a similar level of GAA transcript increase to A06069 (dual GAA spacers), while driving about 50% reduction in GYSI transcript.
[0314] FIG. 4E shows a western blot and quantification of GAA protein expression after treatment. FIG. 4F shows a western blot and quantification of GYSI protein expression after treatment. These data demonstrate that multi-targeting AAV (A06070) promotes similar level of GAA protein increase to A06069, while driving about 70% reduction in GYSI protein.
[0315] FIG. 4G shows the quantification of glycogen levels in LOPD myotubes transduced with AAV9 expressing dual snRNA cassettes (under mouse U7 and mouse U1 promoters), targeting GAA exon 2 (A06069) and targeting GAA exon 2 as well as GYSI exon 6 (A06070). Cells were harvested for analysis 10 days post-transduction. Glycogen levels were normalized to an AAV empty capsid control. It was observed that multi-targeting AAV (A06070) provides about a 10% benefit in glycogen reduction over GAA targeting alone. Alonger treatment time may help to show further benefit of GAA and GYSI multi-targeting strategy.
[0316] Conclusions: Treatment of LOPD myotubes with AAV multi -targeting with GAA and GYSI U7 snRNAs leads to robust GAA exon 2 inclusion and upregulation of its RNA and protein, as well as simultaneously knocking down GYSI RNA and protein. This promotes a slight increase in the effectiveness of glycogen reduction as compared to AAV targeting sole GAA.INCORPORATION BY REFERENCE
[0317] Every document cited herein, including any cross referenced or related patent or application is hereby incorporated herein by reference in its entirety unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art with respect to any invention disclosed or embodimented herein or that it alone, or in any combination with any other reference or references, teaches, suggests or discloses any such invention. Further, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.OTHER EMBODIMENTS
[0318] While particular embodiments of the disclosure have been illustrated and described, various other changes and modifications can be made without departing from the spirit and scope of the disclosure. The scope of the appended claims includes all such changes and modifications that are within the scope of this disclosure.
Claims
CLAIMSWHAT IS CLAIMED IS:
1. An RNA-targeting nucleic acid molecule comprising a small nuclear RNA (snRNA), wherein the snRNA comprises a targeting sequence that binds an acid alpha-glycosidase (GAA) RNA sequence (GAA targeting sequence).
2. The RNA-targeting nucleic acid molecule of claim 1, wherein the GAA RNA sequence comprises a sequence of GAA intron 1 or exon 2.
3. The RNA-targeting nucleic acid molecule of claim 1, wherein the GAA targeting sequence comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-24.
4. An RNA-targeting nucleic acid molecule comprising a small nuclear RNA (snRNA), wherein the snRNA comprises a targeting sequence that binds a glycogen synthase 1 (GYSI) RNA sequence (GYSI targeting sequence).
5. The RNA-targeting nucleic acid molecule of claim 4, wherein the GYSI RNA sequence comprises as sequence of GYSI exon 5 or exon 6.
6. The RNA-targeting nucleic acid molecule of claim 4, wherein the GYSI targeting sequence comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 25-73.
7. The RNA-targeting nucleic acid molecule of any one of claims 1-6, wherein the snRNA comprises a stem loop (SL).
8. The RNA-targeting nucleic acid molecule of claim 7, wherein the SL comprises one or more nucleic acid sequences at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 74-114.
9. The RNA-targeting nucleic acid molecule of any one of claims 1-8, wherein the GAA RNA sequence and / or the GYSI RNA sequence comprises a pre-mRNA or mRNA sequence.
10. The RNA-targeting nucleic acid molecule of any one of claims 1-9, wherein the snRNA comprises an Sm binding domain (SmBD).
11. The RNA-targeting nucleic acid molecule of claim 10, wherein the SmBD is a Ul, U2, U4, or U5 SmBD.
12. The RNA-targeting nucleic acid molecule of claim 11, wherein the SmBD comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 111 or 112.
13. The RNA-targeting nucleic acid molecule of any one of claims 1-12, wherein the snRNA comprises a 5’ interaction stabilizer domain (5’ISD).
14. The RNA-targeting nucleic acid molecule of claim 13, wherein the 5’ISD comprises the nucleotide sequence GGAGT, CCTCT, GGAGGT, CCTCCT, AGCCAG, GGAAG, GAAGAAG, GTTG, CCGAA, TAAGGAG, GAAG, OR GGCTT.
15. A vector comprising or encoding one or more RNA-targeting nucleic acid molecules of any one of claims 1-14.
16. The vector of claim 15, wherein the vector is an adeno-associated virus (AAV) vector or lentiviral vector.
17. The AAV vector of claim 16, wherein the snRNA is operably linked to a promoter.
18. The AAV vector of claim 16 or 17, wherein the snRNA is operably linked to a U7 promoter or a Ul promoter.
19. The AAV vector of any one of claims 16-18, wherein the snRNA is operably linked to a downstream terminator (DT).
20. The AAV vector of any one of claims 16-19, wherein the snRNA is operably linked to a U7 downstream terminator or a Ul downstream terminator.
21. The AAV vector of any one of claims 16-20, wherein the vector comprises at least one, at least two, at least three, at least four, or at least five snRNA.
22. The AAV vector of any one of claims 16-18, wherein each snRNA is separated by a buffer sequence.
23. The AAV vector of claim 22, wherein the buffer sequence comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one SEQ ID NOs: 143-149.
24. The AAV vector of any one of claims 16-23, wherein the vector comprises a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-169, 185, 190, 192, 194, 196, 199, or 200.
25. A GAA RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 1-24.
26. A GYSI RNA-targeting nucleic acid molecule comprising a targeting sequence set forth in any one of SEQ ID NOs: 25-73.
27. A combination RNA-targeting nucleic acid molecule comprising the GAA RNA- targeting nucleic acid molecule of claim 25 and the GYSI RNA-targeting nucleic acid molecule of claim 26.
28. A polynucleotide or vector comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-169, 199, or 200.
29. A polynucleotide or vector comprising a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 185, 190, 192, 194, or 196.
30. A recombinant AAV (rAAV) comprising:(a) an AAV capsid comprising an AAV capsid protein; and(b) a vector genome comprising a sequence encoding the RNA-targeting nucleic acid molecule of any one of claims 1-14, the GAA RNA-targeting nucleic acid molecule of claim 25, the GYSI RNA-targeting nucleic acid molecule of claim 26, the combination RNA- targeting nucleic acid molecule of claim 27, and / or the polynucleotide of claim 28 or 29.
31. The rAAV of claim 30, wherein the vector genome further comprises a 5' inverted terminal repeat (ITR) sequence and a 3' ITR.
32. The rAAV of claim 30 or 31, wherein the vector genome comprises, in the 5' to 3' direction, a 5' ITR sequence, the snRNA or the RNA-targeting nucleic acid molecule, and a 3' ITR sequence.
33. A recombinant AAV (rAAV) comprising:(a) an AAV capsid comprising an AAV capsid protein; and(b) a vector genome comprising the polynucleotide of claim 28.
34. The rAAV of any one of claims 30-33, wherein the AAV capsid comprises an AAV capsid protein of an AAV serotype selected from the group consisting of: AAV1, AAV2,AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, and variants thereof.
35. The rAAV of any one of claims 30-34, wherein the vector genome is single-stranded or self-complementary.
36. The rAAV of any one of claims 30-35, wherein the rAAV is replication incompetent.
37. A lentiviral particle comprising the polynucleotide or vector of claim 29.
38. A pharmaceutical composition comprising the RNA-targeting nucleic acid molecule of any one of claims 1-14, the vector of any one of claims 15-24, the GAA RNA-targeting nucleic acid molecule of claim 25, the GYSI RNA-targeting nucleic acid molecule of claim 26, the combination RNA-targeting nucleic acid molecule of claim 27, the polynucleotide or vector of claim 28 or 29, the rAAV of any one of claims 30-36, or the lentiviral particle of claim 37.
39. A method of targeting one or more target RNAs of interest and excluding an exon or including an exon, comprising contacting the RNA-targeting nucleic acid molecule of any one of claims 1-14, the vector of any one of claims 15-24, the GAA RNA-targeting nucleic acid molecule of claim 25, the GYSI RNA-targeting nucleic acid molecule of claim 26, the combination RNA-targeting nucleic acid molecule of claim 27, the polynucleotide or vector of claim 28 or 29, the rAAV of any one of claims 30-36, the lentiviral particle of claim 37, or the pharmaceutical composition of claim 38 with a cell comprising the one or more target RNAs.
40. A method of treating a disease or disorder in a subject in need thereof comprising administering to the subject the RNA-targeting nucleic acid molecule of any one of claims 1- 14, the vector of any one of claims 15-24, the GAA RNA-targeting nucleic acid molecule of claim 25, the GYSI RNA-targeting nucleic acid molecule of claim 26, the combination RNA- targeting nucleic acid molecule of claim 27, the polynucleotide or vector of claim 28 or 29, the rAAV of any one of claims 30-36, the lentiviral particle of claim 37, or the pharmaceutical composition of claim 38.
41. The method of claim 40, wherein the disease or disorder is Pompe disease.
42. The method of claim 40 or 41, wherein the administration is systemic, intravenous, or intracerebroventricular.
43. The RNA-targeting nucleic acid molecule of any one of claims 1-14, the vector of any one of claims 15-24, the GAA RNA-targeting nucleic acid molecule of claim 25, the combination RNA-targeting nucleic acid molecule of claim 27, the polynucleotide or vector of claim 28 or 29, the rAAV of any one of claims 30-36, the lentiviral particle of claim 37, or the pharmaceutical composition of claim 38, wherein the GAA RNA sequence is a mutant GAA RNA sequence.
44. The RNA-targeting nucleic acid molecule, vector or method of claim 43, wherein the GAA mutation comprises c.-32-13T>G.
45. A kit comprising the RNA-targeting nucleic acid molecule of any one of claims 1- 14, the vector of any one of claims 15-24, the GAA RNA-targeting nucleic acid molecule of claim 25, the GYSI RNA-targeting nucleic acid molecule of claim 26, the combination RNA- targeting nucleic acid molecule of claim 27, the polynucleotide or vector of claim 28 or 29, the rAAV of any one of claims 30-36, the lentiviral particle of claim 37, or the pharmaceutical composition of claim 38, and instructions for use.
46. Use of the RNA-targeting nucleic acid molecule of any one of claims 1-14, the vector of any one of claims 15-24, the GAA RNA-targeting nucleic acid molecule of claim 25, the GYSI RNA-targeting nucleic acid molecule of claim 26, the combination RNA- targeting nucleic acid molecule of claim 27, the polynucleotide or vector of claim 28 or 29, the rAAV of any one of claims 30-36, the lentiviral particle of claim 37, or the pharmaceutical composition of claim 38 in the manufacture of a medicament for treating a disease or disorder in a subject.
47. The use of claim 46, wherein the disease or disorder is Pompe disease.
Citation Information
Patent Citations
Recombinant AAV vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids
WO2001083692A2
RAAV vector compositions having tyrosine-modified capsid proteins and methods for use
WO2008124724A1
Compositions and methods comprising engineered small nuclear RNA (SNRNA)
WO2023168458A1
Adeno-associated viral vectors for proper packaging of repetitive elements
WO2024119102A1