Method for fabricating pancreatic islet organoid derived from mesenchymal stem cells, pancreatic islet organoid according thereto, and method for screening therapeutic agent for diabetes-related diseases using same
The co-culture of mesenchymal stem cells and beta cells in a three-dimensional environment efficiently produces pancreatic islet organoids, addressing the inefficiencies of iPSC methods, and enables effective diabetes research and treatment applications.
Patent Information
- Application Number
- PCT/KR2024/017776
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-29
- Filing Date
- 2024-11-11
- Publication Date
- 2025-08-07
AI Technical Summary
Existing methods for producing pancreatic islet organoids from induced pluripotent stem cells are costly, time-consuming, and have low differentiation efficiency, and transplantation of iPSC-derived organoids can lead to immune response issues.
A method involving the co-culture of human pancreatic-derived mesenchymal stem cells and a beta cell line in a three-dimensional environment using a biocompatible matrix and culture medium, which includes specific enzyme treatments and subculturing for 50 to 150 days, to produce pancreatic islet organoids that express TRA-1-60, NGN3, and NKX6.1.
This method is more cost-effective, efficient, and time-saving, producing pancreatic islet organoids that are functionally similar to adult pancreatic islets, suitable for disease modeling, drug screening, toxicity assessment, and genetic manipulation for diabetes treatment.
Smart Images

Figure KR2024017776_07082025_PF_FP_ABST
Abstract
Description
Method for producing pancreatic islet organoids derived from mesenchymal stem cells, pancreatic islet organoids produced thereby, and method for screening a treatment agent for diabetes-related diseases using the same
[0001] The present invention relates to a method for producing a pancreatic islet organoid derived from mesenchymal stem cells, a pancreatic islet organoid produced thereby, and a method for screening a treatment agent for diabetes-related diseases using the same.
[0002] An organoid is an organoid that closely resembles a specific body organ in vitro and serves as a model for research or treatment. By inducing differentiation of undifferentiated stem cells into model organ-specific cells, organoids can be used as research models, allowing for the three-dimensional reproduction and observation of actual organs. Furthermore, organoids can be transplanted into damaged or underdeveloped organs for therapeutic purposes.
[0003] Stem cells are cells that remain undifferentiated into specific cell types, but when exposed to specific environments, they possess the ability to differentiate into various cell types that make up an organism. Examples of stem cells include embryonic stem cells, adult stem cells, and induced pluripotent stem cells.
[0004] Mesenchymal stem cells (MSCs) are a representative type of adult stem cell that can be isolated and cultured from various adult tissues. They are known to be capable of differentiating into bone, cartilage, and adipocytes. However, MSCs are typically isolated from bone marrow, and bone marrow-derived MSCs have difficulty differentiating into islet cells, including insulin-secreting cells, making them difficult to use as a material for islet organoids.
[0005] Recently, pancreatic islet organoids have been developed primarily using induced pluripotent stem cells (iPSCs) to mimic the developmental process of the pancreas. For example, they are produced through sequential differentiation of endocrine progenitors and pancreatic progenitors. This process takes approximately 30 days and is costly, but has low differentiation efficiency. Furthermore, transplantation of iPSC-derived organoids can lead to organoid death and functional decline due to the recipient's immune response.
[0006] For example, Korean Patent Publication No. 10-2022-0098914 relates to a technology for inducing differentiation of human induced pluripotent stem cells into endoderm, pancreatic progenitor cells, and pancreatic endocrine cells, and is characterized by producing more mature insulin using a hydrogel containing ionized atelocollagen.
[0007] The purpose of the present invention is to provide a method for producing pancreatic islet organoids derived from mesenchymal stem cells.
[0008] The purpose of the present invention is to provide a pancreatic islet organoid derived from mesenchymal stem cells according to the method for producing the mesenchymal stem cell-derived pancreatic islet organoid.
[0009] The purpose of the present invention is to provide a method for screening a treatment agent for diabetes-related diseases using the mesenchymal stem cell-derived pancreatic islet organoids.
[0010] A method for producing a pancreatic islet organoid derived from mesenchymal stem cells according to an exemplary embodiment may include a step of co-culturing human pancreatic-derived mesenchymal stem cells and a beta cell line.
[0011] In one embodiment, the human pancreatic-derived mesenchymal stem cells can be differentiated by singulating and subculturing human pancreatic tissue cells.
[0012] In one embodiment, the singulation comprises administering multiple treatments of the human pancreatic tissue cells with a decomposing enzyme, wherein the multiple treatments may be performed while sequentially reducing the concentration of the decomposing enzyme.
[0013] In one embodiment, the subculture may be performed for 50 to 150 days.
[0014] In one embodiment, the mixing ratio of the human pancreatic mesenchymal stem cells to the beta cell line may be 1 to 10.
[0015] In one embodiment, the co-culture may be conducted in three dimensions.
[0016] In one embodiment, the co-culture may be performed including a biocompatible matrix and a culture medium.
[0017] In one embodiment, the co-culture may be conducted for 1 to 10 days.
[0018] According to an exemplary embodiment, a pancreatic islet organoid derived from mesenchymal stem cells can be manufactured according to the above manufacturing method.
[0019] In one embodiment, the mesenchymal stem cell-derived pancreatic islet organoids can sequentially express TRA-1-60, NGN3, and NKX6.1.
[0020] A method for screening a treatment agent for a diabetes-related disease according to an exemplary embodiment may utilize the above mesenchymal stem cell-derived pancreatic islet organoid.
[0021] In one embodiment, the method may include the step of contacting a diabetes-related disease treatment candidate substance to the mesenchymal stem cell-derived pancreatic islet organoid; and the step of comparing the genetic variation of the pancreatic islet organoid treated with the diabetes-related disease treatment candidate substance with that of the control group not treated with the diabetes-related disease treatment candidate substance.
[0022] The method for producing a pancreatic islet organoid derived from mesenchymal stem cells according to the present invention can produce pancreatic islet organoids by three-dimensionally co-culturing human pancreatic mesenchymal stem cells and a beta cell line. This production method is more efficient in terms of cost, difficulty, and time compared to existing methods for producing pancreatic islet organoids derived from induced pluripotent stem cells.
[0023] The mesenchymal stem cell-derived pancreatic islet organoids according to the present invention sequentially express TRA-1-60, NGN3, and NKX6.1, and are highly functionally similar to actual adult pancreatic islets. Therefore, they can be utilized for disease modeling, pathological research, drug screening, toxicity assessment, and genetic manipulation aimed at preventing and treating diabetes.
[0024] Figure 1a shows a microscopic view of human pancreatic mesenchymal stem cells (Hp-MSCs) and a beta cell line (MIN6), and Figure 1b schematically illustrates the co-culture process of the two cells.
[0025] Figure 2 is a schematic diagram showing the process of unifying human pancreatic tissue cells.
[0026] Figure 3a is a schematic diagram of the subculture process of single-cell human pancreatic tissue, and Figure 3b is a microscopic observation of cell changes during the subculture process.
[0027] Figure 4 will visually observe the changes in pancreatic islet organoids formed during co-culture of human pancreatic-derived mesenchymal stem cells and beta cell lines.
[0028] Figure 5a is a schematic representation of the distribution of insulin-expressing cells within an organoid according to the formation of a pancreatic islet organoid, and Figure 5b is a microscopic observation of whether cells distributed in the periphery and center express insulin by staining cells within the organoid with H&E during the formation of a pancreatic islet organoid.
[0029] Figures 6a to 6i show markers expressed during the differentiation process of Hp-MSCs, confirmed by RT-PCR. Figures 6a to 6c show mRNA expression of CD44, CD90, and CD105, respectively, and Figures 6d to 6f show mRNA expression of SOX9, PDX1, and NGN3. Figures 6g to 6h show mRNA expression of NESTIN and OCT4, and Figure 6i shows mRNA expression of Amylase.
[0030] Figures 6j and 6k show markers expressed during the pancreatic islet organoid formation process, confirmed by RT-PCR. Figure 6j shows mRNA expression of human GAPDH and mouse beta actin. Figure 6k shows mRNA expression of human NGN3, PAX6, NEUROD, NKX6.1, INS, and SLC2A2.
[0031] Figure 7a shows the expression trends of insulin and PCNA in the peripheral and central cells of pancreatic islet organoids observed under a microscope (D1, D2, D3). Figure 7b shows the border between the insulin-expressing and PCNA-expressing regions in the center of the pancreatic islet organoids observed under a microscope (D5). Figure 7c shows the process of decreasing PCNA expression in the peripheral region of the pancreatic islet organoids observed under a microscope (D3, D4). Figure 7d shows the process of decreasing PCNA expression as the organoids differentiate into insulin-expressing cells in the center of the pancreatic islet organoids observed under a microscope (D1, D5).
[0032] Figure 8a shows the expression of TRA-1-60 and the cell histological characteristics observed under a microscope in the early stage of islet organoid formation (18HR, D1). Figure 8b shows the decrease in TRA-1-60 expression and the increase in insulin expression during islet organoid formation (D3, D5). Figure 8c shows the cells expressing both TRA-1-60 and insulin observed under a microscope during islet organoid formation (D3). Figure 8d shows the observation that NGN3 expression was initially observed during islet organoid formation and then decreased at D5 (D3). Figure 8e shows the observation under a microscope that the expression level of NKX6.1 gradually increased and reached a high level during islet organoid formation (D5). Figure 8f shows the areas adjacent to the expression sites of PCNA, NGN3, and insulin in islet organoids observed under a microscope (D5).
[0033] Figures 9a and 9b show microscopic observations of the expression of C-PEPTIDE and GLUT2, respectively, during the formation of pancreatic islet organoids (D5). Figure 9c is a graph showing the increase in insulin expression in pancreatic islet organoids according to the sugar concentration of the culture medium during the formation of pancreatic islet organoids (D3, D5).
[0034] A method for producing a pancreatic islet organoid derived from mesenchymal stem cells according to an exemplary embodiment (hereinafter, referred to as a method for producing a pancreatic islet organoid) may include a step of coculturing human pancreatic-derived mesenchymal stem cells and a beta cell line. The method for producing a pancreatic islet organoid is more cost-effective, more difficult, and more time-efficient than a conventional method for producing a pancreatic islet organoid derived from induced pluripotent stem cells.
[0035] According to an exemplary embodiment, a pancreatic islet organoid (hereinafter, “pancreatic islet organoid”) derived from mesenchymal stem cells can be produced according to the above production method. The pancreatic islet organoid sequentially expresses TRA-1-60, NGN3, and NKX6.1 and has functions very similar to those of actual pancreatic islets in an adult body. Therefore, it can be utilized for disease modeling, pathological research, drug screening, toxicity assessment, and genetic manipulation for the purpose of preventing and treating diabetes.
[0036] Hereinafter, pancreatic organoids and their production methods according to exemplary embodiments of the present invention will be described in detail with reference to the drawings and examples. However, the drawings and examples are merely exemplary and the present invention is not limited thereto.
[0037] As used herein, the term "organoid" refers to a pseudo-organ created by culturing stem cells to achieve minimal function. Organoids are organized in vitro into a three-dimensional form similar to an in vivo organ, contain a variety of organ-like cells, and can reproduce some of the organ's functions.
[0038] In this specification, the term “mesenchymal stem cell (MSC)” refers to a stem cell with multipotency that can differentiate into mesodermal-derived cells and can maintain self-renewal ability and stem cell function. Mesenchymal stem cells are cells that can attach and grow in a fibroblast-like manner in a living body, form cell colonies from single cells, and differentiate into bone, fat, and cartilage cells.
[0039] As used herein, the term "differentiation" refers to the phenomenon in which cells divide, proliferate, and become specialized in structure or function during the growth of the entire organism. In other words, it refers to the process by which cells, tissues, etc. of an organism change into forms and functions appropriate for their respective roles.
[0040] The term "culture" in this specification refers to the growth of an organism or part of an organism (e.g., organ, tissue, or cell) under artificially controlled environmental conditions. External conditions for culture include temperature, humidity, partial pressure of oxygen or carbon dioxide, and illumination. It is also possible to directly influence the organism by varying the composition of the medium.
[0041] The term "medium" in this specification refers to a medium capable of supporting cell survival, differentiation, and proliferation in vitro, and may include any conventional medium suitable for cell culture and differentiation. The type of medium and culture conditions may be appropriately selected depending on the type of cell.
[0042] The term “derived” in this specification refers to a component obtained from a source by a useful method.
[0043] The nucleotide sequence of the genes and amino acid sequence of the proteins mentioned herein can be found, for example, in databases such as NCBI and UniProt. For example, the nucleotide sequence of the human CD44 gene can be found in NCBI under the NCBI Gene ID: 960. For example, the amino acid sequence of the human CD44 protein can be found in UniProt under the UniProt ID: P16070.
[0044] A method for producing a pancreatic islet organoid according to an exemplary embodiment may include a step of co-culturing human pancreatic-derived mesenchymal stem cells and a beta cell line.
[0045] Human pancreatic mesenchymal stem cells (Hp-MSCs) can be formed by singulating tissue cells isolated from the human pancreas and culturing them for a certain period of time.
[0046] The beta cell line may include mouse pancreatic beta cells. The beta cell line may be obtained by culturing mouse pancreatic beta cells, for example, MIN6, for a certain period of time.
[0047] Referring to Fig. 1b, the human pancreatic mesenchymal stem cells (Hp-MSCs) and the beta cell line (MIN6) can be co-cultured in a three-dimensional environment to produce pancreatic organoids. The pancreatic organoids are capable of producing and secreting insulin.
[0048] In one embodiment, the human pancreatic-derived mesenchymal stem cells can be differentiated by singulating and subculturing human pancreatic tissue cells.
[0049] Referring to FIG. 2, in one embodiment, the unification may be performed by treating the human pancreatic tissue cells with a plurality of proteolytic enzymes. The plurality of treatments may be performed by sequentially reducing the concentration of the proteolytic enzyme. For example, the unification may be performed by treating the human pancreatic tissue cells with a plurality of proteolytic enzymes to break the junctions between pancreatic cells and separate them into single cells or cells similar to single cells. For example, the concentration of the proteolytic enzyme may be sequentially reduced during the plurality of treatments. For example, the unification may be performed by treating the human pancreatic tissue cells with a proteolytic enzyme five times, and the concentration of the proteolytic enzyme may be sequentially reduced during each treatment. For example, the concentrations may be 1 mg / mL, 0.83 mg / mL, 0.69 mg / mL, 0.57 mg / mL, and 0.48 mg / mL.
[0050] The above-mentioned degrading enzyme is not limited to any enzyme capable of degrading human pancreatic tissue cells. For example, the above-mentioned degrading enzyme may include Collagenase P.
[0051] Referring to Figure 3a, single-cell human pancreatic tissue cells can be passaged and differentiated into mesenchymal stem cells, such as Hp-MSCs. For example, mesenchymal stem cell markers CD44, CD90, CD105, NESTIN, and OCT4 can be expressed during the differentiation process. For example, transcription factors SOX9, PDX1, and NGN3, which are involved in pancreatic development, can be expressed during the differentiation process. For example, amylase, a pancreatic exocrine cell marker, can be expressed during the differentiation process.
[0052] In one embodiment, the subculture may be performed for 50 to 150 days. Preferably, the subculture may be performed in a medium for 70 to 120 days. Preferably, the subculture may be performed in two dimensions. The subculture medium is not particularly limited, and may include, for example, DMEM (Dulbeco's Modified Eagle's Medium), IMDM (Iscove's Modified Dulbecco's Medium), a-MEM (Alpha Modification of Eagle's Medium), F12 (Nutrient Mixture F-12), DMEM / F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12), etc.
[0053] In some embodiments, the subculture medium may include a buffer, such as PBS (phosphate-buffered saline), D-PBS (Dulbecco's phosphate-buffered saline), EBSS (Earle's balanced salt solution), or HBSS (Hanks' balanced salt solution). Optionally, penicillin / streptomycin, Glutamax, B27 supplement, N-Acetylcysteine-1, Noggin, Rspondin-1, acidic FGF1, Heparin, Forskolin, and the like may be further included.
[0054] In one embodiment, the mixing ratio of the human pancreatic mesenchymal stem cells to the beta cell line may be 1 to 10. Preferably, it may be 2 to 8, 3 to 7, or 4 to 6.
[0055] In one embodiment, the co-culture may be conducted in three dimensions.
[0056] In one embodiment, the co-culture may be performed using a biocompatible matrix and a culture medium. For example, a culture vessel may contain the biocompatible matrix and the culture medium. Specific conditions for three-dimensional culture are not particularly limited and may be performed using methods commonly used in the art. For example, the co-culture may be performed using a floating culture method in which cells float and aggregate in a culture medium, preventing cell attachment. For example, by using a culture vessel with a concave bottom or by providing a concave biocompatible matrix, cell aggregation can be improved and three-dimensional culture can be effectively performed.
[0057] The biocompatible matrix may be any biocompatible material known in the art suitable for in vitro three-dimensional culture. The biocompatible matrix may be Matrigel, collagen, extracellular matrix, methylcellulose, agarose, polyurethane, hyaluronic acid, or the like.
[0058] The culture medium may include, for example, DMEM, IMDM, a-MEM, F12, DMEM / F12, etc. The culture medium may include, as needed, PBS (phosphate-buffered saline), D-PBS (Dulbecco's phosphate-buffered saline), EBSS (Earle's balanced salt solution), HBSS (Hanks' balanced salt solution). The culture medium may further include penicillin / streptomycin, Glutamax, B27 supplement, N-Acetylcysteine-1, Noggin, Rspondin-1, acidic FGF1, Heparin, Forskolin, etc., as needed.
[0059] Pancreatic islet organoids can be formed through 3D coculture of the aforementioned human pancreatic mesenchymal stem cells and beta cell lines. This method is more cost-effective, less complex, and less time-consuming than conventional methods for producing pancreatic islet organoids derived from induced pluripotent stem cells.
[0060] For example, the pancreatic islet organoid may exhibit characteristics of a cell aggregate of insulin-secreting cells differentiated from the human pancreatic mesenchymal stem cells. Referring to Fig. 5a, during the initial stage of pancreatic islet organoid formation, insulin-expressing cells proliferate abundantly in the periphery, but decrease over time, and rapidly increase in the center.
[0061] For example, the above pancreatic islet organoids can express TRA-1-60, NGN3, PAX6, NEUROD, NKX6.1, INS, and SLC2A2 during the formation process. Therefore, they can differentiate from stem cells into pancreatic endocrine cell precursors, pancreatic cell precursors, beta cell precursors, etc., and produce and secrete insulin.
[0062] According to an exemplary embodiment, a pancreatic islet organoid can be manufactured according to the above manufacturing method. The pancreatic islet organoid can be utilized for disease modeling, pathological research, drug screening, toxicity assessment, and genetic manipulation for the purpose of preventing and treating diabetes.
[0063] In one embodiment, the pancreatic islet organoid can sequentially express TRA-1-60, NGN3, and NKX6.1. Therefore, it is possible to differentiate from stem cells into pancreatic endocrine cell precursors and mature pancreatic endocrine cells, thereby producing and secreting insulin. The pancreatic islet organoid has a function very similar to that of actual pancreatic islets in an adult body. Therefore, the efficiency of organ transplantation can be increased through autologous transplantation.
[0064] A method for screening a treatment agent for a diabetes-related disease according to an exemplary embodiment can utilize the pancreatic islet organoid.
[0065] In one embodiment, the method for screening a diabetes-related disease treatment agent may include the steps of contacting the pancreatic islet organoid with a diabetes-related disease treatment candidate substance; and comparing the genetic variation of the pancreatic islet organoid treated with the diabetes-related disease treatment candidate substance with a control group that has not been treated with the diabetes-related disease treatment candidate substance. Prior to contacting the pancreatic islet organoid with the diabetes-related disease treatment candidate substance, a diabetes-related disease may be induced to mimic the disease or symptom to be treated by the screening target drug.
[0066] Hereinafter, the present invention will be described in detail with examples to specifically illustrate the invention. However, the following examples are intended only to illustrate the invention and are not intended to limit the scope of the present invention.
[0067] Manufacturing example: Manufacturing of pancreatic islet organoids
[0068] Manufacturing Example 1: Preparation of human pancreatic mesenchymal stem cells (Hp-MSCs)
[0069] Manufacturing Example 1-1: Single-cell differentiation of human pancreatic tissue cells
[0070] To isolate pancreatic cells, normal adult pancreatic tissue was obtained in accordance with the regulations of the Kangbuk Samsung Hospital Institutional Review Board, and the procedure was performed in accordance with the Helsinki Protocol and Good Clinical Practice. A modified Ricordi method for isolating pancreatic cells was used.
[0071] Collagenase P (1 mg / mL, 5 mL, Roche) was injected into the pancreatic tissue, placed in a 50 mL tube, filled with Collagenase P to 30 mL, and incubated at 37°C. After 5 minutes, 5 mL of the supernatant was separated, washed 5 times with HBSS, and cultured in a T75 plate containing cell medium. 5 mL of HBSS was supplemented to the Collagenase P solution, inverted, and further incubated. The above process was repeated 3 more times, and the concentration of Collagenase P was sequentially lowered to 1, 0.83, 0.69, 0.57, and 0.48 mg / mL to induce unification of pancreatic tissue cells.
[0072] The cells isolated at each stage are cultured using DMEM (Dulbeccos Modified Eagles Medium, Gibco) medium containing 10% fetal bovine serum (FBS, Gibco) and 1% antibiotics.
[0073] Manufacturing Example 1-2: Subculture of singular cells (Hp-MSCs differentiation)
[0074] The singular human pancreatic tissue cells of Manufacturing Example 1-1 were cultured in the first medium, and the first medium was replaced after 12 hours, and the culture was continued while replacing the medium every 48 hours to induce cell proliferation. After about 32 days, the cells in each plate were detached with 0.25% Trypsin-EDTA and collected into one T75 plate containing the same medium. After that, when the amount of cells was about 50%, they were divided into four T75 plates and cultured, and then divided again into eight plates and cultured. After that, the eight plates were maintained and the cells were passaged twice at 7-day intervals. The medium used in each step was the same as the medium in Manufacturing Example 1-1.
[0075] After completion of subculture, human pancreatic mesenchymal stem cells (Hp-MSCs) were obtained. The obtained Hp-MSCs are shown in Figure 1a.
[0076] The subculture process (passages 1 to 5, P1 to P5) was observed using a laser scanning microscope (FV3000, OLIMPUS) and is shown in Fig. 3b. The epithelial cell morphology gradually decreased, and from passage 3 (P3), cells with a fibroblast morphology exceeding 60% were observed, and from passage 5 (P5), only cells with a fibroblast morphology were observed.
[0077] Manufacturing Example 2: Preparation of mouse-derived beta cells (MIN6 preparation)
[0078] MIN6 beta cells, a mouse pancreatic beta cell line, were cultured. Culture conditions were the same as for pancreatic cells: 10% FBS, 1% antibiotics, and DMEM medium. T75 plates were used to minimize cell overlapping, and cell concentrations were controlled to less than 50% for culture.
[0079] The prepared beta cells MIN6 are shown in Figure 1a.
[0080] Manufacturing Example 3: Pancreatic islet organoid formation through co-culture of Hp-MSCs and MIN6.
[0081] Apply 0.5 mL of Matrigel to the bottom of a 1.55 cm diameter circular plate, and inoculate 5 × 10 Hp-MSCs using culture medium containing DMEM (Gibco) containing 10% FBS (Gibco) and 1% P / S. 6 , MIN6 1×10 6 were mixed and cultured at 37℃ for 5 days.
[0082] Changes in pancreatic islet organoids during the co-culture period were observed visually and are shown in Figure 4. After 5 days, pancreatic islet organoid differentiation was completed, and it was confirmed that the structures were formed in a stable form.
[0083] Example 1: Determination of Cell and Insulin Expression in Pancreatic Islet Organoids
[0084] During the pancreatic organoid formation process of Manufacturing Example 3, cells within the organoid were stained with H&E and observed using a LEICA confocal microscope (STELLARIS 5). In addition, insulin expression in cells distributed in the peripheral and core of the cells was observed, and is shown in Fig. 5b.
[0085] As shown in Figure 5b, during the early stages of islet organoid formation (D1, D2), insulin-expressing cells proliferate predominantly in the periphery, whereas as the islet organoid formation process progresses (D3, D5), the number of insulin-expressing cells increases in the center. Therefore, as differentiation progresses, the formed islet organoids exhibit the characteristics of a cell aggregate of insulin-secreting cells.
[0086] Example 2: Real-Time PCR Measurement
[0087] Example 2-1: Confirmation of expression markers during the differentiation process of Hp-MSCs
[0088] To identify markers expressed during the differentiation process of Hp-MSCs in Manufacturing Example 1-2, quantitative real-time polymerase chain reaction (LightCycler480II) was performed using the primers listed in Table 1. The results are shown in Figures 6a to 6i.
[0089] Gene Forward (5'-3') Reverse (5'-3') CD44(human)CCAGAAGGAACAGTGGTTGGCACTGTCCTCTGGGCTTGGTGTTCD90(human)GAAGGTCCTCTACTTATCCGCCTGATGCCCTCACACTTGACCAGCD105(human)CGGTGGTCAATATCCTGTCGAGAGGAAGTGTGGGCTGAGGTAGAPDX1(human)A CTCCACCTTGGGACCTGTTTTTAAGGTACTCGGCCCAGCTTNGN3(human)CCACGGCCCTCGCTGCTCGCGGACGTGGGGCAGGTCOCT4(human)CCTGAAGCAGAAGAGGATCACCAAAGCGGCAGATGGTCGTTTGGAmylase(human)GATAATGGGAGCAACCAAGTGGCCAGTATGTGCCAGCAGGAAGAC
[0090] Figures 6a to 6c show the expression trends of CD44, CD90, and CD105, which are markers of Hp-MSCs. It can be seen that they are expressed at a significantly higher level compared to induced pluripotent stem cells (iPSCs) during the culture process (P3 to P7).
[0091] Figures 6d to 6f show the expression trends of SOX9, PDX1, and NGN3, transcription factors involved in pancreatic development. It can be seen that markers related to pancreatic differentiation significantly increase during the culture process (P4 to P7).
[0092] Figures 6g to 6h show the expression trends of pancreatic stem cell markers NESTIN and OCT4. It can be seen that NESTIN and OCT4 temporarily and significantly increased during the culture process, respectively, at P4 and P5, and then decreased thereafter.
[0093] Figure 6i shows the expression trend of Amylase, a pancreatic exocrine cell marker, and it can be seen that it is not expressed after P4 depending on the culture process.
[0094] Example 2-2: Identification of markers expressed during pancreatic islet organoid formation
[0095] To identify markers expressed during the pancreatic organoid formation process of Manufacturing Example 3, quantitative real-time polymerase chain reaction (LightCycler480II) was performed using the primers listed in Table 2. The results are shown in Figures 6j and 6k.
[0096] Gene Forward (5'-3') Reverse (5'-3') GAPDH (human) TCAAGGCTGAGAACGGGAAGCGCCCCACTTGATTTTGGAGmouse beta actinGCTTCTTTGCAGCTCCTTATGATCTGGGTCATCTTTTCAPAX6(human)CTGAGGAATCAGAGAAGACAGGCATGGAGCCAGATGTGAAGGAGGNEUROD(human)GGTGCCTTGCTATTCTAAGACGCGCAAAGCGTCTGAACGAAGGAGNKX6.1(human)CGTTGGGGATGACACAGAGAGTCGAGTCCTGCTTCTTCTTGGINS(h uman)ACGAGGCTTCTCTACACACCCTCCACAATGCCACGCTTCTGCASLC2A2(human)ATGTCAGTGGGACTTGTGCTGCAACTCAGCCACCATGAACCAGGINS(mouse)CGTGGCTTCTTCTACACACCCATGCAGCACTGATCCACAATGCCSLC2A2(mouse)GTTGGAAGAGGAAGTCAGGGCAATCACGGAGACCTTCTGCTCAG
[0097] Figure 6j shows the expression of human GAPDH and mouse beta actin mRNA during the early stage of islet organoid formation (OGN-D2) and the process of islet organoid formation (OGN-D5), and compared with MIN6, hMSC (human mesenchymal stem cell prior to differentiation), and hENDO (human endothelial cell). The expression of mouse beta actin mRNA in OGN-D5 organoids was very low, and similar to the level of the negative control, indicating that MIN6 cells died during the process of islet organoid formation.
[0098] Figure 6k shows the expression of human NGN3, PAX6, NEUROD, NKX6.1, INS, and SLC2A2 mRNA during the early stage of islet organoid formation (OGN-D2) and the process of islet organoid formation (OGN-D5), and compared with hMSCs. As islet organoid formation progresses, differentiation of stem cells into pancreatic endocrine cell precursors, pancreatic cell precursors, and beta cell precursors progresses. The expression of mouse INS and SLC2A2 mRNA is comparable to that of MIN6.
[0099] Example 3: Confirmation of insulin and PCNA expression in pancreatic islet organoids.
[0100] In order to confirm the expression patterns of insulin and PCNA (Proliferating cell nuclear antigen) in the organoids during the formation process of the pancreatic islet organoids in Manufacturing Example 3, observation was performed using a LEICA confocal microscope (STELLARIS 5). The results are shown in Figures 7a to 7d.
[0101] Figure 7a shows the expression trends of insulin and PCNA in peripheral and central cells within the islet organoid (D1 to D3). Figure 7b shows the border between the insulin-expressing and PCNA-expressing regions in the center of the islet organoid (D5). Figure 7c shows the process of decreasing PCNA expression in the periphery of the islet organoid (D3, D4). Figure 7d shows the process of decreasing PCNA expression as cells differentiate into insulin-expressing cells in the center of the islet organoid (D1, D5).
[0102] Referring to Figures 7a to 7d, insulin expression in the periphery of pancreatic islet organoids proliferated significantly in the early stages of formation (D1 to D2) and gradually decreased over time (D3 to D4). Cells located in the center proliferated actively in the early stages of formation (D2) but decreased over time, whereas insulin-expressing cells increased rapidly (D5).
[0103] Example 4: Confirmation of TRA-1-60, NGN3, and NKX6.1 expression in pancreatic islet organoids.
[0104] In order to confirm the expression patterns of TRA-1-60, NGN3, and NKX6.1 in the organoid during the formation process of the pancreatic organoid of Manufacturing Example 3, observation was performed using a LEICA confocal microscope (STELLARIS 5), and the results are shown in Figures 8a to 8f.
[0105] Specifically, Fig. 8a shows the expression of TRA-1-60, a marker of Hp-MSCs, and the histological characteristics of the cells in the early stage of islet organoid formation (18HR, D1). Fig. 8b shows the decrease in TRA-1-60 expression and the increase in insulin expression during the islet organoid formation process (D3, D5). Fig. 8c shows the observation of cells expressing both TRA-1-60 and insulin during the islet organoid formation process (D3). Fig. 8d shows that NGN3, which is involved in beta cell differentiation during the islet organoid formation process, is expressed at D3 and then decreases at D5. Fig. 8e shows that the expression level of NKX6.1, a mature beta cell marker, gradually increases during the islet organoid formation process and reaches a high level at D5. Figure 8f shows the regions adjacent to the expression sites of PCNA, NGN3, and insulin, respectively, in pancreatic islet organoids (D5).
[0106] Referring to Figures 8a to 8f, it can be seen that during the process of forming pancreatic islet organoids, stem cells are sequentially differentiated into pancreatic endocrine cell precursors, beta cell precursors, etc., and then differentiated into mature beta cells.
[0107] Example 5: Confirmation of C-PEPTIDE, GLUT2, and insulin expression in pancreatic islet organoids.
[0108] To confirm the expression of C-PEPTIDE, GLUT2, and insulin in the organoids during the formation process of the pancreatic organoids in Manufacturing Example 3, observation was performed using a LEICA confocal microscope (STELLARIS 5). The results are shown in Figures 9a and 9b.
[0109] In the process of forming pancreatic organoids in Manufacturing Example 3, the amount of insulin expression was confirmed according to the sugar concentration of the culture medium. The results are shown in Figure 9c.
[0110] In Fig. 9a and Fig. 9b, it can be confirmed that C-PEPTIDE and GLUT2, which are insulin precursors, are expressed in the insulin-expressing cells of the pancreatic islet organoid during the pancreatic islet organoid formation process (D5).
[0111] In Figure 9c, it can be confirmed that insulin expression in pancreatic islet organoids increases depending on the sugar concentration in the culture medium during the pancreatic islet organoid formation process (D3, D5).
Claims
1. A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, comprising a step of co-culturing human pancreatic mesenchymal stem cells and a beta cell line.
2. In claim 1, the human pancreatic-derived mesenchymal stem cell is A method for producing differentiated mesenchymal stem cell-derived pancreatic islet organoids by singulating and subculturing human pancreatic tissue cells.
3. In claim 2, the unification is: A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, wherein the human pancreatic tissue cells are treated with a decomposing enzyme, and the treatment is performed while sequentially reducing the concentration of the decomposing enzyme.
4. A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, wherein the subculture according to claim 2 is performed for 50 to 150 days.
5. A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, wherein the mixing ratio of the human pancreatic mesenchymal stem cells to the beta cell line in claim 1 is 1 to 10.
6. A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, wherein the co-culture according to claim 1 is performed in three dimensions.
7. A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, wherein the co-culture according to claim 1 is performed using a biocompatible matrix and a culture medium.
8. A method for producing a pancreatic islet organoid derived from mesenchymal stem cells, wherein the co-culture according to claim 1 is performed for 1 to 10 days.
9. A pancreatic islet organoid derived from mesenchymal stem cells according to claim 1.
10. A pancreatic islet organoid derived from mesenchymal stem cells, wherein TRA-1-60, NGN3, and NKX6.1 are sequentially expressed in claim 9.
11. A method for screening a treatment agent for diabetes-related diseases using the mesenchymal stem cell-derived pancreatic islet organoid of claim 9.
12. In claim 11, a step of contacting a candidate substance for treating diabetes-related diseases with the mesenchymal stem cell-derived pancreatic islet organoid; and A method for screening a treatment agent for a diabetes-related disease, comprising a step of comparing genetic variations of pancreatic islet organoids treated with the above diabetes-related disease treatment candidate substance with a control group not treated with the above diabetes-related disease treatment candidate substance.
Citation Information
Patent Citations
Composition for the prevention and treatment of obesity comprising extract of fermented salicornia herbacea l. and extract of fermented artemisia annua l.
KR1020240065851A
Lap pretensioner that minimizes mgg emissions
KR1020250072790A
RFID tag for tire burial with improved transmission and reception sensitivity
KR102636494B1
Lane change system of autonomous vehicle
KR102757102B1
KR20200140836A