Drug-conjugated aptamer therapeutics and applications thereof

Abstract

The present disclosure relates generally to the field of nucleic acids and more particularly to aptamer(s) conjugating with an therapeutic agent to form an aptamer therapeutics.

Description

DRUG-CONJUGATED APTAMER THERAPEUTICS AND APPEICATIONS THEREOFPriority Information

[0001] This application claims benefit of and priority to U.S. Provisional Patent Application No. 63 / 626,192, filed January 29, 2024, the contents of which is incorporated by reference in its entirety.Sequence Listing

[0002] The instant application contains a Sequence Listing which has been filed electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on January 28, 2025, is named G4590-19000PCT_20250128_SeqListing.xml and is 14,971 bytes in size.Field of the Invention

[0003] The present disclosure relates generally to the field of nucleic acids and more particularly to aptamer(s) conjugating with a therapeutic agent to form an aptamer therapeutics.Background of the Invention

[0004] The blood brain barrier (BBB) dynamically regulates brain homeostasis. It is composed of brain capillary endothelial cells, pericytes, astrocytic foot processes, and nerve endings terminating on the capillary surface. Tight and adherens junctions between the adjacent endothelial cells prohibit paracellular transport of hydrophilic compounds across the BBB, and transcellular transport by passive diffusion is available only to lipophilic or water-soluble molecules under 500 Da. Moreover, the active efflux transporters on the BBB restrict the entry of chemotherapeutic agents into the central nervous system (CNS). Therefore, there is a need to develop a chemotherapeutic agent being able to penetrate BBB.Summary of the Invention

[0005] The present disclosure develops an aptamer conjugating with an anti-cancer drug to form a aptamer therapeutic for treating a cancer. Particularly, the aptamer therapeutic can penetrate BBB to treat a brain cancer.

[0006] In one embodiment, the present disclosure provides an isolated aptamer comprising a polynucleotide sequence selected from the group consisting of:ACGCTCGGATGCCACTACAGGTCGGCAATGCATGGTAACTAGTGCGGGTGTGTGCAACTCCTCATGGACGTGCTGGTGAC (SEQ ID NO: 1);ACGCTCGGATGCCACTACAGGGGGTAGGTTCGCCGGGTCCAAATGCCTATTATCATCCAACTCATGGACGTGCTGGTGAC (SEQ ID NO:2);ACGCTCGGATGCCACTACAGCTCCATACGTATCTCCACCATTCCTTGGGGATTTATAAGTCTCATGGACGTGCTGGTGAC (SEQ ID NO:3);ACGCTCGGATGCCACTACAGATGTTCCAACTATAGTTGGGGTCAAATCTTCCCAATGGTGCTCATGGACGTGCTGGTGAC (SEQ ID NO:4);GTCGGCAATGCATGGTAACTAGTGCGGGTGTGTGCAACTC (SEQ ID NO:5);GGGGTAGGTTCGCCGGGTCCAAATGCCTATTATCATCCAA (SEQ ID NO:6);CTCCATACGTATCTCCACCATTCCTTGGGGATTTATAAGT (SEQ ID NO:7); andATGTTCCAACTATAGTTGGGGTCAAATCTTCCCAATGGTG (SEQ ID NO:8); or a variant thereof or a salt of any of foregoing.

[0007] In one embodiment, the polynucleotide sequence of SEQ ID NOs:l to 8 or a variant thereof or a salt of any of foregoing have a G-quadruplexes structure.

[0008] In one embodiment, the aptamer comprises a polynucleotide sequence of SEQ ID NO:1 or 3 or 5 or 7 or a variant thereof or a salt of any of foregoing. Preferably, the aptamer comprises a polynucleotide sequence of SEQ ID NO:1 or a variant thereof or a salt of any of foregoing.

[0009] In one embodiment, the polynucleotide sequence of SEQ ID NO:1 or 5 or a variant thereof a salt or any of foregoing forms 3 stem-loops with a total of 9 GC pairs.

[0010] In one embodiment, the present disclosure provides a method for delivering a drug to penetrate BBB of a subject, comprising administering an aptamer-therapeutic conjugate described herein to a subject, wherein the aptamer-therapeutic conjugate is a conjugate of one or more therapeutics described herein and one or more aptamers described herein. Preferably, the aptamer has G-quadruplexes structures and comprises a polynucleotide sequence having less than 150 base pairs.

[0011] In a further embodiment, the aptamer comprises a polynucleotide sequence having less than 100 base pairs or having about 50 to 100 base pairs.

[0012] In some embodiments the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO:1, 2, 3, 4, 5, 6, 7 or 8 or a variant thereof or a salt of any of foregoing.

[0013] In a further embodiment, the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO: 1 or 3 or 5 or 7 or a variant thereof or a salt of any of foregoing. Preferably, the aptamer comprises a polynucleotide sequence of SEQ ID NO: lor 3 or a variant thereof or a salt of any of foregoing.

[0014] In some embodiments, the variant of the aptamer as described herein comprises a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the unique region of anyone of the sequences selected from the group consisting of SEQ ID NOS: 1 to 8 or a variant thereof or a salt of any of foregoing is provided. In another embodiment, the variant of the aptamer comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any one of the sequences selected from the group consisting of SEQ ID NOS: 1 to 8 or a variant thereof or a salt of any of foregoing is provided. In a particular embodiment, the variant of the aptamer comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the unique region of any one of the sequences selected from the group consisting of SEQ ID NOS: 1, 3, 5 and 7 or a variant thereof or a salt of any of foregoing provided. In yet another embodiment, the variant of the aptamer comprises a nucleotide sequence of 80 contiguous nucleotides identical to 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 40, 30, 20 or 10 contiguous nucleotides included in any one of the sequences selected from the group consisting of SEQ ID NOS: 1 to 8 or a variant thereof or a salt of any of foregoing is provided. In another embodiment, the variant of the aptamer comprises a nucleotide sequence of 80 contiguous nucleotides identical to 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 40, 30, 20 or 10 contiguous nucleotides included in the sequences of SEQ ID NO: 1 or 5 or a variant thereof or a salt of any of foregoing is provided.

[0015] In some embodiments, the variant of the aptamer as described herein comprises a chemical modification selected from the group consisting of: a chemical substitution at a sugar position; a chemical substitution at a phosphate position; and a chemical substitution at a base position of the nucleic acid sequence. In some embodiments, the modification is selected from the group consisting of: incorporation of a modified nucleotide; 3' capping, conjugation to a high molecular weight, non-immunogenic compound (such as polyethylene glycol (PEG)); conjugation to a lipophilic compound; and modification of the phosphate back bone.

[0016] In one embodiment, the present disclosure provides an aptamer-therapeutic conjugate, comprising one or more therapeutic agents conjugated with one or more aptamers as described herein.

[0017] In one embodiment, the present disclosure provides a pharmaceutical composition comprising an aptamer-therapeutic conjugate and a pharmaceutically acceptable carrier or excipient.

[0018] In one embodiment, the therapeutic agent is an agent associated with a CNS disease. In some embodiments, the CNS disease is a CNS tumor or a neurological condition such as neurodegenerative diseases and a disease related to CNS damage (such as stroke).

[0019] In some embodiments, the therapeutic agent is an anti-cancer agent or an agent for neurodegenerative diseases or CNS damages.

[0020] In one embodiment, the anti-cancer agent is a chemotherapy drug. In some embodiments, the chemotherapy drug is an alkylating agent, an antimetabolite, an anthracycline, an anti-tumor antibiotic, a topoisomerase inhibitor or a mitotic inhibitor.

[0021] Certain embodiments of the anti-cancer agent include, but are not limited to, platinumbased chemotherapy drug (such as cisplatin, oxaliplatin, and carboplatin), busulfan, carmustine, melphalan, lomustine, 5-fluorouracil, methotrexate, daunorubicin, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, cabazitaxel, docetaxel or paclitaxel. In a further embodiment, the anti-cancer drug is a platinum-based drug.

[0022] In one embodiment, the present disclosure provides a method for treating or preventing a disease in CNS, comprising administering an aptamer-therapeutic conjugate described herein to a subject, wherein the therapeutic agent is an agent for a CNS disease.

[0023] In one embodiment, the present disclosure provides a method for treating a cancer, comprising administering an aptamer-therapeutic conjugate described herein to a subject, wherein the therapeutic agent is an anti-cancer agent.

[0024] In one embodiment, the present disclosure provides a method for treating or preventing a neurological condition, comprising administering an aptamer-therapeutic conjugate described herein to a subject, wherein the therapeutic agent is an agent for a neurological condition.

[0025] In some embodiments, the neurological condition is neurodegenerative disease, neuromuscular condition (such as muscular dystrophy, amyotrophic lateral sclerosis), brain condition (such as attention deficit hyperactivity disorder (ADHD), Bell’s palsy, carpal tunnel syndrome, cerebral aneurysms, diabetic neuropathy, epilepsy, migraines and headache disorders, stroke and traumatic brain injury) and spine condition (such as spina bifida, spinal cord injury and spinal muscular’ atrophy).

[0026] In some embodiments, the neurodegenerative disease is Alzheimer's disease, ataxia, Huntington's disease, Parkinson's disease, motor neuron disease, Lewy body disease, spinal muscular atrophy, multiple system atrophy and progressive supranuclear palsy, mild cognitive impairment, migraine, multiple sclerosis, myasthenia gravis or amyotrophic lateral sclerosis (ALS).

[0027] The embodiments of the aptamer-therapeutic conjugate are those described herein.

[0028] In some embodiments, the disease is a CNS cancer, neurodegenerative diseases or a disease related to CNS damage (such as stroke).

[0029] In a further embodiment, the CNS cancer is a brain cancer, brain metastases, anaplastic astrocytoma, glioblastoma or leptomeningeal carcinomatosis.

[0030] In a further embodiment, the leptomeningeal carcinomatosis is a lung cancer leptomeningeal carcinomatosis (LM).

[0031] In a further embodiment, the method for treating and / or preventing a neurological condition achieves a systemic therapeutic effect such as anti-cancer effect. Preferably, the method can reduce the usage amount of the drug. In some embodiments, the drug is an anti-cancer drug such as platinum-based drugs.Brief Description of the Drawings

[0032] Figure 1: Establishment of a leptomeningeal carcinomatosis (LM) mouse model. (A) The scheme illustrated direct inoculation of luciferase-expressing cells through cistema magna to establish a LM orthotopic mouse model. (B) The mouse was monitored by the IVIS. Prominent BLI signals over the brain and the spinal cord were observed at Day 6 post tumor cell inoculation and the mouse was sacrificed for IHC confirmation. (C) Tumor cells (red arrows) were observed in the ventricular space of the brain (left panel) and the spinal cord (right panel) in the IHC studies.

[0033] Figure 2: Identification of AptBl, a BBB-penetrating and cancer-targeting aptamer by in vivo SELEX. (A) The scheme illustrated the process of in vivo SELEX. (B) Aptamers were divided into group I or II based on the QGRS prediction. The group I aptamer contained G-quadruplex structure and the group II did not. The LM mouse I administered with Cy5-labeled group I aptamers showed fluorescent signals over the brain / spine in a crescendo pattern at 2 hours and 4 hours after injection. (C) Confocal microscopy images revealed group I aptamer signals (red) in the tumor cells (green) on the leptomeninges. (D) Strong Cy5 fluorescent signals emitted from the brain and the spine were detected in the LM mouse administered with AptBl. (E) Confocal microscopy images revealed AptBl signals (pink) in the tumor cell (green) on the leptomeninges. (F) The Mfold prediction of AptBl secondary structures.

[0034] Figure 3: Detection of AptBl in CSF. (A) CSF was sampled directly from the cistema magna 30 mins after AptBl injection through the tail vein. (B) Gross picture of mouse cistema magna (blue triangle). (C) CSF sampled from the cisterna magna with the capillary. (D) AptBl was amplified from the CSF and plasma. (E) Accuracy of the amplified AptBl sequences was confirmed by Sanger sequencing. (F) CSF and plasma AptBl concentrations were determined by qPCR. SD: standard deviation.

[0035] Figure 4: AptBCisl, an aptamer-cisplatin conjugate, showed efficacy in lung cancer LM diseases. (A) Successful AptBl and cisplatin conjugation shown on the native polyacrylamide gel. (B) The scheme illustrated the timeline of tumor cell inoculation and IV drug treatment (AptBCisl or cisplatin). (C) The mice were monitored by the IVIS; BLI signal intensity implicated corresponding tumor burden. Mice in the cisplatin group showed stronger BLI signals than mice in the AptBCisl group on Day 14 post tumor inoculation (n=8 in each group). (D) Significant body weight reduction in the cisplatin group (**P< 0.01). Formulation of body weight change: (Day X I Day 2) %. (E) IVIS images were taken at Day 2 and Day 8 post tumor inoculation; cisplatin or AptBCisl was given on Day 2, 3, 5, 7 post tumor inoculation. The mice were sacrificed on Day 8 and the brains were subjected to immunofluorescent studies. (F) Confocal microscopy images showed better preserved tumor cell contours (green; upper panel: luciferase; lower panel: EGFR) and lower percentage of vH2AX-positive cells (red) in the cisplatin group. (G) Lower percentage of yH2AX-positive cells in the cisplatin group. Approximate 1200 cells and 450 cells, respectively, were analyzed for the cisplatin group and the AptBCisl group. Asterisks denote statistically significant differences. **P< 0.01 (unpaired t test). Data are means ± SEM.

[0036] Figure 5: AptBCisl inhibits tumor growth at lower platinum concentrations. (A) Plasma and CSF platinum concentration was measured by ICP-MS. (B) The scheme illustrated thetimeline of subcutaneous tumor cell inoculation and drug treatment in the lung cancer subcutaneous xenograft mouse model. SELEX buffer, AptBl, AptBCisl, or cisplatin was given via tail vein at Day 6, 7, 9, 11, 13, and 15 post tumor inoculation (n=4 for each group). (C) Tumor size was measured on a daily basis and the mice were sacrificed on Day 23. (D) Tumor gross pictures. (E) Body weight reduction was more obvious in the cisplatin 2 mg / kg group. Asterisks denote statistically significant differences. *P< 0.05, **P< 0.001 (unpaired t test). Data are means ±SEM.

[0037] Figure 6: AptBl interacts with EAAT2, Nucleolin and YB-1. (A) Results of AptBl- AP / MS study revealed three candidate AptBl interacting proteins: EAAT2, YB-1 and Nucleolin. (B) AP- immunoblots verified the interaction between AptB 1 and EAAT2, Nucleolin, as well as YB-1 in the PC9 cells and in the mouse brain. (C) Confocal microscopy images showed colocalization (yellow) of AptBl (red) and Nucleolin (green, upper panel) or YB-1 (green, lower panel) in the PC9 cells. (D) AptBl-treated cells were fractionated into cytosol and nucleus fractions. AptBl sequences were successfully amplified in both cellular fractions. (E) Purified GST and GST-YB-1 proteins confirmed by Coomassie Blue stain and immunoblots. (F) The YB- 1 exonuclease assay results supported the role of YB-1 as an exonuclease for AptBl. (G) The scheme illustrated the proposed mechanism of AptBCisl as novel therapeutics for lung cancer with and without LM.Detailed Description of the Invention

[0038] Any methods, compounds and materials similar or equivalent to those described herein can be used in the practice of this invention. Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms withcommonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0039] The singular form "a", "an", and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following alternatives: "A", "B", "A or B", and "A and B."

[0040] The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-, double- or multiple- stranded form, or complements thereof. The term "polynucleotide" denotes a linear’ arrangement of nucleotides. Meanwhile, "nucleotide" usually refers to an individual unit of a polynucleotide, essentially a monomer. Nucleotides may be ribonucleotides, deoxyribonucleotides, or their modified variants.

[0041] The term "aptamer" as used herein denotes polynucleotides (such as short ribonucleotides or deoxyribonucleotides) that bind with high affinity and specificity to proteins, peptides, and small molecules. Aptamers can also be described as polynucleotide-based targetbinding entities. They may be composed of RNA or DNA and can adopt secondary or tertiary structures, allowing them to fold into a variety of complex molecular configurations.

[0042] The terms "conjugate," "bioconjugate," and "bioconjugate linker" refer to the connection between atoms or molecules. This connection can be either direct or indirect. For instance, a conjugate formed between a first moiety and a second moiety can occur directly through a covalent bond or linker, or indirectly through non-covalent interactions. These non-covalentinteractions may include electrostatic forces (such as ionic bonds, hydrogen bonds, or halogen bonds), van der Waals forces, hydrophobic interactions, and other similar interactions.

[0043] The term "percent identity" refer to sequences or subsequences that are either exactly the same or share a specified percentage of identical amino acid residues or nucleotides. This percentage can range from approximately 80% to 99% or higher, with preferred thresholds including 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%. The comparison is typically conducted over a defined region, ensuring maximum alignment and correspondence within a specified comparison window. These comparisons can be performed using BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or through manual alignment and visual inspection. Sequences that meet these criteria are described as "substantially identical." This definition also applies to the complement of a test sequence and encompasses sequences that may have deletions, additions, or substitutions. The preferred algorithms used for these comparisons can accommodate gaps and similar variations.

[0044] The terms "treat," "treating," and "treatment" are used interchangeably and refer to the actions of partially or completely preventing, alleviating, mitigating, or managing a symptom, secondary disorder, or condition relating to a cancer. The term "treating" specifically denotes the application or administration of the composition of matter of pharmaceutical composition described herein to a subject who is experiencing a symptom, secondary disorder, or condition relating to a cancer. The goal is to partially or fully alleviate, relieve, delay the onset of, inhibit the progression of, reduce the severity of, or decrease the incidence of one or more symptoms, secondary disorders, or condition. Treatment may also be provided to individuals showing only early signs of these symptoms, disorders, or conditions to lower the risk of developing further complications of a disease. A treatment is generally considered "effective" if it leads to a reductionin one or more symptoms or clinical markers, as defined in this document. Alternatively, a treatment is deemed "effective" if it slows or stops the progression of a symptom, disorder, or condition.

[0045] The term "BBB" refers to any blood-brain barrier existing in the brain and central nervous system.

[0046] The term "isolated" as used herein, when referring to a nucleic acid or protein, indicates that the nucleic acid or protein is largely free from other cellular components that are typically associated with it in its natural environment. It may exist in a homogeneous form and can be found in either a dry state or an aqueous solution. The purity and homogeneity of the isolated substance are usually assessed using analytical chemistry methods, such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. A protein that is the main component in a preparation is considered to be substantially purified.

[0047] The term "about" as used herein refers to a range of values that encompasses the specified value and includes those that a person of ordinary skill in the field would deem reasonably comparable. For example, "about" is defined as falling within one standard deviation based on measurements that are widely accepted in the industry. Additionally, "about" may indicate a range extending to ±10% of the specified value.

[0048] Therapy for brain cancer remains challenging partly due to the biological nature of BBB. Aptamers are small oligonucleotides considered as antibody surrogates. Compared with monoclonal antibodies, aptamers are small in size, and may thus possess advantages for targeted delivery to certain specific tissue compartments, for example, the CNS. Recent studies showed potentiality of aptamers in neuro-oncology and neurodegenerative disorders (Murakami, K., Izuo, N., Bitan, G. Aptamers targeting amyloido genic proteins and their emerging role inneurodegenerative diseases. J Biol Chem 298, 101478 (2022)). Nevertheless, no aptamer therapeutics for brain cancers has yet been reported.

[0049] Accordingly, the present disclosure provides a novel DNA therapeutics. Particularly, an aptamer comprising a polynucleotide sequence selected from the group consisting of SEQ ID Nos: 1 to 4 or a variant or a salt of any of the foregoing is provided. Aptamers are nucleic acid molecules characterized by their ability to bind to target molecules with high specificity and affinity. Nearly all aptamers are non-naturally occurring molecules. Aptamers possess several advantageous characteristics for targeted drug delivery, including ease of selection and synthesis, high binding affinity and specificity, low immunogenicity, and versatile synthetic accessibility. They can effectively deliver anticancer agents, such as chemotherapy drugs, toxins, and siRNAs, to cancer cells in vitro.

[0050] Aptamers can be selected in vitro from extensive libraries of randomized sequences through a process known as systematic evolution of ligands by exponential enrichment (SELEX). Alternatively, slow off-rate modified aptamers (SOMAmers) can be developed. The application of SELEX and SOMAmer technologies involves incorporating functional groups that mimic amino acid side chains, thereby enhancing the chemical diversity of the aptamers. This approach allows for the enrichment and identification of high- affinity aptamers specific to proteins.

[0051] Aptamers can be produced via article synthesis using techniques familiar to those with expertise in the field. An example is chemical synthesis on a solid support, often employing phosphoramidite chemistry. In this process, a sol id- supported nucleotide undergoes detritylation and is then coupled with an appropriately activated nucleoside phosphoramidite to create a phosphite triester bond. This is followed by a capping step and oxidation of the phosphite triester using an oxidizing agent. This cycle is repeated to construct the aptamer.

[0052] One embodiment of the DNA therapeutics is AptBCis l . The AptBCisl is a cisplatin- conjugated, BBB-penetrating and lung cancer-targeting DNA aptamer. Its backbone, AptBl, was identified via in vivo SELEX using a lung cancer LM orthotopic mouse model. The AptBl binds to EAAT2, Nucleolin, and YB-1 proteins. These interactions may contribute to the BBB- penetrating, the lung cancer-targeting, the nuclear- translocating, and the cisplatin-releasing characteristics of AptBCisl. The data shows that AptBCisl exhibits promising tumor suppressive effect at lower cisplatin concentrations in lung cancer LM orthotopic and subcutaneous xenograft mouse models. The results suggest the translational potential of AptBCisl in lung cancer LM, and in cancers of which platinum-based chemotherapy stands as the standard therapy. For example, the present disclosure achieves a systemic anticancer effect of the drug as the new therapeutics effectively suppressed cancer growth (xenograft mouse models) at a lower equivalent platinum concentration.

[0053] The aptamers described in the present disclosure may feature various chemical modifications, including substitutions at the sugar, phosphate, and / or base positions of the nucleic acid. Such modifications may improve the stability of the aptamer or make the aptamer more resistant to degradation. Examples of these modifications include the incorporation of modified nucleotides, the addition of a capping moiety (such as 3' capping), conjugation to a high molecular weight, non-immunogenic compound (like polyethylene glycol (PEG)), attachment to a lipophilic compound, and alterations to the phosphate backbone.

[0054] The variant of the polynucleotide of the present disclosure may exhibit a primary sequence identity of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% with one of SEQ ID NOs 1 to 8.

[0055] Modifications to generate nucleotide variant populations of the aptamer which are resistant to nucleases can include one or more substitute intemucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include, but are not limited to, 2'- position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5- bromo or 5-iodo-uracil; backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanidine. Modifications can also include 3' and 5' modifications such as capping.

[0056] In further embodiments, the nucleotides comprise modified sugar groups, for example, one or more of the hydroxyl groups is replaced with halogen, aliphatic groups, or functionalized as ethers or amines. Other modifications are known to one of ordinary skill in the art.

[0057] The present disclosure also includes pharmaceutical compositions containing the aptamer or the aptamer therapeutic as described herein. In some embodiments, the compositions include an effective amount of the aptamer or the aptamer therapeutic, alone or in combination, with one or more pharmaceutically acceptable carriers.

[0058] The aptamer(s) described herein can form a conjugate with a therapeutic agent. Preferably, the therapeutic agent is an agent associated with CNS diseases such as CNS cancer, neurodegenerative diseases or a disease related to CNS damage. As previously mentioned, the aptamer described herein, along with their various embodiments, can be utilized to transport compound moieties or compounds (such as therapeutic agents or imaging agents) into a cell.

[0059] The present disclosure also provides a method of treating a disease. The method includes administering to a subject in need thereof an effective amount of the conjugate described herein.

[0060] The conjugate(s) described herein can be administered to a subject via various methods of delivery, including oral administration, suppository use, topical application, and routes such as intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration. It also encompasses the implantation of slow-release devices, such as mini-osmotic pumps. Administration can occur through any route, including parenteral and transmucosal methods (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal).

[0061] Parenteral administration encompasses various methods, including intravenous, intramuscular, intra-arterial, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial routes. Additional delivery methods may include liposomal formulations, intravenous infusions, transdermal patches, and others. The term "co-administer" refers to the administration of a conjugate described herein either concurrently, immediately before, or immediately after the administration of one or more other therapies, such as cancer treatments like chemotherapy, hormonal therapy, radiotherapy, or immunotherapy. The conjugate of the present disclosure can be given individually or in combination with other treatments. Coadministration encompasses both simultaneous and sequential delivery of the conjugate, whether administered alone or in combination with others

[0062] The conjugate(s) described herein can be used to treat or prevent a pathology, such as a disease or disorder, or alleviate the symptoms of such disease or disorder in a patient. For example, conjugate(s) described herein can be used to treat or prevent a cancer or a pathology associated with CNS diseases. Examples of the CNS disease includes, but is not limited to, CNStumor and neurological condition such as neurodegenerative diseases and a disease related to CNS damage (such as stroke).

[0063] Examples of the CNS tumor include, but are not limited to, metastatic brain tumors, medulloblastoma, malignant lymphoma, germ cell tumors, meningioma, hypophyseal adenoma, neurilemmoma, glioblastoma, malignant glioma, diffuse or anaplastic astrocytoma, oligodendroglioma, or any other primary or secondary central nervous system malignancy.

[0064] Examples of agents associated with CNS cancer include, but are not limited to, chemotherapeutic drugs, antibody drugs and ADCs. Embodiments of the agent against CNS cancer include, but are not limited to, ABT-414 (depatuxizumab mafodotin), AMG-595 (Anti-EGFR ADC with DM1), anti-TfR ADCs with linked low-molecular cargos, anti-TfR and anti-EGFR bispecific ADCs with low-molecular payloads, trispecific mAbs against TfR, EGFR, and tumorspecific molecules, temozolomide (an alkylating agent), lomustine (Gleostine), procarbazine, nimustine (ACNU), vincristine, bevacizumab (a monoclonal antibody (mAb) against vascular endothelial growth factor (VEGF)), BCNU (bis-chloroethylnitrosourea), a BCNU wafer (an alkylating slow-release agent), axitinib, tesevatinib, nintedanib, sunitinib, pazopanib, sorafenib, cabozantinib, vandetanib, motesanib, cediranib, regorafenib, tivozanib, linifanib, dasatinib, imatinib, quizartinib, vemurafenib, dabrafenib and trametinib.

[0065] Examples of the neurological condition include, but are not limited to, neurodegenerative diseases, neuromuscular conditions (such as muscular dystrophy, amyotrophic lateral sclerosis), brain conditions (such as attention deficit hyperactivity disorder (ADHD), Bell’s palsy, carpal tunnel syndrome, cerebral aneurysms, diabetic neuropathy, epilepsy epilepsy, migraines and headache disorders, stroke and traumatic brain injury) and spine conditions (such as spina bifida, spinal cord injury and spinal muscular atrophy).

[0066] Examples of the neurodegenerative diseases include, but are not limited to, Alzheimer's disease, ataxia, Huntington's disease, Parkinson's disease, motor neuron disease, Lewy body disease, spinal muscular atrophy, multiple system atrophy and progressive supranuclear palsy, mild cognitive impairment, migraine, multiple sclerosis, myasthenia gravis and amyotrophic lateral sclerosis (ALS).

[0067] Examples of agents associated with neurological diseases include, but are not limited to, donepezil (aricept), galantamine (razadyne), rivastigmine (exelon), idursulfase beta, anti-TfR ADC with-iduronate-2- sulfatase, bispecific RmAbl58-scFv8D3, Anti-TfR mAb with erythropoietin, scFab of anti-TfR mAb and anti-Ap mAb31, aducanumab, levetiracetam (Keppra), topiramate (Topamax), lamotrigine (Lamictal), oxcarbazepine (Trileptal), divalproex sodium (Depakote), gabapentin (Neurontin), pregabalin (Lyrica), carbidopa, levodopa, pramipexole (Mirapex), ropinirole (Requip), rotigotine (Neupro), clozapine, quetiapine, olanzapine, propranolol, alteplase (t-PA), reteplase, urokinase, prourokinase, tenecteplase, anistreplase and streptokinase.

[0068] The patient or subject having a pathology, i.e., the patient or subject treated by the methods of this invention can be a vertebrate, more particularly a mammal, or more particularly, a human.

[0069] The preparation of pharmaceutical compositions will be known to those of skill in the art in light of the present disclosure. Typically, such compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and thelike. The use of sterile formulations, such as saline-based washes, by surgeons, physicians or health care workers to treat a particular area in the operating field may also be particularly useful.

[0070] All publications and patent documents cited herein are incorporated herein by reference as if each such publication or document was specifically and individually indicated to be incorporated herein by reference. Citation of publications and patent documents is not intended as an admission that any is pertinent prior art, nor does it constitute any admission as to the contents or date of the same. The present disclosure having now been described by way of written description, those of skill in the art will recognize that the invention can be practiced in a variety of embodiments and that the foregoing description and examples below are for purposes of illustration and not limitation of the claims that follow.

[0071] Embodiments

[0072] Embodiment 1. An isolated aptamer comprising a polynucleotide sequence selected from the group consisting of SEQ ID Nos: 1 to 8 or variant thereof or a salt of any of foregoing.

[0073] Embodiment 2. The isolated aptamer of claim 1 , wherein the polynucleotides sequence of SEQ ID NOs:l to 8 or a variant thereof or a salt of any of foregoing have G-quadruplexes structures.

[0074] Embodiment 3. The isolated aptamer of any one of Embodiments 1 to 2, wherein the aptamer comprises a polynucleotide sequence of SEQ ID NO: 1 or 3, or 5, or 7 or a variant thereof or a salt of any of foregoing.

[0075] Embodiment 4. The isolated aptamer of any one of Embodiments 1 to 3, wherein the aptamer comprises a polynucleotide sequence of SEQ ID NO:1 or 5 or a variant thereof or a salt of any of foregoing.

[0076] Embodiment 5. The isolated aptamer of any one of Embodiments 1 to 4, wherein the polynucleotides sequence of SEQ ID NO:1 or 5 or a variant thereof or a salt of any of foregoing forms 3 stem-loops with a total of 9 GC pairs.

[0077] Embodiment 6. A method for delivering a therapeutic agent to penetrate BBB of a subject, comprising administering an aptamer-therapeutic conjugate described herein to a subject, wherein the aptamer-therapeutic conjugate is a conjugate of one or more therapeutic agents and one or more aptamers of Embodiments 1 to 5.

[0078] Embodiment 7. The method of Embodiment 6, wherein the aptamer has G- quadruplexes structure and comprises a polynucleotide sequence having less than 150 base pairs.

[0079] Embodiment 8. The method of any one of Embodiments 6 to 7, wherein the aptamer comprises a polynucleotide sequence having less than 100 base pairs or having about 50 to 100 base pairs.

[0080] Embodiment 9. The method of any one of Embodiments 6 to 8, wherein the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO: 1, 2, 3 4, 5, 6, 7 or 8 or a variant thereof or a salt of any of foregoing.

[0081] Embodiment 10. The method of any one of Embodiments 6 to 9, wherein the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO: 1 or 3 or a variant thereof or a salt of any of foregoing.

[0082] Embodiment 11. The method of any one of Embodiments 6 to 9, wherein the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO: 1 or 5 or a variant thereof or a salt of any of foregoing.

[0083] Embodiment 12. An aptamer-therapeutic conjugate, comprising a therapeutic agent conjugated with an aptamer of any of Embodiments 1 to 5.

[0084] Embodiment 13. The aptamer-therapeutic conjugate of Embodiment 12, wherein the therapeutic agent is an agent associated with a CNS disease.

[0085] Embodiment 14. The aptamer-therapeutic conjugate of Embodiment 13, wherein the CNS disease is a CNS tumor or a neurological condition such as neurodegenerative diseases and a disease related to CNS damage (such as stroke).

[0086] Embodiment 15. The aptamer-therapeutic conjugate of any one of Embodiments 12 and 13, wherein the therapeutic agent is an anti-cancer agent or an agent for neurodegenerative diseases or CNS damages.

[0087] Embodiment 16. The aptamer-therapeutic conjugate of Embodiment 15, wherein the anti-cancer agent is a chemotherapy drug or a targeted cancer drug.

[0088] Embodiment 17. A method for treating or preventing a disease in CNS, comprising administering an aptamer-therapeutic conjugate of any one of Embodiments 12 to 16 to a subject, wherein the therapeutic agent is an agent for a CNS disease.

[0089] Embodiment 18. A method for treating a CNS cancer, comprising administering an aptamer-therapeutic conjugate of any one of Embodiments 12 to 16 to a subject, wherein the therapeutic agent is an anti-cancer agent.

[0090] Embodiment 19. The method of Embodiment 18, wherein the CNS cancer is a brain cancer, brain metastases, anaplastic astrocytoma, glioblastoma or leptomeningeal carcinomatosis.

[0091] Embodiment 20. The method of Embodiment 19, wherein the leptomeningeal carcinomatosis is a lung cancer leptomeningeal carcinomatosis (LM).

[0092] Embodiment 21. A method for treating or preventing a neurological condition, comprising administering an aptamer-therapeutic conjugate of any one of Embodiments 12 to 16 to a subject, wherein the therapeutic agent is an agent for a neurological condition.

[0093] Embodiment 22. The method of Embodiment 2E wherein the neurological condition is neurodegenerative disease, neuromuscular condition (such as muscular dystrophy, amyotrophic lateral sclerosis), brain condition (such as attention deficit hyperactivity disorder (ADHD), Bell’s palsy, carpal tunnel syndrome, cerebral aneurysms, diabetic neuropathy, epilepsy, migraines and headache disorders, stroke and traumatic brain injury) and spine condition (such as spina bifida, spinal cord injury and spinal muscular atrophy).EXAMPLE

[0094] Material and methods

[0095] Animal study

[0096] All mouse experiments were performed in BALB / c nude mice of matching age (6 weeks; weight ~ 20 g). The mice were obtained from the National Laboratory Animal Center (Taipei, Taiwan). The experiments were approved by the Department of Animal Care, Institute of Biomedical Sciences, Academia Sinica, Taiwan (IACUC approval number: IBMS-CRC100-P02).

[0097] Cells and Cell culture

[0098] The human lung cancer cell line CL1-5 was established in our laboratory

[0013] , and PC9 cells were obtained from a collaborative laboratory in the National Taiwan University Hospital. CL1-5 and PC9 cells were cultured in RPMI-1640 medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 100 pg / mL PrimocinTM (InvivoGen, USA). Cells used for experiments were all within 10 passages after thawing. The mouse endothelial cell line, bEnd.3, was obtained from the Bioresource Collection and Research Center Taiwan and cultured in high glucose Dulbecco's modified Eagle's medium (Life Technologies, Grand Island, NY), supplemented with 10% FBS, HEPEs, 100 U / mL penicillin, and 100 pg / mL streptomycin. Stably transfected, pooled clones were maintained in medium supplemented with 2 pg / mL puromycin(InvivoGen) or 400 pg / mL G418 (TnvivoGen). Mycoplasma testing was performed regularly using PlasmoTest™ Kit (InvivoGen).

[0099] Chemicals, oligonucleotides, siRNA and antibodies

[0100] All chemicals were purchased from Sigma- Aldrich. Aptamer libraries or modified aptamers were synthesized by Integrated DNA Technologies (Coralville, IA, USA) or Purigo Biotech. The synthetic single-stranded DNA library was composed of 80-nucleotide-long singlestranded DNAs with 40 random sequences flanked by primer sequences, 5'- ACGCTCGGATGCCACTACAG[N]4OCTCATGGACGTGCTGGTGAC (SEQ ID NO:9), n=a, t, g, c.

[0101] Anti-luciferase antibody (sc-74548), EAAT2 siRNA (sc-35256), Nucleolin siRNA (sc-29230) and YB- 1 siRNA (sc-38634) were purchased from Santa Cruz. YH2AX (9718), YB-1 (4202), and EAAT2 (20848) antibodies were purchased from Cell signaling. Human EGFR (aa 746-750 deletion; EGFRdel l9) antibody (MAB8336) was purchased from R&D systems. Nucleolin antibody (ab22758) was purchased from Abeam.

[0102] Leptomeningeal carcinomatosis (LM) orthotopic mouse models

[0103] B ALB / c nude mice at 6 weeks of age were used for the LM orthotopic mouse model establishment. Stable cells used included luciferase-expressing PC9 or CL1-5 cells. To generate LM orthotopic mouse model for in vivo SELEX or for AptBCisl efficacy study, respectively, IxlO6or 3xl05cells were resuspended in 10 pL PBS (137 mM NaCl, 2.7 mM KC1, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) and were inoculated directly into the cistema magna of the anesthetized recipient mice. Tumor burden was monitored via the in vivo imaging system (IVIS, Xenogen Caliper IVIS spectrum, USA) and mouse body weight was measured on a daily basis.

[0104] Subcutaneous xenograft mouse models

[0105] For the subcutaneous xenograft mouse model, 5 x 105PC9 cells were resuspended in 10 pL PBS and inoculated onto the right flank of BALB / c nude mice at 6 weeks of age. Tumor size and mouse body weight were measured on a daily basis. Volume was calculated as the follows: (length x widthA2) x 0.51.

[0106] Immunohistochemistry study

[0107] To assure the successful establishment of LM orthotopic mouse models, the mice were euthanized at Day 6 after tumor inoculation, upon which strong bioluminescent (BLI) signals were detected by IVIS over the anatomical locations of brain and spinal cord. Transcardiac perfusion with PBS and 4% paraformaldehyde was performed prior to organ isolation. The isolated brain and spine were fixed in 4% paraformaldehyde overnight at 4°C. The tissues were then embedded in paraffin and built into tissue blocks. For histology study, the tissue slides were rehydrated and blocked with PBS containing 10% normal goat serum, 2% BSA, as well as 0.2% Triton X-100 (PBST). To detect tumor cells, luciferase antibody (sc-74548, Santa Cruz) was prepared with PBST containing 10% normal goat serum and 1% BSA. After overnight incubation at 4°C, the samples were washed and stained with HRP-conjugated secondary antibody (PK-6102, Vector).

[0108] Immunofluorescence study

[0109] Immunofluorescence (IF) studies were performed on tissue sections to detect LM tumor cells, aptamers, and several protein markers. After scarification, transcardiac perfusion with PBS and 4% paraformaldehyde was performed prior to mouse organ isolation. The isolated brain was fixed in 4% paraformaldehyde at 4°C overnight and was transferred to 30% sucrose bathing at 4°C for another 24 hours. The samples were embedded in OCT compound and made into cryosections. For the IF staining, the samples were blocked with PBST containing 10% normalgoat serum and 2% BSA. Hybridization with Luciferase, EGFRdell9, yH2AX, Nucleolin, or YB- 1 antibodies was carried out overnight at 4°C. The secondary antibodies used included anti-FITC and anti-Cy3. Images were acquired using a Zeiss LSM700 confocal microscope (Carl Zeiss Microimage, Thornwood, NY).

[0110] In vivo SELEX

[0111] For in vivo SELEX, 2xl015single-stranded DNA (ssDNA) oligonucleotides were dissolved in the SELEX buffer (140 mM NaCl, 4 mM KC1, 1 mM MgCh, 1 mM CaCh, and 40 mM HEPES, pH 7.4). The ssDNA oligonucleotide library was intraperitoneally injected into the LM mouse, of which tumor signals were detected in the anatomical location of brain by the IVIS (Xenogen Caliper IVIS spectrum, USA) at Day 6 post tumor inoculation. The mouse was anesthetized and was perfused with the SELEX buffer to remove the unbound oligonucleotides at 6 hours post ssDNA library administration. The collected brain tissue was snap-frozen by liquid nitrogen, followed by proteinase K digestion at 55°C overnight. The DNA was extracted with Gentra Puregene Tissue Kit (Qiagen); the extracted DNAs served as the sample for oligonucleotide sequences amplification. The amplified oligonucleotide sequences were then subjected to singlestranded isolation and refolding as previously described (Lai, W.Y., Wang, J.W., Huang, B.T., Lin, E.P, Yang, P.C. A novel TNF-a-targeting aptamer for TNF-a-mediated acute lung injury and acute liver failure. Theranostics 9, 1741-1751 (2019)). and were intraperitoneally injected into the LM mouse for subsequent SELEX round. After the 4th SELEX round, the amplified oligonucleotide sequences were ligated into Clonejet vector (Thermo Fisher) for colony PCR. The amplicon sequences were determined by Sanger sequencing (ABI3730, Applied Bioscicnccs). Grouping of the identified aptamers was performed based on the presence of probable G-quadruplex structures or not, as predicted by the QGRS Mapper (https: / / bioinformatics.ramapo.edu / QGRS / index.php).

[0112] Cerebrospinal fluid (CSF) and plasma collection

[0113] Plasma was sampled via cardiac puncture. Blood was centrifuged immediately after sampling and the supernatant was transferred to sterile Eppendorf tubes. CSF was sampled through surgical procedures. In brief, the mouse was anesthetized; the skin, the subcutaneous tissue and the muscle were dissected from the posterior neck to expose cistema magna with the assistance of microscopy and micromanipulator (M650, Wild Heerbrugg). CSF was collected via direct dura puncture with capillaries. The samples were stored in -80°C freezer until use.

[0114] AptB 1 and platinum concentration measurement

[0115] Concentrations of the CSF and the plasma AptB 1 were measured via quantitative PCR (qPCR). For quantification, a standard curve for AptBl was established with 80-mer oligonucleotides: concentrations of the 80-mer oligonucleotides were serially diluted from 100 PM to 0.01 PM to constitute a formula of Y=0.2982X+5.3802, R=0.9997. Concentrations of the AptBl were measured accordingly. Concentrations of the CSF or the plasma platinum were determined by the Inductively Coupled Plasma Mass Spectrometry (ICP-MS) (Thermo Fisher Scientific) analysis.

[0116] Aptamer-cisplatin conjugation

[0117] Cisplatin powder was purchased from Sigma and the drug was dissolved in doubled-distilled water (ddFFO) at the concentration of 1 mg / ml. The aptamer was denatured at 95°C; was cooled at 4°C and was refolded at 37°C in the SELEX buffer prior to cisplatin conjugation. The conjugation was carried out per protocol Zhu, G., Niu, G., Chen, X. Aptamer- Drug Conjugates. Bioconjug Chem 26, 2186-2197 (20 / 5)). The success of conjugation was confirmed by gel electrophoresis (16% PAA non-denaturing gel; monoacrylamide to bisacrylamide ratio of 19: 1); signal visualization was made with STAINS-ALL (Sigma- Aldrich). The platinatedaptamers were further analyzed with Inductively Coupled Plasma Optical Emission Spectrometry (ICP-OES) (Varian 720-ES, Agilent Technologies) to measure the quantity of conjugated platinum. The platinated aptamers were dissolved in the SELEX buffer and were stored at -20°C until use.

[0118] AptBCisl treatment in the LM orthotopic mouse model

[0119] AptBCisl or cisplatin was injected through tail vein at Day 2, 3, 5, 7, 9, 11 post tumor cell inoculation. The dosage of AptBCisl used was 1 mg / kg (approximately equaled to cisplatin 0.35 mg / kg) and that of cisplatin was 2 mg / kg. Tumor burden was monitored by the IVIS (Xenogen Caliper IVIS spectrum, USA), and mouse body weight was measured on a daily basis.

[0120] AptBCisl treatment in the subcutaneous xenograft mouse model

[0121] BALB / c nude mice inoculated with PC9 cells (5x105) at the flank were divided into 6 groups on Day 6 post inoculation, at which time point the tumor volume reached about 30- 40 mm3. The drugs, respectively, (1) SELEX buffer, (2) cisplatin 0.35 mg / kg, (3) cisplatin 2 mg / kg, (4) AptBl 1 mg / kg, (5) AptBCisl 1 mg / kg (-0.35 mg / kg cisplatin), or (6) AptBCisl 2 mg / kg (-0.7 mg / kg cisplatin), were given via tail vein. Tumor volume and mouse body weight were measured on a daily basis.

[0122] Aptoprecipitation

[0123] The cells or the homogenized mouse brain (Dounce Tissue Grinder; Wheaton) was prepared in lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 5mM MgCh, 1 mM EDTA, 5% glycerol, 1% NP-40) containing protease inhibitors (Thermo Fisher). The biotinylated aptamer was conjugated with Streptavidin in 1 X SSC buffer at 4°C for 3 hours and was then washed with lysis buffer. The biotinylated aptamer or the Streptavidin-Sepharose agarose beads (Amersham pharmacia) were incubated with cell lysates overnight at 4°C, and the samples were washed withdetergent-free lysis buffer for 4 times. The aptoprecipitants were then denatured at 95°C in the SDS sample buffer and were subjected to immunoblots for analysis.

[0124] Exonuclease assay

[0125] The control oligonucleotide 5' -FAM-TCGATCGGGGCGGGGCGATCGGGGCGGGGCGA (SEQ ID NO: 10) (20 ng) or the 5'-FAM AptBl aptamer (20 ng) was mixed with purified GST or GST-YB-1 proteins (400 ng each) and was incubated in the reaction buffer (50mM Tris, pH7.5, lOmM MgCh) at 35°C for 4 hours. After brief centrifugation, the reaction products were separated by 22% acrylamide gel with 8M Urea. The gel was then scanned by Typhoon 9410 (GE).

[0126] Establishment of a leptomeningeal carcinomatosis (LM) mouse model for in vivo SELEX

[0127] To identify BBB-penetrating and lung cancer-targeting aptamers, we established a lung cancer LM orthotopic mouse model for in vivo SELEX. In brief, luciferase-expressing CL1- 5 lung cancer stable cells were inoculated directly into the mouse cistema magna (Figure la). Tumor burden was monitored on a daily basis with IVIS. The mouse was sacrificed on Day 6 post tumor cell inoculation, at which time point strong bioluminescent (BLI) signals emitted from the tumor cells were detected by the IVIS over anatomical locations of the brain and the spine (Figure lb). The isolated brain and spinal cord were made into paraffin blocks, and were examined with H&E and immunohistochemistry (IHC) stains using anti-luciferase antibody. As shown in the Figure 1C, tumor cells formed tumor islets on the ventricular cavity walls of the brain (left panel) and the spine (right panel). The data indicated successful establishment of a lung cancer LM orthotopic mouse model, which served as the in vivo SELEX platform for BBB-penetrating aptamers identification.

[0128] Identification of AptBl, a BBB-penetrating and cancer-targeting aptamer, via in vivo SELEX

[0129] For candidate aptamer identification, an oligonucleotide library, comprised of 101580-nucleotide-long ssDNA molecules, was injected intraperitoneally (IP) into the LM mouse. In each SELEX round, the brain was isolated after SELEX buffer perfusion at 6 hours post ssDNAs injection, and the brain was isolated for DNA extraction. The extracted DNAs were amplified by PCR with specific primers designed for aptamer amplification. The amplicons were captured by beads and were subjected to single-strand isolation by heating. The ssDNAs were then IP injected again, serving as the library for the subsequent SELEX round. A total of 4 SELEX rounds were carried out, and the enriched oligonucleotide sequences were subjected to Sanger sequencing (Figure 2A). Overall, 9 candidate aptamers (AptBl to AptB9) were identified (Table 1).Table 1. Aptamer sequences identified from in vivo SELEXTable.1. Aptamer sequences identified from the in vivo SELEXID AG(kcal / mol)(SEQ ID NO:15)

[0130] The 9 candidate aptamers were amplified by PCR and labeled with the fluorophore, Cyanine-5 (Cy5). These aptamers were assigned into two groups based on the QGRS Mapper prediction results: the group I (AptBl-4) sequences contained G-quadruplexes structures while the group II (AptB5-9) sequences did not. The pooled group I or group II aptamers, respectively, were IP injected into the LM mouse I or II, of which prominent BLI signals emitted from the tumor cells were detected over the anatomical location of brain. As shown in the Figure 2B, strong Cy5 fluorescent signals emitted from anatomical locations of the brain and the spine were detected by the IVIS in the LM mouse I, with a crescendo pattern after IP injection, but not in the mouse II. The data suggested the BBB -penetrating ability of the group I aptamers is better than group II aptamers. The LM mouse I was perfused with SELEX buffer and the brain was made into cryosections. As shown in the Figure 2C, signals for the group I aptamers (red) were detected in the tumor cells (green) on the leptomeninges. The data further supported the BBB-penetrating ability of the group I aptamers, and suggested their lung cancer-targeting potentiality.

[0131] Next, the 4 aptamers within the group I, the Cy5-AptBl to Cy5-AptB4, were individually IP injected into the LM mice, with Cy5-labled random sequences serving as the control. As shown in the Figure 2D, Cy5 signals were detected from anatomical locations of the brain and / or the spine in mice injected with AptBl and AptB3. As the AptBl -injected mouse showed the most promising signal, the mouse brain was made into cryosections for further confirmation. As expected, confocal microscopy images revealed AptBl signals (pink) in the tumor cells (green) on the leptomeninges, suggesting its BBB-penetrating and lung cancertargeting ability (Figure 2E). A structure prediction by Mfold suggested that AptB 1 formed 3 stemloops with a total of 9 GC pairs (Figure 2F).

[0132] To reassure the BBB-penetrating ability of AptB l , it was IP administered into tumor-naive nude mice. A crescendo pattern of the Cy5-AptBl signals were detected in the anatomical location of the brain at 0.5 hour, 1 hour, 3 hours, and 6 hours after injection. The data further suggested that the BBB-penetrating ability of AptBl is irrelevant to the BBB disruption introduced by CNS cancer metastasis.

[0133] Detection of AptBl sequences in the cerebrospinal fluid (CSF)

[0134] To further confirm that the AptB 1 signals detected via the IVIS and by the confocal microscopy were from the aptamers located in the ventricular space instead of CNS microcirculation, the CSF was sampled directly from the cisterna magna with glass capillary tubes. In brief, the AptB 1 was intravenously (IV) injected through the tail vein, and the CSF was collected approximately 30 mins after the injection (Figure 3A-C). To detect the AptBl sequences, the CSF was PCR amplified with primers specific to our aptamer library. As shown in the agarose gel electrophoresis, the AptB 1 amplicons were detected both in the plasma and in the CSF sampled from the mouse administered with AptBl (Figure 3D). The sequence accuracy was verified by Sanger sequencing (Figure 3E). Next, percent of penetration across the BBB was measured by qPCR. The AptBl or the 80-mer oligonucleotide random sequences (control), 20 pg each, was IV injected through the tail vein. Plasma and CSF was sampled approximately 30 mins after drug administration as aforementioned, and the samples were subjected to qPCR for quantification. As shown in the Figure 3F, the CSF / plasma ratio for the AptBl was 10.54%, and that for the oligonucleotide random sequences was 2.57%. The data further supported the BBB-penetrating ability of AptB 1.

[0135] AptBCisl, an aptamer-cisplatin conjugate, showed efficacy in lung cancer LM diseases

[0136] To develop an AptB 1 -chemotherapeutic agent conjugate for lung cancer LM diseases, we conjugated cisplatin to the AptBl, forming AptBCisl. The successful conjugation was shown on the 16% non-denaturing polyacrylamide gel electrophoresis - the AptBCisl had a slower moving rate owing to its greater positive charges contributed by the cisplatin (Figure 4A). Next, the AptBCisl was subjected to Inductively Coupled Plasma Optical Emission Spectrometry analyses. The results showed that each AptBl sequence segment contained approximately 27 platinum molecules.

[0137] We then examined tumor suppressive effect of AptBCisl using a lung cancer LM orthotopic model. In brief, PC9 lung cancer cells were inoculated directly into the cisterna magna, and the AptBCis 1 (1 mg / kg, with equivalent cisplatin concentration of 0.35 mg / kg) or the cisplatin (2 mg / kg) was IV administered via tail vein at Day 2, 3, 5, 7, 9, and 11 post tumor inoculation (Figure 4B). Growth of the tumors was monitored via IVIS, and the mouse body weight was measured in a daily manner. As shown in the Figure 4C, BLI signals emitted from the cancer cells were much stronger in the cisplatin-treated group than in the AptBCisl -treated group, suggesting better tumor suppressive effect with AptBCisl than with cisplatin. In line with the IVIS data, reduction of mouse body weight was modest in the AptBCisl -treated group at Day 14 post tumor inoculation, while that was significant in the cisplatin-treated group (Figure 4D), supporting the effect of AptBCisl on tumor suppression.

[0138] To assure that the aforementioned tumor suppression was attributed by the cisplatin-induced cytotoxicity, the AptBCisl or the cisplatin-treated mice were sacrificed on Day 8 post tumor inoculation, and the brains were examined by immunofluorescent studies (Figure 4E). In brief, cryosections of the brain were co-stained with yH2 AX- specific antibody, and luciferase or EGFR (aa746-750del)-specific antibody. The yH2AX stands as a marker for cisplatin-induced DNA double-strand break (Kinner, A., Wu, W7., Staudt, C., lliakis, G. Gamma-H2AX in recognition and signaling of DNA double-strand breaks in the context of chromatin. Nucleic Acids Res 36, 5678-5694 (2008 )) the luciferase expression indicates tumor cells in our system, and the EGFR (aa746-750del) antibody specifically targets EGFR Dell9-expressing PC9 cells. As shown in the Figure 4F, tumor cells in the AptBCisl -treated group highlighted by the luciferase or the EGFR signals showed discohesiveness of the cells with fragmented cell mass, indicating extensive cell death; in contrast, tumor cells in the cisplatin-treated group had complete plasma membrane, indicating viability of the cells. Moreover, the yH2AX signals were more extensively distributed across tumor cells in the AptBCisl -treated group than in the cisplatin-treated one, suggesting a higher degree of DNA double-strand break induced by AptBCisl treatment (Figure 4F-G). Taken together, our data suggested better tumor suppressive effect of AptBCisl than cisplatin on lung cancer LM diseases.

[0139] AptBCisl inhibits lung cancer growth at lower cisplatin concentrations

[0140] The LM mouse data showed better tumor suppressive effect with AptBCisl at a lower equivalent systemic cisplatin concentration (0.35 mg / kg) than with cisplatin (2 mg / kg). It is, therefore, of particular importance to determine the CSF platinum concentration in these two scenarios.

[0141] In brief, CSF from the tumor-naive mouse was directly sampled at 30 minutes after tail vein injection, either with AptBCisl of 1 mg / kg or with cisplatin at 2 mg / kg. The CSF and the paired plasma specimens were subjected to Inductively Coupled Plasma Mass Spectrometry (ICP- MS) for platinum concentration determination. The ICP-MS results showed that the CSF platinum concentration with AptBCisl 1 mg / kg treatment was one tenth of that with cisplatin (2 mg / kg) treatment (Figure 5A). Moreover, the ICP-MS data suggested a 10% or a 20% CSF to plasma ratio,respectively, with AptBCisl or cisplatin treatment. With better tumor suppressive effect at lower CSF platinum concentration observed in the AptBCisl treatment group, the data implicated that AptBCisl exerted its anti-tumor effect beyond the scope of total platinum concentration and BBB- penetrating ability.

[0142] To confirm this, we examined the anti-tumor effect of AptBCisl using lung cancer subcutaneous xenograft mouse models. In brief, PC9 lung cancer cells were inoculated onto the back of BALB / c nude mice. The SELEX buffer control and different treatments, respectively, cisplatin 0.35 mg / kg, cisplatin 2 mg / kg, AptBl 1 mg / kg, AptBCisl 1 mg / kg (-0.35 mg / kg cisplatin), and AptBCisl 2 mg / kg (-0.7. mg / kg cisplatin) were given via tail vein on day 6, 7, 9, 11, 14, and 15 post tumor inoculation (Figure 5B). The results showed that AptBCisl 1 mg / kg (-0.35 mg / kg cisplatin) had greater tumor suppressive effect than cisplatin 0.35 mg / kg, and its effect was only slightly inferior to that of high-dose cisplatin (2 mg / kg). Of note, AptBCisl 2 mg / kg (-0.7 mg / kg cisplatin) showed similar tumor suppressive effect to high-dose cisplatin (2 mg / kg) (Figure 5C-D). Consistent with the LM orthotopic mouse model data, the results of the subcutaneous xenograft mouse model also showed that AptBCisl exhibited better tumor suppressive effect at lower equivalent cisplatin concentrations than cisplatin alone. The results once again strengthen the hypothesis that AptBCisl exerts its anti-tumor effect beyond the issue of total platinum concentration.

[0143] Moreover, while AptBCisl at 1 mg / kg or 2 mg / kg did not lead to body weight reduction, cisplatin 2 mg / kg resulted in about 10% body weight loss during the treatment period (Figure 5E). The data suggested the toxicity of high-dose cisplatin and the relative safety of AptBCisl at its effective dosage.

[0144] AptBl binds to EAAT2, Nucleolin, and YB-1 proteins

[0145] To elucidate the mechanisms, we next investigated AptB 1 -interacting proteins. Aptoprecipitation (AP, aptamer-based protein precipitation) with AptB 1 was performed using total cell lysates prepared from the mouse brains or the PC9 lung cancer cells. Mass spectrometry (MS) analyses for the aptoprecipitants revealed three candidate proteins: excitatory amino acid transporter 2 (EAAT2), Y-Box binding protein 1 (YB-1), and Nucleolin (Figure 6A).

[0146] The results were then verified with AptB 1 AP-immunoblots . The mouse brain tis sue and the PC9 cell aptoprecipitants were immunoblotted with EAAT2, YB-1, or Nucleolin antibody. Antibody specificity was confirmed by the immunoblots on total cell lysates prepared from the mouse endothelial (bEnd3) or the human lung cancer (PC9) cells with or without SiRNA treatment, respectively, SiEAAT2, SiYB-1, or SiNucleolin. The results showed that signals for EAAT2, YB- 1 and Nucleolin were detected both in the mouse brain and in the PC9 aptoprecipitants, but with different signal intensities. The signal for EAAT2 was the strongest in the mouse brain but the weakest in the PC9. The signal for Nucleolin went opposite in these two aptoprecipitants, being the strongest in the PC9 but the weakest in the mouse brain (Figure 6B). Confocal microscopy images further visualized the aptamer-protein interactions. As shown in the Figure 6C, signals for the AptBl (red) and the Nucleolin (green; upper panel) as well as the AptB 1 (red) and the YB-1 (green, lower panel) co-localized (yellow) in the PC9 cells, both in the cytoplasm and in the nucleus.

[0147] To further confirm the existence of AptBl in the cell nucleus, the AptBl -treated PC9 cells were separated into the cytosol and the nucleus fractions. DNAs were independently extracted from these two fractions, and the AptBl sequences were amplified with AptBl -specific primers. The successful amplification of AptBl from the nucleus fraction supported the entrance of AptBl into cell nucleus (Figure 6D).

[0148] Cisplatin interacts with DNA, and forms covalent adduct with purine DNA bases and platinum compound [6]. Therefore, the AptBl DNA backbone has to be digested before cisplatin can be released from the AptBCisl, so as to exert its cytotoxic effect on targeted cancer cells. Prior studies suggested the role of YB-1 as an exonuclease (Izumi, H., Imamura, T., Nagatani, G., Ise, T., Murakami, T., Uramoto, H., et al. Y box-binding protein-1 binds preferentially to single-stranded nucleic acids and exhibits 3 'T5 'exonuclease activity:. Nucleic Acids Res 29, 1200-1207 (2001)). To test if YB-1 served as the exonuclease for AptBl, the 5'- FAM-labeled AptB 1 or the control oligonucleotides was incubated with the purified GST-YB-1 or the GST proteins. As shown in the Figure 6F, AptBl and control oligonucleotides were both digested by the GST-YB-1 proteins, resulting in smears shown on the 22% polyacrylamide gel. The data supported the role of YB-1 as an exonuclease for AptBCisl.

[0149] Taken together, we showed that AptBl binds to EAAT2, Nucleolin and YB-1. The binding with EAAT2 could contribute to the BBB-penetrating ability of AptBl. The interaction with Nucleolin may explain the efficient nucleus delivery of AptBCisl. The binding with YB-1 in turn leads to the digestion of AptBl DNA backbone, facilitating the release of cisplatin from the AptBCisl. All these together constituted the promising tumor suppressive effect of AptBCisl at lower cisplatin concentrations, in both lung cancer LM orthotopic and subcutaneous xenograft mouse models (Figure 6G).

Claims

ClaimsWhat is claimed is:

1. An isolated aptamer comprising a polynucleotide sequence selected from the group consisting of SEQ ID Nos: 1 to 8 or variant thereof or a salt of any of foregoing.

2. The isolated aptamer of claim 1, wherein the polynucleotides sequence of SEQ ID NOs: 1 to 8 or a variant thereof or a salt of any of foregoing have G-quadruplexes structures.

3. The isolated aptamer of Claim 1 or 2, wherein the aptamer comprises a polynucleotide sequence of SEQ ID NO: 1 or 3 or 5 or 7 or a variant thereof or a salt of any of foregoing.

4. The isolated aptamer of Claim 1 or 2, wherein the aptamer comprises a polynucleotide sequence of SEQ ID NO: 1 or 5 or a variant thereof or a salt of any of foregoing.

5. The isolated aptamer of Claim 1 or 2, wherein the polynucleotides sequence of SEQ ID NO:1 or 5 or a variant thereof or a salt of any of foregoing forms 3 stem-loops with a total of 9 GC pairs.

6. The isolated aptamer of Claim 1 or 2 for use in a method for delivering a therapeutic agent to penetrate BBB of a subject, comprising administering an aptamer-therapeutic conjugate described herein to a subject, wherein the aptamer-therapeutic conjugate is a conjugate of one or more therapeutic agents and one or more aptamers of any one of Claim 1 or 2.

7. The isolated aptame of Claim 6, wherein the aptamer has G-quadruplexes structure and comprises a polynucleotide sequence having less than 150 base pairs.

8. The isolated aptame of claim 6, wherein the aptamer comprises a polynucleotide sequence having less than 100 base pairs or having about 50 to 100 base pairs.

9. The isolated aptamer of Claim 6, wherein the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO:1, 2, 3 or 4 or a variant thereof or a salt of any of foregoing.

10. The isolated aptamer of Claim 6, wherein the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO:1 or 3 or 5 or 7 or a variant thereof or a salt of any of foregoing.

11. The isolated aptamer of Claim 6, wherein the aptamer used in the method comprises a polynucleotide having a sequence of SEQ ID NO:1 or 5 or a variant thereof or a salt of any of foregoing.

12. An aptamer-therapeutic conjugate, comprising a therapeutic agent conjugated with an aptamer of any of Claims 1 to 5.

13. The aptamer-therapeutic conjugate of Claim 12, wherein the therapeutic agent is an agent associated with a CNS disease.

14. The aptamer-therapeutic conjugate of Claim 13, wherein the CNS disease is a CNS tumor or a neurological condition such as neurodegenerative diseases and a disease related to CNS damage (such as stroke).

15. The aptamer-therapeutic conjugate of Claim 12 or 13, wherein the therapeutic agent is an anti-cancer agent or an agent for neurodegenerative diseases or CNS damages.

16. The aptamer-therapeutic conjugate of Claim 15, wherein the anti-cancer agent is a chemotherapy drug or a targeted cancer drug.

17. The isolated aptamer of Claim 1 or 2 for use in a method for treating or preventing a disease in CNS, comprising administering an aptamer-therapeutic conjugate of any one of Claims 12 to 16 to a subject, wherein the therapeutic agent is an agent for a CNS disease.

18. The isolated aptamer of Claim 1 or 2 for use in a method for treating a CNS cancer, comprising administering an aptamer-therapeutic conjugate of any one of Claims 12 to 16 to a subject, wherein the therapeutic agent is an anti-cancer agent.

19. The isolated aptamer of claim 18, wherein the CNS cancer is a brain cancer, brain metastases, anaplastic astrocytoma, glioblastoma or leptomeningeal carcinomatosis.

20. The isolated aptamer of claim 19, wherein the leptomeningeal carcinomatosis is a lung cancer leptomeningeal carcinomatosis (LM).

21. The isolated aptamer of Claim 1 or 2 for use in a method for treating or preventing a neurological condition, comprising administering an aptamer-therapeutic conjugate of any one of Claims 12 to 16 to a subject, wherein the therapeutic agent is an agent for a neurological condition.

22. The isolated aptamer of Claim 21, wherein the neurological condition is neurodegenerative disease, neuromuscular condition (such as muscular dystrophy, amyotrophic lateral sclerosis), brain condition (such as attention deficit hyperactivity disorder (ADHD), Bell’s palsy, carpal tunnel syndrome, cerebral aneurysms, diabetic neuropathy, epilepsy, migraines and headache disorders, stroke and traumatic brain injury) and spine condition (such as spina bifida, spinal cord injury and spinal muscular atrophy).

Images