High-bioactivity plasmid DNA, preparation and storage thereof, vaccine, kit and use thereof

Abstract

The present invention relates to the field of biomedicine. Particularly provided are a high-bioactivity plasmid DNA, preparation and storage thereof, a vaccine, a kit, and a use thereof. The preparation method for the high-bioactivity plasmid DNA comprises: lysing bacterial cells after expansion culture and collecting a supernatant to obtain a crude solution containing a plasmid; purifying the crude solution by means of two-step liquid chromatography to obtain a purified plasmid DNA; precipitating the purified plasmid DNA by means of an alcohol and / or a polyol to concentrate and activate the plasmid DNA; and storing the plasmid DNA as a precipitate. The provided preparation method meets medical-grade standards, shortens the plasmid DNA purification time and reduces the material cost, improves the plasmid DNA yield and activity, and facilitates long-term storage. In addition, the plasmid DNA has higher in-vivo transfection efficiency and expression stability, thereby facilitating efficient introduction of a target gene into an organism. Thus, the plasmid DNA obtained by means of the method is suitable for use as an active component of a gene therapy drug or a DNA vaccine.

Description

Highly bioactive plasmid DNA, its preparation and storage, vaccine, kit and its application Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a plasmid DNA with high biological activity and its preparation and storage, a vaccine, a kit and its application. Background Art

[0002] Plasmid DNA is a covalently closed double-stranded DNA molecule derived from bacteria. It can express corresponding proteins in the target host through the open reading frame (ORF) it carries. It is the foundation of modern molecular biology and the cornerstone of a series of nucleic acid vaccines and gene therapy. With the vigorous development of the medical field, the demand for medical-grade high biological activity is also increasing. On the one hand, plasmids can encode antigenic proteins, which can induce specific cellular and humoral immune responses after being transferred into the host body. DNA vaccines using plasmids as carriers are entering a stage of rapid industrialization. On the other hand, plasmids, as carriers of genetic information, are templates for the in vitro synthesis of mRNA and are also important raw materials in the packaging process of viral vectors such as AAV.

[0003] Currently, the main purification schemes are alkaline lysis + liquid chromatography. Among the existing technologies for plasmid purification, GE's three-column method and BIA two-step method are the most commonly used plasmid purification schemes. However, in the actual operation of GE's three-column method, the concentrated solution of the plasmid lysate contains a large amount of RNA. The RNA will precipitate in the high-concentration ammonium sulfate solution and become congealed in the molecular sieve, resulting in significant column efficiency loss and potential contamination risks. Secondly, this method undergoes three-step liquid phase purification, and the recovery efficiency is lower than that of the two-step liquid phase purification. Finally, the overall flow rate of this method is slow, and it is restricted by the limitation of the molecular sieve loading volume, which also leads to its limited processing capacity. Moreover, in the actual operation process, the BIA two-step method will still have a small amount of host RNA contamination. In addition, this scheme uses the traditional alkaline lysis method for lysis and adds additional calcium chloride for pre-removal of impurities. The resulting product needs to be diluted to meet the liquid chromatography loading conditions, which makes the total volume of the feed liquid increased several times, requires more loading time, and produces more wastewater. Finally, high-concentration or even solid ammonium sulfate is required to prepare the sample between the two liquid phase steps, which makes the connection between the liquid phases of the two-step liquid phase method not smooth and difficult to fully automate. The overall process time and material costs are relatively high, and the purity of the plasmid DNA finally obtained is relatively low.

[0004] Therefore, it is crucial to provide a method for preparing highly biologically active plasmid DNA so as to obtain medical-grade, highly active plasmid DNA at the lowest possible cost for the development of modern molecular biology.

[0005] Summary of the Invention

[0006] The technical problem to be solved by the present invention is that the existing plasmid purification process has poor operational consistency, many time-consuming processing steps, low loading capacity, high time and material costs, and the biological activity of the plasmid DNA obtained is greatly lost, and the biological activity decreases with the extension of storage time.

[0007] In response to the above technical problems, the present invention provides a plasmid DNA with high biological activity, its preparation and storage, vaccine, kit and its application.

[0008] The technical solution of the present invention is:

[0009] In the first aspect, the present invention provides a plasmid DNA with high biological activity, characterized in that the biological activity is measured by the expression level of the protein encoded by the plasmid after intramuscular injection of the plasmid. After intramuscular injection of the plasmid DNA with high biological activity, the expression level of the protein encoded by it is increased by 10 times or more compared with the plasmid extracted by traditional methods or commercial kits.

[0010] Preferably, the highly biologically active plasmid DNA is prepared by the following steps:

[0011] (A) Lysing the cells: Adding a solution containing 2.0 M or greater ammonium sulfate to lyse the cells containing the DNA, clarifying the resulting lysate, and collecting the supernatant, i.e., the crude feed containing the plasmid, wherein the final ammonium sulfate concentration in the crude feed is 2.0-3.2 M;

[0012] (B) Purification of plasmid DNA: The crude plasmid solution is subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45 M to 2.1 M ammonium sulfate to obtain a hydrophobic chromatography product, wherein one or more mobile phases are used;

[0013] (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; and

[0014] (D) Activating plasmid DNA: The purified plasmid DNA is precipitated with monohydric alcohol and / or polyhydric alcohol to obtain a plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thereby obtaining a plasmid DNA with high biological activity.

[0015] In a second aspect, the present invention provides a method for preparing a plasmid DNA with high biological activity, comprising the following steps:

[0016] (A) Lysing the cells: Adding a solution containing 2.0 M or greater ammonium sulfate to lyse the cells containing the DNA, clarifying the resulting lysate, and collecting the supernatant, i.e., the crude feed containing the plasmid, wherein the final ammonium sulfate concentration in the crude feed is 2.0-3.2 M;

[0017] (B) Purification of plasmid DNA: The crude plasmid solution is subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45 M to 2.1 M ammonium sulfate to obtain a hydrophobic chromatography product, wherein one or more mobile phases are used;

[0018] (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; and

[0019] (D) Activating plasmid DNA: The purified plasmid DNA is precipitated with monohydric alcohol and / or polyhydric alcohol to obtain a plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thereby obtaining a plasmid DNA with high biological activity.

[0020] Preferably, it comprises the following steps:

[0021] Step 1) expansion culture: expanding the bacterial strain containing the plasmid;

[0022] Step 2) Lysing the cells: adding an ammonium sulfate solution containing 2.0 M or more to the cells after the expanded culture in step 1 to lyse the cells containing DNA; preferably, the cells after the expanded culture in step 1 are subjected to solid-liquid separation, and the separated cells are resuspended at a ratio of 1 g:3-10 mL of the wet weight of the separated cells to the volume of the first solution, calculated as g:mL, and then the second solution and the third solution are added to lyse the cells containing DNA;

[0023] Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride;

[0024] The second solution is an alkaline solution containing a surfactant;

[0025] The third solution is an ammonium sulfate solution containing greater than or equal to 2.0M;

[0026] More preferably, the volume ratio of the first solution, the second solution, and the third solution is 1:1:2-7, specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells in the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is then added to the lysate in the above ratio to neutralize the alkaline lysis product to obtain a lysate, the lysate is clarified, and the supernatant is collected, i.e., a crude material solution containing the plasmid, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2 M;

[0027] Step 3) Purifying the plasmid DNA: The crude plasmid-containing solution is loaded onto a hydrophobic chromatography column, and then subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain a hydrophobic chromatography product, wherein the mobile phase is one or more than one.

[0028] Step 4) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, loading the diluted hydrophobic chromatography product onto an ion exchange chromatography column, and then performing ion exchange chromatography with a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types;

[0029] Step 5) Activating the plasmid DNA: precipitating the purified plasmid DNA with a monohydric alcohol and / or a polyhydric alcohol, and / or concentrating the plasmid DNA by freeze-drying or ultrafiltration and then precipitating it with a monohydric or polyhydric alcohol to activate the purified plasmid DNA and obtain a plasmid DNA with high biological activity;

[0030] Step 6): Storing the plasmid DNA: storing the plasmid DNA with high biological activity in monohydric alcohol and / or polyhydric alcohol.

[0031] In a third aspect, the present invention provides a method for storing plasmid DNA with high biological activity, comprising the following steps:

[0032] (A) Lysing the cells: Adding a solution containing 2.0 M or greater ammonium sulfate to lyse the cells containing the DNA, clarifying the resulting lysate, and collecting the supernatant, i.e., the crude feed containing the plasmid, wherein the final ammonium sulfate concentration in the crude feed is 2.0-3.2 M;

[0033] (B) Purification of plasmid DNA: The crude plasmid solution is subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45 M to 2.1 M ammonium sulfate to obtain a hydrophobic chromatography product, wherein one or more mobile phases are used;

[0034] (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types;

[0035] (D) activating plasmid DNA: precipitating the purified plasmid DNA with monohydric alcohol and / or polyhydric alcohol to obtain a plasmid DNA precipitate, thereby activating the purified plasmid DNA, i.e., obtaining a plasmid DNA with high biological activity; and

[0036] (E) Storage of plasmid DNA: Plasmid DNA with high biological activity is stored in monohydric alcohol and / or polyhydric alcohol.

[0037] Preferably, the storage method comprises the following steps:

[0038] Step 1) expansion culture: expanding the bacterial strain containing the plasmid;

[0039] Step 2) Lysing the cells: adding an ammonium sulfate solution containing 2.0 M or more to the cells after the expanded culture in step 1 to lyse the cells containing DNA; preferably, the cells after the expanded culture in step 1 are subjected to solid-liquid separation, and the separated cells are resuspended at a ratio of 1 g:3-10 mL of the wet weight of the separated cells to the volume of the first solution, calculated as g:mL, and then the second solution and the third solution are added to lyse the cells containing DNA;

[0040] Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride;

[0041] The second solution is an alkaline solution containing a surfactant;

[0042] The third solution is an ammonium sulfate solution containing greater than or equal to 2.0M;

[0043] More preferably, the volume ratio of the first solution, the second solution, and the third solution is 1:1:2-7, specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells in the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is then added to the lysate in the above ratio to neutralize the alkaline lysis product to obtain a lysate, the lysate is clarified, and the supernatant is collected, i.e., a crude material solution containing the plasmid, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2 M;

[0044] Step 3) Purifying the plasmid DNA: The crude plasmid-containing solution is loaded onto a hydrophobic chromatography column, and then subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain a hydrophobic chromatography product, wherein the mobile phase is one or more than one.

[0045] Step 4) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, loading the diluted hydrophobic chromatography product onto an ion exchange chromatography column, and then performing ion exchange chromatography with a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types;

[0046] Step 5) activating the plasmid DNA: precipitating the purified plasmid DNA with a monohydric alcohol and / or a polyhydric alcohol, and / or concentrating the plasmid DNA by freeze-drying or ultrafiltration and then precipitating the purified plasmid DNA with a monohydric or polyhydric alcohol to obtain a plasmid DNA with high biological activity; and

[0047] Step 6): Storing the plasmid DNA: storing the plasmid DNA with high biological activity in monohydric alcohol and / or polyhydric alcohol.

[0048] And / or preferably, the monohydric alcohol is ethanol or isopropanol; and the polyhydric alcohol is polyethylene glycol.

[0049] And / or preferably, the storage temperature is -18 to -24°C.

[0050] And / or preferably, the third solution is a solution containing 2.1-4.0 M ammonium sulfate, preferably, the third solution is a solution containing 4.0 M ammonium sulfate.

[0051] And / or preferably, in step 3), specifically including:

[0052] (1) Column equilibration: equilibrate the hydrophobic chromatography column with the first mobile phase for 2 or more column volumes, preferably 3 column volumes;

[0053] (2) Loading: Pass the crude material containing the plasmid through a hydrophobic chromatography column;

[0054] (3) Elution: Use the second mobile phase to elute the hydrophobic chromatography column until all indicators are stable;

[0055] (4) Elution: Use the third mobile phase for elution, and collect the eluted product to obtain a hydrophobic chromatography product.

[0056] And / or preferably, the first mobile phase is a mixed solution containing 2.0-2.1 M ammonium sulfate, more preferably, a mixed solution containing 2.1 M ammonium sulfate;

[0057] And / or preferably, the second mobile phase is a mixture containing 1.90-2.05 M ammonium sulfate, more preferably, a mixture containing 1.95-2.00 M ammonium sulfate;

[0058] And / or preferably, the third mobile phase is a mixed solution containing 1.45M-1.8M ammonium sulfate, more preferably, a mixed solution containing 1.50-1.8M ammonium sulfate.

[0059] And / or preferably, in step 4, specifically including:

[0060] (1) Column equilibration: equilibrate the ion exchange chromatography column with the fourth mobile phase for 2 or more column volumes, preferably 3 column volumes;

[0061] (2) loading: mixing the hydrophobic chromatography product with the fourth mobile phase at a volume ratio of 1:1-3 to dilute the hydrophobic chromatography product, and then passing the diluted hydrophobic chromatography product through an ion exchange chromatography column;

[0062] (3) Eluent: Use the fifth mobile phase to elute the ion exchange chromatography column by the column volume until all indicators are stable;

[0063] (4) Elution: Use the sixth mobile phase for elution and collect the eluted product to obtain purified plasmid DNA

[0064] Wherein, the ion exchange chromatography column is an anion exchange chromatography column, and preferably, the ion exchange chromatography column is a strong anion exchange chromatography column.

[0065] And / or preferably, the conductivity of the diluted hydrophobic chromatography product is less than or equal to 100 mS / cm.

[0066] And / or preferably, the fourth mobile phase is a low conductivity solution of less than or equal to 40 mS / cm, more preferably, water and / or a mixed solution containing 0-50 mM ethylenediaminetetraacetic acid;

[0067] And / or preferably, the fifth mobile phase is a medium conductivity solution greater than or equal to 40 mS / cm and less than or equal to 60 mS / cm, more preferably, a mixed solution containing 0.4-0.50 M sodium chloride;

[0068] And / or preferably, the sixth mobile phase is a high conductivity solution greater than or equal to 60 mS / cm, more preferably, a mixed solution containing 0.5 M-1 M sodium chloride.

[0069] In a fourth aspect, the present invention provides a vaccine obtained by using the highly biologically active plasmid DNA or the highly biologically active plasmid DNA obtained by the preparation method.

[0070] Preferably, the vaccine is an injectable vaccine, and more preferably, the injectable vaccine is obtained by mixing the highly biologically active plasmid DNA or the highly biologically active plasmid DNA obtained by the preparation method with a buffer solution.

[0071] In a fifth aspect, the invention provides a kit comprising the highly biologically active plasmid DNA or a reagent or vaccine made from the plasmid DNA prepared by the method for preparing the highly biologically active plasmid DNA.

[0072] Preferably, the highly biologically active plasmid DNA or the highly biologically active plasmid DNA prepared by the preparation method is used in vaccine preparation or gene therapy.

[0073] The beneficial effects of the present invention include:

[0074] (1) The alkaline lysis method of the present invention improves the traditional alkaline lysis method. The crude liquid containing plasmids obtained by the alkaline lysis method of the present invention has fewer impurities and can be directly connected to liquid chromatography for plasmid purification without the need for concentrated feed and liquid exchange. The purification process is more consistent and the purification efficiency is higher. The low RNA concentration in the improved alkaline lysis product enables a higher loading capacity per unit volume of liquid phase filler. At the same time, the filler will not be compacted due to RNA precipitation, which is beneficial to equipment maintenance.

[0075] (2) According to the plasmid purification steps of the hydrophobic chromatography and ion exchange chromatography of the present invention, by adding solutions such as ammonium sulfate and sodium chloride of appropriate concentrations, RNA of larger molecular weight and RNA of smaller molecular weight are effectively removed, respectively, so that the final plasmid DNA does not contain host RNA and other impurities.

[0076] (3) Activating the purified plasmid DNA by precipitation (preferably by precipitation with monohydric alcohol and / or polyhydric alcohol). Alternatively, the purified plasmid DNA can be concentrated by ultrafiltration or lyophilization and then activated with monohydric alcohol or polyhydric alcohol, so that the plasmid DNA exhibits higher biological activity and is resistant to long-term storage.

[0077] (4) The method for purifying highly biologically active plasmid DNA provided by the present invention (two-column liquid chromatography) has a better yield than the traditional method for purifying plasmid DNA (three-column liquid chromatography), consumes less material, and takes less time overall while saving ultrafiltration equipment.

[0078] (5) The storage method provided by the present invention is to further store the highly biologically active plasmid DNA obtained by the preparation method of the highly biologically active plasmid DNA in a monohydric alcohol or a polyhydric alcohol at a storage temperature of -18°C to -24°C. Utilizing this storage method, the biological activity of the plasmid DNA can be maintained for a long period of time without significantly decreasing the in vivo transfection efficiency and stability.

[0079] (6) The vaccine provided by the present invention is obtained by high biological activity plasmid DNA or high biological activity plasmid DNA preparation method. Preferably, the vaccine is an injectable vaccine, which can induce high titer antibody production and high level of cellular immunity and other superior effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] FIG1 is a hydrophobic chromatography liquid chromatogram and agarose gel electrophoresis detection results of preliminary experiment 1 of the present invention.

[0081] FIG2 is an ion exchange liquid chromatography diagram and agarose gel electrophoresis detection results of preliminary experiment 2 of the present invention.

[0082] FIG3 is a comparative photograph of bacterial lysates treated by the traditional alkaline lysis method and the improved alkaline lysis method of the present invention, as well as a comparative electrophoresis diagram of RNA removal.

[0083] FIG4 is a 100 ms low exposure agarose gel electrophoresis diagram of Examples 1-8 of the present invention and Comparative Examples 1-8 and a 1000 ms high exposure agarose gel electrophoresis diagram.

[0084] FIG5 is a graph showing the comparison of the plasmid DNA obtained by the method for preparing a highly biologically active plasmid DNA according to Application Example 1 of the present invention and the plasmid DNA obtained using a commercial kit.

[0085] FIG6 is a graph showing the comparison of in vivo transfection efficiency and expression stability of plasmid DNA activated by different precipitation methods in Application Example 2 of the present invention.

[0086] FIG7 is a graph showing the comparison of in vivo transfection efficiency and expression stability of plasmid DNA stored in different storage methods in Application Example 2 of the present invention.

[0087] FIG8 is a graph showing the comparison results of the traditional plasmid DNA preparation method and the high biological activity plasmid DNA preparation method of Application Example 3 of the present invention.

[0088] FIG9 is a diagram showing the experimental process and results of using a high biological activity plasmid DNA obtained by the method for preparing a high biological activity plasmid DNA in Application Example 4 of the present invention to immunize mice with a DNA vaccine. DETAILED DESCRIPTION

[0089] The technical solutions of the present invention are further described in detail below with reference to specific embodiments and the accompanying drawings, but the present invention is not limited to the following technical solutions.

[0090] Specifically include the following:

[0091] 1. Lysis of Bacteria

[0092] The Escherichia coli containing the plasmid was inoculated into LB medium for bacterial expansion culture.

[0093] Use hollow fiber column filtration or centrifugation to separate the solid and liquid of the expanded cultured bacteria, collect the bacteria, and add the first solution at a ratio of 1:3-10 (g:mL) to the volume of the first solution to resuspend the separated bacteria, and then add the second solution and the third solution;

[0094] Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride; the first solution is preferably 10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and has a pH of 8.0;

[0095] The second solution is an alkaline solution containing a surfactant; the second solution is preferably 200 mM sodium hydroxide + 1 weight % sodium dodecyl sulfate;

[0096] The third solution is an ammonium sulfate solution containing greater than or equal to 2.0 M. Preferably, the third solution is an ammonium sulfate solution containing 2.1-4.0 M. More preferably, the third solution is an ammonium sulfate solution containing 4.0 M.

[0097] Among them, in terms of volume ratio, the volume ratio of the first solution, the second solution and the third solution is 1:1:2-7. Specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells according to the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is then added to the lysate according to the above ratio to neutralize the alkaline lysis product, and the lysate is allowed to stand to obtain a lysate. The lysate is clarified to collect the supernatant, i.e., the crude material solution containing the plasmid. The final ammonium sulfate concentration in the crude material solution containing the plasmid is 2.0-3.2M, and the pH is <9, so as to avoid excessive lysis to produce denatured plasmids or poor RNA removal effect, resulting in product contamination or reduced yield.

[0098] It should be noted that the collection method includes but is not limited to hollow fiber column filtration or centrifugation, and the clarification method includes but is not limited to centrifugation or tangential flow filtration, and other methods commonly used by those skilled in the art.

[0099] When the activated bacterial cells are collected by filtration using a hollow fiber column, it is preferred to use a filter membrane with a pore size of 1 μm or 0.22 μm for filtration.

[0100] The centrifugation parameters for collecting and expanding the cultured bacteria are: 6000-12000g, centrifugation for 5-30min.

[0101] The centrifugation parameters for clarifying the lysate are: 6000-12000 g, centrifugation for 5-30 min.

[0102] After centrifuging the lysate, the lysate is filtered using a filter membrane, preferably a 0.44 μm filter membrane.

[0103] When the neutralized lysate is clarified by tangential flow filtration, it is preferred to use one or a combination of a 5 μm filter membrane and a 0.22 μm filter membrane for filtration.

[0104] It should be noted that the third solution is an acidic solution containing greater than or equal to 2.0 M ammonium sulfate. Other auxiliary components added to the third solution for improving performance but not changing the concentration of ammonium sulfate in the third solution, such as metal chelators, acid-base buffers, etc., all fall within the scope of the third solution of the present invention.

[0105] 2. Purification of Plasmid DNA

[0106] (1) The crude material liquid is loaded onto a hydrophobic chromatography column, and a hydrophobic chromatography product is obtained through a hydrophobic chromatography process. The hydrophobic chromatography column comprises a packed column or a monolithic column containing a hydrophobic chromatography medium, preferably a packed column or a monolithic column containing a thiopyridine-modified granular hydrophobic chromatography medium. The hydrophobic chromatography column can be of any type, and its column specifications and volume can also be arbitrary.

[0107] Hydrophobic chromatography process: 1. Column equilibration: Use the first mobile phase to equilibrate the hydrophobic chromatography column for 2 or more column volumes, preferably 3 column volumes, with a linear flow rate of 2 cm / min or more; 2. Sample loading: Pass the crude material containing the plasmid through the hydrophobic chromatography column at a linear flow rate of 2 cm / min or more; 3. Elution: Use the second mobile phase to elute for 2 or more column volumes, preferably 3 column volumes, until all indicators are stable, with a linear flow rate of 2 cm / min or more. 4. Elution: Use the third mobile phase for elution, and collect the eluted product to obtain the hydrophobic chromatography product.

[0108] Wherein, the first mobile phase is a mixed solution containing 2.0-2.1M ammonium sulfate, pH=5.0-8.5, preferably, a mixed solution containing 2.1M ammonium sulfate, pH=7.5;

[0109] The second mobile phase is a mixture containing 1.90-2.05M ammonium sulfate, pH = 5.0-8.5, preferably a mixture containing 1.95-2.00M ammonium sulfate, pH = 7.5;

[0110] The third mobile phase is a mixed solution containing 1.45M-1.8M ammonium sulfate, pH=5.0-8.5, preferably, a mixed solution containing 1.50-1.8M ammonium sulfate, pH=7.5.

[0111] (2) The hydrophobic chromatography product is mixed with a fourth mobile phase to dilute the hydrophobic chromatography product so that the conductivity of the hydrophobic chromatography product is less than or equal to 100 mS / cm, and then the hydrophobic chromatography product is loaded onto an anion exchange chromatography column and purified according to an ion exchange chromatography process to obtain purified plasmid DNA. The anion exchange chromatography column includes a packed column or a monolithic column containing an anion exchange medium, preferably a packed column or a monolithic column containing a strong anion exchange medium modified with quaternary ammonium. The anion exchange chromatography column can be of any type, and its column specifications and volume can also be arbitrary.

[0112] Ion exchange chromatography process: 1. Column balancing: Use the fourth mobile phase to balance 2 or more strong anion exchange chromatography columns, preferably 3 column volumes, with a linear flow rate of 2 cm / min or more; 2. Loading: Mix the hydrophobic chromatography product with the fourth mobile phase in a volume ratio of 1:1 or more, preferably 1:1-3, so that the conductivity of the mixed solution is less than or equal to 100 mS / cm, to dilute the hydrophobic chromatography product, and then pass the diluted product through the strong anion exchange chromatography column at a linear flow rate of 2 cm / min or more; 3. Elution: Use the fifth mobile phase to elute for 2 or more, preferably 3 column volumes until all indicators are stable, and the linear flow rate is 2 cm / min or more; 4. Elution: Use the sixth mobile phase to elute, and collect the eluted product to obtain purified plasmid DNA.

[0113] The fourth mobile phase is a low conductivity solution of less than or equal to 40 mS / cm, pH = 5.0-8.5; preferably, water or TE buffer (0-50 mM ethylenediaminetetraacetic acid + 100 mM tris (hydroxymethyl)aminomethane hydrochloride, pH = 7.5);

[0114] The fifth mobile phase is a medium conductivity solution with a conductivity of 40 mS / cm or more and 60 mS / cm or less, and a pH of 5.0-8.5. Preferably, it is a mixture containing 0.4-0.50 M sodium chloride, and a pH of 7.5.

[0115] The sixth mobile phase is a high conductivity solution with a conductivity of 60 mS / cm or higher and a pH of 5.0-8.5, preferably a mixed solution containing 0.5 M to 1 M sodium chloride and a pH of 7.5.

[0116] 3. Concentration, Activation, and Storage of Plasmid DNA

[0117] The purified plasmid DNA can be precipitated using one of isopropanol precipitation, ethanol precipitation, or polyethylene glycol precipitation to obtain a plasmid DNA precipitate, which is then used to activate the purified plasmid DNA to obtain a highly biologically active plasmid DNA. Alternatively, the purified plasmid can be concentrated by ultrafiltration or lyophilization and then activated using a monohydric alcohol or polyhydric alcohol. The highly biologically active plasmid DNA activated by the monohydric alcohol or polyhydric alcohol can be stored in isopropanol, ethanol, or polyethylene glycol at a temperature of -18 to -24°C.

[0118] Isopropanol precipitation: the purified plasmid DNA was mixed with 3M sodium acetate (pH=5.5) and isopropanol in a volume ratio of 1:0.1 or greater:0.5 or greater, centrifuged at 12000g for 10 minutes, rinsed twice with 75% by volume ethanol, and air-dried.

[0119] Ethanol precipitation: The purified plasmid DNA was mixed with 3M sodium acetate (pH 5.5) and ethanol in a volume ratio of 1:0.1 or greater:1.5 or greater. The mixture was centrifuged at 12000 g for 10 min, rinsed twice with 75% ethanol by volume, and air-dried.

[0120] Polyethylene glycol precipitation: final concentration 500 mM sodium chloride and 10 wt% polyethylene glycol, centrifuge at 12000 g for 10 min, and rinse twice with 75 vol% ethanol.

[0121] Specifically, under the same dosage conditions, compared with the purified plasmid DNA obtained by the preparation method of the prior art, the purified plasmid DNA obtained by the preparation method provided by the present invention, that is, the highly biologically active plasmid DNA, has a higher number of transfected cells and total protein expression in vivo.

[0122] In order to better understand the technical solution of the present invention, the technical solution of the present invention is described in detail below in conjunction with specific embodiments.

[0123] Unless otherwise specified, the various reagents / instruments used in the examples and comparative examples of the present invention are conventional commercial products. The sources of experimental materials and instrument information used in the present invention are shown in Table 1:

[0124] Table 1 Reagents and instruments used in Examples and Comparative Examples

[0125] In vivo fluorescence imaging was used to detect the biological activity of plasmid DNA: plasmid DNA was dissolved in PBS buffer (final concentration of 1 mg / mL) and injected intramuscularly into the tibialis anterior muscle of mice. Three days later, luciferin substrate (150 mg / kg body weight) was injected intraperitoneally into the mice and detected using an in vivo luciferase imaging instrument.

[0126] Qubit assay for plasmid DNA concentration: Follow the instructions of the Qubit fluorometer kit and use the Qubit4 instrument to detect the concentration of plasmid DNA.

[0127] Nanodrop detects the UV absorbance of plasmid DNA: aspirate 1 μl of sample onto the sample stage and read the UV absorbance ratio A280 / A260.

[0128] Detection of residual host DNA by qPCR: The genome of Escherichia coli DH5α was extracted and used as a standard. Fluorescence quantitative amplification was performed using Primer 1: ACACGGTCCAGAACTCCTACG (Sequence No. 1) and Primer 2: CCGGTGCTTCTTCTGCGGGTAACGTCA (Sequence No. 2). The amount of residual host DNA in the purified plasmid sample was calculated. PCR reaction conditions were: 95°C for 5 min, (95°C for 10 s, 60°C for 20 s, 72°C for 20 s) at 40×, 60°C for 5 s.

[0129] BCA detection of protein residue: According to the instructions of the BCA kit, take 10 μl of sample to detect the protein residue and convert the unit.

[0130] Recombinant Factor C method for endotoxin residue detection: Follow the instructions of the recombinant Factor C endotoxin detection kit to determine the endotoxin residue in the purified plasmid sample.

[0131] The construction method of plasmid pVAX-luci-tdT in the preliminary experiments, examples and comparative examples is as follows:

[0132] The plasmid backbone, pVAX, was obtained from Invitrogen. Luciferase and the red fluorescent protein, tdTomato, were amplified using primer pairs, respectively. The primer pairs for luciferase amplification were: Luci-F: CCGTCAGACTCGAGGCCACCATGGAAGACGCCAAAAACAT (Sequence No. 3), Luci-R: CCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCACGGCGATCTTTCCGCCCT (Sequence No. 4); the primer pairs used for tdTomato amplification were: tdT-F: TAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGTGAGCAAGGGCGAGGAG (Sequence No. 5), tdT-R: GGCTGATCAGCGGGTTTAAACTTACTTGTACAGCTCGTCCATGCC (Sequence No. 6). Amplified products were size-checked by agarose gel electrophoresis and recovered using a gel extraction kit. The vector backbone was digested with restriction endonucleases XhoI and PmeI, and the digested products were detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments were recovered using a gel recovery kit for standby use. Plasmid construction was completed using a seamless cloning kit (Novozymes, C116). Specifically, the digested vector and the two fragments were mixed in a ratio of 40ng, 20ng, and 20ng, and added to the 2xpremix component in the C116 kit and incubated at 50 degrees Celsius for 5 minutes. The product was transformed into Escherichia coli DH5α and plated for overnight culture. The next day, single clones were picked for PCR identification and sequencing. Single clones with correct sequences and high plasmid yields were selected for seed preservation. Monoclones were preserved in glycerol. Specifically, the bacterial solution grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and frozen in an ultra-low temperature refrigerator at -80 degrees Celsius.

[0133] The construction method of the plasmid pB-CAG-iCre-ERT2 in the application example is as follows:

[0134] The plasmid backbone pB-CAG-iCre-ERT2 was purchased from Addgene, No. 137858. The LRRK2 gene was cloned from a mouse cDNA library. The amplification primers were: LRRK-F: AGGGCGCGGCAGCCGCTTCAGCTAGTGGCAGCTGTCAGGG (Sequence No. 7), LRRK-R: CAGGGAGAAGTTAGTGGCCTCAACAGATGTTCGTCTCAT (Sequence No. 8). The amplified product was checked for size using agarose gel electrophoresis and recovered using a gel recovery kit for later use. The vector backbone was digested with restriction endonucleases XhoI and BamHI, and the digested product was checked by agarose gel electrophoresis to ensure complete digestion. The corresponding fragment was then recovered using a gel recovery kit for later use. Plasmid construction was completed using a seamless cloning kit (Novozymes, C116). Specifically, the enzyme-cut vector and the amplified product were mixed in a ratio of 40 ng and 20 ng, and the 2xpremix component in the C116 kit was added and incubated at 50 degrees Celsius for 5 minutes. The product was transformed into Escherichia coli DH5α and plated for overnight culture. The next day, single clones were picked for PCR identification and sequencing. Single clones with correct sequences and high plasmid yields were selected for seed preservation. Monoclones were preserved in glycerol. Specifically, the bacterial solution grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and frozen in an ultra-low temperature refrigerator at -80 degrees Celsius.

[0135] The construction method of the plasmid pAAV-DIO-CAG-EYFP in the application example is as follows:

[0136] The plasmid backbone, pAAV-DIO-CAG-EYFP, was purchased from Addgene, catalog number 104052. The red fluorescent protein mScarlet was amplified using the following primer pair: ms-f: GGCGCGCCTTACTTGTACAGCTCGTCCATGCCG (Sequence No. 9), ms-r: GCTAGCGCCATGGTGAGCAAGGGCGAGGCAGTG (Sequence No. 10). The amplified product was size-verified by agarose gel electrophoresis and recovered using a gel extraction kit. The recovered amplified product and vector backbone were double-digested with the restriction endonucleases AscI and NheI, and the digested product was gel-recovered for future use. Plasmid construction was accomplished using T4 ligase. Specifically, 80 ng and 50 ng of the digested vector and fragment were mixed and added to T4 ligase and its buffer. The ligation was carried out overnight at 16°C. The ligated product was transformed into Escherichia coli DH5α and plated for overnight culture. The next day, single colonies were identified by PCR and sequenced. Single clones with correct sequences and high plasmid yields were selected for seed preservation. Single clones were preserved using glycerol. Specifically, bacterial liquid grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and frozen in a -80°C ultra-low temperature freezer.

[0137] The construction method of the plasmid pAAV-luci-cre in the application example is as follows:

[0138] The plasmid backbone, pVAX, was from Invitrogen. Luciferase and tdTomato were amplified using primer pairs: Luci-F: TTGTTTAGTGAACCGTCAGACTCGAGGCCACCATGGAAGACGCCAAAAACAT (Sequence No. 11), Luci-R: GACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCACGGCGATCTTTCCGCCCTTCT (Sequence No. 12); and tdTomato: Cre-F: TGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGTCCAATTTACTGACCGTACAC (Sequence No. 13), Cre-R: GGCTGATCAGCGGGTTTAAACTTAATCGCCATCTTCCAGCAGGCG (Sequence No. 14). The size of the amplified product was detected by agarose gel electrophoresis, and the gel recovery kit was used to recover the fragments for later use. The vector backbone was digested with restriction endonucleases XhoI and PmeI, and the digested products were detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments were recovered using a gel recovery kit for later use. Plasmid construction was completed using a seamless cloning kit (Novozymes, C116). Specifically, the digested vector and the two fragments were mixed in a ratio of 40ng, 20ng, and 20ng, and the 2xpremix component in the C116 kit was added and incubated at 50 degrees Celsius for 5 minutes. The product was transformed into Escherichia coli DH5α and plated for overnight culture. The next day, single clones were picked for PCR identification and sequencing. Single clones with correct sequences and high plasmid yields were selected for seed preservation. Monoclones were preserved in glycerol. Specifically, the bacterial solution grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and frozen in an ultra-low temperature refrigerator at -80 degrees Celsius.

[0139] The construction method of the plasmid pVax-S in the application example is as follows:

[0140] The plasmid backbone, pVax-S, was obtained from Invitrogen and double-digested with XhoI and PmeI. The digested products were checked by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments were recovered using a gel recovery kit for later use. The spike protein sequence of the novel coronavirus COVID-19 was obtained from NCBI, gene number 43740568. The gene was codon-optimized and fully synthesized for mouse use by Nanjing GenScript Biotechnology Co., Ltd. The synthesized DNA fragment was amplified using the following primers: Spike-F: GGCGGCCGCTCGAGGCCACCATGGATTGGACTTGGATCCTCTTCCTGGTTGCCGCTGCCACTAGAGTGCACAGCGTCAACCTTACTACTAGAAC (Sequence No. 15), Spike-R: CAGTCGAGGCTGATCAGCGGGTTTAAACTTACTTATCGTCGTCATCCTTGTAATCTCTAGATGTGTAATGCAGCTTGACGCCC (Sequence No. 16). The amplified product was size-verified by agarose gel electrophoresis and recovered using a gel extraction kit. Specifically, 40 ng of the digested vector and 20 ng of the amplified product were mixed, added to the 2x premix component of the C116 kit, and incubated at 50°C for 5 minutes. The product was transformed into Escherichia coli DH5α and plated overnight. Single colonies were identified and sequenced the next day by PCR. Single clones with correct sequences and high plasmid yields were selected for seed preservation. Single clones were preserved using glycerol. Specifically, bacterial liquid grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and frozen in a -80°C ultra-low temperature freezer.

[0141] 40% (w / v) sterile glycerol was prepared by mixing 40 mL of analytical grade glycerol with 60 mL of ultrapure water and sterilizing by high temperature and high pressure sterilization at 121° C. for 30 min.

[0142] Preliminary experiment 1: Screening of hydrophobic chromatography conditions

[0143] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into 6 L of LB medium at a ratio of 1:1000 for bacterial expansion. The culture parameters were 37°C and 220 rpm for 16 h. The expanded cells were collected by centrifugation at 8000 g and 4°C for 10 min to obtain 36 g of wet weight.

[0144] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 270 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0145] (3) The crude material containing the plasmid is loaded onto a hydrophobic chromatography column and eluted with a gradient of ammonium sulfate solution. The eluents are collected and their elution components are detected by 1% by weight agarose gel electrophoresis to determine the optimal elution and elution conditions. Hydrophobic chromatography process: 1. Column equilibration, using solution A to equilibrate the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Sample loading: The crude material containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Gradient elution: using eluent, the eluent includes solution A and solution B, using pump A to pump solution A and pump B to pump solution B, starting from 100% by volume of solution A, gradually reducing the volume ratio of solution A and increasing the volume ratio of solution B until reaching 100% by volume of solution B. The eluted products of the eluents of solution A with different volume ratios and solution B with different volume ratios are collected and their components are detected by 1% by weight agarose gel electrophoresis. The electrophoresis gel was exposed to both short and long exposure times to confirm the observation of all trace components. The hydrophobic chromatography column was 26 mm x 10 mm with a 50 mL bed volume and was packed with mercaptopyridine. The test results are shown in Figures 1 (A) and 1 (B).

[0146] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0147] Solution B is 10 mM EDTA + 100 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0148] As shown in (A) and (B) in Figure 1, (A) in Figure 1 is a water chromatography liquid chromatogram of the elution product of the eluents of solution A with different volume ratios and solution B with different volume ratios corresponding to the preliminary experiment 1 of the present invention. (B) in Figure 1 is a result diagram of detecting the components of the eluted product by 1 weight% agarose gel electrophoresis. The results show that sample segment 7 is the main supercoiled plasmid, and the corresponding eluent is: 76 volume% solution A + 24 volume% solution B. Elution with a higher volume ratio of solution A (volume ratio>90%) can remove open-chain plasmids (sample segment 5), and a lower concentration of solution A (volume ratio<75%) will elute RNA (sample segment 9). It can be seen that appropriate elution and elution conditions are the key to ensuring stable separation of hydrophobic chromatography.

[0149] Therefore, based on preliminary experiment 1, the present invention selects the following hydrophobic chromatography washing and elution conditions:

[0150] Elution conditions: Use 95% by volume of solution A + 5% by volume of solution B to elute the column until all indicators are stable, with a flow rate of 10 mL / min;

[0151] Elution conditions: 76% by volume of solution A + 24% by volume of solution B were used for elution at a flow rate of 10 mL / min.

[0152] Preliminary experiment 2: ion exchange chromatography condition screening

[0153] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into 6 L of LB medium at a ratio of 1:1000 for bacterial expansion. The culture parameters were 37°C and 220 rpm for 16 h. The expanded cells were collected by centrifugation at 8000 g and 4°C for 10 min to obtain 36 g of wet weight.

[0154] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 270 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0155] (3) The crude material liquid containing the plasmid is loaded on a hydrophobic chromatography column to obtain a hydrophobic chromatography product through a hydrophobic chromatography process. The hydrophobic chromatography process is as follows: 1. Column balance, using solution A to balance the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Loading: The crude material liquid containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Eluent: The chromatographic column is eluted with 95% by volume of solution A + 5% by volume of solution B until all indicators are stable, with a flow rate of 10 mL / min; 4. Elution: Elution is performed with 76% by volume of solution A + 24% by volume of solution B, with a flow rate of 10 mL / min, to obtain a hydrophobic chromatography product. Wherein, the hydrophobic chromatography column is 26 mm x 10 mm, with a column bed volume of 50 mL, and the filler is a chromatographic column of mercaptopyridine.

[0156] (4) The hydrophobic chromatography product is diluted with water in a ratio of 1:1 and loaded onto a strong anion exchange chromatography column, eluted with a gradient of increasing sodium chloride solution, and the eluents are collected and their components are detected by 1 wt% agarose gel electrophoresis to determine the optimal eluent and elution conditions. Ion exchange chromatography process: 1. Column equilibration: 2 column volumes are equilibrated with solution B at a flow rate of 10 mL / min; 2. Sample loading: The hydrophobic chromatography product and solution B are mixed in a volume ratio of 1:1 and passed through a strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: Using eluent, the eluent includes solution C and solution B, using pump A to pump solution C and pump B to pump solution B, starting from 0 volume% solution C + 100 volume% solution B, and increasing 10 volume% solution C every 2 column volumes (10 mL) until 100 volume% solution C + 0 volume% solution B. The eluted products from eluents containing different volume ratios of Solution C and Solution B were collected and analyzed by 1 wt% agarose gel electrophoresis. The strong anion exchange chromatography column was 16 mm x 10 mm with a 20 mL bed volume and packed with a quaternary ammonium ligand. The test results are shown in Figures 2 (A) and 2 (B).

[0157] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0158] Solution B is 10 mM EDTA + 100 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0159] Solution C is 1 M sodium chloride + 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0160] As shown in (A) and (B) in Figure 2, (A) in Figure 2 is an ion exchange liquid chromatogram of the elution product of the eluents of different volume ratios of solution C and different volume ratios of solution B collected in preliminary experiment 2 of the present invention. (B) in Figure 2 is a result diagram of the detection of the components of the elution product by 1 weight% agarose gel electrophoresis in preliminary experiment 2 of the present invention. The results show that the RNA (sample segment 5) remaining in the hydrophobic chromatography will be eluted before the supercoiled plasmid (sample segment 7). The eluent corresponding to sample segment 7 is: 90 volume% solution C + 10 volume% solution B. The elution conditions between RNA and supercoiled plasmid are slightly different, but very stable. After multiple similar experiments, using 40 volume%-50 volume% solution C for elution can completely remove RNA, retain DNA, and elute DNA under higher concentration conditions (>0.5M NaCl).

[0161] Therefore, based on preliminary experiment 2, the present invention selects the following ion exchange chromatography washing and elution conditions:

[0162] Elution conditions: Use 40% by volume of solution C + 60% by volume of solution B for 3 column volumes until all indicators are stable;

[0163] Elution conditions: 90% by volume of solution C + 10% by volume of solution B were used for elution at a flow rate of 10 mL / min.

[0164] Example 1

[0165] Lysing bacteria:

[0166] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into 6 L of LB medium at a ratio of 1:1000 for bacterial expansion. The culture parameters were 37°C and 220 rpm for 16 h. The expanded cells were collected by centrifugation at 8000 g and 4°C for 10 min to obtain 36 g of wet weight.

[0167] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 270 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.12 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0168] Purification of plasmid DNA:

[0169] (3) The crude material liquid containing the plasmid is loaded on a hydrophobic chromatography column, and a hydrophobic chromatography product is obtained by a hydrophobic chromatography process. The hydrophobic chromatography process is as follows: 1. Column balance, using solution A to balance the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Loading: The crude material liquid containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Eluent: The chromatographic column is eluted with 95% by volume of solution A + 5% by volume of solution B until all indicators are stable, with a flow rate of 10 mL / min; 4. Elution: Elution is performed with 76% by volume of solution A + 24% by volume of solution B, with a flow rate of 10 mL / min, to obtain a hydrophobic chromatography product. Wherein, the hydrophobic chromatography column is 26 mm x 10 mm, with a column bed volume of 50 mL, and the filler is a chromatographic column of mercaptopyridine.

[0170] (4) The hydrophobic chromatography product is diluted with water in a ratio of 1:1, and the diluted hydrophobic chromatography product is loaded on a strong anion exchange chromatography column, and purified plasmid DNA is obtained through an ion exchange chromatography process. The ion exchange chromatography process is as follows: 1. Column balancing: 2 column volumes are balanced with solution B at a flow rate of 10 mL / min; 2. Sample loading: The hydrophobic chromatography product and solution B are mixed in a volume ratio of 1:1 and passed through a strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: 3 column volumes are eluted with 40% by volume of solution C + 60% by volume of solution B until all indicators are stable; 4. Elution: 90% by volume of solution C + 10% by volume of solution B are used for elution at a flow rate of 10 mL / min and the eluted product is collected with a 0.9 M sodium chloride solution to obtain purified plasmid DNA. The strong anion exchange chromatography column is 16 mm x 10 mm, with a column bed volume of 20 mL, and the filler is a quaternary ammonium ligand chromatography column.

[0171] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0172] Solution B is 10 mM EDTA + 100 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0173] Solution C is 1 M sodium chloride + 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0174] Concentrate, activate and store plasmid DNA:

[0175] (5) Ethanol precipitation: The purified plasmid DNA was mixed with 3 M sodium acetate (pH = 5.5) and ethanol in a volume ratio of 1:0.1:3, centrifuged at 12000 g for 10 min, and then rinsed twice with 75% by volume ethanol to obtain.

[0176] (6) Storage: The plasmid DNA obtained in step (5) was stored in ethanol at -20°C.

[0177] Detection:

[0178] (7) The eluted product components were detected by 1 wt% agarose gel electrophoresis.

[0179] Example 2

[0180] The specific steps (1) are the same as those in Example 1.

[0181] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. The lysis was carried out at room temperature for 3 min. Subsequently, 300 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.22 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0182] The specific steps (3)-(7) are the same as those in Example 1.

[0183] Example 3

[0184] The specific steps (1) are the same as those in Example 1.

[0185] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 330 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.32 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0186] The specific steps (3)-(7) are the same as those in Example 1.

[0187] Example 4

[0188] The specific steps (1) are the same as those in Example 1.

[0189] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 360 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.4 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0190] The specific steps (3)-(7) are the same as those in Example 1.

[0191] Example 5

[0192] The specific steps (1) are the same as those in Example 1.

[0193] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 480 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.67 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0194] The specific steps (3)-(7) are the same as those in Example 1.

[0195] Example 6

[0196] The specific steps (1) are the same as those in Example 1.

[0197] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. The lysis was carried out at room temperature for 3 min. Subsequently, 600 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.86 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0198] The specific steps (3)-(7) are the same as those in Example 1.

[0199] Example 7

[0200] The specific steps (1) are the same as those in Example 1.

[0201] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 720 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 3 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0202] The specific steps (3)-(7) are the same as those in Example 1.

[0203] Example 8

[0204] The specific steps (1) are the same as those in Example 1.

[0205] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 840 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 3.11 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0206] The specific steps (3)-(7) are the same as those in Example 1.

[0207] Comparative Example 1

[0208] The specific steps (1) are the same as those in Example 1.

[0209] (2) 36 g of cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecyl sulfate) was added to lyse the cells. Lysis was carried out at room temperature for 3 min. Subsequently, 120 mL of 3 M sodium acetate solution (pH = 5.5) was added, mixed thoroughly, and allowed to stand to obtain a lysate. At this point, the final ammonium sulfate concentration in the lysate was 0 M. The lysate was centrifuged to collect the supernatant, which was the crude material containing the plasmid.

[0210] The specific steps (3)-(7) are the same as those in Example 1.

[0211] Comparative Example 2

[0212] The specific steps (1) are the same as those in Example 1.

[0213] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 60 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 0.8 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0214] The specific steps (3)-(7) are the same as those in Example 1.

[0215] Comparative Example 3

[0216] The specific steps (1) are the same as those in Example 1.

[0217] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 90 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 1.09 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0218] The specific steps (3)-(7) are the same as those in Example 1.

[0219] Comparative Example 4

[0220] The specific steps (1) are the same as those in Example 1.

[0221] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 120 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 1.33 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0222] The specific steps (3)-(7) are the same as those in Example 1.

[0223] Comparative Example 5

[0224] The specific steps (1) are the same as those in Example 1.

[0225] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 150 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 1.54 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0226] The specific steps (3)-(7) are the same as those in Example 1.

[0227] Comparative Example 6

[0228] The specific steps (1) are the same as those in Example 1.

[0229] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 180 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 1.71 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0230] The specific steps (3)-(7) are the same as those in Example 1.

[0231] Comparative Example 7

[0232] The specific steps (1) are the same as those in Example 1.

[0233] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 210 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 1.87 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0234] The specific steps (3)-(7) are the same as those in Example 1.

[0235] Comparative Example 8

[0236] The specific steps (1) are the same as those in Example 1.

[0237] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the bacterial solution. Lysis was carried out at room temperature for 3 min. Subsequently, 240 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2 M. The lysate was centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0238] The specific steps (3)-(7) are the same as those in Example 1.

[0239] Table 2 (1) Screening of the final concentration of ammonium sulfate in the lysate (Examples 1-8)

[0240] Table 2 (2) Screening of the final concentration of ammonium sulfate in the lysate (Comparative Examples 1-8)

[0241] As shown in Figure 3, Figure 3 (A) is a comparative photograph of the bacterial lysate after treatment with the traditional alkaline lysis method (the left side of Figure 3 (A)) and Example 1 of the present invention (the right side of Figure 3 (A)). Figure 3 (B) is a comparative electrophoresis diagram of the removal of RNA after treatment with the traditional alkaline lysis method and Example 1, wherein lane M of Figure 3 (B) represents a 5000bp molecular weight scale, lane 1 represents the removal of RNA in the crude material liquid containing the plasmid obtained by the traditional alkaline lysis method, and lane 2 represents the removal of RNA in the crude material liquid containing the plasmid obtained by the alkaline lysis method of the present invention. The results show that the improved lysis method of the present invention can effectively remove most of the host RNA in the lysed bacterial liquid, significantly reduce the time and material usage of subsequent liquid phase purification, and also improve the plasmid DNA yield. At the same time, it further shows that the alkaline lysis method of the present invention has three significant advantages in lysing bacterial cells: First, ammonium sulfate will produce a weak gas when neutralizing the alkaline lysis product, so that the impurity suspension after lysis floats on the upper layer and is more condensed, which is convenient for removal by filtration or centrifugation. Second, ammonium sulfate's pronounced salting-out effect not only significantly removes contaminating proteins but also significantly removes a significant amount of bacterial host RNA while preserving plasmid DNA, facilitating subsequent purification. Third, the lysate's optimal salt concentration allows for direct connection to hydrophobic chromatography mediated by a lyophilic salt without the need for concentration, buffer exchange, dialysis, or feed addition.

[0242] As shown in (A) in FIG4 , (A) in FIG4 is a 100ms low-exposure agarose gel electrophoresis diagram of the eluted product components detected by 1% agarose gel electrophoresis in Comparative Examples 1-8 and Example 1-8, and (B) in FIG4 is a 1000ms high-exposure agarose gel electrophoresis diagram of the eluted product components detected by 1% agarose gel electrophoresis in Comparative Examples 1-8 and Example 1-8, wherein the lanes are represented from left to right as 5000bp DNA ruler, Comparative Example 1-8, Example 1-8 (8 groups of lanes in the dotted box) and 5000bp DNA ruler. The results show that the alkaline lysis method provided by the present invention can effectively remove RNA and denatured plasmid DNA. And in combination with Table 2 (1)-(2), it can be seen that by comparing Comparative Examples 1-8 and Example 1-8, the effect of the final concentration of ammonium sulfate on the efficiency of RNA removal is further demonstrated. Only when the final concentration of ammonium sulfate is greater than or equal to 2.1M can RNA be effectively removed and DNA denaturation be avoided.

[0243] Application Example 1 (Comparison of plasmid DNA obtained by the method for preparing highly biologically active plasmid DNA with plasmid DNA obtained using a commercial kit)

[0244] (1) Escherichia coli containing the plasmids pB-CAG-iCre-ERT2, pVAX-luci-tdT, pAAV-DIO-CAG-EYFP, and pAAV-luci-cre were inoculated into LB medium at a ratio of 1:1000 for bacterial expansion. The bacterial expansion culture parameters were 37°C and 220 rpm for 16 h. The expanded bacterial cells were collected by centrifugation at 8000g and 4°C for 10 min.

[0245] The specific steps (2)-(5) are the same as those in Example 1.

[0246] As shown in Figure 5, (A) in Figure 5 is a 1000ms high-exposure agarose gel electrophoresis image of the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA in Application Example 1 and the elution product components of the plasmid DNA obtained using a commercial kit, wherein lane 1 represents a 5000bp DNA ruler; lanes 2-5 represent 1000ms high-exposure agarose gel electrophoresis images of the elution product components of the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA; lane 6 represents a 1000ms high-exposure agarose gel electrophoresis image of the elution product components of the plasmid DNA obtained using a commercial kit.

[0247] (B) in Figure 5 is the map and size of the plasmid DNA used in Application Example 1, wherein the plasmid DNA used in lane 2 is plasmid pB-CAG-iCre-ERT2, the plasmid DNA used in lanes 3 and 6 is plasmid pVAX-luci-tdT, the plasmid DNA used in lane 4 is plasmid pAAV-DIO-CAG-EYFP, and the plasmid DNA used in lane 5 is plasmid pAAV-luci-cre.

[0248] The results show that the upper portion of Figure 5 (A) shows a small 100 ng sample load, indicating that the plasmid DNA obtained using the method for preparing highly biologically active plasmid DNA (lanes 2-5) is primarily composed of supercoiled plasmid DNA. The lower portion of Figure 5 (A) shows a large 5 μg sample load, indicating that the plasmid DNA obtained using the method for preparing highly biologically active plasmid DNA (lanes 2-5) is completely free of host RNA. Plasmid DNA obtained using a commercial kit (lane 6) exhibits incomplete host RNA removal. Therefore, the plasmid DNA obtained using the method for preparing highly biologically active plasmid DNA is suitable for plasmids of varying sizes.

[0249] Application Example 2 (Comparison of in vivo transfection efficiency and expression stability of plasmid DNA activated by different precipitation methods and plasmid DNA stored in different ways)

[0250] 1. Lysis of bacteria

[0251] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into 6 L of LB medium at a ratio of 1:1000 for bacterial expansion. The culture parameters were 37°C and 220 rpm for 16 h. The expanded cells were collected by centrifugation at 8000 g and 4°C for 10 min to obtain 36 g of wet weight.

[0252] (2) Based on the wet weight of the cells, 1 g of cells was mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the cells. After resuspension, 5 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecylsulfonate) was added to lyse the cells. Lysis was carried out at room temperature for 3 min, and then 15 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After thorough mixing, the cells were allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.4 M. The lysate was centrifuged and the supernatant, i.e., the crude material containing the plasmid, was collected.

[0253] 2. Purification of plasmid DNA

[0254] (1) The crude material liquid containing the plasmid is loaded on a hydrophobic chromatography column, and a hydrophobic chromatography product is obtained by a hydrophobic chromatography process. The hydrophobic chromatography process is as follows: 1. Column balance, using solution A to balance the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Loading: The crude material liquid containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Elution: Using 92% by volume of solution A + 8% by volume of solution B to elute the chromatographic column until all indicators are stable, with a flow rate of 10 mL / min; 4. Elution: Using 75% by volume of solution A + 25% by volume of solution B for elution, with a flow rate of 10 mL / min and collecting the eluted product of 1.85M ammonium sulfate to obtain a hydrophobic chromatography product. Wherein, the hydrophobic chromatography column is 16 mm x 25 mm, with a column bed volume of 5 mL, and the filler is a chromatographic column of mercaptopyridine.

[0255] (2) The hydrophobic chromatography product is diluted with water in a ratio of 1:1 and loaded onto a strong anion exchange chromatography column, and purified plasmid DNA is obtained through an ion exchange chromatography process. The ion exchange chromatography process is as follows: 1. Column balancing: 2 column volumes are balanced with solution B at a flow rate of 10 mL / min; 2. Sample loading: The hydrophobic chromatography product and solution B are mixed in a volume ratio of 1:1 and passed through a strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: 3 column volumes are eluted with 45% by volume of solution C + 55% by volume of solution B until all indicators are stable; 4. Elution: 100% by volume of solution C is used for elution at a flow rate of 10 mL / min, and the eluted product is collected with a 0.9 M sodium chloride solution to obtain purified plasmid DNA. The strong anion exchange chromatography column is 16 mm x 25 mm, with a column bed volume of 5 mL, and the filler is a quaternary ammonium ligand chromatography column.

[0256] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0257] Solution B is 10 mM EDTA + 100 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0258] Solution C is 1 M sodium chloride + 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0259] 3. Precipitate plasmid DNA

[0260] (1) The purified plasmid DNA obtained by the purification method in Section 2 of this application example is freeze-dried or ultrafiltered, wherein the ultrafiltration is performed using a 300 kDa ultrafiltration membrane for concentration.

[0261] The purified plasmid DNA or the purified and concentrated plasmid was precipitated with isopropanol. The biological activity of the plasmid DNA obtained by the different concentration treatments was then tested through in vivo transfection and delivery efficiency assays. The results are shown in Figure 6 (D), which shows the quantitative statistical results of in vivo fluorescence imaging of the plasmid DNA obtained by the different concentration treatments in Section 3 of this application example.

[0262] (2) Plasmid DNA purified using a commercial kit (the same commercial kit as in Application Example 1) and plasmid DNA purified using a commercial kit were subjected to isopropanol precipitation.

[0263] Then, through in vivo transfection and delivery efficiency measurement experiments, the biological activity of the plasmid DNA purified by the commercial kit after treatment with isopropanol precipitation was detected, as shown in (E) in Figure 6. Figure 6 (E) shows the quantitative statistical results of in vivo fluorescence imaging of the plasmid DNA treated with isopropanol precipitation.

[0264] (3) The purified plasmid DNA obtained by the purification method of the present invention is precipitated by isopropanol precipitation, ethanol precipitation and polyethylene glycol precipitation, and then lyophilized.

[0265] Then, through in vivo transfection and delivery efficiency measurement experiments, the biological activity of the plasmid DNA after treatment with the purification method of the present invention and the traditional purification method was detected, as shown in (F) in Figure 6. (F) in Figure 6 is the quantitative statistical result of in vivo fluorescence imaging of the plasmid DNA treated with monohydric alcohol or polyhydric alcohol precipitation.

[0266] Among them, isopropanol precipitation method: the purified plasmid DNA was mixed with 3M sodium acetate (pH=5.5) and isopropanol in a volume ratio of 1:0.1:0.7, centrifuged at 12000g for 10 minutes, and then rinsed twice with 75% by volume ethanol.

[0267] Ethanol precipitation method: The purified plasmid DNA was mixed with 3 M sodium acetate (pH = 5.5) and ethanol in a volume ratio of 1:0.1:3, centrifuged at 12000 g for 10 min, and then rinsed twice with 75% by volume ethanol.

[0268] Polyethylene glycol precipitation method: Final concentration 500 mM sodium chloride and 10 wt% polyethylene glycol, centrifuge at 12,000 g for 10 min, and rinse twice with 75 vol% ethanol.

[0269] As shown in Figure 6, Figure 6 (A) is a plasmid map of the luciferase reporter gene used for in vivo transfection, Figure 6 (B) is an experimental flow chart for in vivo transfection and delivery efficiency determination, Figure 6 (C) is a representative diagram of in vivo fluorescence imaging, Figure 6 (D) is the quantitative statistical results of in vivo fluorescence imaging of plasmid DNA obtained by different concentration treatment methods in Section 3 of this application example, Figure 6 (E) is the quantitative statistical results of in vivo fluorescence imaging of plasmid DNA treated with isopropanol precipitation, and Figure 6 (F) is the quantitative statistical results of in vivo fluorescence imaging of plasmid DNA treated with monohydric alcohol or polyhydric alcohol precipitation.

[0270] The results showed that after liquid-phase purification, the highest transfection efficiency was achieved by concentration using precipitation, followed by ultrafiltration, and the worst by freeze-drying. Precipitation treatment effectively activated plasmid DNA, improving the efficiency and stability of in vivo delivery. Activation of plasmid DNA by precipitation was not limited to the plasmid preparation method and time, and could effectively restore the biological activity of plasmid DNA after precipitation treatment. Ethanol, isopropanol, and polyethylene glycol could all effectively precipitate and activate plasmid DNA and improve expression stability.

[0271] 4. Storage of plasmid DNA

[0272] The storage conditions for the same batch of plasmid DNA for 21 days are as follows:

[0273] The purified plasmid DNA obtained by the purification method in Section 2 of this application example was precipitated with ethanol and then freeze-dried. The lyophilized plasmid DNA was then stored in PBS buffer, ultrapure water, or anhydrous ethanol at -20°C or 4°C. The biological activity of the plasmid DNA stored in these different storage methods was then tested through in vivo transfection and delivery efficiency assays, as shown in Figure 7.

[0274] As shown in Figure 7, Figure 7 (A) is a plasmid map of the luciferase reporter gene used for in vivo transfection, Figure 7 (B) is an experimental flow chart for in vivo transfection and delivery efficiency determination, Figure 7 (C) is a representative image of in vivo fluorescence imaging of the same batch of plasmid DNA after 21 days of storage under different storage conditions, and Figure 7 (D) is a quantitative statistical result of in vivo fluorescence imaging of the same batch of plasmid DNA after 21 days of storage under different storage conditions.

[0275] Results showed that using the precipitation method to precipitate plasmid DNA and storing it in the precipitate at -20 or 4°C maintained the plasmid DNA's biological activity for extended periods, without significantly decreasing its in vivo transfection efficiency and stability. Furthermore, regardless of whether the plasmid DNA was stored in water or ethanol, its biological activity significantly decreased after storage, manifesting as decreased in vivo transfection efficiency and reduced expression stability.

[0276] Application Example 3 (Comparison of Traditional Plasmid DNA Preparation Methods and Purification Methods for Highly Biologically Active Plasmid DNA)

[0277] 1. Purification method of highly biologically active plasmid DNA (two-column liquid chromatography)

[0278] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into LB medium at a ratio of 1:1000 to obtain 6 L of bacterial culture. The culture parameters were 37°C, 220 rpm, and incubation for 16 h. The expanded cells were collected by centrifugation at 8000 g and 4°C for 10 min.

[0279] (2) 1 g of cells was mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the cells. After resuspension, 5 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecyl sulfate) was added to lyse the cells. Lysis was carried out at room temperature for 3 min. Subsequently, 15 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added, mixed thoroughly, and allowed to stand to obtain a lysate. The lysate was centrifuged to collect the supernatant, which was the crude material containing the plasmid.

[0280] (3) The crude material liquid containing the plasmid is loaded on a hydrophobic chromatography column to obtain a hydrophobic chromatography product through a hydrophobic chromatography process. The hydrophobic chromatography process is as follows: 1. Column balance, using solution A to balance the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Loading: The crude material liquid containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Elution: Using 92% by volume of solution A + 8% by volume of solution B to elute the chromatographic column until all indicators are stable, with a flow rate of 10 mL / min; 4. Elution: Using 75% by volume of solution A + 25% by volume of solution B for elution, with a flow rate of 10 mL / min and collecting the eluted product of 1.85M ammonium sulfate to obtain a hydrophobic chromatography product. Wherein, the hydrophobic chromatography column is 16 mm x 25 mm, with a column bed volume of 5 mL, and the filler is a chromatographic column of mercaptopyridine.

[0281] (4) The hydrophobic chromatography product is diluted with water in a ratio of 1:1 and loaded onto a strong anion exchange chromatography column, and purified plasmid DNA is obtained through an ion exchange chromatography process. The ion exchange chromatography process is as follows: 1. Column balancing: 2 column volumes are balanced with solution B at a flow rate of 10 mL / min; 2. Sample loading: The hydrophobic chromatography product and solution B are mixed in a volume ratio of 1:1 and passed through a strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: 3 column volumes are eluted with 45% by volume of solution C + 55% by volume of solution B until all indicators are stable; 4. Elution: 100% by volume of solution C is used for elution at a flow rate of 10 mL / min and the eluted product is collected with a 0.9 M sodium chloride solution to obtain purified plasmid DNA. The strong anion exchange chromatography column is 16 mm x 25 mm with a column bed volume of 5 mL and is filled with a quaternary ammonium ligand.

[0282] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0283] Solution B is 10 mM EDTA + 100 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0284] Solution C is 1 M sodium chloride + 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0285] 2. Traditional plasmid DNA purification method (three-column liquid chromatography)

[0286] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into LB medium at a ratio of 1:1000 to obtain 6 L of bacterial culture. The culture parameters were 37°C, 220 rpm, and incubation for 16 h. The expanded cells were collected by centrifugation at 8000 g and 4°C for 10 min.

[0287] (2) 1 g of cells was mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the cells. After resuspension, 5 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecyl sulfate) was added to lyse the cells. Lysis was carried out at room temperature for 3 min. Subsequently, 15 mL of the third solution (3 M sodium acetate solution, pH = 5.5) was added, mixed thoroughly, and allowed to stand to obtain a lysate. The lysate was centrifuged to collect the supernatant, which was the crude material containing the plasmid.

[0288] (3) The lysate was clarified by centrifugation at 8000 g, 4°C, for 20 min, and the clarified lysate was concentrated using a 300 kDa ultrafiltration membrane to a volume of less than 75 mL.

[0289] Molecular sieve chromatography: A Sepharose 6FF column with a column volume of 300 mL was used, and A (2.1 M ammonium sulfate solution + TE) was used to balance 2 column volumes. The concentrated lysate in (4) was passed through the molecular sieve, and the first peak was collected.

[0290] Affinity chromatography: A plasmidSelect packed chromatography column with a column volume of 50 mL was used, and solution B (2 M ammonium sulfate + TE) was used to balance 3 column volumes. The molecular sieve-purified plasmid obtained in (5) was passed through the chromatography column, and solution B (2 M ammonium sulfate + TE) was used to balance 3 column volumes for elution, and solution C (1.4 M sodium chloride + 2 M ammonium sulfate + TE) was used for elution.

[0291] Ion exchange chromatography: Use a 50 mL Capto Q30 packed column, equilibrate the column with solution D (0.4 M sodium chloride + TE) for two column volumes, dilute the sample twice with water and pass it through the column, then equilibrate the column with solution D (0.4 M sodium chloride + TE) for three column volumes, and finally elute with solution E (1.0 M sodium chloride + TE) to obtain purified plasmid DNA.

[0292] 3. Isopropanol precipitation: The purified plasmid DNA obtained in steps 1 and 2 of this application example was mixed with 3M sodium acetate (pH = 5.5) and isopropanol in a volume ratio of 1:0.1:0.7. The mixture was centrifuged at 12000g for 10 min and rinsed twice with 75% ethanol.

[0293] 4. The biological activity of the isopropanol-precipitated plasmid DNA obtained in step 3 was tested by in vivo transfection and delivery efficiency assays, as shown in FIG8 .

[0294] (A) in Figure 8 is a parallel comparison diagram of the traditional plasmid DNA purification method (three-column liquid chromatography) and the purification method of high biological activity plasmid DNA (two-column liquid chromatography) in this application example; (B) in Figure 8 is the experimental flow chart of in vivo transfection and delivery efficiency determination in this application example; (C) in Figure 8 is the plasmid DNA map of the luciferase reporter gene used for in vivo transfection in this application example, (D) in Figure 8 is a representative image of the in vivo fluorescence imaging of the plasmid DNA after isopropanol precipitation obtained in Section 3 of this application example, and (E) in Figure 8 is the quantitative statistical results of the in vivo fluorescence imaging of the plasmid DNA after isopropanol precipitation obtained in Section 3 of this application example.

[0295] The results showed that through the traditional plasmid DNA purification method (three-column liquid chromatography) and the high biological activity plasmid DNA purification method (two-column liquid chromatography), the purified plasmid DNA was precipitated, desalted, concentrated and activated to obtain plasmid DNA with similar in vivo delivery efficiency and similar stability.

[0296] 5. Through in vivo transfection and delivery efficiency determination experiments, the quality control index comparison results of the plasmid DNA obtained after isopropanol precipitation in step 3 were tested, as shown in Table 3.

[0297] As shown in Table 3, the results show that the quality control indicators of the plasmid DNA prepared by the method of the present invention, such as residual host DNA and residual endotoxin, are significantly lower than those of the traditional purification method, and the plasmid DNA concentration is significantly better than that of the traditional purification method.

[0298] 6. Comparison of time and material consumption for the main steps of the traditional plasmid DNA purification method (three-column liquid chromatography) and the purification method of highly biologically active plasmid DNA (two-column liquid chromatography) is shown in Table 4.

[0299] As shown in Table 4, the results indicate that the purification method provided by the present invention has a yield approximately 1.5 times that of the traditional purification method, and has lower material consumption. The overall time consumption is 35% of the classic three-column method, eliminating the use of ultrafiltration equipment and related material consumption.

[0300] In summary, the comprehensive performance of plasmid DNA obtained by the purification method of high biological activity plasmid DNA, such as in vivo delivery efficiency, stability, quality, yield and production cost, is significantly higher than that of the traditional plasmid DNA purification method.

[0301] Table 3. Comparison of plasmid DNA quality control indicators

[0302] Application Example 4

[0303] 1. Preparation of pVax-S plasmid DNA encoding COVID-19 spike protein and vaccine thereof

[0304] (1) Escherichia coli containing the pVax-S plasmid was inoculated into LB medium at a ratio of 1:1000 to obtain 6 L of bacterial culture. The culture parameters were 37°C and 220 rpm for 16 h. The expanded cells were collected by centrifugation at 8000g and 4°C for 10 min.

[0305] (2) 1 g of cells was mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the cells. After resuspension, 5 mL of the second solution (200 mM sodium hydroxide + 1 wt% sodium dodecyl sulfate) was added to lyse the cells. Lysis was carried out at room temperature for 3 min. Subsequently, 15 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added, mixed thoroughly, and allowed to stand to obtain a lysate. The lysate was centrifuged to collect the supernatant, which was the crude material containing the plasmid.

[0306] (3) The crude material liquid containing the plasmid is loaded on a hydrophobic chromatography column to obtain a hydrophobic chromatography product through a hydrophobic chromatography process. The hydrophobic chromatography process is as follows: 1. Column balance, using solution A to balance the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Loading: The crude material liquid containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Elution: Using 92% by volume of solution A + 8% by volume of solution B to elute the chromatographic column until all indicators are stable, with a flow rate of 10 mL / min; 4. Elution: Using 75% by volume of solution A + 25% by volume of solution B for elution, with a flow rate of 10 mL / min and collecting the eluted product of 1.85M ammonium sulfate to obtain a hydrophobic chromatography product. Wherein, the hydrophobic chromatography column is 16 mm x 25 mm, with a column bed volume of 5 mL, and the filler is a chromatographic column of mercaptopyridine.

[0307] (4) The hydrophobic chromatography product is diluted with water in a ratio of 1:1 and loaded onto a strong anion exchange chromatography column, and purified plasmid DNA is obtained through an ion exchange chromatography process. The ion exchange chromatography process is as follows: 1. Column balancing: 2 column volumes are balanced with solution B at a flow rate of 10 mL / min; 2. Sample loading: The hydrophobic chromatography product and solution B are mixed in a volume ratio of 1:1 and passed through a strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: 3 column volumes are eluted with 45% by volume of solution C + 55% by volume of solution B until all indicators are stable; 4. Elution: 100% by volume of solution C is used for elution at a flow rate of 10 mL / min and the eluted product is collected with a 0.9 M sodium chloride solution to obtain purified plasmid DNA. The strong anion exchange chromatography column is 16 mm x 25 mm with a column bed volume of 5 mL and is filled with a quaternary ammonium ligand.

[0308] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0309] Solution B is 10 mM EDTA + 100 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0310] Solution C is 1 M sodium chloride + 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0311] (5) Isopropanol precipitation: The purified plasmid DNA was mixed with 3 M sodium acetate (pH 5.5) and isopropanol at a volume ratio of 1:0.1:0.7, centrifuged at 12,000 g for 10 min, and rinsed twice with 75% ethanol. The resulting plasmid DNA precipitate was dissolved in PBS buffer, and the concentration of the plasmid DNA was determined using Qubit4. The plasmid DNA was diluted to 1 mg / mL using PBS buffer and used as the vaccine (referred to as "pVax-S plasmid DNA vaccine").

[0312] 2. Immunization of mice with pVax-S plasmid DNA vaccine and sample collection

[0313] (1) Specific Immunization Process and Sample Collection As shown in FIG9A , mice were randomly divided into two groups, namely, a pVax-S immunization group and a blank immunization group, wherein the mice were eight-week-old female BalB / C mice.

[0314] pVax-S immunization group: Mice were injected with the pVax-S plasmid DNA vaccine encoding the COVID-19 spike protein (the pVax-S plasmid DNA vaccine prepared in Section 1 above) at weeks 0, 2, and 4, respectively. The injection site was the tibialis anterior muscle, and each dose was 5 μg.

[0315] Blank immunization group: The mice were injected with empty vectors that did not encode immunogens at 0, 2, and 4 weeks respectively. The injection site was the tibialis anterior muscle, and the dose was 5 μg each time.

[0316] (2) Blood samples were collected from the orbital vein of mice in the pVax-S immunization group and the blank immunization group at weeks 2, 4, and 6, respectively. The blood samples were allowed to stand at room temperature for 30 minutes and then centrifuged at 1000 g for 30 minutes. The supernatant was collected as the serum sample. The serum samples were assayed for spike protein antibody titers by enzyme-linked immunosorbent assay (ELISA) in Section 3 below to measure the humoral immune response to the highly biologically active plasmid DNA vaccine obtained by the highly biologically active plasmid DNA preparation method.

[0317] (3) Mice in the pVax-S immunization group and the blank immunization group were sacrificed by cervical dislocation at week 6, and then spleen samples were collected by dissection and immersed in PBS buffer at 0°C. The spleen samples were used to measure the number of IFN-γ-positive splenocytes responding to the spike protein by enzyme-linked immunosorbent assay (ELISPOT) in Section 4 below to measure the cellular immune response of the high biological activity plasmid DNA vaccine obtained by the high biological activity plasmid DNA preparation method.

[0318] 3. Enzyme-linked immunosorbent assay (ELISA) to determine spike protein antibody titer

[0319] (1) Dilute the spike protein antigen to 2 μg / mL using antigen coating solution; add 100 μL / well to the ELISA assay plate and coat overnight at 4°C;

[0320] (2) The next day, the coating solution was removed and the cells were rinsed three times with PBST containing 0.1% Tween-20 by volume. 200 μL of blocking solution was added and blocked at 37°C for 2 h. The blocking solution was PBS buffer containing 5% BSA by mass.

[0321] (3) Dilute the serum sample obtained from the mouse in Section 2, Part (2) above at a ratio of 1:10,000: blocking solution. Transfer the diluted serum sample to the coated ELISA assay plate, 100 μL per well, and incubate at 37°C for 1 hour. Discard the sample and wash with PBST 3-5 times.

[0322] (4) Adding a secondary antibody (Goat-anti-mouse IgG), diluting the secondary antibody at a ratio of 1:20,000, and adding the diluted secondary antibody to the ELISA assay plate washed with the PBST in step (3), 100 μL per well, and incubating at 37° C. for 1 hour; discarding the secondary antibody, and washing with the PBST for 3-5 times;

[0323] (5) To the ELISA assay plate washed with PBST in step (4), 100 μL of single-component TMB color development solution was added to each well for color development. After color development reached an appropriate depth, 50 μL of stop solution was added to each well for termination. The OD450 absorbance was read using a microplate reader. The statistical results are shown in C in FIG9 .

[0324] 4. ELISPOT assay to determine the number of IFN-γ positive splenocytes in response to mouse spike protein

[0325] (1) Add 1.5 mL / well of 0°C lymphocyte separation medium to a 24-well plate and place on ice. Transfer the spleen sample obtained from the mouse in Section 2, Part (3) above. Grind the spleen using a 5 / 10 mL syringe piston until the grinding liquid becomes dark red and turbid to obtain a grinding suspension. Filter the grinding suspension through a flow cytometer; transfer the filtered grinding suspension to a 2 mL centrifuge tube, add 0.3 mL of RPMI-1640 to each tube, and centrifuge at 800 g at 4°C for 30 min to obtain the lymphocyte layer.

[0326] (2) Aspirate the lymphocyte layer and transfer it to a new 15 mL centrifuge tube. Add 10 mL of RPMI-1640 medium to each tube, centrifuge at 200 g for 10 min at 4°C, discard the supernatant, and obtain the cell pellet.

[0327] (3) Resuspend the cell pellet in 0.6 mL of serum-free lymphocyte culture medium. Dilute 100-fold and place in a 96-well plate, 0.1 mL per well. Add an equal amount of 0.4% trypan blue dye. Count the cells using a BioRad automated cell counter to calculate the cell concentration. Dilute the cells to 5 × 10 cells / well in serum-free lymphocyte culture medium according to the cell concentration. 6 / mL, take 200 μL and place in a 96-well plate for use, and plate 50 μL per well using a dispenser (250,000 cells).

[0328] (4) Dilute the spike protein peptide library into a culture medium with a serum-free lymphocyte culture medium to obtain a spike protein peptide library concentration of 0.2 mg / mL. Take 200 μL of the culture medium and place it in a 96-well plate for use.

[0329] Experimental wells (+): The cells obtained in step (3) were added to the wells containing the culture medium using a pipette at a volume of 50 μL per well.

[0330] Negative control wells (-): 50 μL of cells obtained in step (3) were added to the wells without the culture medium using a pipette, and cultured at 37° C. for 20 hours.

[0331] (5) Pour the cells and culture medium from the wells, add 0℃ deionized water, 200μL / well, and incubate at 4℃ for 10 minutes to lyse the cells; use the colorimetric reaction reagent in the enzyme-linked immunosorbent assay kit for color development. Specifically, use 250μL / well of 1xWashing Buffer working solution, leave for 1 minute, then discard the liquid in the well, repeat 3 times; add 1xBiotinylatedAntibody working solution to each experimental well, 100μL / well. Incubate at 37℃ for 1 hour; use 250μL / well of 1xWashing Buffer working solution, leave for 1 minute, then discard the liquid in the well, repeat 3 times; add 1xStreptavidin-HRP working solution to each experimental well, 100μL / well. Incubate at 37°C for 1 hour; add 100 μL / well of AEC colorimetric solution and incubate at room temperature in the dark for 30 minutes. Terminate color development based on spot formation. If the room temperature is below 20°C, it is recommended to incubate at 37°C and check every 5-10 minutes. Read the spots using an ELISPOT plate reader, as shown in Figure 9, B. The statistical results are shown in Figure 9, D.

[0332] Figure C in Figure 9 is an enzyme-linked immunosorbent assay to detect the serum anti-spike protein antibody titer of mice that have undergone three doses of pVax-S or blank immunization groups. The results show that the plasmid purified based on the purification method of the present invention can be used for DNA vaccines to induce high-titer antibody production. Figure 9 B is a graph showing the results of an enzyme-linked immunosorbent assay on spleen cells of mice that have undergone three doses of pVax-S immunization groups or blank immunization groups. Figure 9 D is an enzyme-linked immunosorbent assay to detect the number of interferon-γ-positive cells that respond to the spike protein in spleen cells of mice that have undergone three doses of pVax-S immunization groups and blank immunization groups. The results show that the high biological activity plasmid DNA obtained by the preparation method of the high biological activity plasmid DNA of the present invention can be used for DNA vaccines to induce high levels of cellular immunity.

[0333] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A plasmid DNA with high biological activity, characterized in that: The biological activity is measured by the expression level of the protein encoded by the plasmid after intramuscular injection of the plasmid. After intramuscular injection of the high biological activity plasmid DNA, the expression level of the protein encoded by it is increased by 10 times or more compared with the plasmid extracted by traditional methods or kits.

2. The highly biologically active plasmid DNA according to claim 1, wherein The highly biologically active plasmid DNA is prepared by the following steps: (A) Lysing the cells: Adding a solution containing 2.0 M or greater ammonium sulfate to lyse the cells containing the DNA, clarifying the resulting lysate, and collecting the supernatant, i.e., the crude feed containing the plasmid, wherein the final ammonium sulfate concentration in the crude feed is 2.0-3.2 M; (B) Purification of plasmid DNA: The crude plasmid solution is subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45 M to 2.1 M ammonium sulfate to obtain a hydrophobic chromatography product, wherein one or more mobile phases are used; (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; and (D) Activating plasmid DNA: The purified plasmid DNA is precipitated with monohydric alcohol and / or polyhydric alcohol to obtain a plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thereby obtaining a plasmid DNA with high biological activity.

3. The method for preparing a plasmid DNA with high biological activity according to claim 1, characterized in that: It includes the following steps: (A) Lysing the cells: Adding a solution containing 2.0 M or greater ammonium sulfate to lyse the cells containing the DNA, clarifying the resulting lysate, and collecting the supernatant, i.e., the crude feed containing the plasmid, wherein the final ammonium sulfate concentration in the crude feed is 2.0-3.2 M; (B) Purification of plasmid DNA: The crude plasmid solution is subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45 M to 2.1 M ammonium sulfate to obtain a hydrophobic chromatography product, wherein one or more mobile phases are used; (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; and (D) Activating plasmid DNA: The purified plasmid DNA is precipitated with monohydric alcohol and / or polyhydric alcohol to obtain a plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thereby obtaining a plasmid DNA with high biological activity.

4. The preparation method according to claim 3, characterized in that It includes the following steps: Step 1) expansion culture: expanding the bacterial strain containing the plasmid; Step 2) Lysing the cells: adding an ammonium sulfate solution containing 2.0 M or more to the cells after the expanded culture in step 1 to lyse the cells containing DNA; preferably, the cells after the expanded culture in step 1 are subjected to solid-liquid separation, and the separated cells are resuspended at a ratio of 1 g:3-10 mL of the wet weight of the separated cells to the volume of the first solution, calculated as g:mL, and then the second solution and the third solution are added to lyse the cells containing DNA; Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride; The second solution is an alkaline solution containing a surfactant; The third solution is an ammonium sulfate solution containing greater than or equal to 2.0M; The volume ratio of the first solution, the second solution, and the third solution is 1:1:2-7. Specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells in the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is added to the lysate in the above ratio to neutralize the alkaline lysis product to obtain a lysate, and the lysate is clarified to collect the supernatant, i.e., a crude material solution containing the plasmid, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2 M; Step 3) Purifying the plasmid DNA: The crude plasmid-containing solution is loaded onto a hydrophobic chromatography column, and then subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain a hydrophobic chromatography product, wherein the mobile phase is one or more than one. Step 4) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, loading the diluted hydrophobic chromatography product onto an ion exchange chromatography column, and then performing ion exchange chromatography with a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; Step 5) activating the plasmid DNA: precipitating the purified plasmid DNA with a monohydric alcohol and / or a polyhydric alcohol, and / or concentrating the plasmid DNA by freeze-drying or ultrafiltration and then precipitating the purified plasmid DNA with a monohydric or polyhydric alcohol to obtain a plasmid DNA with high biological activity; and Step 6): Storing the plasmid DNA: storing the plasmid DNA with high biological activity in monohydric alcohol and / or polyhydric alcohol.

5. A method for storing plasmid DNA with high biological activity, characterized in that: It includes the following steps: (A) Lysing the cells: Adding a solution containing 2.0 M or greater ammonium sulfate to lyse the cells containing the DNA, clarifying the resulting lysate, and collecting the supernatant, i.e., the crude feed containing the plasmid, wherein the final ammonium sulfate concentration in the crude feed is 2.0-3.2 M; (B) Purification of plasmid DNA: The crude plasmid solution is subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45 M to 2.1 M ammonium sulfate to obtain a hydrophobic chromatography product, wherein one or more mobile phases are used; (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; (D) activating plasmid DNA: precipitating the purified plasmid DNA with monohydric alcohol and / or polyhydric alcohol to obtain a plasmid DNA precipitate, thereby activating the purified plasmid DNA, i.e., obtaining a plasmid DNA with high biological activity; and (E) Storage of plasmid DNA: Plasmid DNA with high biological activity is stored in monohydric alcohol and / or polyhydric alcohol.

6. The storage method according to claim 5, characterized in that: It includes the following steps: It includes the following steps: Step 1) expansion culture: expanding the bacterial strain containing the plasmid; Step 2) Lysing the cells: adding an ammonium sulfate solution containing 2.0 M or more to the cells after the expanded culture in step 1 to lyse the cells containing DNA; preferably, the cells after the expanded culture in step 1 are subjected to solid-liquid separation, and the separated cells are resuspended at a ratio of 1 g:3-10 mL of the wet weight of the separated cells to the volume of the first solution, calculated as g:mL, and then the second solution and the third solution are added to lyse the cells containing DNA; Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride; The second solution is an alkaline solution containing a surfactant; The third solution is an ammonium sulfate solution containing greater than or equal to 2.0M; The volume ratio of the first solution, the second solution, and the third solution is 1:1:2-7. Specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells in the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is added to the lysate in the above ratio to neutralize the alkaline lysis product to obtain a lysate, and the lysate is clarified to collect the supernatant, i.e., a crude material solution containing the plasmid, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2 M; Step 3) Purifying the plasmid DNA: The crude plasmid-containing solution is loaded onto a hydrophobic chromatography column, and then subjected to hydrophobic chromatography using a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain a hydrophobic chromatography product, wherein the mobile phase is one or more than one. Step 4) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, loading the diluted hydrophobic chromatography product onto an ion exchange chromatography column, and then performing ion exchange chromatography with a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA, wherein the mobile phase is one or more types; Step 5) activating the plasmid DNA: precipitating the purified plasmid DNA with a monohydric alcohol and / or a polyhydric alcohol, and / or concentrating the plasmid DNA by freeze-drying or ultrafiltration and then precipitating the purified plasmid DNA with a monohydric or polyhydric alcohol to obtain a plasmid DNA with high biological activity; and Step 6): Storing the plasmid DNA: storing the plasmid DNA with high biological activity in monohydric alcohol and / or polyhydric alcohol.

7. The preparation method according to claim 3 or 4 or the storage method according to claim 5 or 6, characterized in that: The monohydric alcohol is ethanol or isopropanol; the polyhydric alcohol is polyethylene glycol.

8. The preparation method or storage method according to any one of claims 3 to 7, characterized in that: Storage temperature is -18 to -24°C.

9. The preparation method or storage method according to any one of claims 3 to 8, characterized in that: The third solution is a solution containing 2.1-4.0 M ammonium sulfate. Preferably, the third solution is a solution containing 4.0 M ammonium sulfate.

10. The preparation method or storage method according to any one of claims 3 to 9, characterized in that: In step 3), it specifically includes: (1) Column equilibration: equilibrate the hydrophobic chromatography column with the first mobile phase for 2 or more column volumes, preferably 3 column volumes; (2) Loading: Pass the crude material containing the plasmid through a hydrophobic chromatography column; (3) Elution: Use the second mobile phase to elute the hydrophobic chromatography column until all indicators are stable; (5) Elution: Use the third mobile phase for elution, and collect the eluted product to obtain a hydrophobic chromatography product.

11. The preparation method or storage method according to any one of claims 3 to 10, characterized in that: The first mobile phase is a mixed solution containing 2.0-2.1 M ammonium sulfate, preferably, a mixed solution containing 2.1 M ammonium sulfate; The second mobile phase is a mixed solution containing 1.90-2.05M ammonium sulfate, preferably, a mixed solution containing 1.95-2.00M ammonium sulfate; The third mobile phase is a mixed solution containing 1.45M-1.8M ammonium sulfate, preferably, a mixed solution containing 1.50-1.8M ammonium sulfate.

12. The preparation method or storage method according to any one of claims 3 to 11, characterized in that: In step 4, specifically include: (1) Column equilibration: equilibrate the ion exchange chromatography column with the fourth mobile phase for 2 or more column volumes, preferably 3 column volumes; (2) loading: mixing the hydrophobic chromatography product with the fourth mobile phase at a volume ratio of 1:1-3 to dilute the hydrophobic chromatography product, and then passing the diluted hydrophobic chromatography product through an ion exchange chromatography column; (3) Eluent: Use the fifth mobile phase to elute the ion exchange chromatography column by the column volume until all indicators are stable; (4) Elution: Use the sixth mobile phase for elution and collect the eluted product to obtain purified plasmid DNA Wherein, the ion exchange chromatography column is an anion exchange chromatography column, and preferably, the ion exchange chromatography column is a strong anion exchange chromatography column.

13. The preparation method or storage method according to any one of claims 3 to 12, characterized in that: The conductivity of the diluted hydrophobic chromatography product is below 100 mS / cm.

14. The preparation method or storage method according to any one of claims 3 to 13, characterized in that: The fourth mobile phase is a low conductivity solution of 40 mS / cm or less, preferably water and / or a mixture containing 0-50 mM ethylenediaminetetraacetic acid; The fifth mobile phase is a medium conductivity solution between 40-60 mS / cm, preferably a mixed solution containing 0.4-0.50 M sodium chloride; The sixth mobile phase is a high conductivity solution of 60 mS / cm or higher, preferably a mixed solution containing 0.5 M to 1 M sodium chloride.

15. A vaccine obtained by using the highly biologically active plasmid DNA according to claim 1 or 2 or the highly biologically active plasmid DNA obtained by the preparation method according to any one of claims 3 to 14.

16. The vaccine according to claim 15, characterized in that The vaccine is an injectable vaccine. Preferably, the injectable vaccine is obtained by mixing the highly biologically active plasmid DNA described in claim 1 or 2 or the highly biologically active plasmid DNA obtained by the preparation method described in any one of claims 3 to 14 with a buffer.

17. A kit comprising a reagent or vaccine prepared by the plasmid DNA with high biological activity according to claim 1 or 2 or by the method for preparing the plasmid DNA with high biological activity according to any one of claims 3 to 14.

18. Use of the highly biologically active plasmid DNA according to claim 1 or 2, or the highly biologically active plasmid DNA prepared by the preparation method according to any one of claims 3 to 14, in vaccine preparation or gene therapy.

Images