Conjugate for targeted delivery of an antisense oligonucleotide
Carbohydrate ligand-ASO conjugates, specifically designed for 3' terminus attachment, address the challenge of delivering ASOs for site-directed A-to-I editing, improving interaction with ADAR enzymes and enhancing RNA editing precision and efficiency.
Patent Information
- Application Number
- PCT/EP2025/053748
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-26
- Filing Date
- 2025-02-12
- Publication Date
- 2025-08-21
AI Technical Summary
There is a need to enhance the targeted delivery of antisense oligonucleotides (ASOs) for site-directed A-to-I editing to the target RNA inside a cell, as existing delivery methods are limited by the type of cell and conditions required, and different considerations are needed for effective interaction with ADAR enzymes.
Development of carbohydrate ligand-ASO conjugates that specifically deliver ASOs for site-directed A-to-I editing by conjugating the oligonucleotide to a carbohydrate ligand via its 3' terminus, with a linker of 4 to 22 atoms, to enhance interaction with ADAR enzymes and achieve precise RNA editing.
The conjugates effectively deliver ASOs for site-directed A-to-I editing, enhancing the interaction with ADAR enzymes and improving the precision and efficiency of RNA editing within cells.
Smart Images

Figure EP2025053748_21082025_PF_FP_ABST
Abstract
Description
[0001] CONJUGATE FOR TARGETED DELIVERY OF AN ANTISENSE OLIGONUCLEOTIDE FIELD OF THE INVENTION The present invention relates to the field of site-directed RNA editing, whereby an RNA sequence is targeted by an antisense oligonucleotide (ASO) for RNA editing of a genetic mutation (“compensatory editing”) or for editing of an RNA derived from a wildtype allele (“beneficial editing”). The present invention provides a carbohydrate ligand-ASO conjugate for targeted delivery of the ASO to a cell for site-directed RNA editing of a target RNA sequence therein. BACKGROUND RNA editing is a natural process through which some cells can make discrete changes to specific nucleotide sequences within an RNA molecule in a site-specific way. Unlike DNA editing, the advantage of site-directed RNA editing is that it allows modification of the genetic information in a more precise and efficient manner. Contrary to DNA, RNA is generally quickly degraded, and any errors introduced by off-target modifications will be washed out rather than permanently introduced into the modified DNA of a subject. RNA editing may also be less likely to cause an immune reaction since it is an editing mechanism naturally found in humans. Moreover, RNA editing might provide a more natural response than introducing an external, engineered gene. Over the years, oligonucleotide therapeutics have been developed to silence, restore or modify the expression of disease-causing or disease-associated genes in, e.g., cancer and (other) genetic disorders. Such therapeutics include, e.g., antisense oligonucleotides (ASOs), small interfering RNA (siRNA) and microRNA (miRNA) that interfere with coding and noncoding RNAs in a sequence specific manner. The relative ease and accuracy with which ASOs can be customized allows virtually any gene to be targeted. As a result, ASOs are the most clinically developed, with several drugs already approved by the U.S. Food and Drug Administration (FDA) and in clinical trials (Cideciyan et al., 2019;1Gagliardi and Ashizawa, 20212). Site-Directed RNA Editing (SDRE) describes the alteration of an RNA sequence by introducing or removing nucleotides from an RNA or by changing the character of a nucleobase by deamination. RNA are known in the art. The first RNA editing process discovered in mammals was the deamination of cytidine (C) by APOBEC proteins to form uridine (U) (Zinshteyn and Nishikura, 2009)3. To date, the two most useful and most studied types of RNA editing are cytidine (C) to uridine (U) (“C-to-U”) and adenosine (A) to inosine (I) (“A-to-I”) conversions. Notably, for therapeutic purposes in higher eukaryotes the most prevalent type of RNA editing is the “A-to-I” conversion, which is catalysed by the adenosine deaminases acting on RNA (ADARs) family. Over the years, three vertebrate ADAR genes have been identified, which give rise to several ADAR proteins through alternative promoters or splicing (Wulff and Nishikura, 2010)4. ADAR proteins are expressed across various types of human tissues and can alter, inter alia, splicing and translation machineries, double-stranded RNA (dsRNA) structures as well as the binding affinity between RNA and RNA-binding proteins (Tomaselli et al., 20145; Zinshteyn and Nishikura, 20093). Of the three known ADAR genes, hADAR1 and hADAR2 are expressed in most tissues and encode active deaminases. Human ADAR3 (hADAR3) has been described to only be expressed in the central nervous system and reportedly has no deaminase activity in vitro. While all ADARs are multidomain proteins, comprising a targeting or dsRNA-binding domain (dsRBD) and a catalytic domain, ADAR1 proteins additionally comprise one or more Z binding domains, while splice variant ADAR2R and ADAR3 comprises an R domain (Zinshteyn and Nishikura, 20093; Wulff and Nishikura, 20104). Accordingly, the ADAR may be hADAR1, hADAR2 or hADAR3, or any variant thereof. The ability of ADARs to alter the sequence of RNAs has also been used to artificially target RNAs in vitro in cells for RNA editing. “A-to-I” editing was initially identified in Xenopus eggs (Bass and Weintraub, 19876; Rebagliati and Melton, 19877). Human cDNA encoding “double stranded RNA adenosine deaminase” was first cloned by Kim et al. (1994) and “A-to-I” conversion activity of the protein confirmed by recombinant expression in insect cells. Specifically, “A-to-I” editing changes the informational content of the RNA molecule, as inosine preferentially basepairs with cytidine and is therefore interpreted as guanosine (G) by the translational and splicing machinery. Therefore, ADARs have the effect of introducing a functional adenosine to guanosine mutation on the RNA level. Potentially, this approach may used to repair genetic defects and alter genetic information at the RNA level. ASOs are generally short (approx.18 to 45 nucleobases in length), typically single- stranded synthetic RNA or DNA molecules, which use Watson-Crick base pairing to bind sequence specifically to the target RNA. They can be broadly classified into 1st(Gen 1), 2nd(Gen 2), and 3rd(Gen 3) generation ASOs. Notably, ASO sequence and design are the primary drivers that determine the pharmacological and toxicological properties of the oligonucleotide. Gen 1 ASOs were initially employed to inhibit translation of Rous sarcoma virus ribosomal RNA (Stephenson and Zamecnik, 1978)8. They are characterised in having a modified backbone, wherein the nucleotide linkages are modified by sulphur, methyl or amine groups to generate phosphorothioates (PS), methyl-phosphonates, and phosphoramidates, respectively. Hence, ASOs can be chemically modified to improve their properties. For instance, ASOs can be modified to protect them against nucleases and to increase their effectiveness. Gen 2 ASOs show increased nuclease stability and affinity for their RNA targets, which has translated to improved potency and therapeutic index in the clinic. Gen 2 ASOs are typically modified using PS backbone modification and additionally carry alkyl modifications at the 2’ position of the ribose. Such 2’-sugar modifications may include 2’-O-methyl (2’-OMe), 2’-fluoro (2’-F), 2’-O-methoxyethyl (2’-MOE) modifications. Hence, these Gen 2 ASOs tend to be less toxic than PS-modified ASOs and have a slightly higher affinity for their target. In comparison, Gen 3 ASOs tend to be even more heterogenous as they include a large number of chemical modifications that aim to further improve binding-affinity, stability, and pharmacokinetics (Quemener et al., 2019)9. Hence, the diversity of chemical modifications, together with the sequence of the ASO, offers considerable flexibility as relates to the therapeutic approach. That is, depending on their mechanism of action, ASOs can be used to degrade target mRNA, decrease protein levels, modify or correct splicing events, modulate RNA translation or target pathological coding or non-coding RNAs (Quemener et al., 2019)9. ASOs can work through many mechanisms depending, in part, on the region in the RNA sequence that is targeted and ASO design / chemical properties. To ensure specificity, their sequences are generally complementary or at least partially complementary to the target RNA. However, in the case of site-directed mutagenesis, i.e., “A-to-I” RNA editing, the ASO targeting domain typically contains a mismatch opposite the targeted adenosine. It is to be noted that several endogenous substrates of ADAR contain mismatches and / or bulges (Thomas and Beal, 2017)10and therefore could alter or even improve substrate recognition, if these features are mimicked in the ASO / resulting dsRNA. Furthermore, ASOs can be chemically modified to improve their properties. For instance, ASOs can be modified to protect them against nucleases and to increase their effectiveness. While phosphorothioate (PS) modifications seem to have a positive effect on ASOs stability and pharmacokinetics, the difference in chirality of PS linkages may have a substantial influence on the ASO's overall property. PS linkages can be found in two stereoisomers, Rp and Sp, and it is known from the art, that Rp and Sp linkages can influence properties such as, e.g., thermal stability, binding affinity, pharmacologic properties, etc., of the ASO. However, the benefit of Rp and Sp stereoisomers has been controversial (Iwamoto et al., 2017; Crooke et al., 202011). The use of antisense oligonucleotides for site-directed RNA editing has previously been described (Vogel et al., 201412; Merkle et al., 201913) and ASO-based therapies have been gaining more and more traction over the past years for use in the treatment of different genetic disorders. RNA editing systems to specifically recruit endogenous adenosine deaminases have previously been described. Loop-hairpin structured oligonucleotides have previously been described (WO 2020 / 001793) and have been used successfully to harness ADARs with chemically modified oligonucleotides. New designs for nucleoside analogues are constantly being investigated. These oligonucleotides typically are very rich in 2’-F-modifications within the 5’ half, which are generally present as blocks of modifications and uniform block of 2’-O- Methyl-modifications within the 3’ terminus on either side of the CBT. Further, these oligonucleotides contain massively stereopure PS-modified backbones and additional charge-neutral PN linkages (also stereopure), the latter of which is not yet applied in the clinics. That precise, site-specific RNA editing can be achieved by recruiting endogenous ADARs with antisense oligonucleotides has previously been shown by Merkle et al. (2019)13. They were able to demonstrate that chemically optimized ASOs can be used to recruit endogenous human ADARs to edit endogenous transcripts in a simple and programmable way with almost no off-target editing. In WO 2020 / 001793, an artificial nucleic acid for site-directed “A-to-I” editing was provided, wherein the artificial nucleic acid comprised a targeting sequence and recruiting moiety. Other prior art, such as WO 2021 / 071858, relates to oligonucleotides comprising a first and second domain, wherein the first domain comprises one or more 2’-F modifications and the second domain comprises one or more sugars that do not have a 2'-F modification. WO 2022 / 099159 relates to oligonucleotides with a first and second domain, wherein the domains comprise specific percentages of 2’-F modifications and aliphatic substitutions. Research in the field of ASO optimisation for A-to-I editing has led not only to the identification of the CBT but also to a more thorough investigation of the region immediate 5’ and 3’ to the CBT. In addition to specifically looking at CBT modifications (e.g., 2’-F and 2’-FANA), WO 2021 / 243023 also mentions guide or targeting domain modifications 3’ to the nucleobase just outside the CBT (at position +2 of an oligonucleotide comprising the structure [Am]-X1-X2-X3-X4-[Bn], wherein X4corresponds to the +2 position). It was found that editing the +2 position can affect the editing rate of the target. Improved editing was observed with a 2’-F modification at the +2 position. For ASOs to be an effective therapeutic, it is also important to consider the means by which they are delivered to the active site in vivo. There is therefore a need to enhance the targeted delivery of ASOs for site directed A-to-I editing to the target RNA inside the cell. The general delivery of functionalised ASOs to cells has been investigated for ASOs carrying out other biological roles, for example, in the splicing of RNA from pre-mRNA into mRNA. Previously considered methodologies for the delivery of such ASOs to cells have included the utilisation of protein carriers, antibody carriers, direct injection, cell fusion and calcium phosphate-mediated transformation. However, many of these techniques are limited by the type of cell in which transmembrane transport is enabled, as well as the conditions needed for achieving such transport. Efficient delivery to cells in vivo requires specific targeting and protection from the extracellular environment. One methodology that has been adopted for the delivery of functionalised ASOs used in RNA inhibition (RNAi) or silencing (siRNA) involves conjugating a ligand moiety to the ASO. These carbohydrate ligand-ASO conjugates have been developed specifically in the context of delivery of functionalised ASOs used in RNA inhibition (RNAi) or silencing (siRNA). The conjugates help to deliver the functionalised ASO to the required site, for example using receptor-mediated endocytotic activity. Following binding of the ligand to a cell-surface or membrane receptor, the activated receptor facilitates the movement of the ASO into the interior of the cell via invagination of the membrane structure or fusion of the delivery system with the cell membrane. The functionalised ASO can then carry out the desired RNA inhibition (RNAi) or silencing (siRNA). Multiple receptor-mediated endocytotic systems are known. In particular, the asialoglycoprotein receptor (ASGP-R), which is highly abundant on liver cells, in particular hepatocytes, has been identified as a high-capacity receptor for certain ligands. For example, it has been found that carbohydrate ligand conjugates comprising ligands such as N-acetylgalactosamine (GalNAc) ligands, are capable of binding to ASGP-R expressed by liver cells, resulting in the delivery and uptake of the conjugate into the cell. In fact, the ASGP-R has been found to show a high affinity for GalNAc ligands conjugated to functionalised ASOs used in RNA inhibition (RNAi) or silencing (siRNA). Carbohydrate ligand-ASO conjugates have therefore been used to facilitate uptake of ASOs into cells, ASOs capable of RNA inhibition (RNAi) or silencing (siRNA). However, the carbohydrate ligand-ASO conjugates in question have been designed specifically with ASOs functionalised for RNAi or siRNA in mind, and their optimised delivery. The biological activity of site-directed A-to-I editing of a target RNA inside a cell is very different to RNA inhibition and silencing, and different considerations need to be made for conjugates delivering ASOs functionalised for site-directed A-to-I editing to both ensure and enhance this biological function. For example, the additional interaction with the ADAR enzymes required to achieve the site-directed A- to-I editing needs to be taken into consideration. There is therefore a need to focus on the development of ligand-ASO conjugates having optimal structures for the delivery of ASOs designed for the specific function of site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). SUMMARY OF THE INVENTION The present invention advantageously provides an advantageous delivery system for oligonucleotides (or antisense oligonucleotides, ASOs) designed for the specific function of site-directed A-to-I editing for in vitro and in vivo use. The problem solved by the present invention lies in the provision of a carbohydrate ligand-ASO conjugate able to effectively deliver ASOs capable of mediating a functional change from an adenosine (A) to a guanosine (G) in a target RNA. Specifically, the invention provides enhanced delivery of ASOs that provide enhanced site-directed A-to-I RNA editing. The ASOs are for use in site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). The carbohydrate ligand-ASO conjugates described herein are beneficial within the context of A-to-I editing of a target RNA within a cell. The structure of the carbohydrate ligand-ASO conjugates of the present invention is specific to the ultimate role required of them, delivery of ASOs specifically designed for site-directed A-to-I editing of a of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). According to a first aspect of the invention, there is provided a compound comprising an oligonucleotide A conjugated to a carbohydrate ligand moiety B comprising at least one carbohydrate ligand, wherein the oligonucleotide A is for site- directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the oligonucleotide A having a 3’ terminus and a 5’ terminus, and conjugated to the carbohydrate ligand moiety B via its 3’ terminus. According to a second aspect of the present invention, there is provided a compound comprising an oligonucleotide A conjugated to a carbohydrate ligand moiety B comprising at least one carbohydrate ligand via a linker comprising a linking moiety R1having a main chain length of from 4 to 22 atoms, wherein the oligonucleotide A is for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the oligonucleotide A having a 3’ terminus and a 5’ terminus, and conjugated to the carbohydrate ligand moiety B via its 3’ terminus. According to a third aspect of the present invention, there is provided a compound of formula (I): (I) wherein: X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group (-OH), and -O- ; X1is O, and X2is selected from -SH or -S-; or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3, : R1has A is an RNA oligonucleotide for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the RNA oligonucleotide having a 3’ terminus and a 5’ terminus, and linked to P of formula (I) via its 3’ terminus; and B is a carbohydrate ligand moiety comprising at least one carbohydrate ligand. According to a fourth aspect of the present invention, there is provided a compound of formula (I): wherein: X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group (-OH), and -O- ; X1is O, and X2is selected from -SH or -S-; or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3, ; R1is selected from the following ; ; ;;; ;;;; , , , m is 0 to 16, and n is 0 to 17, with the proviso that if k is 0, m is 1 to 16 and if m is 0, k is from 1 to 16, each occurrence of L is independently selected from a direct bond and C1-4alkylene, and each occurrence of Y and Z is independently selected from O, S and NRc, Rcbeing selected from hydrogen and C1-4alkyl; for formula (IIb) and (IIb’), n is 1 to 19, and each occurrence of R2and R3is independently selected from hydrogen and C1-4alkyl; for formula (IIc) and (IIc’), m is 1 to 5, n is 0 to 15, and each occurrence of Y is independently selected from O and S; for formula (IId) and (IId’), k is 1 to 4, m is 1 to 10, and n is 1 to 16; for formula (IIe) and (IIe’), m is 1 to 16, and n is 1 to 16; for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 16, n is 1 to 16, Y is selected from O, S or NRc, where Rcis selected from hydrogen and C1-4alkyl, and Z is selected from O or S; for formula (IIg) and (IIg’), m is 1 to 15 and n is 1 to 15; for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 1 to 15 and n is 1 to 15; with the proviso that R1has a main chain length of from 4 to 22 atoms; A is an RNA oligonucleotide for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the RNA oligonucleotide having a 3’ terminus and a 5’ terminus, and linked to P of formula (I) via its 3’ terminus; and B is a carbohydrate ligand moiety comprising at least one carbohydrate ligand. According to a fifth aspect of the invention, there is provided a compound comprising the following formula (VIII): (VIII) wherein B is a carbohydrate ligand moiety comprising at least one carbohydrate ligand; and R1is selected from the following: ; ; ; ; According to a sixth aspect of the present invention, there is provided a pharmaceutical composition comprising the compound according to the first to fifth aspect of the present invention, and a pharmaceutically acceptable excipient or diluent. According to a seventh aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use in site- directed A-to-I editing of a target RNA, preferably for use in site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). According to an eighth aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for therapeutic use. According to a ninth aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for therapeutic use involving editing of a target RNA, to effect loss-of-function or gain-of-function in a translated product of the target RNA, preferably involving site-directed A-to-I editing of a target RNA inside a cell with adenosine deaminase acting on RNA (ADAR). According to a tenth aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use as a medicament. According to an eleventh aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use in the treatment or prevention of a genetic disease or genetic disorder. According to a twelfth aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use in the treatment or prevention of a disease or disorder involving editing of a target RNA, to effect loss-of-function or gain-of-function in a translated product of the target RNA, preferably involving site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). According to a thirteenth aspect of the present invention, there is provided a method of treating or preventing a disease or disorder in a subject, the method comprising administering an effective amount of the compound according to the first to fifth aspect of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention. According to a fourteenth aspect of the present invention, there is provided a method of carrying out site-directed A-to-I editing of a target RNA, preferably site-directed A- to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the method comprising administering an effective amount of the compound according to the first to fifth aspect of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention. According to a fifteenth aspect of the present invention, there is provided an in vitro method for site-directed A-to-I editing of a target RNA, the method comprising a step of contacting a cell with the to the first to fifth aspect of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention. BRIEF DESCRIPTION OF DRAWINGS Figures 1 to 11 demonstrate in vitro and in vivo RNA editing % achieved by compounds where the oligonucleotide A is attached at its 3’ terminus. in vitro and in vivo RNA editing % is also provided for compounds where the oligonucleotide A is attached at its 5’ terminus. Figures 12 to 24 show the compounds as set out in Tables 2 and 3 herein. DETAILED DESCRIPTION The present inventors have advantageously identified carbohydrate ligand-ASO conjugates having structures optimised to facilitate targeted delivery of a specific ASO designed for site-directed A-to-I editing to a cell for editing of a target RNA sequence therein. This disclosure is thus directed to compounds according to the first to fifth aspects of the present invention. These compounds are carbohydrate ligand-ASO conjugates optimised to effectively deliver ASOs capable of mediating a functional change from an adenosine (A) to a guanosine (G) in a target RNA. Specifically, the invention provides enhanced delivery of ASOs that provide enhanced site-directed A- to-I RNA editing. The ASOs are for use in site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). To achieve site-directed A-to-I editing, the ASOs of the compounds according to the first to fifth aspects of the present invention must interact with specific ADAR enzymes (adenosine deaminases acting on RNA). Their delivery to cells therefore requires different considerations versus other ASOs that are not required to interact with further entities other than the intended target, for example, ASOs involved in RNA inhibition (RNAi) or silencing (siRNA). There are different mechanisms of action at play here for ASOs designed for site-directed A-to-I editing, impacting the design and structure of the delivery vehicle that efficiently transports the ASO to the required cell and enables it to effectively carry out its required function. For the compounds according to the to fourth aspects, and optionally the fifth aspect, of the present invention, the present inventors have surprisingly found that it is advantageous for the oligonucleotide A - an RNA oligonucleotide for site-directed A-to-I editing - to be conjugated to the carbohydrate ligand moiety B via its 3’ terminus. It has been found that this is advantageous over the 5’ attachment of the oligonucleotide A. The 3’ attachment of the oligonucleotide A to the carbohydrate ligand moiety B advantageously enhances the specific function of site-directed A-to-I editing carried out by the oligonucleotide A versus 5’ attachment. This is particularly surprising for the present inventors as carbohydrate ligand-ASO conjugates for the delivery of other functionalised ASOs, for example those used in RNA inhibition (RNAi) or silencing (siRNA), do not show such an advantage in respect of their particular biological function between 5’ and 3’ attachment, and in fact typically favour the 5’ attachment. Accordingly, the present inventors have surprisingly identified that, in the context of RNA oligonucleotides for the biological function of site-directed A-to-I editing, for compounds according to the first to fourth aspects, and optionally the fifth aspect, of the present invention, 3’ attachment of the oligonucleotide A is advantageous versus 5’ attachment. Additionally, for the compounds according to the second to fourth aspects of the present invention, linker R1preferably has a main chain length of from 4 to 18 atoms, such as from 4 to 13 atoms, or from 4 to 12 atoms, or from 4 to 10 atoms. For the compounds according to the fifth aspect of the present invention, R1has one of the specified structures. The present inventors consider such R1main chain length and / or structures to further enhance the specific function of site-directed A-to-I editing as seen for 3’ attachment of the oligonucleotide A. Without being bound by theory, the present inventors consider that these preferred structural features advantageously enhance the site-directed A-to-I editing of a target RNA sequence achieved by the compounds according to the first to fifth aspects of the present invention, in particular versus delivery systems typically used to provide ASOs for RNAi or siRNA technology. The specific design and structure of the compounds according to the first to fifth aspects of the present invention provide an effective delivery system for oligonucleotides (or antisense oligonucleotides, ASOs) designed for the specific function of site-directed A-to-I editing for in vitro and in vivo use. The compounds according to the first to fifth aspects of the present invention deliver the ASOs to a cell to enable the to interact with specific ADAR enzymes (adenosine deaminases acting on RNA) and carry out their intended function in the most effective manner. As used herein the term “flanking region” refers to the 5’ and / or 3’ region on the oligonucleotide that is adjacent or directly adjacent to the N0on the 5′ and / or 3’ portion of the oligonucleotide. As used herein, the term "nucleic acid" is intended to include any DNA molecules (e.g., cDNA or genomic DNA) and any RNA molecules (e.g., mRNA) and analogues of the DNA or RNA generated using nucleotide analogues. Oligonucleotides can be single-stranded (ss) or double-stranded (ds). A single-stranded oligonucleotide can have double-stranded regions (formed by portions of the single-stranded oligonucleotide). A double-stranded oligonucleotide can have single-stranded regions, for example, at regions where the two oligonucleotide chains are not complementary to each other. Each component of the DNA or RNA can be modified and categorized by modification of (1) the internucleoside linkage, (2) the deoxyribose / ribose, and / or (3) the nucleobase. The term “nucleobase” or “base” refers to biological building blocks that can form nucleosides, which, in turn, may be components of nucleotides. Naturally occurring bases are generally guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U), which are derivatives of purine or pyrimidine. Cytosine, thymine, and uracil are pyrimidine bases that are generally linked to the backbone through their 1 -nitrogen. Adenine and guanine are purine bases and generally linked to the backbone through their 9-nitrogen. It should be understood that naturally and non-naturally occurring base analogues are also included and that the term “nucleobase” also includes “modified nucleobases”. Within the context of this invention, the term "modified nucleobase" and "modified base" may be used interchangeably with the term “nucleobase”. A nucleobase may be a nucleobase, which comprises a modification. A modified nucleobase may be capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. The modified nucleobase may be capable of increasing hydrogen bonding, base pair stacking and / or stabilizing a nucleic acid complex. The modified nucleobase (e.g., Benner’s base) may be capable of mimicking the N3 protonated cytosine base. A modified nucleobase may be a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. A modified nucleobase in the context of oligonucleotides may refer to a nucleobase that is not A, T, C, G or U. Modifications include but are not limited to nonstandard nucleobases 5-methyl-2’-deoxycytidine (m5C or MeC), pseudouridine (pU), dihydrouridine, inosine (I), and 7- methylguanosine. Other modifications may include nucleobase replacement by (N) heterocycles (e.g., nebularine) or aromatic rings that stack well in the RNA duplex, such as, e.g., a Benner’s base Z (and / or analogues) or 8-oxo-adenosine (8-oxo-A). As used herein, the term “Benner’s base Z” refers to the pyrimidine analogue 6-amino- 5-nitro-3-(1′-β-D-2′-deoxyribofuranosyl)-2(1H)-pyridone (dZ). A modification may include the introduction of nucleobase analogues or simple heterocycles that boost editing. As used herein, and as commonly understood by the skilled person in the art, the expression “derivative thereof” refers to a derivative of a (modified) nucleobase, nucleoside or nucleotide. For example, a derivative may be a corresponding nucleobase, nucleoside or nucleotide that has been chemically derived from said nucleobase, nucleoside or nucleotide. For instance, a derivative of deoxycytidine may include fluoro-modified deoxycytidine, 5-methyl-2’-deoxycytidine (m5C or MeC), or ribocytidine. The term "nucleoside(s)" refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. A “nucleoside” may refer to a nucleoside unit in an oligonucleotide or a nucleic acid. The term "nucleoside(s)" encompasses all modified versions and derivatives “modified nucleobases”. The term "nucleotide(s)" as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more linkages (e.g., phosphate linkages in natural DNA and RNA). In some cases, the linkage may be a non-naturally occurring and / or modified linkage. The linkage may be an internucleoside linkage as described herein. The modified linkage may be a PS linkage. A “nucleotide” may refer to a nucleotide unit in an oligonucleotide or a nucleic acid. The term "nucleotide(s)" encompasses all modified versions and derivatives of “nucleosides” and “modified nucleobases”. The term “oligonucleotide(s)“ as used is defined as is generally understood by the skilled person as a molecule including two or more covalently linked nucleosides. They can comprise DNA and / or RNA. The oligonucleotides may have a backbone comprising deoxyribonucleotides and / or ribonucleotides. The term “internucleoside linkage” refers to a linkage between adjacent nucleosides. “Internucleoside linkage” and “linkage” may be used interchangeably. Linkages may be continuous (consecutive) or discontinuous (interrupted). As used herein, the term “discontinuous” or “interrupted” means that there are not more than, e.g., 4, 5, 6, 7 or more consecutive internucleoside linkage modifications of the same modification. The naturally occurring PO linkages may be replaced by modified internucleoside linkages. Hence, the linkage may be a non-natural internucleoside linkage. The internucleoside linkages may be charged, for example, an atom of the linkage may be protonated or deprotonated. This may be under physiological conditions, or in a solution, such as when the compound of the invention is combined with a pharmaceutically acceptable carrier or diluent. The internucleoside linkages may comprise a negatively charged ion (anion), e.g. S- or O-.This negatively charged ion may have a positively charged counter ion associated therewith, e.g. sodium Na+. A salt may be formed. As used herein the term “stereopure” or “stereorandom” refers to chemically modified oligonucleotides. Specifically, the term “stereopure” refers to oligonucleotides that are chirally pure (or “stereochemically pure”). The term “stereorandom” refers to racemic (or “stereorandom”, “non-chirally controlled”) oligonucleotides. Hence, the oligonucleotides of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more stereorandom internucleoside linkages (mixture of Rp and Sp linkage phosphorus at the internucleoside linkage, e.g., from traditional non-chirally controlled oligonucleotide synthesis). An internucleoside linkage may be a phosphorothioate (PS) linkage. An internucleoside linkage may be a stereorandom PS linkage. An internucleoside linkage may be a chirally controlled PS linkage. An internucleoside may not be chirally controlled. An internucleoside linkage may not be a chirally controlled PS linkage. As used herein the term “antisense oligonucleotide” or “ASO” refers to a strand of nucleotide analogue that hybridizes with the complementary (target) RNA in a sequence-specific manner via Crick base pairing. The ASO may be chemically modified. The terms “antisense oligonucleotide” and “oligonucleotide” may be used interchangeably. As used herein, the term “target RNA” refers to an RNA, which is subject to the editing process, and “targeted” by the respective ASOs of the invention. As used herein, the term “off-target” or “off-targeting” refers to non-specific and / or unintended genetic modification(s) of the target. Off-target editing may include unintended point mutations, deletions, insertions, inversions, and translocations. For instance, off-target editing may arise from the promiscuous reactivity of the deaminase enzymes. The term "modified sugar" refers to a moiety that can replace a naturally occurring sugar. A modified sugar may mimic the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. The naturally occurring sugar is generally the pentose deoxyribose or ribose, though it should be understood that naturally and non-naturally occurring sugar analogues are also included. For example, sugars may comprise C4 sugars, C5 sugars and / or C6 sugars. A modified sugar may be substituted. A modified sugar may be a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA (e.g., arabinose). A modified sugar may comprise a 2'-modification. Examples of useful 2’-sugar modifications include, e.g., 2’-ribose (RNA), 2’-deoxyribose (DNA), 2’-arabinose etc.. Those skilled in the art, will appreciate that various types of 2’-sugar modifications are known that can be used in accordance with the present disclosure. The 2’-sugar modification may be 2’-ribose. The 2’-sugar modification may be 2’-deoxyribose. The terms ‘modified internucleoside linkages’, ‘modified linkage’ and ‘modified phosphodiester’, and like terms as used herein, refer to a moiety that can replace a phosphodiester, typically a moiety that can replace a phosphodiester as a (internucleoside) group or linkage. The modified phosphodiester may be a phosphorothioate (PS) modification (e.g. -O-P(SH)(=O)-O-, -O-P-(O-)(=S)-O-, -O-P- (OH)(=S)-O-, or -O-P(S-)(=O)-O-), a phosphoryl guanidine (PN) modification, a methanesulfonyl (mesyl) modification (e.g. -O-P(OH)(=N-SO2-CH3)-O- or -O-P(O- )(=N-SO2-CH3)-O-), or a toluenesulfonyl (tosyl) modification (e.g. -O-P(OH)(=N-SO2- C6H4-CH3)-O- or -O-P(O-)(=N- CH3)-O-) or any other suitable (internucleoside) moiety. The term ‘methanesulfonyl (mesyl)’ may be used interchangeably with ‘mesyl phosphoramidate’ or ‘methanesulfonyl phosphoramidate’. The term ‘toluenesulfonyl’ may be used interchangeably with tosyl phosphoramidate’ and ‘toluenesulfonyl phosphoramidate’. The term “locked nucleic acid” (LNA) or “locked nucleic acids” (LNAs) are also known as bridged nucleic acid (BNA) and refers to modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. A modified sugar may be a bicyclic sugar, e.g., a sugar used in locked nucleic acid (LNA), BNA, etc.. A modified sugar may be an LNA sugar. A modified sugar may be an BNA sugar. A sugar modification may be 2’-OMe, 2'-O-methoxyethyl (2’-MOE), 2’- F, 5’-vinyl, or S-constrained ethyl (S-cEt). A 2’-modification may be a C2-stereoisomer of 2’-F-ribose. A 2'-modification may be 2’-F. A 2'-modification may be 2'-FANA. A modified sugar may be a sugar of morpholino. The oligonucleotide may comprise, e.g., an UNA (unlocked nucleic acid), a PMO (phosphorodiamidate linked morpholino) or a PNA (peptide nucleic acid). The nucleic acid analogue may be a PNA (peptide nucleic acid). The nucleic acid analogue may be PMO (phosphorodiamidate linked morpholino). The term “FANA” or “FANA-modified” refers to 2'-fluoroarabinoside modified nucleobases and / or oligonucleotides comprising such nucleobases. For example, the expression “FANA-cytidine” refers to a cytidine that comprises a 2'-fluoro-beta-D- arabinonucleic acid sugar modification. Within the context of this invention, the expression “a derivate thereof” refers to a corresponding nucleotide(s) or oligonucleotide(s) that has been chemically derived from said nucleotide or oligonucleotide(s). As used herein, the term “complementary”, “partially complementary” or “substantially complementary” refer to nucleic acid sequences, which, due to their complementary nucleotides, are capable of specific intermolecular base-pairing. The oligonucleotide may comprise a nucleic acid sequence complementary to a target sequence, e.g., SERPINA1, or any other target sequence. The ASO may be self-complementary. The ASO may be complementary to a coding or non-coding sequence. As those skilled in the art appreciate, perfect (e.g., 100%) complementarity or pairing is not required and one or more wobbles (wobble base , bulges, mismatches, etc. may be tolerated. The one or more wobbles, bulges, mismatches, etc. may be within or outside the CBT. Hence, ASOs may comprise a wobble base outside the CBT. The ASO may comprise a mismatch outside the CBT. For example, the ASOs may include a mismatch opposite the target adenosine. Hence, the complementarity of the ASOs may be 100%, except at the nucleoside opposite to a target nucleoside to be edited. Complementarity may be at least 80%, 85%, 90%, 95%. Complementarity may be 85%-99%. The ASO may comprise 1, 2, 3, 4, 5 or more mismatches when aligned with the target nucleic acid. One or more mismatches may be independently a wobble base paring. The ASOs may comprise up to 4 mismatches or wobble bases outside the CBT. The ASOs may comprise up to 3 mismatches or wobble bases outside the CBT. The term "mutation" as used herein, refers to a substitution of a residue with another residue within a sequence, e.g., a nucleic acid sequence or amino acid sequence, or to a deletion or insertion of one or more residues within a sequence, e.g., point mutation. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Notably, the invention is not limited to correcting mutations, as it may instead be useful to change a wildtype sequence into a mutated sequence using the ASOs of the invention. Various methods for making amino acid substitutions are well known in the art, and are provided by, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)16). As used herein, the term “beneficial editing” refers to the editing of a target sequence (or base) derived from a wildtype allele (not a mutated allele) in order to, e.g., modulate the function of a wildtype protein in a useful way to prevent or treat a disease. For example, beneficial editing may include sites, such as STAT1 Y701, NLRP3 Y166 and CTNNB1 T41 that are not causes for genetic diseases but rather represent wildtype protein sites. These sites may be changed (no underlying G-to-A mutation) to alter the function of the wildtype protein. The term “compensatory editing” refers to the modification of RNA nucleotides to change and correct one or more detrimental or unfavourable changes in the RNA sequence when compared to wildtype, a compensatory A-to-I change could help to functionally compensate for an otherwise non-editable mutation to ameliorate a disease phenotype. The term "adenosine deaminase(s)" or “adenosine deaminase(s) acting on RNA” [ADAR(s)], as used herein, refers to any (poly)peptide, protein or protein domain or fragment thereof capable of catalysing the hydrolytic deamination of adenosine to inosine. The term thus not only refers to full-length and wild type ADARs but also to a functional fragment or a functional variant of an ADAR. The ADAR may be an (endogenous) adenosine deaminase catalysing the deamination of adenosine to inosine or deoxy-adenosine to deoxyinosine. The ADAR may catalyse the deamination of adenine or adenosine in deoxyribonucleic acid (DNA) or in ribonucleic acid (RNA). The ADAR may be a human ADAR. The ADAR may be an endogenous ADAR. Accordingly, the ADAR may be an endogenous human ADAR1, ADAR2 or ADAR3 (hADAR1, hADAR2 or hADAR3), or any fragment or isoform(s) thereof (e.g., hADAR1 p110 and p150). The term “guide RNA” (gRNA) or “guide oligonucleotide” refers to a piece of RNA or oligonucleotide (comprising RNA and / or DNA) that functions as a guide for enzymes, with which it forms complexes. The guide RNA or guide oligonucleotide may comprise endogenous and / or exogenous sequences. Guide RNAs bind to their target in a sequence-specific manner. Guides can be used in vitro and in vivo. For example, the guide RNA or guide oligonucleotide directs the base-modifying activity / editing function (e.g., ADAR) to the target to be edited in trans. As used herein, the terms “disease” or “disorder” are used interchangeably to refer to a condition in a subject. The condition may be a disease in a subject, the severity of which may be decreased by inducing an immune response in the subject through the administration of a pharmaceutical composition. The condition typically impairs physiological function and may be associated with specific symptoms. As used herein, the term “effective amount” defines an amount that can be administered to a subject without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio, but one that is sufficient to provide the desired effect, e.g. the treatment or prophylaxis manifested by a permanent or in the subject's condition. The amount will vary from subject to subject, depending on the age and general condition of the individual, mode of administration and other factors. Thus, while it is not possible to specify an exact effective amount, those skilled in the art will be able to determine an appropriate "effective" amount in any individual case using routine experimentation and background general knowledge. A therapeutic result in this context includes eradication or lessening of symptoms, reduced pain or discomfort, prolonged survival, improved mobility and other markers of clinical improvement. A therapeutic result need not be a complete cure alone and can be used in combination with other agents. As used herein, the term “in combination” in the context of the administration of two or more therapies to a subject, refers to the use of more than one therapy (e.g., more than one prophylactic agent and / or therapeutic agent). The use of the term "in combination" does not restrict the order in which therapies are administered to a subject. For instance, one or more ASOs may be used in combination. As used herein, the terms “prevent”, “preventing” and “prevention” refer to the inhibition of the development or onset of a disease or symptoms thereof. The term may relate to the administration of the compound to a subject who is known to have an increased risk of developing a certain disorder, or disease. As used herein, the terms “treat”, “treatment”, and “treating” refer to the halting, ceasing the progression of, or (partially) reversing particular symptoms of a disease or disorder. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment. The terms “subject” or “patient” are interchangeable and relate to an animal (e.g., mammals) that may need administration of the compound of the invention in the field of human or veterinary medicine. The subject may be a human. The subject may be administered the oligonucleotide of the invention for beneficial editing. The subject may be administered the oligonucleotide of the invention for compensatory editing. As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency. The term “diluent” or “excipient” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatine, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The formulation should suit the mode of administration. As used herein, the term ‘conjugate’ refers to a compound formed by joining two or more chemical compounds or moieties together. The term ‘conjugated’ refers to two or more chemical compounds or moieties joined together, preferably covalently. In the context of the present invention, the two or more chemical compounds or moieties are preferably joined by a linker - a group linking the two or more compounds or moieties together, such as a covalently bonded linker. As used herein, the term ‘carbohydrate ligand’ refers to a substance capable of interacting with and binding to a target cell, or a biomolecule such as a protein, of a target cell, typically via a receptor inside the cell or in its surface. The carbohydrate ligand is a carbohydrate component. The term ‘carbohydrate’ may be used interchangeably with the term ‘saccharide’, and includes sugars, starch and cellulose, particularly monosaccharide sugars, for example galactose and derivatives thereof. As used herein, the term ‘cluster’ refers to a structure having a combination of two or more carbohydrate ligands included therein. Preferably, the two or more carbohydrate ligands are at termini of the structure. The term “C1-12alkyl” denotes a branched alkyl group having from 1 to 12 carbon atoms. For parts of the range C1-12alkyl all subgroups thereof are contemplated such as C1-10alkyl, C4-8alkyl, C1-3alkyl, C1-2alkyl, C2-4alkyl, C2-3alkyl and C3-4alkyl. Examples of C1-4alkyl include methyl (Me), ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl. The term “alkylene" denotes a straight or branched divalent saturated hydrocarbon chain. The term “C1-xalkylene” denotes a straight or branched divalent saturated hydrocarbon chain having from 1 to x carbon atoms. The C1-xalkylene chain may be attached to the rest of the molecule through one carbon within the chain or through any two carbons within the chain. For example, examples of C1-4alkylenes include methylene [-CH2-], 1,2-ethylene [-CH2-CH2-], 1,1-ethylene [-CH(CH3)-], 1,2-propylene [-CH2-CH(CH3)-] and 1,3-propylene [-CH2-CH2-CH2-]. When referring to a “C1-xalkylene”, all subgroups thereof are contemplated. For examples, for C1-4alkylene, subgroups C1-2alkylene, C1-3alkylene or C2-3alkylene are contemplated. “Optional” or “optionally” means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances in which it does not. The terms "heterocyclyl", and "heterocyclic ring" denote a non-aromatic, fully saturated or partially unsaturated, preferably fully saturated, monocyclic ring system having from 4 to 7 ring atoms (unless otherwise specified), especially 5 to 7, or 5 or 6 ring atoms, in which one or more of the ring atoms are other than carbon, such as nitrogen, sulphur or oxygen. The said ring system may be attached to the rest of the molecule through either a heteroatom or a carbon atom of the ring system. Examples of heterocyclic groups include but are not limited to piperidinyl, morpholinyl, homomorpholinyl, azepanyl, piperazinyl, oxo-piperazinyl, diazepinyl, tertahydropyridinyl, tetrahydropyranyl, pyrrolidinyl, tertrahydrofuranyl, and dihydropyrrolyl. Particular examples include morpholine, piperidine (e.g.1-piperidinyl, 2-piperidinyl, 3-piperidinyl and 4-piperidinyl), pyrrolidine (e.g. 1-pyrrolidinyl, 2- pyrrolidinyl and 3-pyrrolidinyl), pyrrolidone, pyran (2H-pyran or 4H-pyran), dihydrothiophene, dihydropyran, dihydrofuran, dihydrothiazole, tetrahydrofuran, tetrahydrothiophene, dioxane, tetrahydropyran (e.g. 4-tetrahydro pyranyl), imidazoline, imidazolidinone, oxazoline, thiazoline, 2-pyrazoline, pyrazolidine, piperazine, and N-alkyl piperazines as N-methyl piperazine. Further examples include thiomorpholine and its S-oxide and S,S-dioxide (particularly thiomorpholine). Additional examples include azetidine, piperidone, piperazone, and N-alkyl piperidines such as N-methyl piperidine. The terms “heteroaryl” and “heteroaromatic ring” denote a monocyclic heteroaromatic ring comprising 5 to 6 ring atoms in which one or more of the ring atoms are other than carbon, such as nitrogen, sulphur or oxygen. Typically, the heteroaryl ring will contain up to 4 heteroatoms, more typically up to 3 heteroatoms, more usually up to 2, for example a single heteroatom. The said heteroaromatic ring may be attached to the rest of the molecule through either a heteratom or a carbon atom of the ring system. Examples of heteroaryl groups include but are not limited to furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, oxadiazolyl, imidazolyl, oxatriazoly, thiazolyl, isothiazolyl, tetrazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, triazinyl and thiadiazolyl. The heteroaryl ring may contain at least one ring nitrogen atom. The nitrogen atoms in the heteroaryl rings can be basic, as in the case of an imidazole or pyridine, or essentially non-basic as in the case of a pyrrole nitrogen. In general, the number of basic nitrogen atoms present in the heteroaryl group, including any amine group substituents of the ring, will be less than five. The terms “unsaturated” and “partially saturated” refer to rings wherein the ring structure(s) contains atoms sharing more than one valence bond i.e., the ring contains at least one multiple bond, e.g. a C=C, C≡C, or N=C bond. The term “fully saturated” refers to rings where there are no multiple bonds between ring atoms. The term “nitrogen-containing” refers to monocyclic ring system in which at least one of the ring atoms is nitrogen. The group is attached to the rest of the molecule via the nitrogen atom or through a carbon atom on the ring system. One or more of the remaining ring atoms may be other than carbon, such as nitrogen, sulphur or oxygen. Preferably, the ring system comprises only nitrogen and carbon atoms. Examples of such groups include triazines, triazoles, imidazoles, piperidine (1-piperidinyl), pyrrolidine (1-pyrrolidinyl), pyrrolidone, morpholine or piperazine. The term "heteroatom” is any atom that is not carbon or hydrogen. Suitable heteroatoms include nitrogen (N), oxygen (O), sulphur (S), and phosphorus (P). "Hydroxyl” and “hydroxy” refer to the - radical. “Thiol” refers to the -SH radical. “-S(O)2-C6H4-CH3” or “-SO2-C6H4-CH3” refers to a tosyl group. It has the following structure: O O . “Amine” or “amino” as used to the optional one or more heteroatom-containing group of the tether, and R1or R5moieties described herein, refers to a -NH- or -NRc- group forming part of the main chain of atoms of the moiety, where Rcis preferably selected from hydrogen and C1-4alkyl. In any other context, it refers to a -NH- or -NRc- group, where Rcis preferably selected from hydrogen and C1-4alkyl. “Ester” as used herein with respect to the optional one or more heteroatom-containing group of the tether, and R1or R5moieties described herein, refers to a -CO-O- group forming part of the main chain of atoms of the moiety. "Thioester” as used herein with respect to the optional one or more heteroatom- containing group of the tether, and R1or R5moieties described herein, refers to a - CO-S- group forming part of the main chain of atoms of the moiety. "Carbonate” as used herein with respect to the optional one or more heteroatom- containing group of the tether, and R1or R5moieties described herein, refers to a -O- C(O)-O- group forming part of the main chain of atoms of the moiety. “Disulfide” as used herein with respect to the optional one or more heteroatom- containing group of the tether, and R1or R5moieties described herein, refers to a -S- S- group forming part of the main chain of atoms of the moiety. "Amide” as used herein with the optional one or more heteroatom- containing group of the tether, and R1or R5moieties described herein, refers to a - CO-NH- or -NH-CO- group forming part of the main chain of atoms of the moiety. In any other context, it refers to a -CO-NH- or -NH-CO- group. "Substituent" as used herein refers to an atom or group that replaces one or more hydrogen atoms of a particular group or moiety. Suitable substituent groups may be independently selected from among: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, - NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S-C1-4alkyl, and halogen. The term “C1-4alkoxy” refers to a straight or branched C1-4alkyl group which is attached to the remainder of the molecule through an oxygen atom. For parts of the range C1-4alkoxy, all subgroups thereof are contemplated such as C1-3-lkoxy, C1-2alkoxy, C2-4alkoxy, C2-3alkoxy and C3-4alkoxy. Examples of said C1-4alkoxy include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy and tert-butoxy. “Halogen” refers to fluorine, chlorine, bromine or iodine. The term “optional” as used herein means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances in which it does not. It will be appreciated that a chemical group(s) or moiety is attached to the rest of the compound by the atom or group listed first. In some instances, the feature "-" also denotes the attachment of chemical groups or moieties to each other, or to the rest of the compound. In formulas, the feature of a wave line, ,also denotes the attachment of a chemical group(s) or moiety to each other, or to the rest of the compound. In its broadest aspect, the present invention contemplates all optical isomers of the compounds according to the first to fifth aspects of the present invention. In its broadest aspect, the present invention contemplates all optical isomers, racemic forms, enantiomers and diastereoisomers of the compounds according to the first to fifth aspects of the present invention, as described herein. Compounds may be produced in optically active, non- and racemic forms. If a chiral centre or another form of isomeric centre, such as a stereocentre, is present in a compound according to the first to fifth aspect of the present invention, all forms of such isomer or isomers, including enantiomers and diastereoisomers, are intended to be covered herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used. X1& X2For the compounds according to the second aspect of the present invention, the linker between the carbohydrate ligand moiety B and the oligonucleotide A may have the following formula (i): ; where X1is selected from2- N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group (-OH), and -O- ; X1is O, and X2is selected from -SH or -S-; or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3, . For formula (b), q is preferably 1 or 2, more preferably 1. For formula (b), each occurrence of Rais preferably the same. For formula (b), each occurrence of Rais independently preferably C1-4alkyl, more preferably C1-2alkyl and most preferably methyl. Preferably, X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. More preferably, X1is selected from O and S, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. More preferably, X1is O, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. Optionally, X1may be O and X2may be a hydroxyl group. For formula (i), the wavy line on the left-hand side denotes the attachment of R1to carbohydrate ligand moiety B, and the wavy line on the right-hand side denotes the attachment of P to the oligonucleotide A. For the compounds according to the third and fourth aspects of the present invention, X1is preferably selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-, or X1is O, and X2is selected from -SH or -S- . More preferably, X1is selected from O and S, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. More preferably, X1is O, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. Optionally, X1may be O and X2may be a hydroxyl group. For the compounds according to the fifth aspect of the present invention, the compound preferably has the following formula (VIIIa): (VIIIa) where X1is selected2- and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-; X1is O, and X2is selected from -SH or S-; or or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3, . For , (b), each occurrence of Rais preferably the same. For formula (b), each occurrence of Rais independently preferably C1-4alkyl, more preferably C1-2alkyl and most preferably methyl. Preferably, for the compounds according to the fifth aspect of the present invention, X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. More preferably, X1is selected from O and S, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-. More preferably, X1is O, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S- . Optionally, X1may be O and X2may be a hydroxyl group. For compounds according to the third to fifth aspects of the present invention, for formula (I), (i), (VIII), and (VIIIa), when X2is -S- or -O-, this is a negatively charged sulphur or oxygen ion (anion). The S- or O- may be associated with any suitable positively charged counter ion . Suitable examples of positively charged counter ions include sodium (Na+) and ammonium (NH4+), preferably sodium (Na+). A salt may be formed. For the third to fifth aspects of the present invention, for formula (I), (i), (VIII), and (VIIIa), when X2is a hydroxyl group (-OH) or -SH, X2may be protonated so as to be a positively charged moiety. For compounds according to the third to fifth aspects of the present invention, for formula (I), (i), (VIII), and (VIIIa), it will be appreciated that the compound, for example X1, X2and P, may exhibit a mesomeric effect or resonance effect. This may occur under physiological conditions, or in solution, such as when the compound is combined with a pharmaceutically acceptable excipient or diluent. For compounds according to the third to fifth aspects of the present invention, for formula (I), (i), (VIII), and (VIIIa), tautomerisation may occur, for example under physiological conditions, or in solution, such as when the compound is combined with a pharmaceutically acceptable excipient or diluent. Tautomers of the drawn structures for compounds according to the third to fifth aspects of the present invention, for formula (I), (i), (VIII), and (VIIIa), are encompassed, for example with respect to X1, X2and P. It will be appreciated that when X1is O and X2is a hydroxyl group or O-, the compound according to the third to fifth aspects of the present invention may contain a phosphodiester (PO) group or linkage (e.g. -O-P-(OH)(=O)-O-, or -P-O-(O-)(=O)-O-). The oligonucleotide A may be joined to the rest of the compound via a phosphodiester (PO) group or linkage. An O heteroatom (terminal atom of R1) may form part of the phosphodiester group or linkage. Preferably, an O heteroatom (terminal atom of R1) forms part of the phosphodiester group or linkage. Preferably, R1is attached to the P of the phosphodiester group or linkage via an O heteroatom (terminal atom of R1). The O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A may form part of the phosphodiester group or linkage. Preferably, the O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A forms part of the phosphodiester group or linkage. The OH group at the 3’ position or 5’ position of the terminal nucleotide is the OH group carried at the 3’ position or 5’ position of the sugar or modified sugar of the terminal nucleotide. It will be appreciated that when X1is S X2is a hydroxyl group or O-, or when X1is O and X2is -SH or S-, the compound according to the third to fifth aspects of the present invention may contain a phosphorothioate (PS) group or linkage (e.g. -O-P- (OH)(=S)-O-, -O-P-(O-)(=S)-O-, -O-P-(SH)(=O)-O-, or -O-P-(S-)(=O)-O-). The oligonucleotide A may be joined to the rest of the compound via a phosphorothioate (PS) group or linkage. An O heteroatom (terminal atom of R1) may form part of the phosphorothioate group or linkage. Preferably, an O heteroatom (terminal atom of R1) forms part of the phosphorothioate group or linkage. Preferably, R1is attached to the P of the phosphorothioate group or linkage via an O heteroatom (terminal atom of R1). The O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A may form part of the phosphorothioate group or linkage. Preferably, the O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A forms part of the phosphorothioate group or linkage. The OH group at the 3’ position or 5’ position of the terminal nucleotide is the OH group carried at the 3’ position or 5’ position of the sugar or modified sugar of the terminal nucleotide. It will further be appreciated that when X1is N-S(O)2-CH3or N-S(O)2-C6H4-CH3and X2is a hydroxyl group or O-, the compound according to the third to fifth aspects of the present invention may contain a methanesulfonyl (mesyl) group or linkage (e.g. - O-P(OH)(=N-SO2-CH3)-O- or -O-P(O-)(=N-SO2-CH3)-O-), or a toluenesulfonyl (tosyl) group or linkage (e.g. -O-P(OH)(N=SO2-C6H4-CH3-O- or -O-P(O-)(=N-SO2-C6H4-CH3). The oligonucleotide A may be joined to the rest of the compound via a methanesulfonyl or toluenesulfonyl group or linkage. An O heteroatom (terminal atom of R1) may form part of the methanesulfonyl or toluenesulfonyl group or linkage. Preferably, an O heteroatom (terminal atom of R1) forms part of the methanesulfonyl or toluenesulfonyl group or linkage. Preferably, R1is attached to the P of the methanesulfonyl or toluenesulfonyl group or linkage via an O heteroatom (terminal atom of R1). The O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A may form part of the methanesulfonyl or toluenesulfonyl group or linkage. Preferably, the O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A forms part of the methanesulfonyl or toluenesulfonyl group or linkage. The OH group at the 3’ position or 5’ position of the terminal is the OH group carried at the 3’ position or 5’ position of the sugar or modified sugar of the terminal nucleotide. For the compounds according to the first to fifth aspects of the present invention, the oligonucleotide A may be joined to the rest of the compound via a phosphodiester (PO) or modified phosphodiester group or linkage, preferably via a phosphodiester, phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, more preferably a phosphodiester (PO) or phosphorothioate (PS) group or linkage, and more preferably a phosphorothioate (PS) group or linkage. The phosphodiester or modified phosphodiester group or linkage may be charged, for example, an atom of the group or linkage may be protonated or deprotonated. This may be under physiological conditions, or in solution, such as when the compound is combined with a pharmaceutically acceptable carrier or diluent. The phosphodiester or modified phosphodiester group or linkage may comprise a negatively charged ion (anion), e.g. S- or O-.This negatively charged ion may have a positively charged counter ion associated therewith. Suitable examples of positively charged counter ions include sodium (Na+) and ammonium (NH4+), preferably sodium (Na+). A salt may be formed. R1For the compounds according to the second to fourth aspects of the present invention, R1preferably has a main chain length of from 4 to 18 atoms, such as from 4 to 13 atoms, or from 4 to 12 atoms, or from 4 to 10 atoms. More preferably, R1has2a chain length of from 6 to 12 atoms, or 6 to 11 atoms, or from 6 to 10 atoms. More preferably, R1has a main chain length of 7 to 12 atoms, such as from 7 to 11 atoms, or from 7 to 10 atoms, or even 7 to 9 atoms. The present inventors have found that such R1chain lengths, particularly those of the preferred ranges detailed herein, mean that the compounds according to the second to fourth aspects of the present invention can advantageously enable enhanced site directed A-to-I editing to take place, in particular versus delivery systems typically used to provide ASOs for RNAi technology. This R1chain length, coupled with the 3’ attachment of the oligonucleotide A to the carbohydrate ligand moiety B in the compounds according to the second to fourth aspects of the present invention, enables enhanced sited directed A-to-I to be achieved by the oligonucleotide A. For the compounds according to the fifth aspect of the present invention, the selected R1structures, enable enhanced sited directed A-to-I editing to be achieved by the oligonucleotide A. For compounds according to the second or third aspect of the present invention, R1may be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain. The one or more heteroatom in the main chain may be selected from N, S, P and O, or combinations thereof, preferably N, S, and O, or combinations thereof. The one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably the one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, and amide groups, or combinations thereof. The at least one alkylene moiety may be C1-16alkylene, such as from C1-12alkylene, or C1-10alkylene, or C1-4alkylene, or C1-2alkylene.The at least one alkylene moiety may be substituted with one or more substituents. The one or more substituent groups may be independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S-C1-4alkyl, and halogen. Alternatively, R1 may be a linking moiety comprising at least one alkylene moiety, at least one cyclic moiety, and optionally one or more heteroatom or heteroatom- containing group in its main chain. The one or more heteroatom in the main chain may be selected from N, S, P and O, or combinations thereof, preferably N, S, and O, or combinations thereof. The one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably the one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, and amide glycol groups, or combinations thereof. The cyclic structure in the main chain may be selected from a heterocyclic heteroaromatic ring, preferably a nitrogen- containing heterocyclic or heteroaromatic ring, such as a triazole. Preferably, for compounds according to the second or third aspect of the present invention, R1is a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatoms or heteroatom-containing groups in its main chain. The one or more heteroatoms or heteroatom-containing groups in the main chain are as described above. More preferably, R1is a linking moiety comprising at least one alkylene moiety and one or more heteroatoms or heteroatom-containing groups in the main chain. More preferably, R1is a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in its main chain, wherein the one or more heteroatom is selected from N, S, O or P, or combinations thereof, and the one or more heteroatom-containing group is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof groups, or combinations thereof, and optionally the at least one alkylene moiety is substituted with one or more substituents independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2- OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S-C1-4alkyl, and halogen, preferably selected from hydroxyl and -C1-4alkyl- hydroxyl. More preferably, R1is a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in its main chain, wherein the one or more heteroatom is selected from O, N, and S, or combinations thereof, and the one or more heteroatom-containing group is selected from amine, ester, thioester, carbonate, disulfide, and amide groups, or combinations thereof, and optionally the at least one alkylene moiety is substituted with one or more substituents independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S- C1-4alkyl, and halogen, preferably selected from hydroxyl and -C1-4alkyl-hydroxyl. For the compounds according to the second to fifth aspects of the present invention, R1may be attached to the oligonucleotide A via a phosphodiester or modified phosphodiester group or linkage. phosphodiester groups or linkages include phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) groups or linkages. Preferably, R1may be attached to the oligonucleotide A via a phosphodiester or modified phosphodiester group or linkage, such as a phosphodiester or phosphorothioate group or linkage. R1may be attached to the phosphodiester group or linkage, or modified phosphodiester group or linkage, via an O heteroatom (terminal atom of R1). The O heteroatom (terminal atom of R1) may form part of the phosphodiester group or linkage, or modified phosphodiester group or linkage. R1may be attached to the P of the phosphodiester group or linkage, or modified phosphodiester group or linkage, via an O heteroatom (terminal atom of R1). Preferably, the O heteroatom (terminal atom of R1) forms part of the phosphodiester group or linkage, or modified phosphodiester group or linkage. Preferably, R1is attached to the P of the phosphodiester group or linkage, or modified phosphodiester group or linkage, via an O heteroatom (terminal atom of R1). The O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A may form part of the phosphodiester or modified phosphodiester group or linkage, such as the phosphodiester or phosphorothioate group or linkage. Preferably, the O atom of the OH group at the 3’ position or 5’ position of the terminal nucleotide of the oligonucleotide A forms part of the phosphodiester or modified phosphodiester group or linkage, such as the phosphodiester or phosphorothioate group or linkage. The phosphodiester or modified phosphodiester group or linkage may be charged, for example, an atom of the group or linkage may be protonated or deprotonated. This may be under physiological conditions, or in solution, such as when the compound is combined with a pharmaceutically acceptable carrier or diluent. The phosphodiester or modified phosphodiester group or linkage may comprise a negatively charged ion (anion), e.g. S- or O-.This negatively charged ion may have a positively charged counter ion associated therewith. Suitable examples of positively charged counter ions include sodium (Na+) and ammonium (NH4+), preferably sodium (Na+). A salt may be formed. For compounds according to the second or third aspects of the present invention, R1 may be attached to the carbohydrate ligand moiety B via an amide group therein (terminal group of R1). By ‘main chain length’ as used with reference to R1for the compounds according to the second aspect of the present invention, is meant the number of atoms that make up the main chain of R1. The main chain of R1can be considered as the ‘backbone’ of R1(similar to the ‘backbone’ of a polymer being the main chain of a polymer). This is a consecutive chain of atoms. The main chain of R1extends between the carbohydrate ligand moiety B, and the oligonucleotide A, or any phosphodiester or modified phosphodiester group attached thereto. For compounds according to the second aspect of the present invention, R1may include -CH2-, -NH- (amine), -CO-O- (ester), -S-S-(disulfide), and -CO-S- (thioester) moieties. However, when calculating the length of the main chain, it is only the atoms that are connected to the other atoms of the chain (on both sides other than the terminal atoms) that are counted. For example, for a -CH2- moiety, only the C atom is counted, for a -CO-O- moiety only the C atom of the carbonyl (CO) and the second O atom (separate to the carbonyl) are counted, and for an -NH- moiety, only the N atom is counted. No hydrogen atoms form part of the main chain of R1. Additionally, the main chain length does not include any atoms that are substituents, e.g. a hydroxyl substituent, of an atom of the main chain. When R1includes a cyclic structure, the main chain length of R1includes the smallest number of atoms of the cyclic structure that assure the connectivity of the main chain. For compounds according to the second aspect of the present invention, R1may be preferably selected from formula (IIa), (IIa’), (IIa’’) and (IIa’’’), (IIb), (IIb’), (IIc), (IIc’), (IId), (IId’), (IIe), (IIe’), (IIf), (IIf’), (IIf’’), (IIf’’’), (IIg), (IIg’), (IIh), (IIh’), (IIh’’) and (IIh’’’) (formula (IIa) to (IIh’’’) as defined herein for the third or fourth aspects of the present invention. For the compounds according to the third or fourth aspects of the present invention, or for the compounds according to the second aspect of the present invention, when R1is selected from formula (IIa) to (IIh’’’), the main chain length of R1is also the number of atoms that make up the main chain of R1. For the compounds according to the third or fourth aspects of the present invention, or for the compounds according to the second aspect of the present invention when R1is selected from formula (IIa) to (IIh’’’), the main chain of R1is the chain of atoms that extends between the carbohydrate ligand moiety B and the P of formula (I) as shown. The main chain of R1can be considered as the ‘backbone’ of R1(similar to the ‘backbone’ of a polymer being the main chain of a polymer). chain is calculated from the -NH- moiety or -CO- moiety on the left-hand side of the R1structures of formula (IIa) to (IIh’’’) to the -O- moiety on the right-hand side. This main chain may include -CH2-, -NH-, - NRc-, -O-, -S-, and -CO- moieties, where Rcis hydrogen or C1-4alkyl. However, when calculating the length of the main chain, it is only the atom that is connected to the other atoms of the chain that is counted. For example, for a -CH2- moiety only the C atom is counted, for a -CO- moiety only the C atom is counted, and for an -NH- moiety, only the N atom is counted. For the terminal atoms of the main chain, if it is an -NH- moiety at the left-hand side of the R1structure, only the N atom is counted, and if it is a -CO- moiety at the left-hand side of the R1structure, only the C atom is counted. No hydrogen atoms form part of the main chain of R1. Additionally, the main chain length does not include any atoms that are substituents, e.g. an alkyl substituent, of an atom of the main chain. For example, the chain length does not include atoms of -L-ZH of formula (IIa), (IIa’), (IIa’’) and (IIa’’’) or R2or R3of formula (IIb) and (IIb’). When R1includes a cyclic structure, such as for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), the main chain length includes the smallest number of atoms of the cyclic structure that assure the connectivity of the main chain either side of the cyclic structure. For example, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), the main chain includes three atoms of the triazole. For formula (IIa) to (IIh’’’) as defined herein, the wavy line on the left-hand side of the R1structure denotes its attachment to the carbohydrate ligand moiety B and the wavy line on the right-hand side of the R1structure denotes its attachment to the P of formula (I). Preferably, for compounds according to the second to fourth aspects of the present invention, formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 14, and / or k is 0 to 12, and / or l is 0 or 1, and / or m is 0 to 12, and / or n is 0 to 13, with the proviso that if k is 0, m is 1 to 12 and if m is 0, k is from 1 to 12. More preferably, j is 0 to 14, k is 0 to 12, l is 0 or 1, m is 0 to 12, and / or n is 0 to 13, with the proviso that if k is 0, m is 1 to 12 and if m is 0, k is from 1 to 12. More preferably, for compounds according to the second to fourth aspects of the present invention, j is 0 to 7 and / or k is 0 or 1 and / or l is 0 or 1 and / or m is 0 or 1 and / or n is 0 to 7, with the proviso that if k is 0, m is 1, and if m is 0, k is 1. More preferably, for formula (IIa), (IIa’), (IIa’’) (IIa’’’), j is 0 to 7, k is 0 or 1, l is 0 or 1, m is 0 or 1 and n is 0 to 7, with the proviso that if k is 0, m is 1, and if m is 0, k is 1. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 5 and / or k is 0 or 1 and / or l is 0 or 1 and / or m is 0 or 1 and / or n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1. Even more preferably, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 5, k is 0 or 1, l is 0 or 1, m is 0 or 1, and n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): J is 0, k is 0, l is 0, m is 1, and n is 3 to 7, or j is 1, k is 0, l is 0, m is 1, and n is 2 to 6, or j is 2, k is 0, l is 0, m is 1, and n is 1 to 5, or j is 3, k is 0, l is 0, m is 1, and n is 0 to 4, or j is 4, k is 0, l is 0, m is 1, and n is 1 to 3, or j is 5, k is 0, l is 0, m is 1, and n is 0 to 2, or j is 6, k is 0, l is 0, m is 1, and n is 1, or j is 7, k is 0, l is 0, m is 1, and n is 0, or j is 0, k is 1, l is 0, m is 0, and n is 3 to 7, or j is 1, k is 1, l is 0, m is 0, and n is 2 to 6, or j is 2, k is 1, l is 0, m is 0, and n is 1 to 5, or j is 3, k is 1, l is 0, m is 0, and n is 0 to 4, or j is 4, k is 1, l is 0, m is 0, and n is 1 to 3, or j is 5, k is 1, l is 0, m is 0, and n is 0 to 2, or j is 6, k is 1, l is 0, m is 0, and n is 1, or j is 0, k is 0, l is 1, m is 1, and n is 0 to 4, or j is 1, k is 0, l is 1, m is 1, and n is 0 to 3, or j is 2, k is 0, l is 1, m is 1, and n is 0 to 2, or j is 3, k is 0, l is 1, m is 1, and n is 0 or 1, or j is 4, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 0 to 4, or j is 1, k is 1, l is 1, m is 0, and n is 0 to 3, or j is 2, k is 1, l is 1, m is 0, and n is 0 to 2, or j is 3, k is 1, l is 1, m is 0, and n is 0 or j is 4, k is 1, l is 1, m is 0, and n is 0. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 0, m is 1, and n is 4, or j is 2, k is 0, l is 0, m is 1, and n is 3, or j is 3, k is 0, l is 0, m is 1, and n is 2, or j is 4, k is 0, l is 0, m is 1, and n is 1, or j is 5, k is 0, l is 0, m is 1, and n is 0, or j is 1, k is 1, l is 0, m is 0, and n is 4, or j is 2, k is 1, l is 0, m is 0, and n is 3, or j is 3, k is 1, l is 0, m is 0, and n is 2, or j is 4, k is 1, l is 0, m is 0, and n is 1, or j is 5, k is 1, l is 0, m is 0, and n is 0, or j is 0, k is 0, l is 1, m is 1, and n is 2, or j is 1, k is 0, l is 1, m is 1, and n is 1, or j is 2, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 2, or j is 1, k is 1, l is 1, m is 0, and n is 1, or j is 2, k is 1, l is 1, m is 0, and n is 0. Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 1, m is 1, and n is 1. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of L is independently selected from a direct bond and C1-2alkylene. More preferably, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of L is independently selected from a direct bond and C1alkylene. Most preferably, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of L is C1alkylene. Preferably, for compounds according second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of Y is preferably NRc, where Rcis selected from hydrogen and C1-4alkyl, and more preferably NH. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of Z is O. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 0 to 5, k is 0 or 1, l is 0 or 1, m is 0 or 1, and n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1; each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 1, k is 0, l is 0, m is 1, and n is 4, or j is 2, k is 0, l is 0, m is 1, and n is 3, or j is 3, k is 0, l is 0, m is 1, and n is 2, or j is 4, k is 0, l is 0, m is 1, and n is 1, or j is 5, k is 0, l is 0, m is 1, and n is 0, or j is 1, k is 1, l is 0, m is 0, and n is 4, or j is 2, k is 1, l is 0, m is 0, and n is 3, or j is 3, k is 1, l is 0, m is 0, and n is 2, or j is 4, k is 1, l is 0, m is 0, and n is 1, or j is 5, k is 1, l is 0, m is 0, and n is 0, or j is 0, k is 0, l is 1, m is 1, and n is 2, or j is 1, k is 0, l is 1, m is 1, and n is 1, or j is 2, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 2, or j is 1, k is 1, l is 1, m is 0, and n is 1, or j is 2, k is 1, l is 1, m is 0, and n is 0; each occurrence of L is independently from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 1, m is 1, and n is 1; each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 1, m is 1, and n is 1; each occurrence of L is C1alkylene; each occurrence of Y is NH; and each occurrence of Z is O. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: ; More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: ; ; Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: preferably . Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), the compound is of formula (IIa) and (IIa’’). Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIb) and (IIb’), n is 1 to 15, such as 3 to 12. More preferably, for formula (IIb) and (IIb’), n is 4 to 8, and even more preferably n is 6. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIb) and (IIb’), each occurrence of R2and R3is independently selected from hydrogen and C1-3alkyl. More preferably, for formula (IIb) and (IIb’), each occurrence of R2and R3is hydrogen. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIb) and (IIb’), R1is selected from: . More aspects of the present invention, for formula (IIb) and (IIb’), R1is: . Preferably, of the present invention, for formula (IIb) and (IIb’), R1is of formula (IIb). Optionally, for compounds according to the second to fourth aspects of the present invention, R1is not of formula (IIb) and (IIb’). Optionally, for compounds according to the second to fourth aspects of the present invention, R1is not selected from: . Preferably, of the present invention, for formula (IIc) and (IIc’), m is 1 to 4, and / or n is 0 to 11, preferably m is 1 to 4 and n is 0 to 11. More preferably m is 1 or 2 and / or n is 0 to 4, and more preferably, m is 1 or 2 and n is 0 to 4. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’), m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1. Even more preferably, for formula (IIc) and (IIc’), m is 1 and n is 0 to 4. Most preferably, for formula (IIc) and (IIc’), m is 1 and n is 2. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’), each occurrence of Y is O, each occurrence of Y is S, or each occurrence of Y alternates between O and S. More preferably, each occurrence of Y is O. More preferably, for compounds to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’): m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, preferably m is 1 and n is 0 to 4, and more preferably m is 1 and n is 2; and each occurrence of Y is O, each occurrence of Y is S, or each occurrence of Y alternates between O and S. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’): m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, preferably m is 1 and n is 0 to 4, and more preferably m is 1 and n is 2; and each occurrence of Y is O. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’), R1is selected from: More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’), R1is: . Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIc) and (IIc’), the compound is of formula (IIb). Preferably, for compounds according second to fourth aspects of the present invention, for formula (IId) and (IId’), k is 1 to 3, and / or m is 1 to 6, and / or n is 1 to 12, more preferably k is 1 to 3, m is 1 to 6, and n is 1 to 12: More preferably, for compound according to the second to fourth aspects of the present invention, for formula (IId) and (IId’): k is 1 and / or m is 1 to 6 and / or n is 1 to 12, or k is 2 and / or m is 1 to 3 and / or n is 1 to 9, or k is 3, and / or m is 1 and / or n is 1 to 6. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’): k is 1, m is 1 to 6, and n is 1 to 12, or k is 2, m is 1 to 3, and n is 1 to 9, or k is 3, m is 1 and n is 1 to 6 More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’), k is 1, m is 1 to 6, and n is 1 to 12. More preferably, k is 1, m is 1 or 2 and n is 1 to 5. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’): k is 1, m is 1 or 2, and n is 1 to 5, or k is 1, m is 1, and n is 1 to 5, or k is 1, m is 2, and n is 1 to 3. Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’): k is 1, m is 1 and n is 3, or k is 1, m is 2 and n is 1. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’), R1is selected from: Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’), R1is selected from: O Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IId) and (IId’), the compound is of formula (IId). Preferably, for compounds according second to fourth aspects of the present invention, for formula (IIe) and (Iie’), m is 1 to 12, and / or n is 1 to 12, more preferably m is 1 to 12 and n is 1 to 12. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIe) and (Iie’), 1 to 5 and / or n is 1 to 3. More preferably, for formula (Iie) and (Iie’), m is 1 to 5 and n is 1 to 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIe) and (IIe’): m is 1 to 5, and n is 1, or m is 1 to 4, and n is 2, or m is 1 to 3 and n is 3. Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIe) and (IIe’): m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIe) and (IIe’), R1is selected from: ; ; ; . Most aspects of the present invention, for formula (IIe) and (IIe’), R1is selected from: It will be appreciated that the disulfide of formula (IIe) and (IIe’) is a group that is cleavable through interaction with reducing agents in the human body. For example, the disulfide group can be cleaved by reduction via reducing agents such as glutathione, present in the cells of a subject. In the context of the present invention, the present inventors consider that the disulfide group is cleaved by reduction (by reducing agents such as glutathione) once it enters the cell to which the carbohydrate ligand moiety B has delivered the oligonucleotide A. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIe) and (IIe’), the compound is of formula (IIe). Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 12, and / or n is 1 to 12. More preferably, for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 12, and n is 1 to 12. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 5 and / or n is 1 to 3. More preferably, for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 5 and n is 1 to 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 1 to 5 and n is 1, or m is 1 to 4 and n is 2, or m is 1 to 3 and n is 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3. Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’), Z is O. Preferably, for compounds according second to fourth aspects of the present invention, for formula (IIf), (IIf’), (IIf’’) and (IIf’’’), Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 1 to 5 and n is 1, or m is 1 to 4 and n is 2, or m is 1 to 3 and n is 3; Z is O; and Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3; Z is O; and Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIf), (IIf’), (IIf’’), and (IIf’’’), R1is selected from: ; ; ; ; ; ; ; ; ; ; ;
[0002] Preferably, of the present invention, for formula (IIf), (IIf’), (IIf’’) and (IIf’’’), the compound is of formula (IIf) or (IIf’’). Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’), m is 1 to 11 and / or n is 1 to 11. More preferably, for formula (IIg) and (IIg’), m is 1 to 11 and n is 1 to 11. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’), m is 1 to 4 and / or n is 1 to 3. More preferably, for formula (IIg) and (IIg’), m is 1 to 4 and n is 1 to 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’): m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, or m is 1 or 2 and n is 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’): m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2. Most preferably, for compounds to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’): m is 2 and n is 1, or m is 1 and n is 2. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg), R1is selected from: Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’), R1is selected from: . Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIg) and (IIg’), the compound is of formula (IIg). Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 11 and / or n is 11. More preferably, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 11 and n is 11. More peferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 1 to 4 and / or n is 1 to 3. More preferably, for formula (IIh), (IIh’), (IIh’’), and (IIh’’’), m is 1 to 4 and n is 1 to 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’): m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, or m is 1 or 2 and n is 3. More preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’): m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2. Most preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’): m is 2 and n is 1, or m is 1 and n is 2. More preferably, for compounds to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), R1is selected from: ; ; ; ; ; aspects of the present , , , R1from: ; ; Preferably, for compounds according to the second to fourth aspects of the present invention, for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), the compound is of formula (IIh) or (IIh’’). Preferably, for compounds according to the second to fourth aspects of the present invention, R1is selected from formula (IIa), (IIa’’), (IIb), (IIc), (IId), (IIe), (IIf), (IIf’’), (IIg), (IIh), and (IIh’’). Preferably, for compounds according to the second to fourth aspects of the present invention, R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb), (IIb’), (IId) and (IId’). More preferably, R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb), and (IIb’), or R1is selected from (IIa), (IIa’) and (IIb). Most preferably, R1is selected from (IIa) and (IIb). For each of (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), j, k, l, m, n, L, Y, Z, R2and R3as appropriate may have the preferred values set out above. The present inventors have found that such selection of R1advantageously enables the compounds according to the second to fourth aspects of the present invention to provide enhanced site directed A-to-I editing, in particular versus delivery systems typically used to provide ASOs for RNAi technology. More preferably, for compounds according to the second to fourth aspects of the present invention, R1is selected from: ; ; ; ; ; ; More preferably, for compounds according to the second to fourth aspects of the present invention, R1is selected from: ; ; ; ; . More preferably, for compounds according to the second to fourth aspects of the present invention, R1is selected from: ; . More aspects of the present invention, R1is selected from: , most preferably . The present inventors have found that when R1is selected as such, this advantageously enables the compounds according to the second to fourth aspects of the present invention to provide enhanced site directed A-to-I editing, in particular versus delivery systems typically used to provide ASOs for RNAi technology. For compounds according to the second to fifth aspects of the present invention, R1is preferably attached to the oligonucleotide A via a phosphodiester or modified phosphodiester group or linkage, preferably via a phosphodiester, phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, more preferably a phosphodiester or phosphorothioate group or linkage, and more preferably a phosphorothioate (PS) group or linkage; and R1is selected from: . For invention, preferably X1is selected from O and S, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-; and R1is selected from: For compounds according to the fifth aspect of the present invention, R1 is preferably selected from: ; More to aspect present invention, R1is selected from: ; . More invention, R1is selected from: to aspect present invention, R1is not of formula (IIb) and (IIb’). Optionally, for compounds according to the fifth aspect of the present invention, R1is not selected from: . Described herein as oligonucleotide A are, inter alia, antisense oligonucleotides (ASOs). While not intending to be bound by any particular theory of operation, it is believed that nucleobase and internucleoside linkage modifications advantageously improve editing efficacy of ASOs. Since the one or more modifications can be synthetically transferred to various oligonucleotide sequences, such modifications have the potential to improve the editing efficacy of oligonucleotides with different target specificities. The ASOs can be used for several purposes associated with “A- to-I” conversions. That is, the ASOs are not just limited to correcting G-to-A mutations but are also useful in changing a wildtype sequence into a mutated sequence in order to modulate protein expression and / or function (“beneficial editing”). Thus, the oligonucleotides may be used as active agents to treat genetic disorders or genetic diseases associated with one or more G-to-A mutations or change wildtype sequences. The wildtype sequence may be modified to introduce loss-of-function or gain-of-function changes in the translation product of the RNA target. Preferably, for compounds according to the fifth aspect of the present invention comprising the formula (VIII), the compound further comprises an oligonucleotide A for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). The oligonucleotide A may be joined to the formula (VIII) via a phosphodiester (PO) group or linkage or modified phosphodiester group or linkage, such as a phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage. The phosphodiester or modified phosphodiester group or linkage may be charged, for example, an atom of the group or linkage may be protonated or deprotonated. This may be under physiological conditions, in solution, such as when the compound is combined with a pharmaceutically acceptable carrier or diluent. The phosphodiester or modified phosphodiester group or linkage may comprise a negatively charged ion (anion), e.g. S- or O-.This negatively charged ion may have a positively charged counter ion associated therewith. Suitable examples of positively charged counter ions include sodium (Na+) and ammonium (NH4+), preferably sodium (Na+). A salt may be formed. Preferably, if the compound further comprises an oligonucleotide A, the oligonucleotide has a 3’ terminus and a 5’ terminus and is linked to the compound comprising formula (VIII) via its 3’ terminus. More preferably, the compounds according to the fifth aspect of the present invention comprise the formula (VIIIa) and further comprise an oligonucleotide A for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), preferably wherein the oligonucleotide A has a 3’ terminus and a 5’ terminus and linked to the P of formula (VIIIa) via its 3’ terminus. The compounds of the fifth aspect of the present invention have the following: , preferably wherein the oligonucleotide A has a 3’ terminus and a 5’ terminus, and is linked to P via its 3’ terminus. In the context of the present invention, without being bound by theory, the present inventors consider that the required 3’ attachment of the oligonucleotide A means that the compounds according to the first to fifth aspects of the present invention advantageously enable enhanced site directed A-to-I editing to take place versus 5’ attachment, in addition to delivery systems typically used to provide ASOs for RNAi technology. It will be appreciated that, in the context of the present invention, the oligonucleotide A of the compound according to the first to fourth aspect of the present invention is attached at its 3’ terminus via the O atom at the 3’ position of the terminal nucleotide. This will be the O atom of the OH the 3’ position of the terminal nucleotide of the oligonucleotide A. The oligonucleotide A is linked to P of formula (I), (i), (VIII), and (VIIIa) of the third or fourth aspects of the present invention, via an O atom. The oligonucleotide A is linked to P of formula (I), (i), (VIII), and (VIIIa) of the third or fourth aspects of the present invention via the O atom at the 3’ position of the terminal nucleotide. It will be appreciated that, in the context of the present invention, the oligonucleotide A of the compound according to the fifth aspect of the present invention may be attached at its 3’ or 5’ terminus, preferably 3’ terminus, via the O atom at the 3’ or 5’ position of the terminal nucleotide. This will be the O atom of the OH group at the 3’ or 5’ position of the terminal nucleotide of the oligonucleotide A. The oligonucleotide A is linked to P of formula (VIIIa) of the fifth aspect of the present invention, via an O atom. The oligonucleotide A is linked to P of formula (VIIIa) of the fifth aspect of the present invention via the O atom at the 5’ position of the terminal nucleotide. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention includes an oxygen atom at the 3’ or 5’ position of the terminal nucleotide. This is of the OH group at the 3’ or 5’ position of the terminal nucleotide. The oligonucleotide A is linked to P of formula (I), (i), (VIII), and (VIIIa) via this oxygen atom. The oligonucleotide A is linked to P of the formula of Figures 12 to 24 via this oxygen atom. It will be understood that 3’ or 5’ position of the terminal nucleotide as referenced herein is of the sugar or modified sugar of the nucleotide. In the context of the present invention, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention is for use in the site- directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the ADAR being ADAR1. The compound according to the first to fifth aspects of the present invention is thus for use in the site- directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), preferably where the ADAR is ADAR1. In this context, the oligonucleotide A may comprise a sequence that is substantially or completely complementary to the to be edited, except that there will be a mismatch at the site of the edit. Typically, the edit site will be a specific A (adenosine) residue on the target RNA and the complementary residue on the oligonucleotide will be C (cytidine or deoxycytidine), i.e. there will be a mismatch. Accordingly, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention will incorporate a mismatch at the intended site of the edit. Preferably, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention is a single strange oligonucleotide. Preferably, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention is chemically modified. All combinations of modifications of individual nucleotides of the oligonucleotide A are contemplated by the present invention. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise a sequence with a length of at least 25 nucleotides (Nx) capable of binding to a target sequence in a target RNA. The oligonucleotide A may comprise a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a target adenosine in the target RNA that is to be edited. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise at least one nucleotide of the CBT modified at the 2’- position of the sugar residue or being a deoxyribonucleoside, which permits added stabilization against nuclease digestion. Hence, the CBT may be chemically modified. The CBT (3’…- N-1-N0-N+1-…5’) may carry different modifications and permutations of the various modifications. That is, positions N+1, N0and / or N-1may carry modifications at the 2’ position. Only one position within the CBT may be chemically modified, or two positions within the CBT may be chemically modified, or all positions within the CBT may be chemically modified. At least one of the three nucleotides N-1, N0and N+1of the CBT of the oligonucleotide A may be independently selected to be chemically modified at the 2’ position of its sugar residue, or its sugar residue is a deoxyribose. At least one of the three nucleotides N-1, and N+1of the CBT of the oligonucleotide A may be a deoxyribonucleotide. At least one of the three nucleotides N-1, N0and N+1of the CBT may be 2’-FANA-modified. At least one of the three nucleotides N-1, N0and N+1of the CBT may be -O-methyl-modified. At least one of the three nucleotides N-1, N0and N+1of the CBT may be 2’-F-modified. At least one of the three nucleotides N-1, N0and N+1of the CBT may be chemically modified at the 2'-position of the sugar residue, a deoxyribonucleoside, or a combination thereof. At least two of the three nucleotides N-1, N0and N+1of the CBT may be chemically modified at the 2'-position of the sugar residue, a deoxyribonucleoside, or a combination thereof. For the three nucleotides N-1, N0and N+1of the CBT of the oligonucleotide A, one or more of the following may apply: (i) the chemical modification at the 2’ position of the sugar residue of the nucleotide N+1may be 2’fluoro (2’-F), 2’fluoroarabinoside (2’FANA), 2’- OMethoxyethyl (2’-MOE) or 2’-O-Methyl (2’-OMe), or the sugar residue of N+1may be deoxyribose; and / or (ii) the chemical modification at the 2’ position of the sugar residue of the nucleotide N0 may be 2’-FANA, or the sugar residue of N0 may be deoxyribose; and / or (iii) the chemical modification at the 2’ position of the sugar residue of the nucleotide N-1may be 2’-FANA, or 2’-OMe, or the sugar residue of N-1may be deoxyribose. For the oligonucleotide A of the compound according to the first to fifth aspects of the present invention, N-1may be 2’-Ome. Each of the three nucleosides N-1, N0and N+1of the CBT may be either singularly or a combination of: (a) a deoxyribonucleotide; and / or (b) 2’-fluoroarabinoside (2’-FANA) modification; and / or (c) 2’-O-methyl (2’-OMe) modification; and / or (d) 2’-fluoro (2’-F) modification. The middle or centre nucleotide (N0) of the CBT may not comprise a 2’-sugar modification. Preferably, N0comprises no 2’modification of its sugar residue. The middle or centre nucleotide (N0) of the CBT may be selected from cytidine, deoxycytidine, uridine, and deoxy uridine. Preferably, N0is selected from cytidine and deoxycytidine. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise various amounts and combinations of 2’-sugar modifications. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise modifications at the 2’-position of the nucleotides, preferably at least one of the nucleotides N-6, N-5, N-4, N-2, N-1, N+7, N+8, N+9and N+10, and these modifications are composed of different groups. The oligonucleotide A may comprise a mixture of 2’-O-alkyl, 2’-F, 2’-MOE, 2’-FANA and / or LNA modifications at different nucleotides. The oligonucleotide A may comprise any permutation of these 2’-sugar modifications. A 2’-sugar modification may be a 2’-O-alkyl modification, such as a 2’-Ome, 2’-O-ethyl, or 2’-O-propyl modification. A 2’-sugar modification may be a 2’-MOE modification. A 2’-sugar modification may be a 2’-OR, wherein R is substituted C1-10aliphatic. A 2’- sugar modification may be 2’-F or 2’-FANA. A mixture of 2’-F- and 2’-O-alkyl-modifications may be beneficial to editing and preferably, a minimum of 10% of each is desirable. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise a mixture of 2’-F- and 2’-O-alkyl-modifications and a minimum of 15% of each 2’-F- and 2’-O-alkyl-modifications. The oligonucleotide A may comprise a mixture of 2’-F- and 2’-O-alkyl-modifications and a minimum of 20% of each 2’-F- and 2’-O-alkyl- modifications. The oligonucleotide A may comprise a mixture of 2’-F- and 2’-O-alkyl- modifications and a combined minimum of 15%-20%, 20-30%, 30%-40%, 40-50% or 40-60% of 2’-F- and 2’-O-alkyl-modifications. The oligonucleotide A of the to the first to fifth aspectz of the present invention may comprise at least 10% of 2’-F, 2’-Ome, 2’-MOE and / or 2'-FANA modifications. The oligonucleotide A may comprise at least 15%, 20%, 25%, 30%, 35%, 40% of 2’-F, 2’-Ome, 2’-MOE or 2’-FANA modifications. The oligonucleotide A may comprise at least 15%, 20%, 25%, 30%, 35%, 40% of 2’-F, 2’-Ome, 2’-MOE and 2’-FANA modifications. The oligonucleotide A according to the first to fifth aspects of the present invention may not carry a 2’-sugar modification in some of the positions. Not all nucleotides may comprise a 2’-alkyl modification. In some instances, the 2’-O-alkyl modification is not a 2'-MOE. In some instances, the 2’-modification is not a 2'-OMe, 2’-F or 2’- LNA modification. Not all 2’-sugar modifications may be 2’-O-alkyl modifications. Not all 2’-sugar modifications may be 2’-F modifications. Not all 2’-sugar modifications may be 2’-MOE modifications. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise RNA and / or DNA. All nucleotides of the oligonucleotide A of the compound according to the first to fifth aspects of the present invention may be modified at the 2’-position of the sugar residue. For these nucleotides, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 80-100%, or 90-100% may be DNA or 2’-modified. 20-100% of these nucleotides may be DNA or 2’-modified.50-100% of these nucleotides may be DNA or 2’-modified nucleotides. 100% of these nucleotides may be DNA or 2’-modified nucleotides. 30-95%, 40-95%, 40-90%, 50-95%, 50-90%, 60-95% or 60-90% of these nucleotides may be DNA or 2’-modified nucleotides. The DNA content of the oligonucleotide A may be between 0-10%. The DNA content may be between 1-9%, preferably between 1-7%. The DNA content may be between 1-6%, preferably between 1-5%. The DNA content may be between 1-4%, optionally between 1-3%. The DNA content may be less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, or 3%. In one embodiment, no more than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of nucleotides outside the CBT of the oligonucleotide A are deoxynucleotides. In some embodiment, no more 10%, optionally no more than 8%, optionally no more than 6% of nucleotides outside the CBT are deoxynucleotides. The above percentages may be satisfied with modified nucleotides and no DNA. The chemically modified oligonucleotide may comprise no DNA. In one embodiment, only 1 nucleotide outside the CBT is deoxynucleotide. In one embodiment, no more than 2 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 4 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 3 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 5 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 6 nucleotides outside the CBT are deoxynucleotides. In some embodiment, no more than 7 nucleotides outside the CBT are deoxynucleotides. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may specifically comprise 2’-F and / or 2’-OMe modifications. The RNA oligonucleotide may comprise one or more 2’-F modifications. In one embodiment, no more than 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of nucleotides are 2’-F-modified. At least 5%, 10%, 20%, 30%, 40%, 50%, or 60% of nucleotides may be 2’-F-modified. In one embodiment, no more than 35% of nucleotides are 2’-F modified. 30-60% of nucleotides may be 2’-F-modified. 20-70%, preferably 30-45%, of nucleotides may be 2’-F-modified. 35-65% of nucleotides may be 2’-F-modified. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may also comprise 2’-O-methyl (2’-OMe) modifications. The chemically modified oligonucleotides may comprise one or more 2’-OMe modifications. In one embodiment, no more than 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of nucleotides are 2’-OMe-modified. 20-60% of nucleotides may be 2’- OMe-modified.5-55%, preferably 25-55% of nucleotides may be 2’-OMe-modified. Each RNA nucleoside of the oligonucleotide A may be replaced by either a 2’-modified RNA or DNA. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention comprises internucleoside linkages. The oligonucleotide A may comprise one or more chemically modified internucleoside linkages, preferably selected from the group of phosphoryl guanidine (PN), phosphorothioate (PS), toluenesulfonyl , and methanesulfonyl (mesyl) linkages. The internucleoside linkage may be a PN linkage, optionally wherein the PN linkage is located within the 3’ and / or 5’ flanking region of the oligonucleotide A. For the oligonucleotide A, at least 5% of the internucleoside linkages may be methanesulfonyl (mesyl) linkages, optionally wherein at least 10, 20%, 30%, 40%, 50% or 60% the internucleoside linkages may be methanesulfonyl (mesyl) linkages. The oligonucleotide A may comprise a methanesulfonyl (mesyl) linkage located within a 3’ and / or 5’ flanking region(s) outside of the CBT. The oligonucleotide A may comprise 2, 3, 4, 5, 6, or 7 mesyl linkages within a 3’ and / or 5’ flanking region(s) outside of the CBT. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise one or more internucleoside linkages selected from phosphoryl guanidine (PN), phosphorothioate (PS), toluenesulfonyl (tosyl), and methanesulfonyl (mesyl) linkages. The internucleoside linkage modification may be a 3’-3’ or 5’-5’ phosphate ester bonds (3′-P-3′ and 5′-P-5′). The natural 3’-5’ phosphodiester linkage may be replaced by modified internucleoside linkages. The naturally occurring one or more PO linkages may be replaced by modified internucleoside linkages in order to introduce one or more PS linkages or non- phosphorus derived internucleoside linkages. An internucleoside linkage may be a PS linkage. An internucleoside linkage may be a stereorandom PS linkage. An internucleoside linkage may be a chirally controlled PS linkage. An internucleoside linkage may be a PN linkage. An internucleoside linkage may not be a chirally controlled PS linkage. The oligonucleotide A may comprise the following sequence: 3’ - ….N-6N-5jN-4iN-3hN-2gN-1fN0eN+1dN+2cN+3bN+4aN+5N+6N+7N+8N+9N+10…. - 5’ In this sequence, the CBT is shown. The RNA oligonucleotide of formula S is flanked at the 5'-end (adjacent to nucleotide +10) and at the 3'-end (adjacent to nucleotide - 6) with further sequences, which may have either the same length or different lengths. Internucleoside linkages are labelled a to j. The CBT is very sensitive to position- linkage modification, which is due to interference with ADAR active site binding. To obtain improved stabilization and editing, internucleoside linkages may be modified at particular positions within the sequence. Hence, linkage a may be a PS linkage. Linkages d and e may be PS linkage modifications, optionally wherein f is an internucleoside linkage modification. Linkages d and e may be PS linkage modifications. Linkage f may be a PS linkage. The positioning of additional, chemically distinct internucleoside linkages within the oligonucleotide A of the compound according to the first to fifth aspects of the present invention plays an important role when determining a balance between high editing yields, a long half-life and cytotoxicity. The inventors previously discovered (WO 2023 / 099494) that PS linkages should not be placed at positions h and i. Accordingly, in one embodiment, linkage h and i are not chemically modified. In one embodiment, linkage h is not chemically modified. In one embodiment, linkage i is not chemically modified. Linkages h and i may be phosphate (PO) linkages. In some embodiments, linkages h and i are not phosphorothioate (PS) linkages. Up to three linkages from the group consisting of linkages b, c, f, g and j may also be PS linkages. Preferably, linkages a to j are not all PS linkages. Preferably, the linkage f is a PS linkage. Preferably, linkages a, d and e are PS linkages whereas linkages h and i are PO linkages. Linkage b may be a PO or a PS linkage. Linkage b and h may be PO linkages. Also, due to cytotoxicity and non-specific protein binding, it is desirable to reduce the overall PS content of the oligonucleotide A of the compound according to the first to fifth aspects of the present invention. At least linkages a, d, and e may be PS linkages and at least 2 linkages may be phosphate (PO) linkages. Also, PS linkages should be avoided at positions h and i of the sequence. PS linkages at such positions were found to impair editing strongly. In one embodiment, linkages h and i are not PS linkages, optionally wherein h and i are PO linkages. In another embodiment, linkage f, j, g and / or c are / is a PS linkage(s). In one embodiment, linkage g is a phosphate (PO) linkage. In one embodiment, linkage g is a 3',5'-phosphodiester linkage. In one embodiment, linkage g is a PS linkage. Hence, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise the following sequence: 3’ - ….N-6N-5jN-4iN-3hN-2gN-1fN0eN+1cN+3bN+4aN+5N+6N+7N+8N+9N+10…. – 5’, wherein at least linkages d and e are modified, optionally wherein (i) a, d, and e are phosphorothioate (PS) linkages and whereby at least 2 linkages are phosphate (PO) linkages; and / or (ii) linkages h and I are not PS linkages, optionally wherein h and i are PO linkages; and / or (iii) f, j, g and / or c are / is a PS linkage; (iv) b is a PO or PS linkage. RNA oligonucleotides of different lengths may require a different mixture of particular 2’-modifications and internucleoside linkage modifications in order to provide optimal RNA editing. The shorter the RNA oligonucleotide, the better may be the endosomal escape. Moreover, cytotoxicity of the particular RNA oligonucleotide may also depend on its length. Also, shorter RNA oligonucleotides may experience higher specificity. On the other hand, while longer RNA oligonucleotides may bind stronger or faster to their respective RNA target, editing-boosting bulges, mismatches and wobbles may also work better in long RNA oligonucleotides. As a result, there is a benefit and / or trade-off for both long and short RNA oligonucleotides of the invention. Accordingly, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention may be of varying lengths. The oligonucleotide A of the compound of the first to fifth aspects of the present invention may be at least 25 nucleotides (N) long. In some instances, the RNA oligonucleotide may range from about 25-80N in length, e.g., about 25-39N, about 40-60N or about 61-80N in length. The RNA oligonucleotide may have a length of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80N. The RNA oligonucleotide may have a length of 40N, or 44 N or 45N. The RNA oligonucleotide may have a length of 30, 32, 34, 36, or 38N. The RNA oligonucleotide may have a length of 30-38N, such as a length of 30-34N or 36-38N. The RNA oligonucleotide may have a length of 34-38N or 36-38N. The RNA oligonucleotide may have a length of 25-80N, more preferably a length of 25-50N. In one embodiment, the RNA oligonucleotide has a length of no more than 30, 31, 32, 33, 34, 35, 36, 37, or 38nt. In one embodiment, the RNA oligonucleotide has a length of no more than 38, 39, 40, 41, 42, 43, 44, or 45nt. Ranges and lengths intermediate to the above recited ranges and are also contemplated to be part of the invention. The inventors found that in the oligonucleotide A of the compound according to the first to fifth aspects of the present invention, a higher 2’-F content improved editing and could compensate for shortening of the overall length of the oligonucleotide. At least 10%, 20%, 30%, 40%, 50% or 60% nucleotides may be fluoro (F)-modified at the 2’ position of the sugar residue, optionally wherein the 2’-F modification is at one or more of the following nucleotide Nxpositions: 29, 28, 25, 23, 21, 17, 15, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, -8, -10, -12, -13, -14, and -15. The 2’-F modification may be at one or more of the following nucleotide Nxpositions: 29, 28, 25, 23, 21, 17, 15, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, -8, -10, -12, -13, -14, and -15. Preferably, the 2’-F modification may be at one or more of the following nucleotide Nxpositions: 29, 28, 23, 21, 15, 9, 7, 6, 5, 3, 1, -10, -13, -14, and -15. The 2’-F modification may be at one or more of the following nucleotide Nxpositions: 28, 23, 21, 9, 1, -13 and -14. For example, about 10%-20%, 20%-30%, 30%-40%, or 50%-60% nucleotides may be F- modified at the 2’ position of the sugar residue. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may have a length of 30-40N and 4-202’-F modifications. The RNA oligonucleotide may have a length of 30-38N and 2-192’-F modifications. Preferably, the oligonucleotide A may have a length of 38N and 172’-F modifications. Preferably, the oligonucleotide A may have a length of 34N and 192’-F modifications. Preferably, the oligonucleotide A may have a length of 33N and 192’-F modifications. Uniform blocks or stretches of large 2’-sugar modifications within the oligonucleotide A tend to interfere with the binding of ADAR´s dsRNA binding proteins (dsRBDs). Hence, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention may be modified in a way to avoid such interference. For example, the oligonucleotide A may be modified such that it does not comprise continuous stretches or uniform blocks of nucleotides carrying the same chemical modification (i.e., avoidance of a block-like modification structure). Avoiding uniform blocks of more than 6 nucleotides with the same 2’-modification prevents a strong loss of editing activity with natural ADARs. Hence, the oligonucleotide A may not be uniformly modified. In one embodiment, the oligonucleotide A contains no uniform blocks and / or no block-like modification structure. In one embodiment, the oligonucleotide A does not comprise stretches or uniform blocks of nucleotides carrying the same chemical modification at the 2’ position of the sugar moiety. A “block” or “stretch” may, e.g., not comprise more than 4, 5 or 6 nucleotides with the same 2’-sugar modification. In some instances, the block or stretch may be shorter or longer. The oligonucleotide A may contain only 1 block of no more than 6, 5, 4, or 3 nucleotides with the same 2’-sugar modification. The oligonucleotide A may contain 2 blocks, separated by one or more nucleotides having a different 2’-sugar modification. Alternatively, the oligonucleotide A may comprise at least 1 block of nucleotides with the same 2’-sugar modification. The oligonucleotide A may comprise 1, 2, 3, or more blocks of nucleotides with the same 2’-sugar modification. Specifically, stretches of more than 6 nucleotides with the same 2’-modification should be avoided. Avoiding uniform blocks of more than 6 nucleotides with the same 2’- modification prevented a strong loss of editing activity with natural ADARs. Hence, the oligonucleotide A of the compound according to the first to fifth aspects of the present invention may be modified to not include uniform blocks or a continuous stretch of the same 2’-sugar modification. The oligonucleotide A may comprise one or more 2’-sugar modifications, optionally wherein no more than 6 consecutive nucleotides have the same 2’-modification. In one embodiment, no more than 5 consecutive nucleotides have the same modification. In one embodiment, no more than 4 consecutive nucleotides have the same modification. In one embodiment, no more than 3 consecutive nucleotides have the same modification. In one embodiment, no more than 2 consecutive nucleotides have the same modification. In one embodiment, less than 6, 5, 4, or 3 consecutive nucleotides have the same 2’- modification. Hence, the 2’-sugar modification may be 2’-deoxyribose (DNA). In one embodiment, no more than 6 consecutive nucleotides are 2’-H (DNA) modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-H-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-H-modified. The 2’-sugar modification may be 2’-ribose. In one embodiment, no more than 6 consecutive nucleotides are 2’-H (DNA) modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-H-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-H-modified. In one embodiment, no more than 6 consecutive nucleotides are 2’-F-modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-F-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-F-modified. In one no more than 6 consecutive nucleotides are 2’-O-alkyl-modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-O-alkyl-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-O-alkyl-modified, optionally wherein no more than 4 consecutive nucleotides are 2’-Ome-modified. The chemically modified oligonucleotide may comprise 2, 3, 4, 5, or 6 consecutive nucleotides with the same 2’-modification, e.g., 5 consecutive nucleotides are 2’-F-modified. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may contain some “continuous stretch(es)” or “uniform block(s)” of a certain length. The size or length of the “continuous stretch(es)” or “uniform block(s)” may be 2, 3, 4, 5, or 6 nucleotides long. The size or length of the “continuous stretch(es)” or “uniform block(s)” may be no more than 2, 3, 4, 5, or 6 nucleotides long. The oligonucleotide A may comprise no more than 2, 3, 4, 5, or 6 consecutive nucleotides comprising a 2’-F modification. In one embodiment, the oligonucleotide A comprises no more than 2, 3, 4, 5, or 6 consecutive nucleotides comprising a 2’-OMe modification. One or more uniform blocks may be interrupted. Interruption can take place by any other chemical modification (e.g., DNA, RNA, 2’-F, 2’-OMe, 2’-MOE, LNA, etc.). One or more uniform blocks of 2’-F-modified nucleotides may be interrupted, preferably by 2´-OMe-modified nucleotides. One or more uniform blocks of 2´-OMe-modified nucleotides may be interrupted, preferably by 2’-F-modified nucleotides. The blocks may be disrupted by DNA. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention show increased hydrophobicity, stability against degradation and an optimal chemical modification pattern to bind ADARs. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention differs from the nucleic acid oligonucleotides disclosed in the prior art insofar that they do not require a loop-hairpin structured recruiting moiety specifically for recruiting a deaminase. The oligonucleotide A according to the first to fifth aspects of the present invention may or may not comprise a loop-hairpin structure. The oligonucleotide A may not comprise a loop-hairpin structured recruiting moiety. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may not be a chirally controlled oligonucleotide. In one embodiment, an internucleoside of the oligonucleotide A is not chirally controlled. In one embodiment, an internucleoside linkage of the oligonucleotide A is not a chirally controlled PS linkage. In one embodiment, the oligonucleotide A does not comprise independently controlled chiral phosphates. In some embodiments, one or more internucleoside linkage is not independently chirally controlled. In some embodiments, at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or all internucleoside linkages are not chiral internucleoside linkages. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise a 3’ and / or 5’ flanking region comprising PS internucleoside linkages located with the 3’ and / or 5’ flanking region. The oligonucleotide A of the compound according to the first to fifth aspects of the present invention may comprise: (i) less than 60%, preferably less than 50%, or less than 40%, of the internucleoside linkages are PO linkages; and / or (ii) no more than 90%, preferably 80%, 70%, 60%, 50%, 40%, 30% or 20%, of the internucleoside linkages are PS linkages. For the oligonucleotide A of the compound according to the first to fifth aspects of the present invention, at least 10%, preferably 20%, 30%, 40%, 50% or 60%, of the nucleotides of the oligonucleotide A are fluoro (F)-modified in the 2’ position of the sugar residue (2’-F), optionally wherein the 2’-F modification is at one or more of the following nucleotides: 29, 28, 25, 23, 21, 17, 15, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, - 8, -10, -12, -13, -14, and -15. For the oligonucleotide A of the compound according to the first to fifth aspects of the present invention, at least 50%, more preferably at least 80%, of the nucleotides outside the CBT are chemically modified independently from another at the 2’ position of their sugar residue, preferably wherein the modification is selected from 2’-F, 2’- FANA, 2’-O-alkyl such as 2’-OMe, 2’-O-methoxyethyl (2’-MOE), and / or locked nucleic acid (LNA). Carbohydrate Ligand Moiety B For the compounds according to the to fifth aspects of the present invention, carbohydrate ligand moiety B comprises at least one carbohydrate ligand. The carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention may comprise a single carbohydrate ligand or may comprise two or more carbohydrate ligands. Preferably, the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, such as two or three, preferably three. When the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention comprises two or more carbohydrate ligands, this may be known as a carbohydrate ligand cluster. Such terminology is well known in the art. Preferably, each carbohydrate ligand is at a terminus of the carbohydrate ligand cluster. Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is a carbohydrate ligand cluster comprising two or more carbohydrate ligands. When the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention comprises two or more carbohydrate ligands, it may have a multi-antennary structure. By ‘antennary’ is meant a structure resembling an antenna, i.e. a long and extending appendage. The ‘multi’ of the multi-antennary refers to the fact that more than one ‘antenna’ may be present in the structure. Multi- antennary structures include diantennary and triantennary structures, having two or three ‘antennae’ respectively. Each of the ‘antenna’ typically has a carbohydrate ligand at their terminus. If the carbohydrate ligand moiety B has a multi-antennary structure, preferably each carbohydrate ligand is at a different terminus of an antenna. When the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention comprises a single carbohydrate ligand, the carbohydrate ligand moiety B may have a mono-antennary structure. It will be appreciated that such a structure resembles a single ‘antenna’. The carbohydrate ligand is typically at the terminus of the antenna. If the carbohydrate ligand moiety B has a mono-antennary structure, the carbohydrate ligand is preferably at the terminus of the antenna. Preferably, the carbohydrate ligand B of the compounds according to the first to fifth aspects of the present invention has a multi-antennary structure. Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is a multi-antennary carbohydrate ligand cluster. Each carbohydrate ligand is typically at the terminus of each ‘antenna’. Each carbohydrate ligand is thus typically a terminal carbohydrate ligand. Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention has a di-antennary or tri-antennary structure. More preferably, the carbohydrate ligand moiety B has a tri-antennary structure. Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is a diantennary or a triantennary carbohydrate ligand cluster. More preferably, the carbohydrate ligand moiety B is a triantennary carbohydrate ligand cluster. It will be appreciated that for the di-antennary structure, the carbohydrate ligand moiety B comprises two carbohydrate ligands and has a two ’antenna’ structure. The two carbohydrate ligands are preferably positioned at the terminus of each antenna, one on each of the two antennae. For the tri-antennary structure, the carbohydrate ligand moiety B comprises three carbohydrate ligands and has three ‘antenna’ structure. The three carbohydrate ligands are preferably positioned at the terminus of each antenna, one on each of the three antennae. The carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention interacts with cell receptors such as cell surface or membrane receptors, for example an asialoglycoprotein receptor (ASGP-R) on hepatocytes, to deliver the oligonucleotide A to the cell so it can carry out the desired biological activity of site-directed A-to-I editing of a target RNA inside the cell with endogenous ADAR. The carbohydrate ligand moity B can interact and / or bind with the desired cell receptor. It is the at least one carbohydrate ligand of the carbohydrate ligand moiety B that interact / binds with the receptor to achieve this. Accordingly, dependent upon the desired target cell and associated receptor, the at least one carbohydrate ligand can be selected to be compatible for interaction therewith and / or binding thereto. Preferably, for the carbohydrate ligand B of the compounds according to the first to fifth aspects of the present invention, each occurrence of the carbohydrate ligand is a cell surface or cell membrane receptor ligand, such as a cell surface receptor ligand. By this is meant a carbohydrate ligand which interacts with and / or binds to a cell surface receptor or a cell membrane receptor. For carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention, each occurrence of the carbohydrate ligand may be independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucose, fucosamine, fuculose, galactose or a derivative thereof such as D-galactose, L-galactose, D- galactosaminitol, galactosamine, α-D-galactosamine, N-formyl-galactosamine, N- acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, glucose, D-glucose, L-glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl-glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno-heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D-mannopyranose, L- mannopyranose, mannose-6-phosphate, mannosamine, α-D-mannofuranose, β-D- mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β- D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D- fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β- D-galactofuranose, sialic acid, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D- glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido- 2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N- glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tri-O-acetyl-1- thio-6-O-trityl-α-D-glucopyramoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra- O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,4-anhydro-D-allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, D-xylofuranose, L- xylofruanose, and xylulose. For the above-mentioned carbohydrate ligands, the at least one carbohydrate ligand may be attached to the rest of the carbohydrate ligand moiety B via its C1 carbon. A terminal carbohydrate ligand of any antennary structure is typically attached to the rest of the carbohydrate ligand moiety the oxygen atom at the C1 carbon. For the above-mentioned carbohydrate ligands, where the carbohydrate ligand contains a ‘sugar-ring’ (a furanose – five-membered ring system consisting of four carbon atoms and one oxygen atom), the carbohydrate ligand LGis attached to the tether via the oxygen atom of the 1’ position of the sugar-ring. Preferably, for carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention, at least one occurrence of the carbohydrate ligand is selected to be galactose or a derivative thereof. For example, at least one occurrence of the carbohydrate ligand is independently selected from galactose, D- galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso- butanoyl-galactosamine. More preferably, for carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention, at least one occurrence of the carbohydrate ligand is N-acetyl-galactosamine (GalNAc). When the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention comprises two or more carbohydrate ligands, at least two occurrences of the carbohydrate ligand are selected to be galactose or a derivative thereof. For example, at least two occurrences of the carbohydrate ligand are independently selected from galactose, D-galactosaminitol, galactosamine, N- formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. More preferably, at least two occurrences of the carbohydrate ligand are N-acetyl- galactosamine (GalNAc). Preferably, for carbohydrate ligand B of the compounds according to the first to fifth aspects of the present invention, each occurrence of the carbohydrate ligand is the same. More preferably, for carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention, each occurrence of the carbohydrate ligand is independently selected from galactose or a derivative thereof. For example, each occurrence of the carbohydrate ligand is independently selected from galactose, D-galactosaminitol, galactosamine, N- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso- butanoyl-galactosamine. Most preferably, for carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention, each occurrence of the carbohydrate ligand is N-acetyl-galactosamine (GalNAc). It is known that carbohydrate ligands selected from galactose or derivatives thereof are capable of binding to ASGP-R expressed by liver cells, resulting in the delivery and uptake of any carbohydrate ligand moiety, and RNA oligonucleotide conjugated thereto, into the cell. In fact, these asialoglycoprotein receptors have been found to show a high affinity for the carbohydrate ligand, N-acetyl-galactosamine (GalNAc). This is advantageous in the context of the present invention and the delivery of the oligonucleotide A to cells having such receptors to enable the oligonucleotide A to carry out the desired biological activity of site-directed A-to-I editing of a target RNA inside the cell with endogenous ADAR. Preferably, when the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, at least two occurrences of the carbohydrate ligand in the carbohydrate ligand moiety B are the same. More preferably, when the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, each occurrence of the carbohydrate ligand in the carbohydrate ligand moiety B is the same. Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention comprises two or more carbohydrate ligands, each carbohydrate ligand being the same and selected from galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine.. More preferably, each carbohydrate ligand is N-acetyl-galactosamine (GalNAc). More preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is a multi-antennary carbohydrate ligand cluster, preferably a biantennary or carbohydrate ligand cluster, wherein each carbohydrate ligand is the same and is selected from galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine.. More preferably, each carbohydrate ligand is N-acetyl-galactosamine (GalNAc). More preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is a multi-antennary GalNAc cluster, more preferably a biantennary or triantennary GalNAc cluster, and most preferably a triantennary GalNAc cluster. A multi-antennary cluster is advantageous as it is known that the ASGP-R cell surface receptor favourably binds such clusters. It is known that tri-antennary structures comprising galactose or derivatives thereof bind to ASGP-R with greater affinity that bi-antennary or mono-antennary structures (Baenziger and Fiete, 1980; Connolly et al., 1982). The carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention may have the following formula: (IIIa); ; ; ; (IIIe); or (IIIf); where LGis a carbohydrate ligand. For formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe), and (IIIf), for each occurrence, the carbohydrate ligand LGmay be independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L- fucitol, fucose, fucosamine, fuculose, galactose or a derivative thereof such as D- galactose, L-galactose, D-galactosaminitol, galactosamine, α-D-galactosamine, N- formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl-galactosamine, glucose, D-glucose, L-glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl-glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno- heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D-mannopyranose, L-mannopyranose, mannose-6-phosphate, mannosamine, α-D- mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α- D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D- fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α- D-galactofuranose, β-D-galactofuranose, sialic acid, 2-amino-3-O-[I-1-carboxyethyl]- 2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy- 4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D- glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl- 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyramoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,4- anhydro-D-allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D-ribose, D-4-thioribose, L-ribose, L-4- thioribose, sedoheptulose, sorbose, talose, tartaric acid, threose, xylose, D- xylofuranose, L-xylofruanose, and xylulose. Preferably, for formula (IIIb), (IIIc), (IIId), (IIIe), and (IIIf), at least one occurrence of the carbohydrate ligand LGis independently selected to be galactose or a derivative thereof. For example, at least one occurrence of the carbohydrate ligand LGis independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. More preferably, for formula (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), at least one occurrence of the carbohydrate ligand LGis N-acetyl-galactosamine (GalNAc). Preferably, for formula (IIIb), (IIIc), (IIId), (IIIe), and (IIIf) each occurrence of the carbohydrate ligand LGis the same. Preferably, for formula (IIId), (IIIe), and (IIIf), at least two occurrences of the carbohydrate ligand LGare the same. Preferably, for formula (IIId), (IIIe), and (IIIf), at least two occurrences of the carbohydrate ligand LGare independently selected to be galactose or a derivative thereof. For example, at least two occurrences of the carbohydrate ligand LGare independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. More preferably, for formula (IIId), (IIIe), and (IIIf), at least two occurrences of the carbohydrate ligand LGare N-acetyl-galactosamine (GalNAc). More preferably, for formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), each occurrence of the carbohydrate ligand LGis independently selected from galactose or a derivative thereof. For example, each occurrence of the carbohydrate ligand LGis independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. Most preferably, for formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), each occurrence of the carbohydrate ligand is N-acetyl- galactosamine (GalNAc). It will be appreciated that formula a carbohydrate ligand moiety B comprising a single carbohydrate ligand, whilst formula (IIIb) to (IIIf) represent a carbohydrate ligand moiety B comprising two, three or four carbohydrate ligands. Formula (IIIa) is mono-antennary, formula (IIIb) and (IIIc) are bi-antennary, formula (IIId) and (IIIf) are tri-antennary, and formula (IIIe) is tetra-antennary. For formula (IIIa) to (IIIf), the carbohydrate ligand LGis attached to the tether via its C1 atom, typically attached via the oxygen atom at the C1 carbon. For formula (IIIa) to (IIIf), where the carbohydrate ligand LGcontains a ‘sugar-ring’ (a furanose – five- membered ring system consisting of four carbon atoms and one oxygen atom), the carbohydrate ligand LGis attached to the tether via the oxygen atom of the 1’ position of the sugar-ring. The carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is connected to the rest of the compound of formula (I). This is via the R1group as described herein. The wavy line shown in formula (IIIa), (IIIb), (IIIc), (IIId)(IIIe), and (IIIf) denotes attachment to the rest of the compound of formula (I) (via R1). Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is selected from formula (IIIb), (IIId), (IIIe), and (IIIf). More preferably, the carbohydrate ligand moiety B is selected from (IIIb), (IIId) and (IIIf). Each tether of formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe), and (IIIf) either attaches a carbohydrate ligand LGto a branch group (formula (IIIb) to (IIIf)) that links the carbohydrate ligand moiety B to the rest of the compound of formula (I) (via R1), or attaches a carbohydrate ligand LGdirectly (formula (IIIa)) to the rest of the compound of formula (I) (via R1). For formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe), and (IIIf), for each occurrence, the tether may be independently selected to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain. The one or more heteroatom in the main chain may be selected from N, S, P and O, or combinations thereof, preferably N, S, and O, or combinations thereof. The one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably the one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, and amide groups, or combinations thereof. By ‘main chain’ with respect to the tether is the consecutive chain of atoms extending between the branch point and carbohydrate ligand LG(for formula (IIIb) to (IIIf)) and between R1and carbohydrate ligand LG(for formula (IIIa)). The main chain of the tether can be considered as a ‘backbone’ (similar to the ‘backbone’ of a polymer being the main chain of a polymer). The at least one alkylene moiety of the tether may be C1-12alkylene, such as C1-10alkylene, or C1-4alkylene, or C1-2alkylene.The at least one alkylene moiety may be substituted with one or more substituents. The one or more substituent groups may be independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S- C1-4alkyl, and halogen. Preferably, for formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain. More preferably, for formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being selected from N, S, P and O, or combinations thereof, and the one or more heteroatom- containing group in the main chain being selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof. More preferably, for formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or in the main chain being selected from N, S, P, and O, or combinations thereof, and the one or more heteroatom- containing group to be selected from disulfide, amide, phosphodiester and polyethylene glycol groups or combinations thereof. More preferably, for formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being selected from N, S, and O, or combinations thereof, and the one or more heteroatom- containing group to be selected from disulfide, amide, and polyethylene glycol groups or combinations thereof. For formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe) and (IIIf), for each occurrence, the tether may be attached to the branch group (formula (IIIb) to (IIIf)) via an alkylene group, amide group, or O heteroatom, or directly (formula (IIIa)) to the rest of the compound (I) via an alkylene group, amide group, or O heteroatom. For formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe), and (IIIf), for each occurrence, the tether may have a main chain length of from 8 to 24 atoms, such as from 10 to 22 atoms, or from 12 to 20 atoms. For formula (IIIa), (IIIb), (IIIc), (IIId), (IIIe), and (IIIf), for each occurrence, a carbon atom of the at least one alkylene moiety may be substituted with a second tether. The second tether may be the same or may be different to tether from which it is attached. For example, see formula (IIIf). For formula (IIIb), (IIIc), (IIId), (IIIe), and (IIIf), each occurrence of the tether may be different to each other, or maybe the same as each other. Preferably, for formula (IIIb), (IIIc), (IIId) and (IIIe), at least two occurrences of the tether may be the same to each other. Preferably, for formula (IIIf), at least two occurrences of the tether may be different from one another. The carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention may be selected from the following formula: ; ; ; 5 ;
[0003] ;
[0004] where LGis a for each occurrence, n is independently selected from 1 to 6, such as from 1 to 5; and for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom- containing group in its main chain. For formula (IVa) to (IVi), the wavy line shown denotes the attachment to the rest of the compound of formula (I) (via R1). For formula (IVa), (IVb), (IVc), (IVe), each occurrence of n may be independently selected from 1 to 3, preferably from 1 or 2, and more preferably 1. Preferably, for formula (IVa), (IVb), (IVc), (IVd) and (IVe), each occurrence of n is the same. For formula (IVf) to (IVi), each occurrence of n may be independently selected from 1 to 6, such as from 2 to 5. Preferably, for formula (IVf) to (IVi), each occurrence on n is the same. The carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention may be selected from the following formula: ; ; ; ;
[0005] for each occurrence, R5is independently selected to be a to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain. For formula (IVa') to (IVg'), the wavy denotes the attachment to the rest of the compound of formula (I) (via R1). For formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, the carbohydrate ligand LGmay be independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucose, fucosamine, fuculose, galactose or a derivative thereof such as D-galactose, L-galactose, D- galactosaminitol, galactosamine, α-D-galactosamine, N-formyl-galactosamine, N- acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, glucose, D-glucose, L-glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl-glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno-heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D-mannopyranose, L- mannopyranose, mannose-6-phosphate, mannosamine, α-D-mannofuranose, β-D- mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β- D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D- fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β- D-galactofuranose, sialic acid, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D- glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido- 2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N- glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tri-O-acetyl-1- thio-6-O-trityl-α-D-glucopyramoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra- O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,4-anhydro-D-allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, D-xylofuranose, L- xylofruanose, and xylulose. Preferably, for formula (IVb) to (IVi) and (IVb’) to (IVg’), at least one occurrence of the carbohydrate ligand LGis selected to be galactose or a derivative thereof. For example, at least one occurrence of the carbohydrate ligand LGis independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. More preferably, for formula IVb) to (IVg) and (IVb’) to , least one occurrence of the carbohydrate ligand LGis N-acetyl-galactosamine (GalNAc). Preferably, for formula (IVb) to (IVi) and (IVb’) to (IVg’), each occurrence of the carbohydrate ligand LGis the same. Preferably, for formula (IVd) to (IVf), and (IVh), and (IVd)’ to (IIVf’), at least two occurrences of the carbohydrate ligand LGare the same. Preferably, for formula (IVd) to (IVf), and (IVh), and (IVd’) to (IVf’), at least two occurrences of the carbohydrate ligand LGare selected to be galactose or a derivative thereof. For example, at least two occurrences of the carbohydrate ligand LGare independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. More preferably, for formula IVd) to (IVf) and (IVd’) to (IVf’), at least two occurrences of the carbohydrate ligand LGare N-acetyl-galactosamine (GalNAc). More preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), each occurrence of the carbohydrate ligand LGis independently selected from galactose or a derivative thereof. For example, each occurrence of the carbohydrate ligand LGis independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n- butanoyl-galactosamine, and N-iso-butanoyl-galactosamine. Most preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), each occurrence of the carbohydrate ligand is N-acetyl- galactosamine (GalNAc). For formula (IVa) to (IVi) and (IVa’) to (IVg’), the carbohydrate ligand LGis attached to the tether via its C1 atom, typically attached via the oxygen atom at the C1 carbon. For formula (IVa) to (IVi) and (IVa’) to (IVg’), where the carbohydrate ligand LGcontains a ‘sugar-ring’ (a furanose - five-membered ring system consisting of four carbon atoms and one oxygen atom), the carbohydrate ligand LGis attached to the tether via the oxygen atom of the 1’ position of the sugar-ring. For formula (IVa) to (IVi) and (IVa’) to (IVg’), for R5, the one or more heteroatom in the main chain may be selected from N, S, P and O, or combinations thereof, preferably N, S, and O, or combinations thereof. one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably the one or more heteroatom-containing group in the main chain may be selected from amine, ester, thioester, carbonate, disulfide, and amide groups, or combinations thereof. By ‘main chain’ with respect to R5is the consecutive chain of atoms extending between the carbohydrate ligand LGand the other atom to which R5is connected. The main chain of R5can be considered as a ‘backbone’ (similar to the ‘backbone’ of a polymer being the main chain of a polymer). The at least one alkylene moiety of R5may be C1-12alkylene, such as C1-10alkylene, or C1-4alkylene, or C1-2alkylene.The at least one alkylene moiety may be substituted with one or more substituents. The one or more substituent groups may be independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S-C1-4alkyl, and halogen. Preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain. More preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being selected from N, S, P and O, or combinations thereof, and the one or more heteroatom-containing group in the main chain being selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof. More preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being selected from N, S, P, and O, or combinations thereof, and the more heteroatom-containing group to be selected from disulfide, amide, phosphodiester and polyethylene glycol groups or combinations thereof. More preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being selected from N, S, and O, or combinations thereof, and the one or more heteroatom-containing group to be selected from disulfide, amide, and polyethylene glycol groups or combinations thereof. More preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being selected from N, and O, or combinations thereof, and the one or more heteroatom-containing group being selected from amide and polyethylene glycol groups, or combinations thereof. More preferably, for formula (IVa) to (IVg) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, the one or more heteroatom in the main chain being O, and the one or more heteroatom-containing group being a polyethylene glycol group. Preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5 comprises one or more PEG groups. PEG is polyethylene glycol, -[CH2-CH2-O]-. Preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), R5comprises 2 to 5 PEG groups, such as 2 to 4 PEG groups. Preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5has a main chain length of from 9 to 24 atoms, such as from 10 to 22 atoms, or from 12 to 20 atoms. Preferably, for formula (IVb) to (IVi) and (IVb’) to (IVg’), each occurrence of R5may be different to each other, or maybe the same as each other. More preferably, for formula (IVb) to (IVb’) to (IVg’), each occurrence of R5is the same. Preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi). More preferably, the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi). More preferably, the carbohydrate ligand moiety B is selected from formula (IVd), (IVf), and (IVh). More preferably, the carbohydrate ligand moiety B of the compounds according to the first to fifth aspects of the present invention is selected from formula (IVb’) (IVd’), (IVe’), (IVf’), and (IVg’). More preferably, the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVf’), and (IVg’). More preferably, the carbohydrate ligand moiety B is selected from formula (IVd’), and (IVf’). For formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5may be independently selected from: ; ; ;
[0006] ee eac occu e ce o s depe de y seeced o o 0, a d each occurrence of p is independently selected from 1 to 6. Preferably, where each occurrence of n is selected from 1 to 10, such as from 1 to 5, or 1 to 3. Preferably, where each occurrence of p is independently selected from 2 to 5, such as to 2 to 4, or 2 or 3. For formula (R5a) to (R5r), the wavy line shown on the left-hand side denotes the attachment to the part of formula (IVa) to (IVi) and (IVa’) to (IVg’) attached to the rest of the compound of formula (I) via R1, an d the wavy line of the right-hand side denotes attachment to a carbohydrate ligand LG. Preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected from: ;
[0007] b); More pr occurrence, R 5is selected from:
[0008] ; . , the attachment to the part of formula (IVa) to (IVi) and (IVa’) to (IVg’) attached to the rest of the compound of formula (I) (via R1), and the wavy line of the right-hand side denotes attachment to a carbohydrate ligand LG. More preferably, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is selected from: H H N N ; ; ; . carbohydrate ligand moiety B may be selected from the following formula:
[0009] ; ; ; ; where n is from 2 to 6; and LGis as for formula (IVa) to (IVi) and (IVa’) to (IVg’). For formula (Va) to Vf), the wavy line shown denotes the attachment to the rest of the compound of formula (I) (via R1). Preferably, for the compounds according to the first to fifth aspects of the present invention, the carbohydrate ligand moiety has a formula selected from (Va), (Vc), and (Ve). Preferably, formula (Vc) and (Vd) have the following stereochemistry: ;
[0010] . present invention, carbohydrate ligand moiety B is selected from: ; . For formula (VIa) to VIc), the wavy line shown denotes the attachment to the rest of the compound of formula (I) (via R1). Preferably, formula (VIc) has the following stereochemistry:
[0011] . invention, the carbohydrate ligand moiety B is selected from: (VIIa);
[0012] ; . , of the compound of formula (I) (via R1). Most preferably, for the compounds according to the first to fifth aspects of the present invention, the carbohydrate ligand moiety B is of formula (VIIc). More preferably, the formula (VIIc) has the following stereochemistry: . R1is attached to the oligonucleotide A via a phosphodiester (PO) or modified phosphodiester group or linkage, preferably via a phosphodiester, phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, and more preferably a phosphorothioate (PS) group or linkage; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb) (for each of (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), j, k, l, m, n, L, Y, Z, R2and R3as appropriate have the values and preferred values defined herein); and carbohydrate ligand moiety B is selected from formula (IVa) to (IVh), preferably the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi) more preferably, from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi) and more preferably, from formula (IVd), (IVf), and (IVh) (where R5, and LGas appropriate have the values and preferred values defined herein). Preferably, for the compounds according to the first to fourth aspects of the present invention: X1is selected from O, S, N-S(O)2- N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-, or X1is O, and X2is selected from -SH or -S-; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb) (for each of (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), j, k, l, m, n, L, Y, Z, R2and R3as appropriate have the values and preferred values defined herein); and carbohydrate ligand moiety B is selected from formula (IVa) to (IVh), preferably the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi) more preferably, from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi) and more preferably, from formula (IVd), (IVf), and (IVh) (where R5, and LGas appropriate have the values and preferred values defined herein). More preferably, for the compounds according to the first to fourth aspects of the present invention: X1is selected from O and S, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-, preferably X1is O, and X2is selected from a hydroxyl group and -O; or X1is O, and X2is selected from -SH or -S-; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb) (for each of (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), j, k, l, m, n, L, Y, Z, R2and R3as appropriate have the values and preferred values defined herein); and carbohydrate ligand moiety B is selected from formula (IVa’) to (IVg’), preferably the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVe’), (IVf’), and (IVg’), more preferably, from formula (IVb’), (IVd’), (IVf’), and (IVg’), and more preferably, from formula (IVd’) and (IVf’) (where R5, and LGas appropriate have the values and preferred values defined herein). More preferably, for the compounds according to the first to fourth aspects of the present invention: X1is selected from O and S, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-, preferably X1is O, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from: ; ; ; ; ; preferably R1is selected from: ; ; ; more ; ; ;
[0013] ;
[0014] (where x, n and LGhave the values and preferred defined herein), and preferably carbohydrate ligand moiety B is selected from (Va), (Vc) and (Ve), more preferably (Vc), and preferably formula (Vc) and (Vd) have the following stereochemistry:
[0015] ; . More preferably, for the compound according to the first to fourth aspects of the 5 present invention: X1is selected from O and S, and X2is from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-,preferably X1is O, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from: ; ; ; and preferably formula (VIc) has the stereochemistry: , (VIIa);
[0016] ; , (VIIc) has the following stereochemistry:
[0017] . invention, is selected from the following formula: ; ; ; as 5 Preferably, formula (Ia), (Ib) and (Ic) have the following stereochemistry: ; ; . More preferably, the compound according to the first to fourth aspects of the present invention is of formula (Ia) or (Ib). Preferably, the compound according to the first to fourth aspects of the present invention is selected from the following formula: ; , as Preferably, formula (Ia*), (Ib*) and (Ic*) have the following stereochemistry: ; ; . invention is of formula (Ia*) or (Ib*). Preferably, the compound according to the fifth aspect of the present invention comprises the following formula: , ;
[0018] Preferably, the formula (Ia’) to (Ia’’) to (Ic’’) have the following stereochemistry: ; ; . 5 comprises the following formula: ; ; . 5 ; ; . comprises formula (Ia’), (Ib’), (Ia’’), (Ib’’), (Ia*’’) or (Ib*’’). For formula (Ia’) to (Ic’), the wavy line shown denotes the attachment to P of formula (I). For formula (Ia’’) to (Ic’’), the wavy line shown denotes the attachment to the oligonucleotide A of formula (I). The compound according to the first to fifth aspects of the present invention may be incorporated into a pharmaceutical composition. Therefore, according to a sixth aspect of the present invention there is provided a pharmaceutical composition comprising a compound according to the first to fifth aspects of the present invention, and a pharmaceutically acceptable diluent or excipient. The pharmaceutical composition may contain one or more compound according to the first to fifth aspects of the present invention. The present invention therefore provides for a pharmaceutical composition comprising a plurality of compounds, each according to the first to fifth aspects of the present invention. As used herein, the term composition’ refers to a substance, or mixture of substances, suitable for administering to a subject. The pharmaceutical composition according to the sixth aspect of the present invention can be in any form that allows for the composition to be administered to a subject. A pharmaceutically acceptable diluent or excipient may be a sterile aqueous solution, such as a saline solution. This can be isotonic or hypotonic. The pharmaceutical composition according to the sixth aspect of the present invention may be for veterinary and / or human administration. The pharmaceutical composition may be used in conjunction with one or more other therapies. The amount of the compound according to the first to fifth aspects of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention, that will be effective in the treatment or prevention of a disease or disorder will depend on the nature of the disease or disorder and may be determined by standard clinical techniques. Exemplary doses for compounds according to the first to fifth aspect of the present invention range from about 10ng to 1g, 100ng to 100mg, 1μg to 10mg, or 30-300μg of the compound, per patient. In a pharmaceutical composition according to the sixth aspect of the present invention, the compound according to the first to fifth aspect of the present invention may be present at a concentration of 4nM to 100nM, optionally at 20nM or 25nM. Alternatively, the compound may be present at a concentration of 0.8nM, or at a concentration of 4nM. The pharmaceutical composition according to the sixth aspect of the present invention may comprise diluents, additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol), and bulking substances (e.g., lactose, mannitol). The diluents may be of various buffer content (e.g., Tris-HCI, acetate, phosphate), pH, and ionic strength. The pharmaceutical compositions according to the sixth aspect of the present invention may include stabilizers, antioxidants, and colourants, as well as pharmaceutically acceptable additives. The components of the pharmaceutical compositions are chosen such that side effects are minimized and the performance of the compound according to the first to fifth aspect of the present invention is not compromised to such an extent that treatment is ineffective. The pharmaceutical composition may comprise one or more active pharmaceutical agents (a compound according to the first to fifth aspects of the present invention) and a sterile aqueous solution. The pharmaceutical composition according to the sixth aspect of the present invention may comprise one or more salts, e.g., sodium chloride, calcium chloride, sodium phosphate, monosodium glutamate, and aluminium salts (e.g., aluminium hydroxide, aluminium phosphate, alum (potassium aluminium sulfate), or a mixture of such aluminium salts). The pharmaceutical composition according to the sixth aspect of the present invention can be included in a container, pack, or dispenser together with instructions for administration. The present invention describes the use of compounds according to the first to fifth aspects of the present invention, and pharmaceutical compositions according to the sixth aspect of the present invention, in the medical setting, specifically, for site- directed A-to-I editing of a target RNA (e.g., binding to the target RNA via the targeting sequence and by recruiting to the target site a deaminase). The present invention describes compounds according to the first to fifth aspects of the present invention, and pharmaceutical compositions according to the sixth aspect of the present invention, for use in site-directed A-to-I editing of a target RNA and the treatment or prevention of a disorder or disease, as well as methods of carrying out for site-directed editing of a target RNA and methods for treating or preventing a disorder or disease. Site-directed A-to-I editing may take place in vitro, in vivo or ex vivo. Therefore, according to a seventh aspect of the present invention, there is provided a compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use in site-directed A-to-I editing of a target RNA, preferably for use in site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). According to a eighth aspect of the invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for therapeutic use. According to a ninth aspect of the present invention, there is provided a compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for therapeutic use involving editing of a target RNA, to effect loss-of-function or gain-of-function in a translated product of the target RNA, preferably involving site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). According to a tenth aspect of the present invention, there is provided a compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use as a medicament. According to an eleventh aspect of the present invention, there is provided a compound according to the first to fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use in the treatment or prevention of a genetic disease or genetic disorder. According to a twelfth aspect of the present invention, there is provided a compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, for use in the treatment or prevention of a disease or disorder involving editing of a target RNA, to effect loss-of-function or gain-of-function in a translated product of the target RNA, preferably involving site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). According to a thirteenth aspect of the present invention, there is provided a method of treating or preventing a disease or disorder in a subject, the method comprising administering an effective amount of the compound according to the first to fifth aspects of the present invention or the pharmaceutical composition according to the sixth aspect of the present invention. According to a fourteenth aspect of the invention, there is provided a method of carrying out site-directed A-to-I editing of a target RNA, preferably site-directed A- to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the method comprising administering an effective amount of the compound according to the first to fifth aspects of the present invention or the pharmaceutical composition according to the sixth aspect of the present invention. According to a fifteenth aspect of the present invention, there is provided an in vitro method for site-directed A-to-I editing of a target RNA, the method comprising a step of contacting a cell with the compound according to the first to fifth aspects of the present invention or the pharmaceutical composition according to the sixth aspect of the present invention. Preferably, the disease or disorder for which the compound according to the first to fifth aspects of the present invention or the pharmaceutical composition according to the sixth aspect of the present invention is used to treat or prevent, is selected from liver or metabolic diseases and / or cardiac or cardiovascular diseases associated with a gain-of-function (GOF) or loss-of-function (LOF) mutation. The disease or disorder may be a genetic disease or genetic disorder. The disorder or may be associated with a point mutation. For example, the SERPINA1 gene encodes serine protease inhibitor alpha-I antitrypsin (A1AT). A1AT protects tissues from certain inflammatory enzymes, including neutrophil elastase. A deficiency in A1AT (alpha 1 antitrypsin deficiency, A1AD) can lead to excessive break down of elastin in the lungs by neutrophil elastase. This may lead to reduced elasticity in the lungs and subsequent respiratory complications, including emphysema and chronic obstructive lung disease (COPD). Mutant A1AT can also build up in the liver, resulting in cirrhosis and liver failure. Accordingly, the disorder or disease may be associated with a G-to-A mutation in the SERPINA1 gene. The mutation may be selected from SERPINA1 E342K. The disease or disorder may comprise the SERPINA1 gene or an alpha-1- antitrypsin deficiency (A1AD or AATD), optionally wherein the target protein is alpha- 1 antitrypsin. The mutation may be the PiZ mutation (α1-antitrypsin deficiency). The disease or disorder being treated may be associated with a beneficial editing of sites such as STAT1 Y701, NLRP3 Y166 and CTNNB1 T41 that are not causes for genetic diseases but rather protein sites. These sites may be changed (no underlying G-to-A mutation) to alter the function of the wildtype protein. The amount of the compound according to the first to fifth aspects of the present invention or pharmaceutical composition according to the sixth aspect of the present invention to be administered, the dosage and the dosing regimen can vary from cell type to cell type, the disease to be treated, the target population, the mode of administration (e.g., systemic versus local), the severity of disease and the acceptable level of side activity. The amount of compound according to the first to fifth aspects of the present invention administered in a pharmaceutical composition according to the sixth aspect of the present invention is dependent on, for example, the subject being treated, the subject's weight, and the manner of administration. Various administration systems can be used to administer the compounds according to the first to fifth aspects of the present invention or pharmaceutical composition according to the sixth aspect of the present invention. A compound according to the first to fifth aspects of the present invention or pharmaceutical composition according to the sixth aspect of the present invention may be administered as is, i.e., naked and / or in isolated form to a subject, through an organ, e.g., mucosa of the eye, or directly to a cell. When administering a compound according to the first to fifth aspects of the present invention or pharmaceutical composition according to the sixth aspect of the present invention, it is preferred that the compound is dissolved in a solution that is compatible with the administration method. Such administration may be in vivo, in vitro or ex vivo. Hence, depending on the disease or disorder that needs to be treated, or on the cell, tissue or part of the body that needs to be reached by the compound (e.g., in case of beneficial editing), a different administration route or method may be selected. The compound according to the first to fifth aspects of the present invention, or pharmaceutical composition according to the sixth aspect of the present invention, may be administered as a monotherapy or in combination with a different medicament, particularly a medicament suitable for the treatment or prevention of alpha-1-antitrypsin (A1AT) deficiency. The pharmaceutical compositions to the sixth aspect of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be by inhalation (e.g., through nebulization), intranasally, by injection or infusion, intravenously, subcutaneously, intra-dermally, intra-cranially, intramuscularly, intra- tracheally, intra-peritoneally, intra-rectally, by direct injection into a tumour, and the like. Administration may be in any form compatible with pharmaceutical use in humans. Administration of the compound according to the first to fifth aspects of the present invention, or the pharmaceutical composition according to sixth aspect of the present invention may be parenteral administration (such as injection or intravenously by infusion). Parenteral administration includes subcutaneous, intravenous, intradermal, intramuscular and intraperitoneal administration, as well as infusion techniques, such as in the form of sterile injectable aqueous or emulsions as well as oleaginous suspensions. Such suspensions can be formulated according to known art using suitable dispersing or wetting agents and suspending agents. A sterile injectable preparation can be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example a solution in 1,3- butanediol. Among acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed, including synthetic mono-or diglycerides. In addition, omega-3 polyunsaturated fatty acids can find use in preparation of injectables. Intravenous administration, preferably to a human subject, may be given either in the form of a bolus (injected all at once) (IV bolus) or intravenous infusion (IV infusion), for example, infused slowly through a vein of the subject into the plasma at a constant or zero-order rate. Such intravenous infusion, preferably to a human subject, may be provided as an isotonic solution. Such solutions generally have an osomolality of 250 to 375 mOsm / L. Preferred examples of isotonic solutions include normal saline (preferably ~ 0.9% sodium chloride), phosphate buffered saline, lactated Ringer’s solution, ~ 5% dextrose in water (D5W), and Ringer’s solution. For intravenous infusion, the isotonic solution a pH of from 5 to 8, such as from 6 to 8 or from 7.1 to 7.5. For subcutaneous, intravenous, intramuscular, inhalation, or intraperitoneal administration, the compound according to the first to fifth aspects of the present invention may be provided as injectable doses in a pharmaceutically acceptable diluent together with a pharmaceutically acceptable excipient or carrier (which can be a sterile liquid or mixture of liquids). For intramuscular, intraperitoneal, subcutaneous, inhalation, and intravenous use, compounds according to the first to fifth aspects of the present invention may be provided in sterile aqueous solutions or suspensions, buffered to an appropriate pH and isotonicity. Preferably, the compounds according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, are administered parenterally. More preferably by subcutaneous or intravenous administration, and most preferably by injection (subcutaneous or intravenous). Pharmaceutically acceptable excipients and diluents are known in the art. Considerations concerning effective formulations and administration procedures are well known in the art and are described in standard textbooks. See for example Remington: The Science and Practice of Pharmacy, 20th Edition (Lippincott, Williams and Wilkins), 2000; Lieberman et al., ed., Pharmaceutical Dosage Forms, Marcel Decker, New York, N. Y. (1980) and Kibbe et al., ed., Handbook of Pharmaceutical Excipients (3rd Edition), American Pharmaceutical Association, Washington (1999). Pharmaceutically acceptable excipients and diluents will vary depending upon the mode of administration. Suitable pharmaceutically acceptable diluents(s) or excipient(s) include isotonic solutions such as water, saline, phosphate buffered saline, lactated Ringer’s solution, ~ 5% dextrose in water (D5W), aqueous dextrose, Ringer’s solution, hydroxypropyl β cyclodextrin, phosphate buffer, an alcohol (such as ethanol, isopropanol, or hexadecyl alcohol), glycols (such as propylene glycol or polyethylene glycol), glycerol ketals 2,2-dimethyl-1,3-dioxolane-4-methanol), ethers (such as poly(ethylene-glycol) 400), an oil, a fatty acid, a fatty acid ester or glyceride, calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate. The compounds according to the first to fifth aspects of the present invention, or pharmaceutical compositions according to the sixth aspect of the present invention, may be administered to various groups of subjects. The subject may be in need of treatment. Alternatively, the subject may not be in need of treatment (“beneficial editing”). That is, the subject receives the compound according to the first to fifth aspects of the present invention, or pharmaceutical composition according to sixth aspect of the present invention, to edit an RNA derived from a wildtype allele (not a mutated allele) in order to modulate the function of the wildtype protein in a useful way. The compounds according to the first to fifth aspects of the present invention, or pharmaceutical compositions according to the sixth aspect of the present invention, may be administered to a subject. The subject may be a mammal, preferably a human. The compounds according to the first to fifth aspects of the present invention, or pharmaceutical compositions according to the sixth aspect of the present invention, may be administered to a naive subject, i.e., a subject that does not have a disease or disorder, such as a genetic disease or genetic disorder. For example, a compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, may be administered to a naive subject that is at risk of developing a particular disease or disorder, such as a particular genetic disease or genetic disorder. The compound according to the first to fifth aspects of the present invention or pharmaceutical composition according to the sixth aspect of the present invention may be administered to a subject before symptoms manifest or symptoms become severe. The compound according to the first to fifth aspects of the present invention or pharmaceutical composition according to the sixth aspect of the present invention may be administered to a subject who has been diagnosed with a disease or disorder, for example a particular genetic disease or disorder. The subject may be any individual of developing a disease or disorder associated with a G-to-A mutation in genes. The subject may suffer from a disease or disorder associated with a G-to-A mutation in genes. Also provided herein is a method of treating a subject suffering from a disease or disorder, comprising administering to a subject an effective amount of the compound according to the first to fifth aspect of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention. The disease or disorder may be associated with a G-to-A mutation in a subject. The disease or disorder may be a liver or metabolic diseases and / or cardiac or cardiovascular diseases associated with a gain-of-function (GOF) or loss-of-function (LOF) mutation, optionally wherein the disease or disorder comprises the SERPINA1 gene. According to a further aspect of the present invention, there is provided a use of a compound according to the first to fifth aspects of the present invention or a pharmaceutical composition according to the sixth aspect of the present invention in therapy. According to a further aspect of the present invention, there is provided a use of a compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, in the manufacture of a medicament for treating or preventing a disease or disorder associated with a G-to-A mutation. According to a further aspect of the present invention, there is provided a kit or kit of parts comprising a compound according to the first to fifth aspects of the invention and / or a pharmaceutical composition according to the sixth aspect of the present invention. The kit typically additionally comprises instructions for use. The present invention also relates to methods for editing a target adenosine in a target nucleic acid. For example, the present invention provides methods of editing a SERPINA1 polynucleotide, e.g., a SERPINA1 polynucleotide comprising a single nucleotide polymorphism (SNP) associated with alpha I antitrypsin deficiency. Alternatively, the target may be human beta actin (hACTB) or a variant thereof. Further provided herein is an in vitro for site-directed A-to-I editing of a target RNA, the method comprising a step of contacting a cell with the compound according to the first to fifth aspects of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention. The method may be for beneficial and / or compensatory RNA editing. That is, the method may be for targeting wildtype adenosines for beneficial editing or for targeting wildtype adenosines for compensatory editing. The in vitro method according to the eighth aspect of the present invention may comprise, after the step of contacting, the following steps: (a) allowing uptake by the cell of the compound according to the first to fifth aspects of the present invention; (b) allowing annealing of the oligonucleotide A of the compound according to the first to fifth aspects of the present invention to the target RNA; and (c) allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild type enzyme to deaminate the target adenosine in the target RNA sequence to an inosine. Accordingly, there is provided an in vitro method for deaminating at least one specific adenosine present in a target RNA sequence in a cell. A compound according to the first to fifth aspects of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention, may be used in the diagnosis of a disease or disorder, preferably a genetic disease or disorder. Therein, the disease or disorder is preferably selected from the group consisting of infectious diseases, tumour diseases, cardiovascular diseases, autoimmune diseases, allergies and neurological diseases or disorders. The disorder or disease may be associated with a G-to-A mutation. The compound according to the first to fifth aspects of the present invention may be used to make desired changes in a target sequence in a cell or a subject by site- directed editing of nucleotides using an oligonucleotide A that is capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine. As a result, the target sequence is an adenosine deamination reaction mediated by ADAR, converting adenosines into inosine. Given that it is recognised as G, the deamination correcting the pathogenic mutation in the SERPINA1 gene reverses the E342K mutation back to wild-type, reversing or slowing symptoms associated with A1AD experienced by the subject. The present invention may be used with cells from any organ, e.g., skin, lung, heart, kidney, liver, pancreas, gut, muscle, gland, eye, brain, blood and the like. The present invention is particularly suitable for modifying sequences in cells, tissues or organs implicated in a diseased state of a (human) subject. For example, such cells may include, but are not limited, to hepatocytes, hepatocyte like cells, and / or alveolar type II cells, neurons (PNS, CNS), retina, photo receptors cells, Müller Glia cells, RPE, immune cells, B cells, T cells, dendritic cells, macrophages. The present invention may be used with any cells comprising surface or membrane receptors able to interact with the at least one carbohydrate ligand of carbohydrate ligand moiety B. Preferably, the present invention is used with cells comprising asiaglycoprotein receptors (ASGP-R) or mannose receptors, more preferably ASGP-R. This may be particularly suitable for when the carbohydrate ligand moiety B comprises carbohydrate ligand(s) selected from galactose or a derivatives thereof, such as N- acetyl-galactosamine (GalNAc), or mannose or derivatives thereof, respectively. Preferably, the present invention can be used with liver cells, such as hepatocytes, and hepatocyte-like cells. This may be particularly suitable for when the carbohydrate ligand moiety B comprises carbohydrate ligand(s) selected from galactose or derivatives thereof, such as N-acetyl-galactosamine (GalNAc). Preferably, the present invention can be used with immune cells, such as macrophages and dendritic cells. This may be particularly suitable for when the carbohydrate ligand moiety B comprises carbohydrate ligand(s) selected from galactose or derivatives thereof, such as N-acetyl-galactosamine (GalNAc), or mannose or derivatives thereof. In the context of the compounds to the first to fifth aspects of the present invention, it will be appreciated that the carbohydrate ligand moiety B delivers the oligonucleotide A to the required site, for example a liver cell comprising a cell-surface or membrane receptor such as the asialoglycoprotein receptor (ASGP-R). This delivery is facilitated by the affinity of the at least one carbohydrate ligand of the carbohydrate ligand moiety B for the cell-surface or membrane receptor. The at least one carbohydrate ligand of the carbohydrate ligand moiety B binds to the cell-surface or membrane receptor, for example the ASGP-R cell-surface receptor. The then activated receptor is internalised by the cell and facilitates the movement of the ASO into the interior of the cell, typically via invagination of the membrane structure or fusion of the delivery system with the cell membrane. The oligonucleotide A can then carry out its biological function within the cell. The at least one carbohydrate ligand of the carbohydrate ligand moiety B is cleaved inside the cell and metabolised. EXAMPLES Example 1 – Synthesis Compounds were prepared using the following protocols. The oligonucleotides used have the sequences set out in Table 1: Table 1 Oligonucleotide A Sequence (5’ – 3’) A1(SEQ ID No.1) mG&mC*mCfC&fC*mA*fG*mCmoeAfG*fC*moeT&fU*m CfA*mG*fUmoe(MeC)*fC*moe(MeC)fU&mUmoeTfC*m oeT*dC*dI&mUfC*moeG*mA*mU*mG&mG A2(SEQ ID No.2) mC&mC*fC*mA*fG*mCmoeAfG*fC*moeT&fU*mCfA*m G*fUmoe(MeC)*fC*moe(MeC)fU&mUmoeTfC *moeT* dC*dI&mUfC*moeG*mA&mU m = 2’OMe, f = 2’F(fluoro), d = deoxyribose(DNA), moe = 2’OMOE (2’-O- methoxyethyl), Me = 5-methyl, * = PS, & = mesyl Oligonucleotides or R1-oligonucleotide moieties (oligonucleotide attached to precursor of R1linking moiety via 3’ terminus) were synthesised on a MerMade48 oligonucleotide synthesiser, by means of standard solid-phase oligonucleotide synthesis using the following 3% dichloroacetic acid in DCM (dichloromethane) for deblocking, 0.25 M ETT (5-(ethylthio)-1H-tetrazole) in acetonitrile as activator for amidite couplings, 20% acetic anhydride in THF and 10% 1-methylimidazole in THF (tetrahydrofuran) / pyridine for capping, 0.02M iodine in THF / water / pyridine for oxidation and 0.1 M xanthane hydride in pyridine:acetonitrile 1:1 (v:v) for thiolation. Syntheses were carried out in a DMT-ON mode, on 200 nmol - 1 µmol scale and using 1000Å CPG supports from Glen Research / LGC / Hongene: either standard oligonucleotide or R1-oligonucleotide with oligonucleotide attached to precursor of R1linking moiety via its 3’ terminus (loading of ca.30 μmol / g). Fully protected nucleoside phosphoramidites (Hongene, Glen Research) were dissolved to 0.1 M concentration in dry acetonitrile and incorporated using 3 min. coupling time for DNA amidites and 6-9 min. coupling time for all other amidites (2’OMe, 2’F, 2’OMOE, precursor of R1linking moieties for 5’ oligonucleotide functionalisation). The phosphoramidate linkages were obtained via Staudinger reaction, which was carried out with 0.5 M solution of mesyl azide (Enamine Ltd) in dry acetonitrile for 15 min at room temperature. After synthesis, R1-oligonucleotide moieties (oligonucleotide attached to precursor of R1linking moiety via 3’ or 5’ terminus) were cleaved from CPG and deprotected at room temperature in 28%–30% ammonium hydroxide and / or 50% / 50% mixture of 28%–30% ammonium hydroxide / 40% aqueous methylamine (AMA) for 36 hours or 2 h, respectively. Deprotected R1-oligonucleotide moieties (oligonucleotide attached to precursor of R1linking group via 3’ or 5’ terminus) were directly adsorbed on GlenPak cartridges and purified DMT-ON. Purified R1-oligonucleotide moieties (oligonucleotide attached to precursor of R1 linking moiety via 3’ or 5’ terminus) were post-synthetically conjugated with moieties (1) & (2) shown below. Moiety (1) was obtained from Hongene (cat No. ON-133). Moiety (2) was synthesised according to WO 2021 / 071858. For compounds Al-4494 and Al- the purified R1-oligonucleotide moiety (oligonucleotide attached to precursor of R1linking moiety via 3’ or 5’ terminus) of Al- 1550 or Al-0949 respectively was post-synthetically conjugated in a step-by-step manner with 11-(Fmoc-amino)undecanoic acid (obtained from Sigma-Aldrich, cat. No.04068) and then moiety (1) shown below. The in Table 2, and Figures 12 to 19. Oligonucleotides A1and A2include an O atom that is attached to the P atom shown. The O atom is that of the 3’ position of the terminal nucleotide. The compounds having 5’ attachment of oligonucleotide are shown in Table 3, and Figures 20 to 24. Oligonucleotides A1and A2include an O atom that is attached to the P atom shown. The O atom is that of the 5’ position of the terminal nucleotide. By ‘oligonucleotide attached to precursor of R1linking moiety via 3’ or 5’ terminus’ and like terms used herein is meant an oligonucleotide attached to a moiety representing the R1linking moiety but terminating in an amino group rather than an amide group. The amino group of the precursor is with the carboxyl group of moiety (1) or (2) to form the ligand-oligonucleotide compound having an R1linking moiety. Oligonucleotides A1and A2are attached via a phosphodiester linkage as shown in Tables 2 and 3 (and Figures 12 to 24). The terminal O atom of the R1linking moiety forms part of the phosphodiester linkage. Oligonucleotides A1and A2include an O atom at the 3’ or 5’ position of the terminal nucleotide as discussed herein. The O atom links to the P of the structures shown in Tables 2 and 3 (and Figures 12 to 24), and forms part of the phosphodiester linkage. Reaction proceeds via formation of an amide bond between the amino group of the precursor of the R1linking moiety and the carboxyl group of moiety (1) or (2). Moiety (1) or (2) (5 eq.) was dissolved in anhydrous DMF (dimethylformamide) and combined with 5 eq. of TNTU (N,N,N’,N’-Tetramethyl-O-(bicyclo[2.2.1]hept-5-en-2,3- dicarboximido)uroniumtetrafluoroborate) and 5 eq. of DIPEA (N,N- diisopropylethylamine). The mixture was incubated at room temperature for 1h. R1- oligonucleotide moiety (oligonucleotide attached to precursor of R1linking moiety via 3’ or 5’ terminus) (1 eq.) was dissolved in aqueous buffer (0.1 M NaHCO3, pH=9) in presence of 5 eq. of DIPEA (N,N-diisopropylethylamine). The two solutions were combined and further agitated at 37°C for 4h. After this time, the reaction was quenched by precipitation with NaCl / ethanol. Conjugated ligand-oligonucleotide compounds were collected after centrifugation and reconstituted in HPLC grade water. Conjugated ligand-oligonucleotide compounds were purified by means of RP-HPLC according to the method published by Gabriel et al.; Org. Process Res. Dev.2022, 26, 2, 413–421. Eluent gradient: 0-100% B in A; Mobile Phase A: 0.1M phenylboronic acid in [10%MeOH / 90% (0.2M NaOAc)]; Mobile Phase B: 0.1M phenylboronic acid in [90% MeOH / 10% (0.2M NaOAc)]. Column: Hypersil Gold Semiprep. Total flow: 3 mL / min. Oven temperature: 50°C. Total run time: 40 min. Conjugated ligand-oligonucleotide compounds in the collected fractions were precipitated by addition of an excess of ethanol, and isolated after centrifugation. The identity & purity of the conjugated ligand-oligonucleotide compounds were determined by LC-MS (Column: DNA-Pac RP; Total flow: 0.5 mL / min.; Oven temperature: 50°C; Total run time: 10 min.; Eluent gradient: 15-60% B in A; Mobile Phase A: 8 mM Triethylamine (TEA) and 200 mM HFIP in LC-MS grade water; Mobile Phase B: LC-MS grade MeOH). The amount of the conjugated ligand-oligonucleotide compounds was determined by weight as well as by means of UV-Vis spectrophotometry. The compounds were reconstituted in 1xPBS for use in biological experiments. For compounds Al-4494 and Al-4495, 8 eq. of 11-(Fmoc-amino)undecanoic acid was dissolved in anhydrous DMF (dimethylformamide) and combined with 8 eq. of TNTU (N,N,N’,N’-Tetramethyl-O-(bicyclo[2.2.1]hept-5-en-2,3- dicarboximido)uroniumtetrafluoroborate) and 5 eq. of DIPEA (N,N- diisopropylethylamine). The mixture was incubated at room temperature for 1h. R1- oligonucleotide moiety (oligonucleotide attached to precursor of R1linking moiety via 3’ or 5’ terminus) of Al-1550 or Al-0949 respectively (1 eq.) was dissolved in aqueous buffer (0.1 M NaHCO3, pH=9) in presence of 5 eq. of DIPEA (N,N- diisopropylethylamine). The two solutions were combined and further agitated at 37°C for 4h. After this time, the reaction was quenched by precipitation with NaCl / ethanol. The conjugated 11-(Fmoc-amino)undecanoic acid compound that formed in a quantitative manner was collected after centrifugation and used without additional purification. Fmoc protecting group was removed by incubation of 11-(Fmoc- amino)undecanoic acid compound in aqueous ammonia solution for 2h at RT. After this time, the reaction was quenched by precipitation with NaCl / ethanol. The conjugated 11-aminoundecanoic acid compound was collected after centrifugation and used without additional purification. Moiety (1) (8 eq.) was dissolved in anhydrous DMF (dimethylformamide) and combined with 8 eq. of TNTU (N,N,N’,N’-Tetramethyl- O-(bicyclo[2.2.1]hept-5-en-2,3-dicarboximido)uroniumtetrafluoroborate) and 5 eq. of DIPEA (N,N-diisopropylethylamine). The mixture was incubated at room temperature for 1h. The conjugated 11-aminoundecanoic acid-oligonucleotide compound (R1- oligonucleotide moiety (oligonucleotide attached to precursor of R1linking moiety via 3’ or 5’ terminus) (1 eq.) was dissolved in aqueous buffer (0.1 M NaHCO3, pH=9) in presence of 5 eq. of DIPEA (N,N- . The two solutions were combined and further agitated at 37°C for 4h. After this time, the reaction was quenched by precipitation with NaCl / ethanol. Conjugated ligand-oligonucleotide compound (Al-4494 or Al-4495) was collected after centrifugation and reconstituted in HPLC grade water. The conjugated ligand-oligonucleotide compound (Al-4494 or Al- 4495) was purified by means of RP-HPLC according to the method published by Gabriel et al.; Org. Process Res. Dev.2022, 26, 2, 413–421. Eluent gradient: 0-100% B in A; Mobile Phase A: 0.1M phenylboronic acid in [10%MeOH / 90% (0.2M NaOAc)]; Mobile Phase B: 0.1M phenylboronic acid in [90% MeOH / 10% (0.2M NaOAc)]. Column: Hypersil Gold Semiprep. Total flow: 3 mL / min. Oven temperature: 50°C. Total run time: 40 min. Conjugated ligand-oligonucleotide compound (Al-4494 or Al- 4495) in the collected fractions were precipitated by addition of an excess of ethanol, and isolated after centrifugation. The identity & purity of the ligand-oligonucleotide compound was determined by LC-MS (Column: DNA-Pac RP; Total flow: 0.5 mL / min.; Oven temperature: 50°C; Total run time: 10 min.; Eluent gradient: 15-60% B in A; Mobile Phase A: 8 mM Triethylamine (TEA) and 200 mM HFIP in LC-MS grade water; Mobile Phase B: LC-MS grade MeOH). The amount of the ligand-oligonucleotide compound was determined by weight as well as by means of UV-Vis spectrophotometry. The compound was reconstituted in 1xPBS for use in biological experiments. For compound Al-1203, this conjugated ligand-oligonucleotide compound was prepared directly on a Moiety (2)-R1functionalized CPG from Amerigo Scientific (cat. no. MRS1279038APT). Table 2 Comp Structure Al-1068 (A1) Al-0949 (A1) Al-1692 (A1) Al-1697 (A1) Al-4495 (A1) Example 3 - Mouse Experiments (In Vivo) Mouse experiments were performed by Synovo GmbH (Tübingen, Germany) in accordance with procedures approved by the Regional Council (Regierungspräsidium Tübingen, BW, Germany). Mice were housed on a 12:12 light-dark cycle, with ad libitum access to food and water. Mice expressing the human SERPINA1E342K transgene in C57BL / 6J background provided by Prof. Jeffrey Teckman’s laboratory (Saint Louis University). Mice homozygous for the human transgene (PiZZ) were crossbred with wild-type C57BL / 6J and offspring was used in all experiments. Eight-to-ten-week-old male and female mice were subcutaneously injected with 10mg / kg of the compound according to the present invention dissolved in PBS or PBS only as indicated. Injections were performed on experimental day 0, day 2 and day 4. Animals were sacrificed 7 days after the first dose and livers were collected and snap- frozen. Tissues were lysed in buffer RLT (RNeasy mini kit, Qiagen) with a bead homogenizer (Bead Mill Max, VWR) and 1.4 mm ceramic beads, at 4.5 m / s for 30 sec. The lysates were used for total RNA purification using RNeasy mini kit (Qiagen) with an on-column DNase I digest. The obtained RNA was then processed as described below to perform NGS amplicon sequencing and determine the RNA editing yield. Figures 3 and 11 demonstrate the advantageous effect on A-to-I editing of 3’ attachment of oligonucleotide A versus 5’ attachment, in vivo. Figure 4 demonstrates the advantageous effect on A-to-I editing shown by compounds according to the present invention, in vivo. Figure 10 demonstrates the effect of the length of the R1linking moiety, in vivo. Example 4 - Cell Culture, Free Uptake & mRNA Isolation (In Vitro) Freshly isolated primary mouse hepatocytes from transgenic hSERPINA1 E342K (PiZ) mice, were plated in 96-well collagen-coated plates (Greiner) at a density of 2,5 X 104cells per well (100µL per well) in DMEM low glucose (Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin / streptomycin (Gibco) for 4 hours, then they were cultured in William´s E Medium (Gibco) supplemented with 1% GlutaMAXTM(Gibco) and 1% penicillin / streptomycin for 24 hours. The hepatocytes were cultured under standard culture conditions at 37 °C, 5% CO2 and in a humidified atmosphere. With the media change, cells were treated with different concentrations of the compounds according to the present invention in 1X PBS (Gibco) as indicated for the free uptake. Cells were washed with PBS and harvested 24 hours after treatment with the compounds according to the present invention in 125 µl / well lysis buffer (Dynabeads mRNA direct kit, Invitrogen). Lysates of 96-well plates were transferred to a 384-plate and mRNA was isolated using the Dynabeads mRNA direct kit and an automated plate washer (Cytena C.Wash). Figures 1 and 2 demonstrate the advantageous effect on A-to-I editing of 3’ attachment of the oligonucleotide A versus 5’ attachment, in vitro. Al-0991 of Figure 1 and Al-1067 of Figure 2 represent the oligonucleotide A alone (no conjugation to a carbohydrate ligand moiety B via a linking moiety R1). Figures 5, 6 and 7 demonstrate the advantageous effect on A-to-I editing of 3’ attachment of the oligonucleotide A versus 5’ attachment, in vitro. Figure 8 demonstrates the advantageous effect on A-to-I editing shown by compounds according to the present invention, in vitro. Figure 9 demonstrates the effect of the length of the R1linking moiety, in vitro. Example 5 - NGS Amplicon Sequencing To determine editing efficiency, sequencing of the target was carried out as follows: To avoid biases in reverse transcription (RT) mRNA was heated to 90°C for 2 min with an excess of a sense primer prior to RT. For target amplification of the editing region, a reverse transcription and cDNA amplification was performed with Luna Universal One-Step RT-qPCR mix (NEB) in a 10 µl reaction in a 384-well plate. Both the forward and reverse primer had an overhang to enable a second PCR with primers that bind to that overhang. The following primers were used: SERPINA1 E342K: Forward primer: (SEQ ID No.3) Reverse primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGATAGACATGGGTATGG CCTC (SEQ ID No.4) Sense Primer: GCATAAGGCTGTGCTGACCATCGACCCGAAAGGGACTGAAGCTGCTGGGGCC ATGAA (SEQ ID No.5) Subsequently, a second PCR was performed on the PCR product of the first PCR using OneTaq Hot-Start 2xMM with GC buffer (NEB) and forward and reverse primers containing unique indexes as well as adapters for Illumina sequencing. Afterwards, the samples were pooled and the DNA library was purified with the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel), diluted and sequenced together with a PhiX library on an iSeq 100 (Illumina). Results were analysed using a Python script. Briefly, demultiplexed reads were filtered by quality, length and position before editing percentages were calculated by dividing the number of G reads by the sum of the number of G reads and A reads at the respective target site. Data are represented as mean percentage of editing ± standard deviation (SD) of at least 3 replicates. EMBODIMENTS 1. A compound comprising an oligonucleotide A conjugated to a carbohydrate ligand moiety B comprising at least one carbohydrate ligand, wherein the oligonucleotide A is for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the Oligonucleotide A having a 3’ terminus and a 5’ terminus, and conjugated to the carbohydrate ligand moiety B via its 3’ terminus. 2. The compound according to embodiment 1, wherein the oligonucleotide A is conjugated to the carbohydrate ligand moiety B via a linker comprising a linking moiety R1having a main chain length of from 4 to 22 atoms. The compound according to 2, wherein the linker between the carbohydrate ligand moiety B and the oligonucleotide A may have the following structure: wherein X1is (O)2-CH3, and X2is a hydroxyl group, or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3, and oligonucleotide A is linked to P of formula (I) via its 3’ terminus. Formula (a) and (b) are as shown herein. The compound according to any of embodiments 1 to 3, wherein the compound is of formula (I): wherein X1is selected from O, S and N-S(O)2- CH3, and X2is a hydroxyl group, or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3; oligonucleotide A is linked to P of formula (I) via its 3’ terminus; and R1has a main chain length of from 4 to 22 atoms. Formula (I), (a), and (b) are as shown herein. The compound according to embodiment 4, wherein R1is selected from the following formulae: (IIa); (IIa’); (IIa’’); (IIa’’’); (IIb); (IIb’); (IIc); (IIc’); (IId); (IId’); (IIe); (IIe’); (IIf); (IIf’); (IIf’’); (IIf’’’); (IIg); (IIg’); (IIh); (Ih’); (IIh’’); (IIh’’’); wherein, for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 18, k is 0 to 16, l is 0 or 1, m is 0 to 16, and n is 0 to 17, with the proviso that if k is 0, m is 1 to 16 and if m is 0, k is from 1 to 16, each occurrence of L is independently selected from a direct bond and C1-4alkylene, and each occurrence of Y and Z is independently selected from O, S and NRc, where Rcis selected from hydrogen and C1-4alkyl; for formula (IIb) and (IIb’), n 19, and each occurrence of R2and R3is independently selected from hydrogen and C1-4alkyl; for formula (IIc) and (IIc’), m is 1 to 5, n is 0 to 15, and each occurrence of Y is independently selected from O and S; for formula (IId) and (IId’), k is 1 to 4, m is 1 to 10, and n is 1 to 16; for formula (IIe) and (IIe’), m is 1 to 16, and n is 1 to 16; for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 16, n is 1 to 16, Y is selected from O, S or NRc, where Rcis selected from hydrogen and C1-4alkyl, and Z is selected from O or S; for formula (IIg) and (IIg’), m is 1 to 15 and n is 1 to 15; for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 1 to 15 and n is 1 to 15; with the proviso that R1has a main chain length of from 4 to 22 atoms; and oligonucleotide A is linked to P of formula (I) via the 3’ terminus. Formula (IIa); (IIa’); (IIa’’); (IIa’’’); (IIb); (IIb’); (IIc); (IIc’); (IId); (IId’); (IIe); (IIe’); (IIf); (IIf’); (IIf’’); (IIf’’’); (IIg); (IIg’); (IIh); (Ih’); (IIh’’); and (IIh’’’) are as shown herein. The compound according to any of embodiments 2 to 5, wherein R1has a main chain length of from 4 to 18 atoms, preferably from 4 to 13 atoms, or from 4 to 12 atoms, or from 4 to 10 atoms, more preferably from 6 to 12 atoms, or from 6 to 11 atoms, or from 6 to 10 atoms, and more preferably from 7 to 12 atoms, or from 7 to 11 atoms, or from 7 to 10 atoms, or even 7 to 9 atoms. The compound according to any of embodiments 3 to 6, wherein X1is selected from O, S and N-S(O)2-CH3, and X2is a hydroxyl group, preferably wherein X1is O and X2is a hydroxyl group. The compound according to any of embodiments 2 to 7, wherein R1is a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain, or R1may be a linking moiety comprising at least one alkylene moiety, at least one cyclic moiety, and optionally one or more heteroatom or heteroatom-containing group in its main chain, preferably R1is a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom- containing group in its main chain, and more preferably R1is a linking moiety comprising at least one moiety and one or more heteroatom or heteroatom-containing group in its main chain. The compound according to embodiment 8, wherein the one or more heteroatom in the main chain is selected from N, S, P and O, or combinations thereof, and the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably the one or more heteroatom in the main chain is selected from O, N and S, or combinations thereof, and the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, and amide groups, or combinations thereof, and optionally the at least one alkylene moiety of R1is substituted with one or more substituents independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, -C1-4alkoxy, nitro (-NO2), thiol, -S-C1-4alkyl, and halogen, preferably selected from hydroxyl and -C1-4alkyl-hydroxyl. The compound according to any of embodiments 5 to 9, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 14, and / or k is 0 to 12, and / or l is 0 or 1, and / or m is 0 to 12, and / or n is 0 to 13, with the proviso that if k is 0, m is 1 to 12 and if m is 0, k is from 1 to 12, preferably j is 0 to 14, k is 0 to 12, l is 0 or 1, m is 0 to 12, and / or n is 0 to 13, with the proviso that if k is 0, m is 1 to 12 and if m is 0, k is from 1 to 12, more preferably j is 0 to 7 and / or k is 0 or 1 and / or l is 0 or 1 and / or m is 0 or 1 and / or n is 0 to 7, with the proviso that if k is 0, m is 1 and if m is 0, k is 1, and more preferably j is 0 to 7, k is 0 or 1, l is 0 or 1, m is 0 or 1 and n is 0 to 7, with the proviso that if k is 0, m is 1 and if m is 0, k is 1. The compound according to embodiment 10, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 5 and / or k is 0 or 1 and / or l is 0 or 1 and / or m is 0 or 1 and / or n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1, preferably j is 0 to 5, k is 0 or 1, l is 0 or 1, m is 0 or 1, and n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1. The compound according to 10 or 11, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): 2, 0, 0, m 1, n 1 to 5, or j is 3, k is 0, l is 0, m is 1, and n is 0 to 4, or j is 4, k is 0, l is 0, m is 1, and n is 1 to 3, or j is 5, k is 0, l is 0, m is 1, and n is 0 to 2, or j is 6, k is 0, l is 0, m is 1, and n is 1, or j is 7, k is 0, l is 0, m is 1, and n is 0, or j is 0, k is 1, l is 0, m is 0, and n is 3 to 7, or j is 1, k is 1, l is 0, m is 0, and n is 2 to 6, or j is 2, k is 1, l is 0, m is 0, and n is 1 to 5, or j is 3, k is 1, l is 0, m is 0, and n is 0 to 4, or j is 4, k is 1, l is 0, m is 0, and n is 1 to 3, or j is 5, k is 1, l is 0, m is 0, and n is 0 to 2, or j is 6, k is 1, l is 0, m is 0, and n is 1, or j is 0, k is 0, l is 1, m is 1, and n is 0 to 4, or j is 1, k is 0, l is 1, m is 1, and n is 0 to 3, or j is 2, k is 0, l is 1, m is 1, and n is 0 to 2, or j is 3, k is 0, l is 1, m is 1, and n is 0 or 1, or j is 4, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 0 to 4, or j is 1, k is 1, l is 1, m is 0, and n is 0 to 3, or j is 2, k is 1, l is 1, m is 0, and n is 0 to 2, or j is 3, k is 1, l is 1, m is 0, and n is 0 or 1, or j is 4, k is 1, l is 1, m is 0, and n is 0. The compound according to any of embodiments 10 to 12, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, j is 2, j is 3, 0, 0, m 1, n 2, or j is 4, k is 0, l is 0, m is 1, 1, or j is 5, k is 0, l is 0, m is 1, and n is 0, or j is 1, k is 1, l is 0, m is 0, and n is 4, or j is 2, k is 1, l is 0, m is 0, and n is 3, or j is 3, k is 1, l is 0, m is 0, and n is 2, or j is 4, k is 1, l is 0, m is 0, and n is 1, or j is 5, k is 1, l is 0, m is 0, and n is 0, or j is 0, k is 0, l is 1, m is 1, and n is 2, or j is 1, k is 0, l is 1, m is 1, and n is 1, or j is 2, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 2, or j is 1, k is 1, l is 1, m is 0, and n is 1, or j is 2, k is 1, l is 1, m is 0, and n is 0, preferably: j is 1, k is 0, l is 1, m is 1, and n is 1. 14. The compound according to any of embodiments 5 to 13, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of L is independently selected from a direct bond and C1-2alkylene, preferably each occurrence of L is independently selected from a direct bond and C1alkylene, and more preferably each occurrence of L is C1alkylene. 15. The compound according to any of embodiments 5 to 14, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH. 16. The compound according to any of embodiments 5 to 15, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of Z is O. 17. The compound according to any of embodiments 5 to 16, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 0 to 5, k is 0 or 1, l is 0 or 1, m is 0 or 1, and n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1; each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O. The compound according to embodiment 17, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 0, m is 1, and n is 4, or j is 2, k is 0, l is 0, m is 1, and n is 3, or j is 3, k is 0, l is 0, m is 1, and n is 2, or j is 4, k is 0, l is 0, m is 1, and n is 1, or j is 5, k is 0, l is 0, m is 1, and n is 0, or j is 1, k is 1, l is 0, m is 0, and n is 4, or j is 2, k is 1, l is 0, m is 0, and n is 3, or j is 3, k is 1, l is 0, m is 0, and n is 2, or j is 4, k is 1, l is 0, m is 0, and n is 1, or j is 5, k is 1, l is 0, m is 0, and n is 0, or j is 0, k is 0, l is 1, m is 1, and n is 2, or j is 1, k is 0, l is 1, m is 1, and n is 1, or j is 2, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 2, or j is 1, k is 1, l is 1, m is 0, and n is 1, or j is 2, k is 1, l is 1, m is 0, and n is 0 each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O. The compound according to embodiment 17 or 18, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 1, k is 0, l is 1, m is 1, and n is 1; each occurrence of L is selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O. 20. The compound according to any of embodiments 17 to 19, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 1, m is 1, and n is 1; each occurrence of L is C1alkylene; each occurrence of Y is NH; and each occurrence of Z is O. 21. The compound according to any of embodiments 5 to 20, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: ; ; ; 22. The compound according to embodiment 21, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: ; ; The compound according to embodiment 21 or 22, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: The compound according to any of embodiments 5 to 23, wherein for formula (IIb) and (IIb’), n is 1 to 15, or 3 to 12, preferably 4 to 8, and more preferably 6. 25. The compound according to embodiments 5 to 24, wherein for formula (IIb) and (IIb’), each occurrence of R2and R3is independently selected from hydrogen and C1-3alkyl, preferably wherein each occurrence of R2and R3are hydrogen. 26. The compound according to any of embodiments 5 to 25, wherein for formula (IIb) and (IIb’), R1is selected from: 27. (IIb) and (IIb’), R1is of formula (IIb), preferably: . 28. The compound according to any of embodiments 5 to 27, wherein for formula (IIc) and (IIc’), m is 1 to 4, and / or n is 0 to 11, preferably m is 1 to 4 and n is 0 to 11, more preferably m is 1 or 2 and / or n is 0 to 4, more preferably m is 1 or 2 and n is 0 to 4, more preferably m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, more preferably m is 1 and n is 0 to 4, and most preferably m is 1 and n is 2. 29. The compound according to any of embodiments 5 to 28, wherein for formula (IIc) and (Iic’), each occurrence of Y is O, each occurrence of Y is S, or each occurrence of Y alternates O and S, preferably each occurrence of Y is O. The compound according to embodiment 28 or 29, wherein for formula (IIc) and (IIc’): m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, preferably m is 1 and n is 0 to 4, more preferably m is 1 and n is 2; and each occurrence of Y is O, each occurrence of Y is S, or each occurrence of Y alternates between O and S. The compound according to any of embodiments 28 to 30, wherein for formula (IIc) and (IIc’): m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, preferably m is 1 and n is 0 to 4, and more preferably m is 1 and n is 2; and each occurrence of Y is O, and more preferably: for formula (IIc) and (IIc’), R1is selected from: The compound according to any of embodiments 5 to 31, wherein for formula (IId) and (IId’), k is 1 to 3, and / or m is 1 to 6, and / or n is 1 to 12, more preferably k is 1 to 3, m is 1 to 6, and n is 1 to 12, preferably: k is 1 and / or m is 1 to 6 is 1 to 12, or k is 2 and / or m is 1 to 3 and / or n is 1 to 9, or k is 3, and / or m is 1 and / or n is 1 to 6, more preferably: k is 1, m is 1 to 6, and n is 1 to 12, or k is 2, m is 1 to 3, and n is 1 to 9, or k is 3, m is 1 and n is 1 to 6. The compound according to embodiment 32, wherein for formula (IId) and (IId’), k is 1, m is 1 to 6, and n is 1 to 12, preferably k is 1, m is 1 or 2 and n is 1 to 5. The compound according to embodiment 32 or 33, wherein for formula (IId) and (IId’): k is 1, m is 1 or 2, and n is 1 to 5, or k is 1, m is 1, and n is 1 to 5, or k is 1, m is 2, and n is 1 to 3, preferably: k is 1, m is 1 and n is 3, or k is 1, m is 2 and n is 1. The compound according to any of embodiments 5 to 34, wherein for formula (IId) and (IId’), R1is selected from: ; ; for formula (IIe) and (IIe’), m is 1 to 12, and / or n is 1 to 12, preferably m is 1 to 12 and n is 1 to 12, more preferably m is 1 to 5 and / or n is 1 to 3, and more preferably m is 1 to 5 and n is 1 to 3. The compound according to embodiment 36, wherein for formula (IIe) and (IIe’): m is 1 to 5, and n is 1, or m is 1 to 4, and n is 2, or m is 1 to 3 and n is 3. preferably: m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3. The compound according to embodiments 5 to 37, wherein for formula (IIe) and (IIe’), R1is selected from: The for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 12, and / or n is 1 to 12, preferably m is 1 to 12, and n is 1 to 12, more preferably m is 1 to 5 and / or n is 1 to 3, and more preferably m is 1 to 5 and n is 1 to 3. The compound according to embodiment 39, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 1 to 5 and n is 1, or m is 1 to 4 and n is 2, or m is 1 to 3 and n is 3, preferably: m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3. The compound according to embodiment 39 or 40, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’), Z is O, and / or Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH. The compound according to any of embodiments 39 to 41, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 1 to 5 and n is 1, or m is 1 to 4 and n is 2, or m is 1 to 3 and n is 3; Z is O; and Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH; preferably: m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3; Z is O; and Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH; more preferably, R1is selected from: ; ; ; ; ; any for formula (IIg) and (IIg’), m is 1 to 11 and / or n is 1 to 11, preferably m is 1 to 11 and n is 1 to 11, more preferably m is 1 to 4 and / or n is 1 to 3, and more preferably m is 1 to 4 and n is 1 to 3. The compound according to 43, wherein for formula (IIg) and (IIg’): m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, or m is 1 or 2 and n is 3, preferably: m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, and more preferably: m is 2 and n is 1, or n is 1 and n is 2. The compound according to any of embodiments 5 to 44, wherein for formula (IIg) and (IIg’), R1is selected from: . 46. The compound according to any of embodiments 5 to 45, wherein for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 11 and / or n is 11, preferably m is 11 and n is 11, more preferably m is 1 to 4 and / or n is 1 to 3, and more preferably m is 1 to 4 and n is 1 to 3. 47. The compound according to embodiment 46, wherein for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, or m is 1 or 2 and n is 3, preferably: m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, and more preferably: m is 2 and n is 1, or m is 1 and n is 2. 48. The compound according to any of embodiments 5 to 47, wherein for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), R1is selected from: ; ; ; ; ; ; The compound according to of embodiments 5 to 48, wherein R1is selected from formula (IIa), (IIa’’), (IIb), (IIc), (IId), (IIe), (IIf), (IIf’’), (IIg), (IIh), and (IIh’’), or R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb), (IIb’), (IId) and (IId), preferably formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), more preferably (IIa), (IIa’) and (IIb), and more preferably (IIa) and (IIb). The compound according to any of embodiments 5 to 49, wherein R1is selected from: ; ; ; ; 5 ; ; 51. from: ; . : wherein B is a comprising at least one carbohydrate ligand; and R1is selected from the following: ; ; ; ; ; , ; ; or . elected from: , . 54. The compound according to embodiment 52 or 53, wherein the compound further comprises an oligonucleotide A, and / or wherein the compound comprises the following formula (VIIIa) where X1is selected from O, S and N-S(O)2-CH3, and X2is a hydroxyl group, or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3; preferably X1selected from O, S and N-S(O)2-CH3and X2is a hydroxyl group, and more preferably X1is O and X2is a hydroxyl group. Formula (VIIIa), (a) and (b) are as shown herein. The compound according to 54, wherein the compound has the following formula: . The compound according to any of embodiments 1 to 51, 54 and 55, wherein the oligonucleotide A is for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the ADAR being ADAR1. The compound according to any of embodiments 1 to 51, 54, 55 and 56, wherein the oligonucleotide A comprises a sequence that is substantially or completely complementary to the target RNA to be edited, except that there will be a mismatch at the site of the edit. The compound according to any of embodiments 1 to 51, and 54 to 57, wherein the oligonucleotide A is a single strand oligonucleotide. The compound according to any of embodiments 1 to 51, and 54 to 58, wherein the oligonucleotide A is chemically modified. The compound according to any of embodiments 1 to 51, and 54 to 59, wherein the oligonucleotide A comprises a sequence with a length of at least 25 nucleotides (Nx) capable of binding to a target sequence in a target RNA. The compound according to any of embodiments 1 to 51, and 54 to 60, wherein the oligonucleotide A comprises a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a target adenosine in the target RNA that is to be edited. The compound according to any of embodiments 59 to 61, wherein the oligonucleotide A comprises one or more chemically modified internucleoside linkages, preferably one or more chemically modified internucleoside linkages selected from a phosphoryl (PN) linkage, a phosphorothioate (PS) linkage and a methanesulfonyl (mesyl) linkage. 63. The compound according to embodiment 62, wherein the oligonucleotide A comprises a 3’ and / or 5’ flanking region comprising PS internucleoside linkages located within the 3’ and / or 5’ flanking region. 64. The compound according to embodiment 62 or 63, wherein for the oligonucleotide A: (i) less than 60%, preferably less than 50%, or less than 40%, of the internucleoside linkages are PO linkages; and / or (ii) no more than 90%, preferably 80%, 70%, 60%, 50%, 40%, 30% or 20%, of the internucleoside linkages are PS linkages. 65. The compound according to any of embodiments 59 to 64, wherein at least 10%, preferably 20%, 30%, 40%, 50% or 60%, of the nucleotides of the oligonucleotide A are fluoro (F)-modified in the 2’ position of the sugar residue (2’-F), optionally wherein the 2’-F modification is at one or more of the following nucleotides: 29, 28, 25, 23, 21,17, 15, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, -8, - 10, -12, -13, -14, and -15. 66. The compound according to any of embodiments 59 to 65, wherein the oligonucleotide A comprises a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a target adenosine in the target RNA that is to be edited, and at least one of the three nucleotides N-1, N0and N+1of the CBT of the oligonucleotide A is independently selected to be chemically modified at the 2’ position of its sugar residue, or its sugar residue is a deoxyribose. 67. The compound according to embodiment 66, wherein one or more of the following apply for the oligonucleotide A: (i) the chemical modification at the 2’ position of the sugar residue of the nucleotide N+1 is 2’fluoro (2’-F), 2’fluoroarabinoside (2’FANA), 2’- OMethoxyethyl (2’- 2’-O-Methyl (2’-OMe), or the sugar residue of N+1 is deoxyribose; and / or (ii) the chemical modification at the 2’ position of the sugar residue of the nucleotide N0 is 2’-FANA, or the sugar residue of N0 is deoxyribose; and / or (iii) the chemical modification at the 2’ position of the sugar residue of the nucleotide N-1 is 2’-FANA, or 2’-OMe, or the sugar residue of N-1 is deoxyribose. The compound according to any of embodiments 61 to 67, wherein for oligonucleotide A, N0comprises no 2’-modification of its sugar residue. The compound according to any of embodiments 61 to 68, wherein for oligonucleotide A, N0 is selected from cytidine, deoxycytidine, uridine, and deoxy uridine, preferably N0is selected from cytidine and deoxycytidine. The compound according to any of embodiments 61 to 69, wherein the oligonucleotide A comprises a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a target adenosine in the target RNA that is to be edited, and at least 50%, more preferably at least 80%, of the nucleotides outside the CBT are chemically modified independently from another at the 2’ position of their sugar residue, preferably wherein the modification is selected from 2’-F, 2’-FANA, 2’-O-alkyl such as 2’-OMe, 2’-O-methoxyethyl (2’-MOE), and / or locked nucleic acid (LNA). The compound according to any of embodiments 1 to 70, wherein the carbohydrate ligand moiety B comprises a single carbohydrate ligand, or the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, preferably the carbohydrate ligand moiety B comprises two or more carbohydrate ligands. The compound according to any of embodiments 1 to 71, wherein the carbohydrate ligand moiety B comprises a single carbohydrate ligand having a mono-antennary structure, or the carbohydrate ligand moiety B comprises two or more carbohydrate and has a multi-antennary structure, preferably the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and has a multi-antennary structure. 73. The compound according to embodiment 71 or 72, wherein the carbohydrate ligand moiety B comprises two carbohydrate ligands and has a bi-antennary structure, or the carbohydrate ligand moiety B comprises three carbohydrate ligands and has a tri-antennary structure, preferably the carbohydrate ligand moiety B comprises three carbohydrate ligands and has a tri-antennary structure. 74. The compound according to any of embodiments 1 to 73, wherein the at least one carbohydrate ligand, or each occurrence thereof, is a cell surface receptor or cell membrane ligand, preferably a cell surface receptor ligand. 75. The compound according to any preceding embodiment, wherein the at least one carbohydrate ligand, or each occurrence thereof, is independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucose, fucosamine, fuculose, galactose or a derivative thereof such as D-galactose, L-galactose, D- galactosaminitol, galactosamine, α-D-galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, glucose, D-glucose, L-glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl-glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno-heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D-mannopyranose, L- mannopyranose, mannose-6-phosphate, mannosamine, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D- glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D- galactopyranose, α-D-galactofuranose, β-D-galactofuranose, sialic acid, 2- amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2- methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D- mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α- neuraminic acid, 5-thio-β-D- methyl-2,3,4-tri-O-acetyl-1-thio-6- O-trityl-α-D-glucopyramoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra- O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,4-anhydro-D- allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D-ribose, D-4-thioribose, L-ribose, L-4- thioribose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, D-xylofuranose, L-xylofruanose, and xylulose, preferably wherein the at least one carbohydrate ligand, or each occurrence thereof, is selected to be galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine. 76. The compound according to embodiment 75, wherein the at least one carbohydrate ligand, or each occurrence thereof, is N-acetyl-galactosamine (GalNAc). 77. The compound according to any preceding embodiment, wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, and at least two occurrences of the carbohydrate ligand are independently selected to be galactose or a derivative thereof, such as galactose, D- galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl- galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, preferably N-acetyl- galactosamine (GalNAc). 78. The compound according to any preceding embodiments, wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and at least two occurrences of the carbohydrate ligand are the same, preferably wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and each occurrence of the carbohydrate ligand is the same. 79. The compound according to any preceding embodiment, wherein each occurrence of the carbohydrate ligand is independently selected to be galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl- N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably each occurrence of the carbohydrate ligand is N- acetyl-galactosamine (GalNAc). 80. The compound according to any preceding embodiment, wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, each occurrence of the carbohydrate ligand being the same, and being selected from galactose or a derivative thereof, such as galactose, D- galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl- galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, preferably each occurrence of the carbohydrate ligand is N-acetyl-galactosamine (GalNAc). 81. The compound according to any preceding embodiment, wherein the carbohydrate ligand moiety B is a multi-antennary carbohydrate ligand cluster, wherein each carbohydrate ligand is the same and is selected from galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably the carbohydrate ligand moiety B is a biantennary or triantennary carbohydrate ligand cluster, and more preferably each occurrence of the carbohydrate ligand is N-acetyl-galactosamine (GalNAc). 82. The compound according to any preceding embodiment, wherein the carbohydrate ligand moiety B is a multi-antennary GalNAc cluster, preferably a biantennary or triantennary GalNAc cluster, and more preferably a triantennary GalNAc cluster. 83. The compound according to any preceding embodiment, wherein the carbohydrate ligand moiety B is selected from the following formula: (IIIa); (IIIb); (IIIc); (IIId); (IIIe); or (IIIf); where LGis a carbohydrate ligand, preferably wherein for each of (IIIa) to (IIIf), each occurrence of carbohydrate ligand LGis independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucose, fucosamine, fuculose, galactose or a derivative thereof such as D-galactose, L-galactose, D- galactosamine, α-D-galactosamine, N- formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, glucose, D-glucose, L-glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl-glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno-heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D-mannopyranose, L- mannopyranose, mannose-6-phosphate, mannosamine, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D- glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D- galactopyranose, α-D-galactofuranose, β-D-galactofuranose, sialic acid, 2- amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2- methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D- mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α- neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tri-O-acetyl-1-thio-6- O-trityl-α-D-glucopyramoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra- O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,4-anhydro-D- allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D-ribose, D-4-thioribose, L-ribose, L-4- thioribose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, D-xylofuranose, L-xylofruanose, and xylulose, preferably wherein for each of (IIIa) to (IIIf), at least one occurrence of the carbohydrate ligand LGis selected to be galactose or a derivative thereof, such as galactose, D- galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl- galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, and more preferably, for each of (IIIa) to (IIIf), at least one occurrence of the carbohydrate ligand LGis N-acetyl-galactosamine (GalNAc). Formula (IIIa); (IIIb); (IIIc); (IIId); (IIIe); and (IIIf) are as shown herein. The compound according to embodiment 83, wherein for each of (IIIa) to (IIIf), each occurrence of the carbohydrate ligand LGis the same, or for each of (IIId), (IIIe) and (IIIf), at least two occurrences of the carbohydrate ligand LGare the same. 85. The compound according to 83 or 84, wherein for formula (IIId), (IIIe) and (IIIf), at least two occurrences of carbohydrate ligand LGare independently selected from galactose, D-galactosaminitol, galactosamine, N- formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably, at least two occurrences of the carbohydrate ligand LGare N-acetyl-galactosamine (GalNAc). 86. The compound according to any of embodiments 83 to 85, wherein for each of (IIIa) to (IIIf), each occurrence of the carbohydrate ligand LGis independently selected from galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl-galactosamine, N- acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, and preferably, each occurrence of the carbohydrate ligand is N-acetyl- galactosamine (GalNAc). 87. The compound according to any of embodiments 83 to 86, wherein the carbohydrate ligand moiety B is selected from formula (IIIb), (IIId), (IIIe), and (IIIf), preferably the carbohydrate ligand moiety B is selected from formula (IIIb), (IIId), and (IIIf). 88. The compound according to any of embodiments 83 to 87, wherein for formula (IIIa) to (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain, preferably for formula (IIIa) to (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in its main chain, and optionally the one or more heteroatom in the main chain is selected from N, S, P and O, or combinations thereof, and the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably disulfide, amide, phosphodiester and polyethylene glycol groups, or combinations thereof, and more preferably the one or more heteroatom in the main chain is from N, S, and O, or combinations the one or more heteroatom-containing group is selected from disulfide, amide, and polyethylene glycol groups or combinations thereof. The compound according to any of embodiments 83 to 88, wherein for formula (IIIa) to (IIIf), for each occurrence, the tether may have a main chain length of from 8 to 24 atoms, such as from 10 to 22 atoms, or from 12 to 20 atoms. The compound according to any of embodiments 83 to 89, wherein for formula (IIIa) to (IIIf), for each occurrence, a carbon atom of the at least one alkylene moiety is substituted with a second tether, wherein the second tether is the same or different to the first. The compound according to any of embodiments 83 to 90, wherein for formula (IIIb) to (IIIf) each occurrence of the tether may be different to each other, or maybe the same as each other. The compound according to any of embodiments 83 to 91, wherein the carbohydrate ligand moiety B is selected from the following formula: (IVa); (IVb); (IVc); (IVd); (IVe); (IVf); (IVg); (IVh); or (IVi); wherein for each occurrence, n is independently selected from 1 to 6, such as from 1 to 5; and for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain. Formula (IVa); (IVb); (IVc); (IVd); (IVe); (IVf); (IVg); (IVh); and (IVi) are as shown herein. The compound according to any of embodiments 83 to 92, wherein the carbohydrate ligand moiety B is selected from the following formula: (IVa’); (IVb’); (IVc’); (IVd’); (IVe’); (IVf’); or (IVg’). Formula (IVa’); (IVb’); (IVc’); (IVd’); (IVe’); (IVf’); and (IVg’) are as shown herein. The compound according to embodiment 92, wherein, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, and optionally, the one or more heteroatom in the main chain is selected from N, S, P and O, or combinations thereof, the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably disulfide, amide, phosphodiester and polyethylene glycol groups or combinations thereof, more preferably the one or more heteroatom in the main chain is selected from N, S, and O, or combinations thereof, and the one or more heteroatom- containing group is selected from disulfide, amide, and polyethylene glycol groups or combinations thereof, and more preferably the one or more heteroatom in the main chain is selected from N, and O, or combinations thereof, and the one or more heteroatom-containing group is selected from, and polyethylene glycol groups, or combinations thereof. 95. The compound according to embodiment 92 to 94, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5comprises one or more PEG groups. 96. The compound according to embodiment 92 to 95, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5comprises 2 to 5 PEG groups, such as 2 to 4 PEG groups. 97. The compound according to any of embodiments 92 to 96, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5has a main chain length of from 9 to 24 atoms, such as from 10 to 22 atoms, or from 12 to 20 atoms, and / or for formula (IVb) to (IVi) and (IVb’) to (IVg’), each occurrence of R5may be different to each other, or maybe the same as each other, preferably the same. 98. The compound according to any of embodiments 92 and 94 to 97, wherein the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi), preferably, the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi), and more preferably, the carbohydrate ligand moiety B is selected from formula (IVd), (IVf), and (IVh). The compound according to of embodiments 93 to 97, wherein the carbohydrate ligand moiety B is selected from formula (IVb’) (IVd’), (IVe’), (IVf’), and (IVg’), preferably, the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVf’), and (IVg’), and more preferably, the carbohydrate ligand moiety B is selected from formula (IVd’), and (IVf’). The compound according to any of embodiments 92 to 99, wherein, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected from: (R5a); (R5b); (R5c); (R5d); (R5e); (R5f); (R5g); (R5h) (R5i); (R5j); (R5k); (R5m); (R5n); (R5p); (R5q);(R5r); where each occurrence of n is independently selected from 1 to 20, and each occurrence of p is independently selected from 1 to 6, preferably, where each occurrence of n is selected from 1 to 10, such as from 1 to 5, or from 1 to 3 and / or where each occurrence of p is independently selected from 2 to 5, such as to 2 to 4, or 2 or 3. Formula (R5a); (R5b); (R5c); (R5d); (R5e); (R5f); (R5g); (R5h) (R5i); (R5j); (R5k); (R5m); (R5n); (R5p); (R5q); and(R5r) are as shown herein. The compound according to any of embodiments 92 to 100, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected from: (R5a); (R5b); (R5c); (R5d); (R5e); (R5f); (R5g); (R5h), more preferably: (R5a); (R5b); (R5d); or (R5f). Formula (R5a); (R5b); (R5c); (R5d); (R5e); (R5f); (R5g); and (R5h) are as shown herein. The compound according to any of embodiments 92 to 101, wherein, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is selected from: (R5a’); (R5b’); (R5c’); (R5d’); (R5e’); (R5f’); (R5g’); (R5h’); (R5i’); (R5j’); (R5k’); (R5m’); (R5n’); (R5p’); (R5q’); (R5r’), preferably: (R5a’); (R5b’); (R5c’); (R5d’); (R5e’); (R5f’);(R5g’); (R5h’); or (R5i’). Formula (R5a’); (R5b’); (R5c’); (R5d’); (R5e’); (R5f’); (R5g’); (R5h’); (R5i’); (R5j’); (R5k’); (R5m’); (R5n’); (R5p’); (R5q’); and (R5r’) are as shown herein. The compound according to any of embodiments 1 to 102, wherein the carbohydrate ligand moiety B is selected from the following formula: (Va); (Vb); (Vc); (Vd); (Ve); or (Vf), where x is from 1 to 5, such as 2 to 4; and n is from 2 to 6, and preferably formula (Vc) and (Vd) have the following ; (Va); 5 . 104. The compound according to 103, wherein the carbohydrate ligand moiety B is of formula (Va), (Vc) and (Ve). Formula (Va), (Vc) and (Ve) are as shown herein. 105. The compound according to any of embodiments 1 to 104, wherein the carbohydrate ligand moiety B is selected from: (VIa); (VIb); or (VIc); where preferably formula (VIc) has the following stereochemistry: , (VIIc), (VIIc). Formula (VIa); (VIb); and (VIc) are as shown herein. The compound according to embodiments 5 to 110, wherein: X1is selected from O, S and N-S(O)2-CH3and X2is a hydroxyl group, preferably X1is O and X2is a hydroxyl group; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb); and carbohydrate ligand moiety B is selected from formula (IVa) to (IVi), preferably the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi), more preferably, from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi), and more preferably, from formula (IVd), (IVf) and (IVh); preferably wherein: X1is selected from O, S and N-S(O)2-CH3and X2is a hydroxyl group, preferably X1is O and X2is a hydroxyl group; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb); and carbohydrate ligand moiety B is selected from formula (IVa’) to (IVg’), preferably the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVe’), (IVf’), and (IVg’), more preferably, from formula (IVb’), (IVd’), (IVf’), and (IVg’), and more preferably, from formula (IVd’) and (IVf’). The compound according to any of embodiments 5 to 106, wherein: X1is selected from O, S and N-S(O)2-CH3and X2is a hydroxyl group, preferably X1is O and X2is a hydroxyl group; R1is selected from: ; . preferably R1is selected from: ; (Vd); (Ve); or (Vf), where preferably Formula (Vc) and (Vd) have the following stereochemistry: ;
[0019] , and (Ve), more preferably (Vc). Formula (Va); (Vb); (Vc); (Vd); (Ve); and (Vf) are as shown herein. 108. The compound according to any of embodiments 5 to 107, wherein: X1is selected from O, S and N-S(O)2-CH3and X2is a hydroxyl group, preferably X1is O and X2is a hydroxyl group; R1is selected from: ; where preferably formula (VIc) has the following stereochemistry: , ; or (VIIc); where preferably formula (VIIc) has the following stereochemistry: (VIIc), and more preferably ligand moiety B is of formula (VIIc). Formula (VIa); (VIb); and (VIc), and (VIIa); (VIIb); and (VIIc) are as shown herein. The compound according to any of embodiments 1 to 108, wherein the compound is selected from the following formula: (Ia); (Ib); or (Ic), where preferably formula (Ia), (Ib) and (Ic) have the following stereochemistry:
[0020] ; . , (Ib) and (Ic) are as shown herein. The compound according to embodiments 52 to 54, wherein the compound comprises the following formula: (Ia’); (Ib’); or (Ic’), and preferably (Ia’’); (Ib’’); (Ic’’); where preferably the formula (Ia’) to (Ic’) and (Ia’’) to (Ic’’) have the following stereochemistry: ; ; ;
[0021] and more preferably compound comprises formula (Ia’) or (Ia’’). Formula (Ia’), (Ib’), (Ic’), (Ia’’), (Ib’’), and (Ic’’) are as shown herein. 111. A pharmaceutical composition comprising the compound according to any of embodiments 1 to 110, and a pharmaceutically acceptable excipient or diluent. 112. A compound according to any of embodiments 1 to 110, or pharmaceutical composition according to embodiment 111, for therapeutic use. 113. The compound or pharmaceutical composition according to embodiment 112, wherein the therapeutic use involves editing of a target RNA, to effect loss-of- function or gain-of-function in a translated product of the target RNA, preferably site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). 114. A compound according to any of embodiments 1 to 110, or a pharmaceutical composition according to embodiment 111, for use in site-directed A-to-I editing of a target RNA, preferably for use in site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). 115. A compound according to any of embodiments 1 to 110, or a pharmaceutical composition according to embodiment 111, for use as a medicament. 116. A compound according to any of embodiments 1 to 110, or pharmaceutical composition according to embodiment 111, for use in the treatment or prevention of a genetic disease or genetic disorder. 117. A compound according to any of embodiments 1 to 110, or a pharmaceutical composition according to embodiment 111, for use in the treatment or prevention of a disease or disorder involving editing of a target RNA, to effect loss-of-function or gain-of-function in a translated product of the RNA, preferably involving site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). 118. A method for treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering an effective amount of the compound according to any of 1 to 110 or the pharmaceutical composition according to embodiment 111. 119. The method according to embodiment 118, wherein the method for treatment or prevention involves editing of the target RNA, to effect loss-of-function or gain-of-function in a translated product of the RNA, preferably site-directed A- to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). 120. The method according to embodiment 118 or 119, wherein the disease or disorder is a genetic disease or genetic disorder. 121. The compound, pharmaceutical composition, or method according to any of embodiments 116 to 120, wherein the disease or disorder is selected from liver or metabolic diseases and / or cardiac or cardiovascular diseases associated with a gain-of-function (GOF) or loss-of-function (LOF) mutation. 122. The compound, pharmaceutical composition, or method according to any of embodiments 116 to 121, wherein the disease or disorder comprises the SERPINA1 gene or an alpha-1-antitrypsin deficiency (A1AD or AATD), optionally wherein the target protein is alpha-1 antitrypsin. 123. A method of carrying out site-directed A-to-I editing of a target RNA, preferably site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the method comprising administering an effective amount of the compound according to any of embodiments 1 to 110, or the pharmaceutical composition according to embodiment111. 124. An in vitro method for site-directed A-to-I editing of a target RNA, the method comprising a step of contacting a cell with the compound according to any of embodiments 1 to 110, or the pharmaceutical composition according to embodiment 111. 125. The in vitro method of embodiment 124, comprising, after the step of contacting, the following steps: (a) allowing uptake by of the compound according to any of embodiments 1 to 110; (b) allowing annealing of the oligonucleotide A to the target RNA; and (c) allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild type enzyme to deaminate the target adenosine in the target RNA sequence to an inosine. 126. The method according to embodiment 124 or 125, wherein the ADAR is ADAR1. REFERENCES 1. Cideciyan, A. V.; Jacobson, S. G.; Drack, A. V.; Ho, A. C.; Charng, J.; Garafalo, A. V.; et al. (2019). Effect of an intravitreal antisense oligonucleotide on vision in Leber congenital amaurosis due to a photoreceptor cilium defect. Nat. Med. 25(2): 225-228. 2. Gagliardi, M., and Ashizawa, A. T. (2021). The Challenges and Strategies of Antisense Oligonucleotide Drug Delivery. Biomedicines.9(4): 433. 3. Zinshteyn, B., and Nishikura, K. (2009). Adenosine-to-inosine RNA editing. Rev. Syst. Biol. Med.1(2): 202-209. 4. Wulff, B.-E.; and Nishikura, K. (2010). Substitutional A-to-I RNA editing. Interdiscip. Rev. RNA.1(1): 90–101. 5. Tomaselli, S.; Locatelli, F.; Gallo, A. (2014). The RNA editing enzymes ADARs: mechanism of action and human disease. Cell and Tissue Research.356: 527– 532. 6. Bass, B.L.; Weintraub H. (1987). A developmentally regulated activity that unwinds RNA duplexes. Cell.48:607–13. 7. Rebagliati, M.R.; Melton D. A. (1987). Antisense RNA injections in fertilized frog eggs reveal an RNA duplex unwinding activity. Cell.48: 599–605. 8. Stephenson, M. L; Zamecnik, P. C.. (1978). Inhibition of Rous sarcoma viral RNA translation by a specific oligodeoxyribonucleotide. Proc. Natl. Acad. Sci. USA.75(1): 285-288. 9. Quemener, A. M.; Bachelot, L.; A.; Donnou-Fournet, E.; Gilot, D.; and Galibert, M.-D. (2019). The powerful world of antisense oligonucleotides: From bench to bedside. Wiley Interdiscip. Rev. RNA.11(5): e1594. 10. Thomas, J. M.; and Beal, P. A. (2017). How do ADARs bind RNA? New protein- RNA structures illuminate substrate recognition by the RNA editing ADARs. Bioassays.39(4): 1-. 11. Crooke, S. T.; Vickers, T. A.; and Liang, X. (2020). Phosphorothioate modified oligonucleotide–protein interactions. Nucleic Acids Research. 48(10): 5235- 5253. 12. Vogel, P.; Schneider, M. F.; Wettengel, J.; and Stafforst, T. (2014). Improving site-directed RNA editing in vitro and in cell culture by chemical modification of the guide RNA. Angew. Chem. Int. Ed. Engl.53(24): 6267-6271. 13. Merkle, T.; Merz, S.; Reautschnig, P.; Blaha, A.; Li, Q.; Vogel, P.; Wettengel, J; Li, J. B.; Stafforst, T. (2019). Precise RNA editing by recruiting endogenous ADARs with antisense oligonucleotides. Nature Biotechnol.37: 133-138 14. Baenziger and Fiete, 1980, Cell, 2611-620. 15. Connolly et al., 198, J. Biol. Chem., 257, 939-945. 16. Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012).
Claims
CLAIMS 1. A compound comprising an oligonucleotide A conjugated to a carbohydrate ligand moiety B comprising at least one carbohydrate ligand, wherein the oligonucleotide A is for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the Oligonucleotide A having a 3’ terminus and a 5’ terminus, and conjugated to the carbohydrate ligand moiety B via its 3’ terminus.
2. The compound according to claim 1, wherein the oligonucleotide A is conjugated to the carbohydrate ligand moiety B via a linker comprising a linking moiety R1having a main chain length of from 4 to 22 atoms.
3. The compound according to claim 2, wherein R1is attached to the oligonucleotide A via a phosphodiester (PO) or modified phosphodiester group or linkage, preferably via a phosphodiester (PO), phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, and more preferably a phosphorothioate (PS) group or linkage.
4. The compound according to claim 2 or 3, wherein the linker between the carbohydrate ligand moiety B and the oligonucleotide A has the following structure: wherein X1isand N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group (-OH), and -O- ; X1is O, and X2is selected from -SH or -S-; or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3,; 5. The compound according to any of claims 1 to 4, wherein the compound is of formula (I): wherein X1isN-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-; X1is O, and X2is selected from -SH or S-; or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3, ;R1has a main chain length of from 4 to 22 atoms.
6. The compound according to any of claims 2 to 5, whereinR1is selected from the ; ;;;; ;;;; , , , is 0 or 1, m is 0 to 16, and n is 0 to 17, with the proviso that if k is 0, m is 1 to 16 and if m is 0, k is from 1 to 16, each occurrence of L is independently selected from a direct bond and C1-4alkylene, and each occurrence of Y and Z is independently selected from O, S and NRc, where Rcis selected from hydrogen and C1-4alkyl; for formula (IIb) and (IIb’), n is 1 to 19, and each occurrence of R2and R3is independently selected from hydrogen and C1-4alkyl; for formula (IIc) and (IIc’), m is 1 to 5, n is 0 to 15, and each occurrence of Y is independently selected from O and S; for formula (IId) and (IId’), k is 1 to 4, m is 1 to 10, and n is 1 to 16; for formula (IIe) and (IIe’), m is 1 to 16, and n is 1 to 16; for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 16, n is 1 to 16, Y is selected from O, S or NRc, where Rcis selected from hydrogen and C1-4alkyl, and Z is selected from O or S; for formula (IIg) and (IIg’), m is 1 to 15 and n is 1 to 15; for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 1 to 15 and n is 1 to 15; with the proviso that R1has a main chain length of from 4 to 22 atoms.
7. The compound according to any of claims 2 to 6, wherein R1has a main chain length of from 4 to 18 atoms, preferably from 4 to 13 atoms, or from 4 to 12 atoms, or from 4 to 10 atoms, more preferably from 6 to 12 atoms, or from 6 to 11 atoms, or from 6 to 10 atoms, and more preferably from 7 to 12 atoms, or from 7 to 11 atoms, or from 7 to 10 atoms, or even 7 to 9 atoms.
8. The compound according to claims 3 to 7, wherein: X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-; preferably wherein: X1is selected from O and S, and X2is selected from a hydroxyl group and - O-, such as X1is O, and X2is selected from a hydroxyl group and -O-; or X1is O, and X2is selected from -SH or -S-.
9. The compound according to any of claims 2 to 8, wherein R1is a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain, or R1 may be a linking moiety comprising at least one alkylene moiety, at least one cyclic moiety, and optionally one or more heteroatom or heteroatom-containing group in its main chain, preferably R1is a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom- containing group in its main chain, and more preferably R1is a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in its main chain.
10. The compound according to claim 9, wherein the one or more heteroatom in the main chain is selected from N, S, P and O, or combinations thereof, and the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably the one or more heteroatom in the main chain is selected from O, N and S, or combinations thereof, and the one or more heteroatom- containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, and amide groups, or combinations thereof, and optionally the at least one alkylene moiety of R1is substituted with one or more substituents independently selected from: hydroxyl, -C1-4alkyl-hydroxyl such as -CH2-OH, -NRcwhere Rcis selected from hydrogen and C1-4alkyl, - C1-4alkoxy, nitro (-NO2), thiol, -S-C1-4alkyl, and halogen, preferably selected from hydroxyl and -C1-4alkyl-hydroxyl.
11. The compound according to of claims 6 to 10, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 14, and / or k is 0 to 12, and / or l is 0 or 1, and / or m is 0 to 12, and / or n is 0 to 13, with the proviso that if k is 0, m is 1 to 12 and if m is 0, k is from 1 to 12, preferably j is 0 to 14, k is 0 to 12, l is 0 or 1, m is 0 to 12, and / or n is 0 to 13, with the proviso that if k is 0, m is 1 to 12 and if m is 0, k is from 1 to 12, more preferably j is 0 to 7 and / or k is 0 or 1 and / or l is 0 or 1 and / or m is 0 or 1 and / or n is 0 to 7, with the proviso that if k is 0, m is 1 and if m is 0, k is 1, and more preferably j is 0 to 7, k is 0 or 1, l is 0 or 1, m is 0 or 1 and n is 0 to 7, with the proviso that if k is 0, m is 1 and if m is 0, k is 1.
12. The compound according to claim 11, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 0 to 5 and / or k is 0 or 1 and / or l is 0 or 1 and / or m is 0 or 1 and / or n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1, preferably j is 0 to 5, k is 0 or 1, l is 0 or 1, m is 0 or 1, and n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1.
13. The compound according to claim 11 or 12, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 0, k is 0, l is 0, m is 1, and n is 3 to 7, or j is 1, k is 0, l is 0, m is 1, and n is 2 to 6, or j is 2, k is 0, l is 0, m is 1, and n is 1 to 5, or j is 3, k is 0, l is 0, m is 1, and n is 0 to 4, or j is 4, k is 0, l is 0, m is 1, and n is 1 to 3, or j is 5, k is 0, l is 0, m is 1, and n is 0 to 2, or j is 6, k is 0, l is 0, m is 1, and n is 1, or j is 7, k is 0, l is 0, m is 1, and n is 0, or j is 0, k is 1, l is 0, m is 0, and n is 3 to 7, or j is 1, k is 1, l is 0, m is 0, and n is 2 to 6, or j is 2, k is 1, l is 0, m is 0, and n is 1 to 5, or j is 3, k is 1, l is 0, m is 0, and n is 0 to 4, or j is 4, k is 1, l is 0, m is 0, and n is 1 to 3, or j is 5, k is 1, l is 0, m is 0, and n is 0 to 2, or j is 6, k is 1, l is 0, m is 0, and n is 1, or j is 0, k is 0, l is 1, m is 1, and n is 0 to 4, orj is 1, k is 0, l is 1, m is 1, and 0 to 3, or j is 2, k is 0, l is 1, m is 1, and n is 0 to 2, or j is 3, k is 0, l is 1, m is 1, and n is 0 or 1, or j is 4, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 0 to 4, or j is 1, k is 1, l is 1, m is 0, and n is 0 to 3, or j is 2, k is 1, l is 1, m is 0, and n is 0 to 2, or j is 3, k is 1, l is 1, m is 0, and n is 0 or 1, or j is 4, k is 1, l is 1, m is 0, and n is 0.
14. The compound according to any of claims 11 to 13, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 0, m is 1, and n is 4, or j is 2, k is 0, l is 0, m is 1, and n is 3, or j is 3, k is 0, l is 0, m is 1, and n is 2, or j is 4, k is 0, l is 0, m is 1, and n is 1, or j is 5, k is 0, l is 0, m is 1, and n is 0, or j is 1, k is 1, l is 0, m is 0, and n is 4, or j is 2, k is 1, l is 0, m is 0, and n is 3, or j is 3, k is 1, l is 0, m is 0, and n is 2, or j is 4, k is 1, l is 0, m is 0, and n is 1, or j is 5, k is 1, l is 0, m is 0, and n is 0, or j is 0, k is 0, l is 1, m is 1, and n is 2, or j is 1, k is 0, l is 1, m is 1, and n is 1, or j is 2, k is 0, l is 1, m is 1, and n is 0, or j is 0, k is 1, l is 1, m is 0, and n is 2, or j is 1, k is 1, l is 1, m is 0, and n is 1, or j is 2, k is 1, l is 1, m is 0, and n is 0, preferably: j is 1, k is 0, l is 1, m is 1, and n is 1.
15. The compound according to any of claims 6 to 14, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of L is independently selected from a direct bond and C1-2alkylene, preferably each occurrence of L isindependently selected direct bond and C1alkylene, and more preferably each occurrence of L is C1alkylene.
16. The compound according to any of claims 6 to 15, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH.
17. The compound according to any of claims 6 to 16, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), each occurrence of Z is O.
18. The compound according to any of claims 6 to 17, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 0 to 5, k is 0 or 1, l is 0 or 1, m is 0 or 1, and n is 0 to 4, with the proviso that if k is 0, m is 1, and if m is 0, k is 1; each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O.
19. The compound according to claim 18, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 0, m is 1, and n is 4, or j is 2, k is 0, l is 0, m is 1, and n is 3, or j is 3, k is 0, l is 0, m is 1, and n is 2, or j is 4, k is 0, l is 0, m is 1, and n is 1, or j is 5, k is 0, l is 0, m is 1, and n is 0, or j is 1, k is 1, l is 0, m is 0, and n is 4, or j is 2, k is 1, l is 0, m is 0, and n is 3, or j is 3, k is 1, l is 0, m is 0, and n is 2, or j is 4, k is 1, l is 0, m is 0, and n is 1, or j is 5, k is 1, l is 0, m is 0, and n is 0, or j is 0, k is 0, l is 1, m is 1, and n is 2, or j is 1, k is 0, l is 1, m is 1, and n is 1, orj is 2, k is 0, l is 1, m is 1, and 0, or j is 0, k is 1, l is 1, m is 0, and n is 2, or j is 1, k is 1, l is 1, m is 0, and n is 1, or j is 2, k is 1, l is 1, m is 0, and n is 0 each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O.
20. The compound according to claim 18 or 19, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), j is 1, k is 0, l is 1, m is 1, and n is 1; each occurrence of L is independently selected from a direct bond or C1-2alkylene, preferably from a direct bond and C1alkylene, and more preferably C1alkylene; each occurrence of Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH; and each occurrence of Z is O.
21. The compound according to any of claims 18 to 20, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’): j is 1, k is 0, l is 1, m is 1, and n is 1; each occurrence of L is C1alkylene; each occurrence of Y is NH; and each occurrence of Z is O.
22. The compound according to any of claims 6 to 21, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from:
23. The compound according to 22, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: ; ;24. The compound according to claim 22 or 23, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from:.
25. The compound according to any of claims 22 to 24, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is: .
26. The compound according to any of claims 22 to 25, wherein for formula (IIa), (IIa’), (IIa’’) and (IIa’’’), R1is selected from: .
27. The compound according to any of claims 6 to 26, wherein for formula (IIb) and (IIb’), n is 1 to 15, or 3 to 12, preferably 4 to 8, and more preferably 6.
28. The compound according to any of claims 6 to 27, wherein for formula (IIb) and (IIb’), each occurrence of R2and R3is independently selected from hydrogen and C1-3alkyl, preferably wherein each occurrence of R2and R3are hydrogen.
29. The compound according to any of claims 6 to 28, wherein for formula (IIb) and (IIb’), R1is selected from:.
30. and (IIb’), R1is of formula (IIb), preferably: .
31. The compound according to any of claims 6 to 30, wherein for formula (IIc) and (IIc’), m is 1 to 4, and / or n is 0 to 11, preferably m is 1 to 4 and n is 0 to 11, more preferably m is 1 or 2 and / or n is 0 to 4, more preferably m is 1 or 2 and n is 0 to 4, more preferably m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, more preferably m is 1 and n is 0 to 4, and most preferably m is 1 and n is 2.
32. The compound according to any of claim 6 to 31, wherein for formula (IIc) and (Iic’), each occurrence of Y is O, each occurrence of Y is S, or each occurrence of Y alternates between O and S, preferably each occurrence of Y is O.
33. The compound according to claim 31 or 32, wherein for formula (IIc) and (IIc’): 1, preferably m is 1 and n is 0each occurrence of Y is O, of Y is S, or each occurrence of Y alternates between O and S.
34. The compound according to any of claims 31 to 33, wherein for formula (IIc) and (IIc’): m is 1 and n is 0 to 4, or m is 2 and n is 0 or 1, preferably m is 1 and n is 0 to 4, and more preferably m is 1 and n is 2; and each occurrence of Y is O, and more preferably: for formula (IIc) and (IIc’), R1is selected from:
35. The compound according to any of claims 6 to 34, wherein for formula (IId) and (IId’), k is 1 to 3, and / or m is 1 to 6, and / or n is 1 to 12, more preferably k is 1 to 3, m is 1 to 6, and n is 1 to 12, preferably: k is 1 and / or m is 1 to 6 and / or n is 1 to 12, or k is 2 and / or m is 1 to 3 and / or n is 1 to 9, or k is 3, and / or m is 1 and / or n is 1 to 6, more preferably: k is 1, m is 1 to 6, and n is 1 to 12, or k is 2, m is 1 to 3, and n is 1 to 9, or k is 3, m is 1 and n is 1 to 6.
36. The compound according to claim 35, wherein for formula (IId) and (IId’), k is 1, m is 1 to 6, and n is 1 to 12, preferably k is 1, m is 1 or 2 and n is 1 to 5.
37. The compound according to claim 35 or 36, wherein for formula (IId) and (IId’): k is 1, m is 1 or 2, and n is 1 to 5, or k is 1, m is 1, and n is 1 to 5, or k is 1, m is 2, and n is 1 to 3, preferably: k is 1, m is 1 and n is 3, or k is 1, m is 2 and n is 1.
38. The compound according to any of claim 6 to 37, wherein for formula (IId) and (IId’), R1is selected from:
39. The formula (IIe) and (IIe’), m is 1 to 12, and / or n is 1 to 12, preferably m is 1 to 12 and n is 1 to 12, more preferably m is 1 to 5 and / or n is 1 to 3, and more preferably m is 1 to 5 and n is 1 to 3.
40. The compound according to claim 39, wherein for formula (IIe) and (IIe’): m is 1 to 5, and n is 1, or m is 1 to 4, and n is 2, or m is 1 to 3 and n is 3. preferably: m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3.
41. The compound according to any of claims 6 to 40, wherein for formula (IIe) and (IIe’), R1is selected from: ; ;42. The compound according to claims 6 to 41, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’), m is 1 to 12, and / or n is 1 to 12, preferably m is 1 to 12, and n is 1 to 12, more preferably m is 1 to 5 and / or n is 1 to 3, and more preferably m is 1 to 5 and n is 1 to 3.
43. The compound according to claim 42, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 1 to 5 and n is 1, or m is 1 to 4 and n is 2, or m is 1 to 3 and n is 3, preferably: m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3.
44. The compound according to claim 42 or 43, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’), Z is O, and / or Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, preferably NH.
45. The compound according to any of claims 42 to 44, wherein for formula (IIf), (IIf’), IIf’’) and (IIf’’’): m is 1 to 5 and n is 1, or m is 1 to 4 and n is 2, or m is 1 to 3 and n is 3; Z is O; and Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH; preferably: m is 3 and n is 1, or m is 2 and n is 2, or m is 1 and n is 3; Z is O; and Y is NRc, where Rcis selected from hydrogen and C1-4alkyl, such as NH; more preferably, R1is selected from:IJ44 ; ; ; ; ; ; ;; ;46. formula (IIg) and (IIg’), m is 1 to 11 and / or n is 1 to 11, preferably m is 1 to 11 and n is 1 to 11, more preferably m is 1 to 4 and / or n is 1 to 3, and more preferably m is 1 to 4 and n is 1 to 3.
47. The compound according to claim 46, wherein for formula (IIg) and (IIg’): m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, or m is 1 or 2 and n is 3, preferably: m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, and more preferably: m is 2 and n is 1, or n is 1 and n is 2.
48. The compound according to any of claims 6 to 47, wherein for formula (IIg) and (IIg’), R1is selected from:.
49. The compound according to claims 6 to 48, wherein for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 11 and / or n is 11, preferably m is 11 and n is 11, more preferably m is 1 to 4 and / or n is 1 to 3, and more preferably m is 1 to 4 and n is 1 to 3.
50. The compound according to claim 49, wherein for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, or m is 1 or 2 and n is 3, preferably: m is 1 to 4 and n is 1, or m is 1 to 3 and n is 2, and more preferably: m is 2 and n is 1, or m is 1 and n is 2.
51. The compound according to any of claims 6 to 50, wherein for formula (IIh), (IIh’), (IIh’’) and (IIh’’’), R1is selected from: ; ;52. The compound according to any of claims 6 to 51, wherein R1is selected from formula (IIa), (IIa’’), (IIb), (IIc), (IId), (IIe), (IIf), (IIf’’), (IIg), (IIh), and (IIh’’), or R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb), (IIb’), (IId) and (IId), preferably formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), more preferably (IIa), (IIa’) and (IIb), and more preferably (IIa) and (IIb).
53. The compound according to any of claims 6 to 52, wherein R1is selected from; ; ; ; ; ;54. from: ; ,.
55. The .
56. The .
57. The is attached to the oligonucleotide A via a phosphodiester or modified phosphodiester group or linkage, preferably via a phosphodiester, phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, and more preferably a phosphorothioate (PS) group or linkage; and R1is selected from:
58. The compound according to any of claims 4 to 57, wherein: (a) X1is selected from O and S, and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; and (b) R1is selected from:
59. A (VIII) wherein B is a carbohydrate ligand moiety comprising at least one carbohydrate ligand; and R1is selected from the following: ;IJ56.
60. The compound according to claim 59, wherein R1is selected from:.
62. The.
63. The compound according to any of claims 59 to 62, wherein the compound further comprises an oligonucleotide A and oligonucleotide A is joined to the formula (VIII) via a phosphodiester (PO) linkage or modified phosphodiester group or linkage, preferably via a phosphodiester, phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, and more preferably via a phosphorothioate (PS) group or linkage.
64. The compound according to any of claims 59 to 63, wherein the compound further comprises an oligonucleotide A, and / or wherein the compound comprises the following formula (VIIIa): (VIIIa)wherein X1is2- and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and O-; X1is O, and X2is selected from -SH or -S-; or or X1is O and X2is of formula (a) or (b), where each instance of Raand Rbis independently selected from hydrogen and C1-4alkyl, and q is from 1 to 3,; S(O)2-C6H4- CH3, and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; more preferably wherein X1is selected from O and S, and X2is selected from a hydroxyl group and O-, such as X1is O and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-.
65. The compound according to claim 63 or 64, wherein the compound has the following formula: .
66. The compound any 1 to 58, 63 to 65, wherein the oligonucleotide A is for site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the ADAR being ADAR1.
67. The compound according to any of claims 1 to 58, and 63 to 66, wherein the oligonucleotide A comprises a sequence that is substantially or completely complementary to the target RNA to be edited, except that there will be a mismatch at the site of the edit.
68. The compound according to claims 1 to 58, and 63 to 67, wherein the oligonucleotide A is a single strand oligonucleotide.
69. The compound according to any of claims 1 to 58, and 63 to 68, wherein the oligonucleotide A is chemically modified.
70. The compound according to any of claims 1 to 58, and 63 to 69, wherein the oligonucleotide A comprises a sequence with a length of at least 25 nucleotides (Nx) capable of binding to a target sequence in a target RNA.
71. The compound according to any of claims 1 to 58, and 63 to 70, wherein the oligonucleotide A comprises a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a target adenosine in the target RNA that is to be edited.
72. The compound according to any of claims 69 to 71, wherein the oligonucleotide A comprises one or more chemically modified internucleoside linkages, preferably one or more chemically modified internucleoside linkages selected from a phosphoryl guanidine (PN) linkage, a phosphorothioate (PS) linkage, a toluenesulfonyl (tosyl) linkage, and a methanesulfonyl (mesyl) linkage.
73. The compound according to claim 72, wherein the oligonucleotide A comprises a 3’ and / or 5’ flanking region comprising PS internucleoside linkages located within the 3’ and / or 5’ flanking region.
74. The compound according to claim 72 or 73, wherein for the oligonucleotide A: (i) less than 60%, preferably less than 50%, or less than 40%, of the internucleoside linkages are PO linkages; and / or (ii) no more than 90%, preferably 80%, 70%, 60%, 50%, 40%, 30% or 20%, of the internucleoside linkages are PS linkages.
75. The compound according to any of claims 69 to 74, wherein at least 10%, preferably 20%, 30%, 40%, 50% or 60%, of the nucleotides of the oligonucleotide A are fluoro (F)-modified in the 2’ position of the sugar residue (2’-F), optionally wherein the 2’-F modification is at one or more of the followingnucleotides: 29, 28, 25, 23, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, -8, - 10, -12, -13, -14, and -15.
76. The compound according to any of claims 69 to 75, wherein the oligonucleotide A comprises a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a target adenosine in the target RNA that is to be edited, and at least one of the three nucleotides N-1, N0and N+1of the CBT of the oligonucleotide A is independently selected to be chemically modified at the 2’ position of its sugar residue, or its sugar residue is a deoxyribose.
77. The compound according to claim 76, wherein one or more of the following apply for the oligonucleotide A: (i) the chemical modification at the 2’ position of the sugar residue of the nucleotide N+1 is 2’fluoro (2’-F), 2’fluoroarabinoside (2’FANA), 2’- OMethoxyethyl (2’-MOE) or 2’-O-Methyl (2’-OMe), or the sugar residue of N+1 is deoxyribose; and / or (ii) the chemical modification at the 2’ position of the sugar residue of the nucleotide N0 is 2’-FANA, or the sugar residue of N0 is deoxyribose; and / or (iii) the chemical modification at the 2’ position of the sugar residue of the nucleotide N-1 is 2’-FANA, or 2’-OMe, or the sugar residue of N-1 is deoxyribose.
78. The compound according to any of claims 71 to 77, wherein for oligonucleotide A, N0comprises no 2’-modification of its sugar residue.
79. The compound according to any of claims 71 to 78, wherein for oligonucleotide A, N0 is selected from cytidine, deoxycytidine, uridine, and deoxy uridine, preferably N0is selected from cytidine and deoxycytidine.
80. The compound according to any of claims 71 to 79, wherein the oligonucleotide A comprises a central base triplet (CBT) of three nucleotides (…N-1, N0, N+1…) where N0is the central nucleotide directly opposite to a targetadenosine in the target RNA is to be edited, and at least 50%, more preferably at least 80%, of the nucleotides outside the CBT are chemically modified independently from another at the 2’ position of their sugar residue, preferably wherein the modification is selected from 2’-F, 2’-FANA, 2’-O-alkyl such as 2’-OMe, 2’-O-methoxyethyl (2’-MOE), and / or locked nucleic acid (LNA).
81. The compound according to any of claims 1 to 80, wherein the carbohydrate ligand moiety B comprises a single carbohydrate ligand, or the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, preferably the carbohydrate ligand moiety B comprises two or more carbohydrate ligands.
82. The compound according to any of claims 1 to 81, wherein the carbohydrate ligand moiety B comprises a single carbohydrate ligand having a mono- antennary structure, or the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and has a multi-antennary structure, preferably the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and has a multi-antennary structure.
83. The compound according to claim 81 or 82, wherein the carbohydrate ligand moiety B comprises two carbohydrate ligands and has a bi-antennary structure, or the carbohydrate ligand moiety B comprises three carbohydrate ligands and has a tri-antennary structure, preferably the carbohydrate ligand moiety B comprises three carbohydrate ligands and has a tri-antennary structure.
84. The compound according to any of claims 1 to 83, wherein the at least one carbohydrate ligand, or each occurrence thereof, is a cell surface receptor or cell membrane ligand, preferably a cell surface receptor ligand.
85. The compound according to any preceding claim, wherein the at least one carbohydrate ligand, or each occurrence thereof, is independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucose, fucosamine, fuculose, galactose or a derivative thereof such as D-galactose, L-galactose, D- galactosaminitol, galactosamine, α-D-galactosamine, N-formyl-galactosamine, N-acetyl- (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, glucose, D-glucose, L-glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl-glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno-heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D-mannopyranose, L- mannopyranose, mannose-6-phosphate, mannosamine, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D- glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D- galactopyranose, α-D-galactofuranose, β-D-galactofuranose, sialic acid, 2- amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2- methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D- mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α- neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tri-O-acetyl-1-thio-6- O-trityl-α-D-glucopyramoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra- O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,4-anhydro-D- allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D-ribose, D-4-thioribose, L-ribose, L-4- thioribose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, D-xylofuranose, L-xylofruanose, and xylulose, preferably wherein the at least one carbohydrate ligand, or each occurrence thereof, is selected to be galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine.
86. The compound according to claim 85, wherein the at least one carbohydrate ligand, or each occurrence thereof, is N-acetyl-galactosamine (GalNAc).
87. The compound according to any preceding claim, wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, and at least two occurrences of the carbohydrate ligand are independently selected to be galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine (GalNAc),N-propionyl-galactosamine, N- galactosamine, and N-iso-butanoyl- galactosamine, preferably N-acetyl-galactosamine (GalNAc).
88. The compound according to any preceding claims, wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and at least two occurrences of the carbohydrate ligand are the same, preferably wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands and each occurrence of the carbohydrate ligand is the same.
89. The compound according to any preceding claim, wherein each occurrence of the carbohydrate ligand is independently selected to be galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N- formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably each occurrence of the carbohydrate ligand is N- acetyl-galactosamine (GalNAc).
90. The compound according to any preceding claim, wherein the carbohydrate ligand moiety B comprises two or more carbohydrate ligands, each occurrence of the carbohydrate ligand being the same, and being selected from galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably each occurrence of the carbohydrate ligand is N- acetyl-galactosamine (GalNAc).
91. The compound according to any preceding claim, wherein the carbohydrate ligand moiety B is a multi-antennary carbohydrate ligand cluster, wherein each carbohydrate ligand is the same and is selected from galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably the carbohydrate ligand moiety B is a biantennary or triantennary carbohydrate ligand cluster, and more preferably each occurrence of the carbohydrate ligand is N-acetyl-galactosamine (GalNAc).
92. The compound according to claim, wherein the carbohydrate ligand moiety B is a multi-antennary GalNAc cluster, preferably a biantennary or triantennary GalNAc cluster, and more preferably a triantennary GalNAc cluster.
93. The compound according to any preceding claim, wherein the carbohydrate ligand moiety B is selected from the following: (IIIa); (IIIb); (IIIc); (IIId); (IIIe); or (IIIf);where LGis a carbohydrate ligand, preferably wherein for each of (IIIa) to (IIIf), each occurrence of carbohydrate ligand LGis independently selected from allose, altrose, arabinose, D-arabinose, cladinose, erythrose, erythrulose,fructose, D-fucitol, L-fucitol, fucosamine, fuculose, galactose or a derivative thereof such as D-galactose, L-galactose, D-galactosaminitol, galactosamine, α-D-galactosamine, N-formyl-galactosamine, N-acetyl- galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, glucose, D-glucose, L- glucose, glucose-6-phosphate, glucosaminitol, glucosamine, N-acetyl- glucosamine (GluNAc), glucose glyceraldehyde, L-glycero-D-manno-heptose, glycerol, glycerone, gulose, idose, lyxose, mannose or a derivative thereof, D- mannopyranose, L-mannopyranose, mannose-6-phosphate, mannosamine, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D- mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D- galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D- galactofuranose, sialic acid, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D- glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4- formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D- glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyramoside, 4-thio-β-D- galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco- heptopyranoside, 2,4-anhydro-D-allonitrile, lactose, psicose, quinovose, quinovosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, D- ribose, D-4-thioribose, L-ribose, L-4-thioribose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, D-xylofuranose, L- xylofruanose, and xylulose, preferably wherein for each of (IIIa) to (IIIf), at least one occurrence of the carbohydrate ligand LGis selected to be galactose or a derivative thereof, such as galactose, D-galactosaminitol, galactosamine, N- formyl-galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, and more preferably, for each of (IIIa) to (IIIf), at least one occurrence of the carbohydrate ligand LGis N-acetyl-galactosamine (GalNAc).
94. The compound according to claim 93, wherein for each of (IIIa) to (IIIf), each occurrence of the carbohydrate ligand LGis the same, or for each of (IIId), (IIIe) and (IIIf), at least two occurrences of the carbohydrate ligand LGare the same.
95. The compound according to 93 or 94, wherein for formula (IIId), (IIIe) and (IIIf), at least two occurrences of carbohydrate ligand LGare independently selected from galactose, D-galactosaminitol, galactosamine, N-formyl- galactosamine, N-acetyl-galactosamine (GalNAc), N-propionyl- galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoyl- galactosamine, preferably, at least two occurrences of the carbohydrate ligand LGare N-acetyl-galactosamine (GalNAc).
96. The compound according to any of claims 93 to 95, wherein for each of (IIIa) to (IIIf), each occurrence of the carbohydrate ligand LGis independently selected from galactose or a derivative thereof, such as galactose, D- galactosaminitol, galactosamine, N-formyl-galactosamine, N-acetyl- galactosamine (GalNAc), N-propionyl-galactosamine, N-n-butanoyl- galactosamine, and N-iso-butanoyl-galactosamine, and preferably, each occurrence of the carbohydrate ligand is N-acetyl- galactosamine (GalNAc).
97. The compound according to any of claims 93 to 96, wherein the carbohydrate ligand moiety B is selected from formula (IIIb), (IIId), (IIIe), and (IIIf), preferably the carbohydrate ligand moiety B is selected from formula (IIIb), (IIId), and (IIIf).
98. The compound according to any of claims 93 to 97, wherein for formula (IIIa) to (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain, preferably for formula (IIIa) to (IIIf), for each occurrence, the tether is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in its main chain, and optionally the one or more heteroatom in the main chain is selected from N, S, P and O, or combinations thereof, and the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably disulfide, amide, phosphodiester and polyethylene glycol groups, or combinations thereof, and more preferably the one or more heteroatom in the main chain is from N, S,and O, or combinations the one or more heteroatom-containing group is selected from disulfide, amide, and polyethylene glycol groups or combinations thereof.
99. The compound according to any of claims 93 to 98, wherein for formula (IIIa) to (IIIf), for each occurrence, the tether may have a main chain length of from 8 to 24 atoms, such as from 10 to 22 atoms, or from 12 to 20 atoms.
100. The compound according to any of claims 93 to 99, wherein for formula (IIIa) to (IIIf), for each occurrence, a carbon atom of the at least one alkylene moiety is substituted with a second tether, wherein the second tether is the same or different to the first.
101. The compound according to any of claims 93 to 100, wherein for formula (IIIb) to (IIIf) each occurrence of the tether may be different to each other, or maybe the same as each other.
102. The compound according to any of claims 93 to 101, wherein the carbohydrate ligand moiety B is selected from the following formula: ; ;;;wherein for each occurrence, independently selected from 1 to 6, such as from 1 to 5; and for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and optionally one or more heteroatom or heteroatom-containing group in its main chain.
103. The compound according to any of claims 93 to 102, wherein the carbohydrate ligand moiety B is selected from the following formula: ; ; ; ;.
104. (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected to be a linking moiety comprising at least one alkylene moiety and one or more heteroatom or heteroatom-containing group in the main chain, and optionally,the one or more heteroatom main chain is selected from N, S, P and O, or combinations thereof, and the one or more heteroatom-containing group in the main chain is selected from amine, ester, thioester, carbonate, disulfide, amide, phosphodiester, modified phosphodiester, and polyethylene glycol groups, or combinations thereof, preferably disulfide, amide, phosphodiester and polyethylene glycol groups or combinations thereof, more preferably the one or more heteroatom in the main chain is selected from N, S, and O, or combinations thereof, and the one or more heteroatom- containing group is selected from disulfide, amide, and polyethylene glycol groups or combinations thereof, and more preferably the one or more heteroatom in the main chain is selected from N, and O, or combinations thereof, and the one or more heteroatom-containing group is selected from, and polyethylene glycol groups, or combinations thereof.
105. The compound according to claim 102 to 104, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5comprises one or more PEG groups.
106. The compound according to claim 102 to 105, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5comprises 2 to 5 PEG groups, such as 2 to 4 PEG groups.
107. The compound according to any of claims 102 to 106, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5has a main chain length of from 9 to 24 atoms, such as from 10 to 22 atoms, or from 12 to 20 atoms, and / or for formula (IVb) to (IVi) and (IVb’) to (IVg’), each occurrence of R5may be different to each other, or maybe the same as each other, preferably the same.
108. The compound according to any of claims 102, and 104 to 107, wherein the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi), preferably, the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi), and more preferably, the carbohydrate ligand moiety B is selected from formula (IVd), (IVf), and (IVh).
109. The compound according of claims 103 to 107, wherein the carbohydrate ligand moiety B is selected from formula (IVb’) (IVd’), (IVe’), (IVf’), and (IVg’), preferably, the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVf’), and (IVg’), and more preferably, the carbohydrate ligand moiety B is selected from formula (IVd’), and (IVf’).
110. The compound according to any of claims 102 to 109, wherein, for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected from: ; ;; ; occurrence of p is independently selected from 1 to 6, preferably, where eachoccurrence of n is selected to 10, such as from 1 to 5, or from 1 to 3 and / or where each occurrence of p is independently selected from 2 to 5, such as to 2 to 4, or 2 or 3.
111. The compound according to any of claims 102 to 110, wherein for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is independently selected from: ; ;;.
112. The for formula (IVa) to (IVi) and (IVa’) to (IVg’), for each occurrence, R5is selected from: ; ; ;; ; 5 10 ;; ; .
113. The compound according to claims 1 to 112, wherein the carbohydrate ligand moiety B is selected from the following formula: ;;n is from 2 to 6, and preferably formula (Vc) and (Vd) have the following stereochemistry:; . .
114. The compound according to claim 113, wherein the carbohydrate ligand 5 moiety B is of formula (Va), (Vc) and (Ve).
115. The compound according to claims 1 to 114, wherein the carbohydrate ligand moiety B is selected from: ;; ,where preferably formula the following stereochemistry: (VIIc),(VIIc).
116. The compound according to any of claims 3 to 115, wherein R1is attached to the oligonucleotide A via a phosphodiester (PO) or modified phosphodiester group or linkage, preferably via a phosphodiester, phosphorothioate (PS), phosphoryl guanidine (PN), toluenesulfonyl (tosyl), or methanesulfonyl (mesyl) group or linkage, and more preferably a phosphorothioate (PS) group or linkage; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb), more preferably R1is selected from (IIa); and carbohydrate ligand moiety B is selected from formula (IVa) to (IVi), preferably the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi), more preferably, from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi), and more preferably, from formula (IVd), (IVf) and (IVh); preferably wherein: X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-;R1is selected from formula , , (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb), more preferably R1is selected from (IIa); and carbohydrate ligand moiety B is selected from formula (IVa’) to (IVg’), preferably the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVe’), (IVf’), and (IVg’), more preferably, from formula (IVb’), (IVd’), (IVf’), and (IVg’), and more preferably, from formula (IVd’) and (IVf’).
117. The compound according to any of claims 4 to 116, wherein: X1is selected from O, S, N-S(O)2-CH3, and N-S(O)2-C6H4-CH3, and X2is selected from a hydroxyl group and -O-; or X1 is O, and X2 is selected from - SH or -S-, preferably X1is selected from O and S, and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb), more preferably R1is selected from (IIa); and carbohydrate ligand moiety B is selected from formula (IVa) to (IVi), preferably the carbohydrate ligand moiety B is selected from formula (IVb), (IVd), (IVe), (IVf), (IVg), (IVh) and (IVi), more preferably, from formula (IVb), (IVd), (IVf), (IVg), (IVh) and (IVi), and more preferably, from formula (IVd), (IVf) and (IVh); preferably wherein: X1is selected from O and S, and X2is selected from a hydroxyl group and O- , such as X1is O and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from formula (IIa), (IIa’), (IIa’’), (IIa’’’), (IIb) and (IIb’), preferably, R1is selected from (IIa), (IIa’) and (IIb), and more preferably, R1is selected from (IIa) and (IIb), more preferably R1is selected from (IIa); and carbohydrate ligand moiety B is selected from formula (IVa’) to (IVg’), preferably the carbohydrate ligand moiety B is selected from formula (IVb’), (IVd’), (IVe’), (IVf’), and (IVg’), more preferably, from formula (IVb’), (IVd’), (IVf’), and (IVg’), and more preferably, from formula (IVd’) and (IVf’).
118. The compound according to claims 4 to 117, wherein: X1is selected from O and S, and X2is selected from a hydroxyl group and O- , such as X1is O and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from: ; ; ; ; ;; ; ; ; ; ;;;where preferably Formula (Vc) and (Vd) have the following stereochemistry:, and (Ve), more preferably (Vc).
119. The compound according to any of claims 4 to 118, wherein:X1is selected from O and S, is selected from a hydroxyl group and O- , such as X1is O and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from: ; ; ; ; ;5; ;; ;where preferably Formula (Vd) have the following stereochemistry:, and (Ve), more preferably (Vc).
120. The compound according to any of claims 4 to 119, wherein: X1is selected from O and S, and X2is selected from a hydroxyl group and O- , such as X1is O and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from:(VIIa);;(VIIc), .
121. The compound according to any of claims 115 to 117, wherein X1is selected from O and S, and X2is selected from a hydroxyl group and O-, such as X1is O and X2is selected from a hydroxyl group and O-; or X1is O, and X2is selected from -SH or -S-; R1is selected from:carbohydrate ligand moiety B (VIIc) (VIIc);.is selected from the following formula:; ,where preferably formula (Ia), (Ib) (Ic) have the following stereochemistry: ; ; ;or .
123. The compound according to any of claims 1 to 121, wherein the compound is selected from the following formula:;; ; or .
124. The compound according to claims 59 to 64, wherein the compound comprises the following formula:;; ; ;;and more preferably wherein comprises formula (Ia’), (Ia’’), (Ib’) or (Ib’’).
125. The compound according to claims 59 to 64, wherein the compound comprises the following formula: ; ; ;; more or .
126. A pharmaceutical composition comprising the compound according to any of claims 1 to 125, and a pharmaceutically acceptable excipient or diluent.
127. A compound according to any of claims 1 to 125, or pharmaceutical composition according to claim 126, for therapeutic use.
128. The compound or pharmaceutical composition according to claim 125, wherein the therapeutic use involves editing of a target RNA, to effect loss-of-function or gain-of-function translated product of the target RNA, preferably site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR).
129. A compound according to any of claims 1 to 125, or a pharmaceutical composition according to claim 126, for use in site-directed A-to-I editing of a target RNA, preferably for use in site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR).
130. A compound according to any of claims 1 to 125, or a pharmaceutical composition according to claim 126, for use as a medicament.
131. A compound according to any of claims 1 to 125, or pharmaceutical composition according to claim 126, for use in the treatment or prevention of a genetic disease or genetic disorder.
132. A compound according to any of claims 1 to 125, or a pharmaceutical composition according to claim 126, for use in the treatment or prevention of a disease or disorder involving editing of a target RNA, to effect loss-of- function or gain-of-function in a translated product of the RNA, preferably involving site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR).
133. A method for treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering an effective amount of the compound according to any of claims 1 to 125 or the pharmaceutical composition according to claim 126.
134. The method according to claim 133, wherein the method for treatment or prevention involves editing of the target RNA, to effect loss-of-function or gain- of-function in a translated product of the RNA, preferably site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR).
135. The method according to claim 133 or 134, wherein the disease or disorder is a genetic disease or genetic disorder.
136. The compound, or method according to claim 131 to 135, wherein the disease or disorder is selected from liver or metabolic diseases and / or cardiac or cardiovascular diseases associated with a gain-of- function (GOF) or loss-of-function (LOF) mutation.
137. The compound, pharmaceutical composition, or method according to any of claims 131 to 136, wherein the disease or disorder comprises the SERPINA1 gene or an alpha-1-antitrypsin deficiency (A1AD or AATD), optionally wherein the target protein is alpha-1 antitrypsin.
138. A method of carrying out site-directed A-to-I editing of a target RNA, preferably site-directed A-to-I editing of a target RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR), the method comprising administering an effective amount of the compound according to any of claims 1 to 125, or the pharmaceutical composition according to claim 126.
139. An in vitro method for site-directed A-to-I editing of a target RNA, the method comprising a step of contacting a cell with the compound according to any of claims 1 to 125, or the pharmaceutical composition according to claim 126.
140. The in vitro method of claim 139, comprising, after the step of contacting, the following steps: (a) allowing uptake by the cell of the compound according to any of claims 1 to 125; (b) allowing annealing of the oligonucleotide A to the target RNA; and (c) allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild type enzyme to deaminate the target adenosine in the target RNA sequence to an inosine.
141. The method according to claim 139 or 140, wherein the ADAR is ADAR1.
Citation Information
Patent Citations
Oligonucleotide compositions and methods of use thereof
WO2021071858A1
Methods and compositions for the ADAR-mediated editing of serpina1
WO2021243023A1
Antisense oligonucleotides (ASO) for efficient and precise RNA editing with endogenous adenosine deaminase acting on RNA (ADAR)
WO2023099494A1
Oligonucleotide compositions and methods of use thereof
US20230220384A1
Antisense oligonucleotides (ASO) for efficient and precise RNA editing with endogenous adenosine deaminase acting on RNA (ADAR)
US20230235329A1