Methods for manufacturing nutritional enhancement product for live feed using nutrient-rich microalgae schizochytrium sp. biomass

Abstract

The present invention relates to: a feed composition for zooplankton, comprising biomass derived from Schizochytrium sp. microalgae; a method for culturing zooplankton using same; and an aquaculture method for fish or crustaceans. The biomass derived from Schizochytrium sp. microalgae of the present invention has the effect of nutritionally enriching zooplankton, and when zooplankton fed with the biomass is fed to fish or crustaceans, growth of fish or crustaceans is promoted and non-specific immunity is enhanced, and thus the biomass can be effectively used as a feed composition or a feed additive.

Description

Method for manufacturing a nutritionally enhanced feed product using a strain of the nutrient-rich microalgae Schizochytrium genus

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2024-0021854, dated February 15, 2024, the entire contents of which are incorporated herein by reference.

[0003] Numerous papers and patents are referenced and cited throughout this application. The disclosures of these cited papers and patents are incorporated into this application in their entirety by reference, providing a clearer understanding of the state of the art and the scope of the present invention.

[0004] The present invention relates to a feed composition for zooplankton containing biomass derived from microalgae of the genus Schizochytrium (Schizochytrium sp.), a method for culturing zooplankton using the same, and a method for culturing fish or crustaceans.

[0005] The feeding schedule for fish is applied directly to the production of fish seedlings. Rotifers, fortified with lipids focused on DHA (docosahexaenoic acid), are fed for 2-3 days after hatching. Once the larvae grow to the point where they can consume artemia, they are fed both rotifers and artemia for 2-3 days. After that, they are fed artemia, fortified with DHA, before transitioning to copepods and particle feed.

[0006] Research on unknown mortality occurring in the early stages of seed production is insufficient.

[0007] The mass mortality period that occurs during the fish seed production process is generally divided into three stages. The first mortality period is when the larvae hatch from fertilized eggs with poor egg quality die due to nutritional deficiencies in the broodstock during the yolk absorption process. The second mortality period is when the larvae, which are mainly rotifers supplied as their first food immediately after yolk absorption, cannot normally ingest the rotifers supplied due to the small mouths of the hatched larvae, or when they ingest rotifers with deficiencies in nutrition, or when they cannot digest and absorb them even if they do ingest them, which can ultimately be said to be deaths due to nutritional deficiencies. The third mortality period occurs when the transition from live prey organisms to particulate feed is made at an incorrect time, when particulate feed that does not fit their mouth size is supplied, or when the larvae are supplied with nutritional imbalances or unreasonable feed with nutrients that do not fit their developmental stage.

[0008] In order to successfully cultivate various species of fish, it is necessary to identify the causes of mass mortality of hatched larvae and crustacean larvae during the seed production process, devise solutions to address these issues, and develop methods to improve the survival rate of hatched larvae and crustacean larvae during the rearing process.

[0009] The white shrimp (Penaeus vannamei) is the most widely farmed crustacean worldwide, with approximately 4.9 million tons produced, accounting for approximately 53% of total crustacean production and projected to continue growing (FAO, 2021). White shrimp (Penaeus vannamei) is more resistant to disease than other shrimp species, including early mortality syndrome (EMS) and white spot syndrome virus (WSSV), and its rapid growth rate makes it the most widely farmed shrimp worldwide. However, with the recent increase in farmed production, white shrimp are increasingly vulnerable to various diseases due to deteriorating water quality (ammonia) and decreased tolerance to changes in water temperature and salinity. Vibrio parahaemolyticus, the bacterium that causes EMS, is the most common infectious disease causing mass mortality in shrimp. To ensure the success of shrimp farming, in addition to increasing growth rate and feed efficiency, it is necessary to enhance non-specific immunity to reduce mass mortality caused by infectious diseases.

[0010] The larvae of P. vannamei undergo a molting process, which includes the nauplius, zoea, mysis, and postlarvae. Food sources, including rotifers and Artemia, play a crucial role in the early seed production of P. vannamei. Food sources for P. vannamei larvae are supplemented with essential nutrients, such as eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and vitamins (Putra et al., 2018). However, research on the use of microalgae as a nutritional supplement for P. vannamei larvae is limited.

[0011] Microalgae are known to have high potential as feed ingredients due to their ease of cultivation, stable supply, and mass production. Generally, microalgae are high in protein (30-50%) and lipid (10-20%) and essential amino acids, and are actively being researched as a fishmeal replacement or additive in aquaculture feed. Furthermore, they are rich in vitamins and carotenoids, such as zeaxanthin, canthaxanthin, and astaxanthin, which are well-known natural antioxidants and immune-boosting agents, and are therefore attracting attention as functional feed additives. While microalgae are known to have high potential as feed ingredients or additives for aquaculture, research on technologies and methods for their effective utilization remains insufficient.

[0012]

[0013] [Prior Art Literature]

[0014] [Patent Document]

[0015] (Patent Document 1) US 2015-0208696 A1

[0016] The present inventors have conducted extensive research to develop a feed for aquaculture of fish or crustaceans utilizing microalgae. As a result, they have discovered that a feed composition containing biomass derived from Schizochytrium sp. microalgae exhibits a nutritionally enriching effect on zooplankton, and that ingesting the feed promotes the growth of fish or crustaceans and enhances their non-specific immunity, thereby completing the present invention.

[0017] Accordingly, the purpose of the present application is to provide a feed composition for zooplankton comprising biomass derived from microalgae of the genus Schizochytrium sp. The feed composition may have a nutritional enhancement effect on zooplankton (e.g., a nutritional enhancement agent for zooplankton).

[0018] Another object of the present application is to provide a method for culturing zooplankton, which comprises a step of feeding zooplankton with the biomass derived from the microalgae of the genus Schizochytrium described above and / or the feed composition for zooplankton described above.

[0019] Another object of the present application is to provide a feed composition for fish and / or crustaceans, comprising zooplankton that has consumed the biomass derived from the microalgae of the genus Schizochytrium described above and / or the feed composition for zooplankton described above.

[0020] Another object of the present application is to provide a method for culturing fish and / or crustaceans, which comprises a step of feeding zooplankton that has consumed the biomass derived from the microalgae of the genus Schizochytrium described above and / or the feed composition for zooplankton described above to the fish and / or crustaceans.

[0021] Another object of the present application is to provide a use of the biomass derived from the microalgae of the genus Schizochytrium described above and / or a feed composition for zooplankton containing the same for enhancing the nutrition of zooplankton, promoting the growth of crustaceans, and / or enhancing non-specific immunity.

[0022]

[0023]

[0024] According to one aspect of the present application, the present application provides a feed composition for zooplankton comprising biomass derived from microalgae of the genus Schizochytrium sp., and a composition and method comprising the same.

[0025] The present inventors have conducted extensive research to develop aquaculture feed for fish or crustaceans utilizing microalgae. As a result, we have discovered that a feed composition containing biomass derived from microalgae of the genus Schizochytrium exhibits a nutritionally enriching effect on zooplankton, and that zooplankton ingesting this feed promotes the growth of fish and / or crustaceans and enhances non-specific immunity.

[0026]

[0027] Hereinafter, the present invention will be described in more detail. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the level of the technical field to which the present invention pertains and the contents of the present invention.

[0028]

[0029] Microalgae of the genus Schizochytrium (Schizochytrium sp.)

[0030] In this specification, the term “microalgae” refers to organisms that are not easily visible to the naked eye but can be seen through a microscope and live freely floating in water, and are also called phytoplankton. There are various types of microalgae, and even strains that are unable to photosynthesize and grow only through heterotrophy. The term “microalgae” may be used interchangeably with “strain” in this specification.

[0031] In this specification, the term “Schizochytrium sp.” is one of the genera belonging to the family Thraustochytriaceae of the order Thraustochytriales, and may be used interchangeably with the term “genus Schizochytrium.”

[0032] In the present specification, microalgae of the genus Schizochytrium refers to microorganisms belonging to the family of Thraustochytriaceae, and may be at least one selected from the group consisting of Schizochytrium aggregatum, Schizochytrium limacinum, Schizochytrium minutum, etc., but are not limited thereto.

[0033] In one embodiment of the present invention, the above-described Schizochytrium strain may be, but is not limited to, CD03-7004 strain (accession number KCTC15006BP).

[0034] The present inventors irradiated a wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) with gamma rays to induce a mutation, selected a strain among the mutant strains having antioxidant pigment production ability, and named it Schizochytrium sp. CD03-7004. The strain was deposited with the Korean Collection for Type Cultures (KCTC), an international depository under the Budapest Treaty, on June 20, 2022, and assigned the accession number KCTC15006BP.

[0035]

[0036] Biomass derived from microalgae of the genus Schizochytrium (Schizochytrium sp.)

[0037] As used herein, the term "biomass" refers to living organisms such as plants, animals, and microorganisms that can be used as chemical energy, i.e., the energy source of bioenergy. Ecologically, it also refers to the weight or energy content of a specific organism existing within a unit of time and space. Furthermore, the biomass may include, but is not limited to, compounds secreted by cells, and may contain cells and / or intracellular contents as well as extracellular substances.

[0038] In the present specification, the microalgae-derived biomass may include the microalgae itself, a culture thereof, a fermentation thereof, a dried product thereof, a crushed product thereof, or a product produced by culturing or fermenting the microalgae, or may include a concentrate or dried product of the biomass, but is not limited thereto. In one embodiment, the microalgae-derived biomass may include at least one selected from the group consisting of microalgae, a culture of the microalgae, a dried product of the culture, and a crushed product of the dried product. Drying may be performed by, but is not limited to, spray drying, hot air drying, freeze drying, natural drying, or vacuum drying.

[0039] The "culture" of the above microalgae refers to a product produced by culturing the microalgae, and may specifically be a culture solution containing microalgae or a culture filtrate from which the microalgae have been removed, but is not limited thereto. The "dry product" of the microalgae culture refers to the microalgae culture from which moisture has been removed, and may be, for example, in the form of dried microalgae cells, but is not limited thereto. In addition, the "crushed product" of the dried product refers to a general term for the result of crushing the dried product from which moisture has been removed from the microalgae culture, and may be, for example, in the form of dried microalgae cell powder, but is not limited thereto. The culture of the microalgae can be produced by inoculating the microalgae into a microalgae culture medium and according to a culturing method known in the art, and the dried product of the culture and the crushed product thereof can also be produced according to a method for treating or drying microalgae or a culture solution known in the art.

[0040] In one embodiment, the above-described microalgae-derived biomass may contain 40 wt% to 95 wt% of protein (crude protein), and more specifically, 40 wt% to 95 wt%, 40 wt% to 90 wt%, 40 wt% to 85 wt%, 40 wt% to 82.5 wt%, 40 wt% to 80.5 wt%, 50 wt% to 95 wt%, 50 wt% to 90 wt%, 50 wt% to 85 wt%, 50 wt% to 82.5 wt%, 50 wt% to 80.5 wt%, 60 wt% to 95 wt%, 60 wt% to 90 wt%, 60 wt% to 85 wt%, 60 wt% to 82.5 wt%, 60 wt% to 80.5 wt%, 70 wt% It may include, but is not limited to, 70 wt% to 90 wt%, 70 wt% to 85 wt%, 70 wt% to 82.5 wt%, 70 wt% to 80.5 wt%, 75 wt% to 95 wt%, 75 wt% to 90 wt%, 75 wt% to 85 wt%, 75 wt% to 82.5 wt%, 75 wt% to 80.5 wt%, 77.5 wt% to 95 wt%, 77.5 wt% to 90 wt%, 77.5 wt% to 85 wt%, 77.5 wt% to 82.5 wt%, or 77.5 wt% to 80.5 wt%. Thus, it can be seen that the protein content of the biomass derived from the microalgae of the genus Schizochytrium of the present invention is higher than that of the biomass of the genus Schizochytrium known previously (about 10% to 15%).

[0041] In one embodiment, the above-described microalgae-derived biomass may contain 3 wt% to 30 wt% of fat (crude lipids), and more specifically, 3 wt% to 30 wt%, 3 wt% to 20 wt%, 3 wt% to 15 wt%, 3 wt% to 13 wt%, 3 wt% to 12 wt%, 6 wt% to 30 wt%, 6 wt% to 20 wt%, 6 wt% to 15 wt%, 6 wt% to 16 wt%, 6 wt% to 12 wt%, 9 wt% to 30 wt%, 9 wt% to 20 wt%, 9 wt% to 15 wt%, 9 wt% to 16 wt%, 9 wt% to 12 wt%, 10 wt% to 30 wt%, 10 wt% to 20 wt%, 10 wt% to 15 It may include, but is not limited to, 10 wt% to 16 wt%, 10 wt% to 12 wt%, 11 wt% to 30 wt%, 11 wt% to 20 wt%, 11 wt% to 15 wt%, 11 wt% to 16 wt%, or 11 wt% to 12 wt%.

[0042] In one embodiment, the microalgae-derived biomass described above may contain moisture in an amount of 0.25 wt% to 10 wt%, and more specifically, 0.25 wt% to 10 wt%, 0.25 wt% to 9 wt%, 0.25 wt% to 8.5 wt%, 0.25 wt% to 8 wt%, 0.25 wt% to 7 wt%, 0.25 wt% to 6 wt%, 1 wt% to 10 wt%, 1 wt% to 9 wt%, 1 wt% to 8.5 wt%, 1 wt% to 8 wt%, 1 wt% to 7 wt%, 1 wt% to 6 wt%, 3 wt% to 10 wt%, 3 wt% to 9 wt%, 3 wt% to 8.5 wt%, 3 wt% to 8 wt%, 3 wt% to 7 wt%, 3 wt% It may include, but is not limited to, 6 wt% to 10 wt%, 4 wt% to 9 wt%, 4 wt% to 8.5 wt%, 4 wt% to 8 wt%, 4 wt% to 7 wt%, 4 wt% to 6 wt%, 4.5 wt% to 10 wt%, 4.5 wt% to 9 wt%, 4.5 wt% to 8.5 wt%, 4.5 wt% to 8 wt%, 4.5 wt% to 7 wt%, 4.5 wt% to 6 wt%, 5 wt% to 10 wt%, 5 wt% to 9 wt%, 5 wt% to 8.5 wt%, 5 wt% to 8 wt%, 5 wt% to 7 wt%, or 5 wt% to 6 wt%.

[0043] In one embodiment, the microalgae-derived biomass described above may contain 0.05 parts by weight to 4.5 parts by weight of eicosapentaenoic acid (EPA) based on 100 parts by weight of fat (crude lipids), and more specifically, 0.05 parts by weight to 4.5 parts by weight, 0.05 parts by weight to 3.5 parts by weight, 0.05 parts by weight to 2.5 parts by weight, 0.05 parts by weight to 1.5 parts by weight, 0.05 parts by weight to 1.0 parts by weight, 0.1 parts by weight to 4.5 parts by weight, 0.1 parts by weight to 3.5 parts by weight, 0.1 parts by weight to 2.5 parts by weight, 0.1 parts by weight to 1.5 parts by weight, 0.1 parts by weight to 1.0 parts by weight, 0.5 parts by weight to 4.5 parts by weight, 0.5 parts by weight to It may include, but is not limited to, 3.5 parts by weight, 0.5 parts by weight to 2.5 parts by weight, 0.5 parts by weight to 1.5 parts by weight, 0.5 parts by weight to 1.0 parts by weight, 0.75 parts by weight to 4.5 parts by weight, 0.75 parts by weight to 3.5 parts by weight, 0.75 parts by weight to 2.5 parts by weight, 0.75 parts by weight to 1.5 parts by weight, 0.75 parts by weight to 1.0 parts by weight, 0.8 parts by weight to 4.5 parts by weight, 0.8 parts by weight to 3.5 parts by weight, 0.8 parts by weight to 2.5 parts by weight, 0.8 parts by weight to 1.5 parts by weight, or 0.8 parts by weight to 1.0 parts by weight.

[0044] In this specification, the term "eicosapentaenoic acid ((5Z,8Z,11Z,14Z,17Z)-Icosa-5,8,11,14,17-pentaenoic acid, EPA)" refers to C 20 H 30 It is one of the polyunsaturated fatty acids with the chemical formula O2, and is an omega-3 fatty acid along with ALA and DHA, and can also be abbreviated as 20:5n-3.

[0045] In one embodiment, the microalgae-derived biomass described above may contain 0.01 to 2 parts by weight of docosapentaenoic acid (DPA) based on 100 parts by weight of fat (crude lipids), and more specifically, 0.01 to 2 parts by weight, 0.01 to 1.5 parts by weight, 0.01 to 1 part by weight, 0.01 to 0.75 parts by weight, 0.01 to 0.5 parts by weight, 0.01 to 0.4 parts by weight, 0.05 to 2 parts by weight, 0.05 to 1.5 parts by weight, 0.05 to 1 part by weight, 0.05 to 0.75 parts by weight, 0.05 to 0.5 parts by weight, 0.05 to It may include, but is not limited to, 0.4 parts by weight, 0.15 parts by weight to 2 parts by weight, 0.15 parts by weight to 1.5 parts by weight, 0.15 parts by weight to 1 part by weight, 0.15 parts by weight to 0.75 parts by weight, 0.15 parts by weight to 0.5 parts by weight, 0.15 parts by weight to 0.4 parts by weight, 0.3 parts by weight to 2 parts by weight, 0.3 parts by weight to 1.5 parts by weight, 0.3 parts by weight to 1 part by weight, 0.3 parts by weight to 0.75 parts by weight, 0.3 parts by weight to 0.5 parts by weight, or 0.3 parts by weight to 0.4 parts by weight.

[0046] In this specification, the term "docosapentaenoic acid ((7Z,10Z,13Z,16Z,19Z)-docosa-7,10,13,16,19-pentaenoic acid, DPA)" means C 22 H 34 One of the polyunsaturated fatty acids with the chemical formula O2, which can also be abbreviated as 22:5n-3.

[0047] In one embodiment, the microalgae-derived biomass described above may contain 20 parts by weight to 50 parts by weight of docosahexaenoic acid (DHA) based on 100 parts by weight of fat (crude lipids), and more specifically, 20 parts by weight to 45 parts by weight, 20 parts by weight to 40 parts by weight, 20 parts by weight to 35 parts by weight, 20 parts by weight to 34 parts by weight, 25 parts by weight to 50 parts by weight, 25 parts by weight to 45 parts by weight, 25 parts by weight to 40 parts by weight, 25 parts by weight to 35 parts by weight, 25 parts by weight to 34 parts by weight, 27.5 parts by weight to 45 parts by weight, 27.5 parts by weight to 40 parts by weight, 27.5 parts by weight to 35 parts by weight, 27.5 parts by weight to 34 parts by weight, 30 parts by weight to It may include, but is not limited to, 50 parts by weight, 30 parts by weight to 45 parts by weight, 30 parts by weight to 40 parts by weight, 30 parts by weight to 35 parts by weight, 30 parts by weight to 34 parts by weight, 32 parts by weight to 50 parts by weight, 32 parts by weight to 45 parts by weight, 32 parts by weight to 40 parts by weight, 32 parts by weight to 35 parts by weight, 32 parts by weight to 34 parts by weight, 33 parts by weight to 50 parts by weight, 33 parts by weight to 45 parts by weight, 33 parts by weight to 40 parts by weight, 33 parts by weight to 35 parts by weight, or 33 parts by weight to 34 parts by weight.

[0048] In this specification, the term “docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA)” refers to C 22 H 32It is one of the polyunsaturated fatty acids with the chemical formula O2, and is an omega-3 fatty acid along with alpha-linolenic acid (ALA) and eicosapentaenoic acid (EPA). Its common name is cervonic acid, and it can also be abbreviated as 22:6n-3.

[0049] In this specification, the term “omega-3 fatty acid” refers to a type of unsaturated fatty acid, which is a fatty acid in which the first double bond is located at the third carbon from the methyl end (the end of the fatty acid) of the fatty acid. Representative examples of omega-3 fatty acids include eicosapentaenoic acid ((5Z,8Z,11Z,14Z,17Z)-Icosa-5,8,11,14,17-pentaenoic acid, EPA) and docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA). These cannot be produced in the body of fish, so they must be consumed through diet, and are known as essential fatty acids that play an important role in the metabolism and cell function of fish.

[0050] As demonstrated in the examples described below, in the case of zooplankton that consumed the feed composition containing the microalgae biomass of the present invention described above, the content of omega-3 fatty acids was significantly increased, confirming that the feed composition containing the microalgae biomass of the present invention has an omega-3 fatty acid strengthening effect.

[0051]

[0052] Feed composition

[0053] As used herein, the term "feed composition" may mean something that provides nutrition to animals (including unicellular or multicellular heterotrophic organisms such as zooplankton, livestock, and fish) or is necessary for maintaining their health or growth. The feed composition may be a single feed, a compound feed, or a supplementary feed. The single feed may mean a plant-based, animal-based, or mineral substance that is used directly as feed or as a raw material for a compound feed. The supplementary feed may mean something added to feed to prevent deterioration in the quality of the feed or to increase the utility of the feed. The compound feed may be a product obtained by mixing or processing single feed, supplementary feed, etc. in an appropriate ratio.

[0054] The above feed composition may refer to a substance that supplies organic or inorganic nutrients necessary for sustaining the life of an animal or producing meat, milk, etc. The feed composition may additionally contain nutrients necessary for sustaining the life of an animal or producing meat, milk, etc. The feed composition may be manufactured into various types of feed known in the art, and specifically may include concentrate feed, forage, and / or special feed. Alternatively, the feed composition may be manufactured in the form of compound feed (Extruded pellet, EP feed, dry feed) or raw feed (Moist pellet, MP feed, wet feed).

[0055] In this specification, feed additives may include substances added to feed for various purposes such as nutrient supplementation and weight loss prevention, increasing the digestibility and availability of fiber in feed, improving milk quality, preventing reproductive disorders and improving conception rates, and preventing summer heat stress. The feed additives may refer to supplementary feeds under the Feed Management Act, and may further include mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysine; protected fatty acids such as fatty acid calcium salts; probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

[0056] In this specification, the term “feed composition” may be interpreted to encompass “feed additive”.

[0057] The feed composition may further include grains, such as ground or shredded wheat, oats, barley, corn and rice; plant-based protein feeds, such as feeds mainly composed of soybeans and sunflower; animal-based protein feeds, such as blood meal, meat meal, bone meal and fish meal; dry ingredients composed of sugars and dairy products, such as various types of milk powder and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters and the like.

[0058] The feed composition may be administered to animals alone or in combination with other feed additives in an edible carrier. Furthermore, the feed composition may be readily administered to animals as a top dressing, by mixing it directly into feed, or in an oral formulation separate from the feed. When administered separately from feed, the composition may be prepared as an immediate-release or sustained-release formulation by combining it with an edible carrier acceptable in the feed industry, as is well known in the art. The edible carrier may be a solid or liquid, such as corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, or propylene glycol. When a solid carrier is used, the feed composition may be in the form of a tablet, capsule, powder, troche, or saccharide tablet, or a top dressing in the form of a microdispersible. When a liquid carrier is used, the feed composition may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.

[0059] The feed composition may include, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a cryoprotectant, or an excipient. The cryoprotectant may be at least one selected from the group consisting of glycerol, trehalose, maltodextrin, skimmed milk powder, and starch. The preservative, stabilizer, or excipient may be included in the composition in an effective amount sufficient to reduce deterioration of the microalgae included in the feed composition. In addition, the cryoprotectant may be included in the composition in an effective amount sufficient to reduce deterioration of the microalgae included in the composition when the composition is in a dried state.

[0060] The above feed composition can be used by adding it to animal feed by immersion, spraying, or mixing.

[0061] The feed composition can be applied to a number of animal diets, including but not limited to mammals, birds, fish, crustaceans, cephalopods, reptiles, and amphibians. For example, the mammals can include pigs, cattle, sheep, goats, laboratory rodents, or pets, and the birds can include poultry, including but not limited to chickens, turkeys, ducks, geese, pheasants, or quail. The crustaceans can include but are not limited to shrimp, barnacles, and the like. In addition, the feed composition can also be applied to a diet of zooplankton, such as rotifers, artemia, daphnia pulex, and the like. In addition, the fish can include freshwater fish, saltwater fish, commercially farmed fish and their fry, ornamental fish, and the like.

[0062]

[0063] Feed composition for zooplankton

[0064] One example of the present application provides a feed composition for zooplankton comprising biomass derived from the above-described microalgae of the genus Schizochytrium (Schizochytrium sp.).

[0065] The above-described feed composition for zooplankton may be used as a nutritional fortifier for zooplankton. Accordingly, another example provides a nutritional fortifier for zooplankton comprising biomass derived from the microalgae of the genus Schizochytrium sp. described above.

[0066] The above Schizochytrium sp. microalgae, the microalgae-derived biomass and the feed composition are as described above.

[0067] In this specification, the term “plankton” refers to organisms that passively float or drift in fresh or salt water according to the movement of water. The plankton may include aquatic animals and plants of various sizes, such as bacteria living in the water, unicellular protists, multicellular algae such as sea squirts, fish eggs, krill, and large jellyfish. The plankton may include bacterioplankton, phytoplankton, and zooplankton. The bacterioplankton refers to prokaryotes (planktonic bacteria) floating in the water layer, the phytoplankton refers to phytoplankton floating in the water layer, and the zooplankton may refer to various animal planktonic animals, from unicellular protozoa floating in the water layer to eggs, larvae, and fry of multicellular fish.

[0068] In one embodiment, the above-described zooplankton may be at least one selected from the group consisting of zooplankton of unicellular flagellates, ciliates, radiolarians, foraminifera, jellyfish, arrow worms, copepods, crustaceans, mystics, snails, sea mystics, krill, and krill, and more specifically, may be at least one selected from the group consisting of rotifers, artemia, and daphnia pulex, and most specifically, may be rotifers, artemia, or a combination thereof, but is not limited thereto, and any zooplankton that can be used as food for fish or crustaceans may be used without limitation.

[0069] As demonstrated in the examples described below, the feed composition containing the above-described microalgae biomass has the effect of enhancing the nutrition of zooplankton, and when zooplankton that has consumed the feed composition containing the above-described microalgae biomass is fed to fish or crustaceans, the growth of the fish and / or crustaceans can be promoted and non-specific immunity can be enhanced.

[0070] Accordingly, the feed composition for zooplankton of the present application described above may be used to enhance the nutrition of zooplankton, promote the growth of fish and / or crustaceans, and / or enhance non-specific immunity of fish and / or crustaceans.

[0071] In one example, the feed composition for zooplankton described above may additionally include inosine monophosphate (IMP), taurine, or a combination thereof.

[0072] In one embodiment, the feed composition for zooplankton described above may additionally include inosine monophosphate (IMP). At this time, the inosine monophosphate may be included in an amount of 0.05% (w / w) to 1% (w / w) of the mixture of the microalgae-derived biomass and inosine monophosphate, and more specifically, 0.05% (w / w) to 1% (w / w), 0.05% (w / w) to 0.75% (w / w), 0.05% (w / w) to 0.6% (w / w), 0.05% (w / w) to 0.5% (w / w), 0.05% (w / w) to 0.4% (w / w), 0.05% (w / w) to 0.3% (w / w), 0.05% (w / w) to 0.25% (w / w), 0.05% (w / w) to 0.2% (w / w), 0.05% (w / w) to 0.175% (w / w), 0.05% (w / w) to 0.15% (w / w), 0.05% (w / w) to 0.125% (w / w), 0.05% (w / w) to 0.11% (w / w), 0.05% (w / w) to 0.1% (w / w), 0.075% (w / w) to 1% (w / w), 0.075% (w / w) to 0.75% (w / w), 0.075% (w / w) to 0.6% (w / w), 0.075% (w / w) to 0.5% (w / w), 0.075% (w / w) to 0.4% (w / w), 0.075% (w / w) to 0.3% (w / w), 0.075% (w / w) to 0.25% (w / w), 0.075% (w / w) to 0.2% (w / w), 0.075% (w / w) to 0.175% (w / w), 0.075% (w / w) to 0.15% (w / w), 0.075% (w / w) to 0.125% (w / w), 0.075% (w / w) to 0.11% (w / w), 0.075% (w / w) to 0.1% (w / w), 0.09% (w / w) to 1% (w / w), 0.09% (w / w) to 0.75% (w / w), 0.09% (w / w) to 0.6% (w / w), 0.It may include, but is not limited to, 0.09% (w / w) to 0.5% (w / w), 0.09% (w / w) to 0.4% (w / w), 0.09% (w / w) to 0.3% (w / w), 0.09% (w / w) to 0.25% (w / w), 0.09% (w / w) to 0.2% (w / w), 0.09% (w / w) to 0.175% (w / w), 0.09% (w / w) to 0.15% (w / w), 0.09% (w / w) to 0.125% (w / w), 0.09% (w / w) to 0.11% (w / w), or 0.09% (w / w) to 0.1% (w / w).

[0073] In another embodiment, the feed composition for zooplankton described above may additionally contain taurine. At this time, the taurine may be included at 0.05% (w / w) to 1% (w / w), and more specifically, 0.05% (w / w) to 1% (w / w), 0.05% (w / w) to 0.75% (w / w), 0.05% (w / w) to 0.6% (w / w), 0.05% (w / w) to 0.5% (w / w), 0.05% (w / w) to 0.4% (w / w), 0.05% (w / w) to 0.3% (w / w), 0.05% (w / w) to 0.25% (w / w), 0.05% (w / w) to 0.2% (w / w), 0.05% (w / w) to 0.175% (w / w), 0.05% (w / w) to 0.15% (w / w), 0.05% (w / w) to 0.125% (w / w), 0.05% (w / w) to 0.11% (w / w), 0.05% (w / w) to 0.1% (w / w), 0.075% (w / w) to 1% (w / w), 0.075% (w / w) to 0.75% (w / w), 0.075% (w / w) to 0.6% (w / w), 0.075% (w / w) to 0.5% (w / w), 0.075% (w / w) to 0.4% (w / w), 0.075% (w / w) to 0.3% (w / w), 0.075% (w / w) to 0.25% (w / w), 0.075% (w / w) to 0.2% (w / w), 0.075% (w / w) to 0.175% (w / w), 0.075% (w / w) to 0.15% (w / w), 0.075% (w / w) to 0.125% (w / w), 0.075% (w / w) to 0.11% (w / w), 0.075% (w / w) to 0.1% (w / w), 0.09% (w / w) to 1% (w / w), 0.09% (w / w) to 0.75% (w / w), 0.09% (w / w) to 0.6% (w / w), 0.09% (w / w) to 0.5% (w / w), 0.09% (w / w) to 0.4% (w / w), 0.09% (w / w) to 0.3% (w / w), 0.It may include, but is not limited to, 0.09% (w / w) to 0.25% (w / w), 0.09% (w / w) to 0.2% (w / w), 0.09% (w / w) to 0.175% (w / w), 0.09% (w / w) to 0.15% (w / w), 0.09% (w / w) to 0.125% (w / w), 0.09% (w / w) to 0.11% (w / w), or 0.09% (w / w) to 0.1% (w / w).

[0074] In another embodiment, the feed composition for zooplankton described above may additionally include inosinic monophosphate and taurine. At this time, the inosine monophosphate may be included in an amount of 0.05% (w / w) to 1% (w / w) of the mixture of the microalgae-derived biomass, inosine monophosphate and taurine, and more specifically, 0.05% (w / w) to 1% (w / w), 0.05% (w / w) to 0.75% (w / w), 0.05% (w / w) to 0.6% (w / w), 0.05% (w / w) to 0.5% (w / w), 0.05% (w / w) to 0.4% (w / w), 0.05% (w / w) to 0.3% (w / w), 0.05% (w / w) to 0.25% (w / w), 0.05% (w / w) to 0.2% (w / w), 0.05% (w / w) to 0.175% (w / w), 0.05% (w / w) to 0.15% (w / w), 0.05% (w / w) to 0.125% (w / w), 0.05% (w / w) to 0.11% (w / w), 0.05% (w / w) to 0.1% (w / w), 0.075% (w / w) to 1% (w / w), 0.075% (w / w) to 0.75% (w / w), 0.075% (w / w) to 0.6% (w / w), 0.075% (w / w) to 0.5% (w / w), 0.075% (w / w) to 0.4% (w / w), 0.075% (w / w) to 0.3% (w / w), 0.075% (w / w) to 0.25% (w / w), 0.075% (w / w) to 0.2% (w / w), 0.075% (w / w) to 0.175% (w / w), 0.075% (w / w) to 0.15% (w / w), 0.075% (w / w) to 0.125% (w / w), 0.075% (w / w) to 0.11% (w / w), 0.075% (w / w) to 0.1% (w / w), 0.09% (w / w) to 1% (w / w), 0.09% (w / w) to 0.75% (w / w), 0.09% (w / w) to 0.6% (w / w), 0.09% (w / w) to 0.5% (w / w), 0.It may include, but is not limited to, 0.09% (w / w) to 0.4% (w / w), 0.09% (w / w) to 0.3% (w / w), 0.09% (w / w) to 0.25% (w / w), 0.09% (w / w) to 0.2% (w / w), 0.09% (w / w) to 0.175% (w / w), 0.09% (w / w) to 0.15% (w / w), 0.09% (w / w) to 0.125% (w / w), 0.09% (w / w) to 0.11% (w / w), or 0.09% (w / w) to 0.1% (w / w).

[0075] In addition, the taurine may be included in an amount of 0.05% (w / w) to 1% (w / w) of the mixture of the microalgae-derived biomass, inosine monophosphate, and taurine, and more specifically, 0.05% (w / w) to 1% (w / w), 0.05% (w / w) to 0.75% (w / w), 0.05% (w / w) to 0.6% (w / w), 0.05% (w / w) to 0.5% (w / w), 0.05% (w / w) to 0.4% (w / w), 0.05% (w / w) to 0.3% (w / w), 0.05% (w / w) to 0.25% (w / w), 0.05% (w / w) to 0.2% (w / w), 0.05% (w / w) to 0.175% (w / w), 0.05% (w / w) to 0.15% (w / w), 0.05% (w / w) to 0.125% (w / w), 0.05% (w / w) to 0.11% (w / w), 0.05% (w / w) to 0.1% (w / w), 0.075% (w / w) to 1% (w / w), 0.075% (w / w) to 0.75% (w / w), 0.075% (w / w) to 0.6% (w / w), 0.075% (w / w) to 0.5% (w / w), 0.075% (w / w) to 0.4% (w / w), 0.075% (w / w) to 0.3% (w / w), 0.075% (w / w) to 0.25% (w / w), 0.075% (w / w) to 0.2% (w / w), 0.075% (w / w) to 0.175% (w / w), 0.075% (w / w) to 0.15% (w / w), 0.075% (w / w) to 0.125% (w / w), 0.075% (w / w) to 0.11% (w / w), 0.075% (w / w) to 0.1% (w / w), 0.09% (w / w) to 1% (w / w), 0.09% (w / w) to 0.75% (w / w), 0.09% (w / w) to 0.6% (w / w), 0.09% (w / w) to 0.5% (w / w), 0.09% (w / w) to 0.4% (w / w), 0.09% (w / w) to 0.3% (w / w), 0.09% (w / w) to 0.25% (w / w), 0.09% (w / w) to 0.2% (w / w), 0.09% (w / w) to 0.175% (w / w), 0.09% (w / w) to 0.15% (w / w), 0.09% (w / w) to 0.125% (w / w), 0.09% (w / w) to 0.11% (w / w), or 0.09% (w / w) to 0.1% (w / w), but is not limited thereto.

[0076] According to another aspect of the present application, the present application provides a use of the biomass derived from the microalgae of the genus Schizochytrium described above and / or a feed composition for zooplankton comprising the same for enhancing zooplankton nutrition.

[0077] According to another aspect of the present application, the present application provides a use of the biomass derived from the microalgae of the genus Schizochytrium described above and / or a feed composition for zooplankton comprising the same for promoting the growth of fish and / or crustaceans.

[0078] According to another aspect of the present application, the present application provides a use of the biomass derived from the microalgae of the genus Schizochytrium described above and / or a feed composition for zooplankton comprising the same for enhancing non-specific immunity in fish and / or crustaceans.

[0079] In the above aspect, the biomass derived from microalgae of the genus Schizochytrium, the feed composition for zooplankton containing the same, the nutritional enhancement of zooplankton, the promotion of growth of fish and / or crustaceans, and the enhancement of non-specific immunity are as described above.

[0080]

[0081] Method for culturing zooplankton

[0082] According to another aspect of the present application, the present application provides a method for culturing (breeding) zooplankton, comprising the step of feeding the zooplankton with the biomass derived from the microalgae of the genus Schizochytrium and / or the feed composition for zooplankton.

[0083] According to another aspect of the present application, the present application provides a method for enhancing the nutrition of zooplankton, comprising the step of feeding the zooplankton with the biomass derived from the microalgae of the genus Schizochytrium and / or the feed composition for zooplankton.

[0084] In the above method, prior to the feeding step, a step of preparing a biomass derived from the above-described microalgae of the genus Schizochytrium and / or a feed composition for zooplankton may be additionally included.

[0085] In the above method, the feeding step can be performed by any method for providing food to zooplankton, and for example, it can include a step of supplying or adding the biomass derived from the microalgae of the genus Schizochytrium and / or the feed composition for zooplankton to zooplankton (which can be interpreted as including an aquatic environment containing the zooplankton), but is not limited thereto.

[0086] In the above method, the feeding amount of the microalgae-derived biomass of the genus Schizochytrium and / or the feed composition for zooplankton described above can be appropriately determined according to the type, size, condition, feeding purpose, etc. of the zooplankton to be fed. In one specific example, the feeding amount of the microalgae-derived biomass and / or feed composition for zooplankton may be, but is not limited to, about 0.3% (w / w) or more, about 0.35% (w / w) or more, about 0.4% (w / w) or more, about 0.45% (w / w) or more, or about 0.5% (w / w) or more (the upper limit is not particularly limited, and may be, for example, about 20% (w / w), about 15% (w / w), about 10% (w / w), about 5% (w / w), about 3% (w / w), or about 2% (w / w) of the zooplankton population, based on the dry powder of the microalgae-derived biomass, but is not limited thereto.

[0087] In this specification, the term “nutritional enhancement” means regulating or improving the nutrient content, such as protein, fat, vitamins, and minerals, of food, feed, or feedstuffs used as food for other animals, thereby increasing the growth, survival, and productivity of humans or animals consuming them.

[0088] Since the method for culturing zooplankton and the method for strengthening the nutrition of zooplankton of the present invention are methods performed by feeding the feed composition of the present invention described above to zooplankton, the overlapping contents between the inventions are commonly applied, and the description thereof is omitted to avoid excessive complexity of the present specification.

[0089]

[0090] Feed composition and farming method for fish and / or crustaceans

[0091] According to another aspect of the present application, the present application provides a feed composition for fish and / or crustaceans, comprising zooplankton that has been ingested (fed) with the above-described feed composition for zooplankton. The feed composition may have a non-specific immune-enhancing effect in fish and / or crustaceans.

[0092] According to another aspect of the present application, the present application provides an immune-enhancing composition for fish and / or crustaceans, comprising zooplankton that has been fed (ingested) the feed composition for zooplankton described above.

[0093] According to another aspect of the present application, the present application provides a method for cultivating fish and / or crustaceans, comprising a step of feeding zooplankton that has been ingested (fed) with the feed composition for zooplankton described above to fish and / or crustaceans.

[0094] According to another aspect of the present application, the present application provides a method for enhancing non-specific immunity in fish and / or crustaceans, comprising the step of feeding zooplankton that has been ingested (fed) with the feed composition for zooplankton described above to fish and / or crustaceans.

[0095] In the above method, prior to the feeding step, a step of preparing zooplankton that has consumed (fed) the biomass derived from the microalgae of the genus Schizochytrium and / or the feed composition for zooplankton may be additionally included.

[0096] In the above method, the feeding step may be performed by any method for providing food to fish and / or crustaceans, and may include, but is not limited to, a step of supplying or adding the above-described zooplankton to fish and / or crustaceans (which may be interpreted as including an aquatic environment containing the fish and / or crustaceans).

[0097] In the above method, the feeding amount of the above-described zooplankton can be appropriately determined according to the type, size, condition, feeding purpose, etc. of the fish and / or crustaceans to be fed.

[0098] In this specification, "fish" can broadly include vertebrates living in the water, and is not limited in type. For example, the "fish" can be marine fish such as sea bream, flounder, black rockfish, red sea bream, croaker, mullet, and grouper, and terrestrial fish such as eel, smelt, trout, trout, and mandarin fish, and preferably, farmed fish, but is not limited thereto.

[0099] In this specification, “crustacean” is an arthropod that lives in water and includes one or more selected from the group consisting of shrimp, crab, and crayfish.

[0100] In one embodiment of the present invention, the above-described crustaceans may be shrimps such as Litopenaeus vannamei, Marsupenaeus japonicus, Penaeus monodon, Penaeus chinensis, and Penaeus morguiensis, and crabs such as Shanghai crab and flower crab, and most preferably Litopenaeus vannamei, but are not limited thereto.

[0101] The form in which the above feed composition is ingested by zooplankton may include all forms in which the zooplankton directly ingests the feed composition supplied as food, or the feed composition supplied as food is absorbed by the zooplankton, thereby being located within the cells or inside (e.g., within tissues such as the spleen, intestines, kidneys, and liver) of the zooplankton.

[0102] The method for cultivating the above fish or crustaceans can be any method commonly used in the art.

[0103] In this specification, the term "non-specific immunity" may be used interchangeably with "innate immunity," and refers to a natural defense mechanism that an organism possesses innately and is expressed on its own, and which does not recognize specific pathogens or foreign substances, but rather a defense function that generally acts against general pathogens. In particular, crustaceans are invertebrates and lack an acquired immunity (adaptive immunity) system, so they rely heavily on a non-specific immune system when invaded by pathogens. Therefore, enhancing non-specific immunity is a very important task in crustacean farming.

[0104] In one embodiment of the present invention, the method for enhancing non-specific immunity of fish or crustaceans may be to increase the gene expression level of one or more proteins selected from the group consisting of Lysozyme, Penaeidin-3, Crustin, and LGBP (lipopolysaccharide and β-1, 3-glucan binding protein).

[0105] The above-mentioned lysozyme, penaeidin-3, crustin, and LGBP (lipopolysaccharide and β-1, 3-glucan binding protein) are non-specific immune-related proteins of fish and crustaceans. Lysozyme is one of the key antimicrobial enzymes in the innate immunity of crustaceans, inhibiting bacterial infection by hydrolyzing the mucopolysaccharide of bacterial cell walls and exhibiting antibacterial activity against Gram-negative bacteria. Crustin is a peptide that plays an important role in the innate immunity of crustaceans and primarily exhibits antibacterial activity against Gram-positive bacteria. Penaeidin-3 can directly destroy the cell membrane or cell wall of crustacean microorganisms, killing various bacteria and fungi. LGBP (lipopolysaccharide and β-1, 3-glucan binding protein) recognizes lipopolysaccharide and β-1, 3-glucan-binding protein in various fungi and Gram-negative bacteria, activates a signal transduction system that triggers an immune response, and activates antimicrobial peptide release and phagocytosis.

[0106] Since the feed composition for fish or crustaceans of the present invention includes zooplankton that has consumed the feed composition for zooplankton of the present invention described above, any overlapping content between the inventions is commonly applied, and the description thereof is omitted to avoid excessive complexity of the present specification.

[0107] The method for culturing fish or crustaceans and the method for enhancing non-specific immunity of fish or crustaceans of the present invention are methods performed by feeding the zooplankton that has ingested the zooplankton feed composition of the present invention described above to fish or crustaceans, and therefore, the overlapping contents between the inventions are commonly applied, and their description is omitted to avoid excessive complexity of the present specification.

[0108]

[0109] The present invention relates to a feed composition for zooplankton comprising a biomass derived from microalgae of the genus Schizochytrium sp., a method for culturing zooplankton using the same, and a method for culturing fish or crustaceans using the same. The biomass derived from microalgae of the genus Schizochytrium sp. of the present invention has the effect of strengthening the nutrition of zooplankton, and when the zooplankton that has ingested the biomass is fed to fish or crustaceans, the growth of the fish or crustaceans is promoted and non-specific immunity is enhanced, and therefore, the biomass can be usefully utilized as a feed composition or feed additive.

[0110]

[0111] Figure 1 is a diagram showing the results of observing with an optical microscope whether rotifers are nutritionally enhanced after being fed with the microalgae biomass of the present invention.

[0112] Figure 2 is a diagram showing the results of observing the nutritional enhancement of Artemia using an optical microscope after feeding the microalgae biomass of the present invention.

[0113] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0114]

[0115] Example

[0116] Hereinafter, the present application will be described in more detail with the following examples. However, the examples below are intended to exemplify the present application, and the scope of the present application is not limited by the examples below, as will be apparent to those skilled in the art to which the present application pertains.

[0117]

[0118] Hereinafter, the present invention will be described in more detail through examples.

[0119] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0120]

[0121] Manufacturing Example 1: Preparation of a novel Schizochytrium sp. CD03-7004 mutant strain.

[0122] The pure isolated wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) was cultured in modified-GYEP (glucose 10 g / L, yeast extract 1 g / L, peptone 1 g / L, MgSO4·7H2O 2 g / L, H3BO3 5.0 mg / L, MnCl2 3.0 mg / L, CuSO4 0.2 mg / L, NaMo4·2H2O 0.05 mg / L, CoSO4 0.05 mg / L, ZnSO4·7H2O 0.7 mg / L) medium containing 30 g / L glucose for about 24 h to reach the early exponential phase, and then the culture solution sample was centrifuged to harvest the cells. The harvested cells had a cell count of about 10 9 The cells / mL were suspended in 0.1 M Phosphate Buffer Solution containing 1.0% NaCl and used for gamma irradiation.

[0123] The above-mentioned microalgae strain CD01-5000 was irradiated with gamma rays at a dose of 4.0 kGY. The gamma-irradiated microalgae culture was allowed to recover overnight in a darkroom, then plated on GYEP medium containing 20 g / L agar and cultured at 30°C for approximately 5 days. Viable colonies were selected during the culture and passaged under the same medium and culture conditions. Colonies with a reddish morphology were selected between passages and purified and cultured as a single cell line. The Schizochytrium strain was named Schizochytrium sp. CD03-7004 and deposited with the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology on June 20, 2022, and assigned the accession number KCTC15006BP.

[0124]

[0125] The whole genome sequences of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain were compared to identify the mutated sequence in CD03-7004 and construct a PCR marker.

[0126] Specifically, the mutant CD03-7004 strain was confirmed to have an additional portion of 15 base pairs (the portion in bold in the sequence of SEQ ID NO. 1 below, SEQ ID NO. 5) when compared to the genome of the wild-type CD01-5000 strain.

[0127] [DNA fragment sequence for amplification of mutant CD03-7004 strain (SEQ ID NO: 1)]

[0128] tttcagactgctttttgcttttttgcttgcttgcttttttgcttgcttgcttttggcttgcttttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0129] [DNA fragment sequence to be amplified from the wild-type CD01-5000 strain (SEQ ID NO: 2)]

[0130] tttcagactgctttttgcttttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0131] Primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and Primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) were selected to amplify this part, and PCR amplification was performed using them. The PCR reaction was performed using a reaction solution containing Taq polymerase. After denaturation at 95°C for 5 minutes, 35 cycles of denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds were repeated, and then polymerization was performed at 72°C for 5 minutes. The reaction solution amplified through the PCR process was electrophoresed on a 1.7% agarose gel to confirm the size of the amplified DNA. As a result, the size of the DNA fragment amplified from the mutant CD03-7004 strain was approximately 140 bp, whereas the size of the DNA fragment amplified from the wild-type CD01-5000 strain was approximately 120 bp, confirming that the mutant CD03-7004 strain was different from the wild-type strain.

[0132] Therefore, the above results show that primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) can be utilized to select the mutant CD03-7004 strain.

[0133]

[0134] Manufacturing Example 2: Manufacturing of dried microalgae biomass powder

[0135] The microalgae biomass dry powder (MB) to be used in the experiment was manufactured using the Schizochytrium sp. CD03-7004 strain (KCTC15006BP) prepared in Manufacturing Example 1 using the following method.

[0136] For the preliminary culture prior to the main culture at 30 L scale, each strain was inoculated into GYEP medium containing 50 ml of working volume and 30 g / L of glucose in a 500 ml flask, and cultured in a shaking incubator at 30°C and 180 rpm for approximately 20 hours. The preliminary culture was inoculated into a 30 L fermenter containing medium under the same conditions and fermented in a total working volume of 20 L. Glucose corresponding to 20% of the working volume was continuously added for cell culture under the conditions of 30°C, 500 rpm, 0.5-1 vvm, and pH 5-7, and the glucose concentration at this time was maintained at the level of 20 g / L. The culture was terminated when all of the supplied carbon source, glucose, was consumed. The cultured solution was dried using a dryer so that the moisture content became approximately 5-8%.

[0137]

[0138] Example 1: Confirmation of the effect of rearing through rotifer nutrition enhancement in the early larval stage of whiteleg shrimp.

[0139] In this example, the raw material to be tested was microalgae biomass dried powder (MB), and as comparative raw materials, commercially available products, Comparative Group 1 (Chlorella, DHA and EPA mixed product) and Comparative Group 2 (Chlorella powder) were selected, and inosine monophosphate (IMP) and taurine were selected as functional additives.

[0140]

[0141] 1-1. Test to determine the amount of added microalgae biomass dried powder (MB)

[0142] Before conducting a rotifer nutritional enrichment experiment, the following experiment was conducted to determine the appropriate amount of microalgae biomass dry powder (MB) to be used for nutritional enrichment.

[0143] Microalgae biomass dry powder (MB) was supplied to 500 ml of rotifers (average population: 5,000,000 ind. / L) at concentrations of 0.25, 0.5, 1.0, 1.5, and 2.0% (w / w), respectively. The rotifers used were commercially available from Aquanet (Korea). After 2 hours of enrichment, the enrichment status of each experimental group was confirmed under a microscope. As a result, chlorella contained in the commercial rotifers remained in the 0.25% concentration, and in the experimental groups supplied with 0.5% or more, all the chlorella in the intestines were confirmed to be replaced by MB. Therefore, it was found that the maximum amount of MB that rotifers can accept is 0.5%, and subsequent rotifer enrichment experiments were conducted by feeding 0.5% of MB to the rotifer breeding water.

[0144]

[0145] 1-2. Feed manufacturing and breeding conditions

[0146] 1-2-1. Setting up each diet group and analyzing the ingredients

[0147] In order to confirm the rearing effect through rotifer nutritional enrichment, rotifers that did not undergo nutritional enrichment were used as the control group, and the experimental groups were set as i) a group with added microalgae biomass powder (MB group), ii) a group with added microalgae biomass powder and inosine monophosphate (IMP) (MB+IMP group), iii) a group with added microalgae biomass powder and taurine (MB+taurine group), iv) a group with a commercially available mixed product of Chlorella and DHA, EPA as a control group (comparison group 1), and v) a group with added commercially available Chlorella powder as a control group (comparison group 2). MB or the commercial product was dissolved in the rearing water at a concentration of 0.5% (w / w) for each test group and used as a nutritional enrichment agent. For the MB+IMP group, MB and IMP were used at a weight ratio of 99.9:0.1, and for the MB+taurine group, MB and taurine were used at a weight ratio of 99.9:0.1.

[0148] The components of each dietary group were analyzed using the following method.

[0149] First, the crude fat content of the experimental group and the comparative group was analyzed as follows. 2 g of the comparative group product other than the dried biomass powder obtained in Manufacturing Example 2-1 was added with 8.3 M hydrochloric acid solution, heated to 80°C, then 30 mL of ethyl ether and 20 mL of petroleum ether were added, mixed for 30 seconds, and centrifuged. This process was repeated three or more times. The separated solvent layer was recovered, transferred to a pre-weighed round flask, nitrogen was injected to remove the solvent, and then cooled to constant weight in a desiccator. The weight of the dried oil (crude fat) was measured by subtracting the weight of the empty flask from the weight of the flask after drying, as shown in the following calculation formula, and the total oil (crude fat) content was calculated. The DHA content in the oil (crude fat) was measured by gas chromatography after pretreatment with methanolic 0.5 N NaOH and 14% trifluoroborane methanol (BF3).

[0150] [Calculation formula]

[0151] Total oil content (%) = (*oil g / dry cell mass g) X 100

[0152] *Oil g: Weight of flask after acid hydrolysis and solvent removal - Weight of empty flask

[0153]

[0154] The protein content of the experimental and control groups was analyzed as follows. 1 g of each product was placed in a Kjeldahl apparatus (Kjeltec 2100) analysis tube, 12–15 mL of 98% sulfuric acid and a catalyst were added, and the product was digested in a digester. The digestion tube was then mounted on an autosampler. The crude protein content was measured by cooling and collecting the gaseous ammonia generated by heating and distilling it with caustic soda and steam in the Kjeldahl apparatus, and then titrating it with a 0.1 N hydrochloric acid solution to automatically calculate the nitrogen content.

[0155] Moisture was analyzed by atmospheric pressure heating and drying method (125℃, 3 h) according to the AOAC (2005) method.

[0156] The results of component analysis of microalgae biomass dried powder are shown in Table 1 below, and the results of composition analysis of omega-3 fatty acids, which are essential fatty acids for fish, are shown in Table 2.

[0157] Dietary crude protein (wt%), crude lipids (wt%), moisture (wt%), MB group 79.5±0.20, 14.6±0.34, 5.06±0.09, MB+IMP group 79.0±2.06, 13.8±0.22, 4.67±0.14, MB+taurine group 79.6±0.49, 12.7±0.87, 4.89±0.07, Chlorella+DHA+EPA (comparative group 1) 23.2±1.25, 42.7±4.38, 91.8±0.01, Chlorella powder (comparative group 2) 63.0±0.28, 7.18±1.7, 14.40±0.05

[0158] Fatty acids (% by weight) in crude fat of 100 g fat (lipid) Schizochytrium sp. CD03-7004 C20:5n-3 (EPA: eicosapentaenoic acid) 0.9 C22:6n-3 (DHA: docosahexaenoic acid) 33.1 C22:5n-3 (DPA: docosapentaenoic acid) 0.4

[0159] As shown in Table 1, the protein content of the microalgal biomass of the present invention exceeded 80%, which was significantly higher than the protein content of the biomass of the genus Schizochytrium known previously (about 10 to 15 wt%). In addition, the fat content of the microalgal biomass of the present invention was approximately 11 wt%, which was lower than the fat content of the biomass of the genus Schizochytrium known previously (about 50 to 60 wt%). In addition, the MB group, MB+IMP group, and MB+taurine group had a higher crude fat content than Comparative Group 2, and the crude protein content was significantly higher than Comparative Group 1 and Comparative Group 2, which indicated that they had an excellent nutritional enhancement effect.

[0160]

[0161] 1-2-2. Rotifer Nutrition Enhancement

[0162] Rotifers (Brachionus rotundiformis, Aquanet, Korea) used as food for the early larvae of Whiteleg shrimp were reared in an incubator (ZH-2000, Ziss aqua, Korea) according to the method of Kwon and Park (2008) under the following rearing conditions: water temperature 30 ± 0.5℃, salinity 32 ± 0.1 ppt, pH 7.0 ± 0.1, density 1,000 individuals / mL. The rearing temperature is the temperature reported to be the most active for reproduction. Since the feeding amount for rotifers is not clear, the feeding amount was set based on the remaining rotifers in the tank. That is, the cell count of rotifers was counted every morning (average 5,000,000 ind. / L), 2 L was dispensed to each experimental group, and the supply amount was 5 g per 1 L, which is the amount that does not deplete the rotifers in the experimental tank, to prevent the formula as much as possible, and the nutritional supplement was fed. The control group did not receive any treatment.

[0163]

[0164] 1-2-3. Whiteleg shrimp breeding test

[0165] The whiteleg shrimp used for the rearing experiment were early larvae with an average body length of 0.67±0.03 mm. The early larvae were purchased from a nursery to be as large as possible for the experiment. A total of 200 shrimps were randomly placed in 28 acrylic tanks (50 L each), and the experiment was repeated four times. An aeration generator was installed to supply sufficient dissolved oxygen to the test tanks, and the water temperature was maintained at 30.0±0.98℃, dissolved oxygen at 7.43±0.30 mg / L, and ammonia (NH3) at approximately 0.02 ppm during the rearing experiment. At the end of the rearing experiment, the weight and body length of each shrimp were measured to investigate the growth rate and survival rate.

[0166]

[0167] 1-2-4. Experimental Procedure

[0168] After adding 500 ml of the corresponding nutritional supplement to the rotifers of the experimental and control groups, the rotifers were enriched for 6 hours according to the method of Park and Brwon (2004). Afterwards, the rotifers were separated using a strainer and washed with fresh water to remove salt and foreign substances.

[0169] Afterwards, the nutrient-fortified rotifers were fed three times a day (07:00, 13:00, and 19:00) for 9 days to the early larvae of whiteleg shrimp for rearing experiments. The daily feed amount was supplied at 25% to 35% of the shrimp body weight according to the method of Silva et al. (2021). To confirm the nutritional fortification of rotifers, each feeding was observed using an optical microscope, and at the end of the rearing experiment, the weight and body length of each shrimp were measured to investigate the growth rate and survival rate.

[0170]

[0171] 1-2-5. Analysis of rotifer components

[0172] The composition of rotifers was analyzed according to the AOAC (2005) method. Moisture was analyzed using the atmospheric pressure drying method (125℃, 3 h), crude protein was analyzed using an automatic crude protein analyzer (Kjeltec system 2300, Sweden), and lipid was analyzed using a Soxhlet extraction device (Soxhlet heater system C-SH6, Korea). The fatty acid composition in rotifers was analyzed by gas chromatography (6800GC; Agilent, San Francisco, CA, USA) according to the method of Garces and Mancha (1993).

[0173]

[0174] 1-2-6. Nonspecific immunoassay of whiteleg shrimp

[0175] Crustaceans like whiteleg shrimp lack an adaptive immune system and cannot remember antigens, so they rely heavily on their nonspecific (innate) immune system. Therefore, enhancing nonspecific immunity through the use of additives is essential for whiteleg shrimp.

[0176] Lysozyme is one of the key antimicrobial enzymes in the innate immunity of crustaceans. It inhibits bacterial infection by hydrolyzing the mucopolysaccharide in the bacterial cell wall, and has antibacterial activity against Gram-negative bacteria in White shrimp. Crustin is a peptide that plays an important role in the innate immunity of crustaceans and has an antibacterial effect mainly on Gram-positive bacteria. Penaeidin-3 can kill various bacteria and fungi by directly destroying the cell membrane or cell wall of crustacean microorganisms. LGBP (lipopolysaccharide and β-1, 3-glucan binding protein) recognizes lipopolysaccharide and β-1, 3-glucan-binding protein in various fungi and Gram-negative bacteria, activates a signal transduction system that triggers an immune response, and activates the release of antimicrobial peptides and phagocytosis.

[0177] To measure the relative expression levels of Lysozyme, Crustin, Penaeidin-3, and LGBP genes related to nonspecific immunity in white shrimp, quantitative real-time polymerase chain reaction (qRT-PCR) was performed. The hepatopancreas of the test shrimp was isolated, and total RNA was extracted using TRI-zol® (Sigma, St. Louis, MO, USA). The purity (OD) of RNA was determined using Nano drop 2000 (Thermo Scientific, Wilmington, DE, USA). 260 / OD 280, 1.8-2.0) were measured, and cDNA was synthesized using the PrimeScriptTM first-strand cDNA synthesis kit (TaKaRa, Shiga, Japan). The synthesized cDNA was diluted 10-fold in nuclease-free water and used for qPCR analysis (Lysozyme, crustin, penaeidin, LGBP). qRT-PCR was performed to analyze the expression levels of Lysozyme, Penaeidin-3a, and Crustin in the hepatopancreas of White shrimp according to the method of Miandare et al. (2017), and the expression level of LGBP was analyzed according to the method of Yang et al. (2015). β-actin was used as a reference gene. To confirm gene expression in qRT-PCR, each sample was diluted to a total volume of 20 μL with 2 μL of cDNA, 10 μL of TaKaRa Ex TaqTMSYBR premix, 0.4 μL of forward and reverse primers, and 7.2 μL of H2O. The PCR was performed using a Real Time System TP 950 Thermal Cycler DiceTM (TP950, TaKaRa, Shiga, Japan), and the PCR products were confirmed by electrophoresis on a 1.5% agarose gel. The primer sequences and target gene sizes used in this experiment are shown in Table 3 below.

[0178] Primer sequences and target gene sizes by gene Target gene Primer direction Sequences (5'-3') Sequence number Product size (bp) Lysozyme Forward TGTTCCGATCTGATGTCC 6 121 Reverse GCTGGTTGTAAGCCACCC 7 Penaeidin-3a Forward CACCCTTCGTGAGACCTTTG 8 123 Reverse AATATCCCTTTCCCACGTGAC 9 Crustin Forward ACGAGGCAACCATGAAGG 10 141 Reverse AACCACCACCAACACCTAC 11 LGBP Forward ACCGCATCAGTTATACC 12 77 Reverse GTCATCGCCCTTCCAGTTG 13 β-actin Forward CCACGAGACCACCTACAAC 14 142 Reverse AGCGAGGGCACTGATTTC 15

[0179]

[0180] 1-3. Results of nutritional enrichment of rotifers - Optical microscope observation and rotifer component analysis

[0181] Rotifer cell counts were performed daily in the morning, and the supply was maintained at 60 rotifers per mL in the experimental tank to minimize the risk of malnutrition. Each experimental group was observed under an optical microscope after daily nutritional enrichment, and the results are shown in Figure 1.

[0182] As a result, as shown in Fig. 1, when the microalgae biomass of the present invention was fed to rotifers, it was observed that nutrients were contained in the rotifer intestines, indicating that nutritional enhancement of the rotifers was successfully achieved.

[0183] Additionally, the results of analyzing the crude protein, crude fat, and fatty acid composition of the nutrient-fortified rotifer are shown in Table 4 below.

[0184] - Dietary control group MB group MB + IMP group MB + Taurine group Chlorella + DHA + EPA (comparative group 1) Chlorella powder (comparative group 2) Composition ratio (weight % of dry matter) Crude protein 61.05 3.45 0.15 6.85 7.75 8.2 Crude lipids 24.72 1.72 1.82 7.93 2.72 5.0 Fatty acids (crude fat) Weight%) C143.462.282.352.241.52-C1624.950.952.551.117.219.8C16:1---8.3418.8C1813.62.922.692.706.42-C18:1n9c15.4---11.35.79C18:2n6c42.61.581.581.8433.651.4C18:3n-3----9.564.15C20:5n-3----4.35-C22:6n-3-42.340.942.17.72-

[0185] As shown in Table 4, the MB+taurine group had a lower crude fat content than the control group 1, but it was confirmed that it contained significantly higher amounts of omega-3 fatty acids, which are essential fatty acids, especially DHA (C22:6n-3).

[0186] It was found that the MB group and MB+IMP group showed an effect of strengthening omega-3 fatty acid, an essential nutrient for shrimp, compared to Comparative Example 1 and Comparative Example 2, which contained a larger amount of crude fat, despite containing relatively less crude fat than the control group as well as Comparative Group 1 and Comparative Group 2.

[0187]

[0188] 1-4. Results of Whiteleg Shrimp Breeding Test - Growth Rate and Survival Rate Evaluation

[0189] After a total of 9 days of rearing experiment, the average weight, body length, and number of whiteleg shrimp were measured in each tank, and the growth rate (body length increase rate) and survival rate were calculated based on the results, which are shown in Table 5 below. The calculation formulas for calculating growth rate and survival rate are as follows.

[0190] Each value is the average of n=4 and is expressed as mean ± standard deviation. Values ​​with different superscripts in the same column indicate significant differences (P<0.05).

[0191] Length gain (LG; %) = 100 × [Final body length - Initial body length] / Initial body length

[0192]

[0193] Survival rate (Shrimp survival; %) = 100 × [final number of shrimp / initial number of shrimp]

[0194]

[0195] After the rotifer feeding experiment, the growth rate (%) and survival rate (%) were measured. Dietary growth rate Survival rate (%) Body length increase (mm) Body length increase rate (%) Control group 6.97±0.71 c 1035±106 c 43.5±11.7 b MB group 9.60±0.27 a 1425±40.4 a 70.1±5.01 a MB+IMP group 9.39±0.35 a 1394±52.1 a 68.5±3.03 a MB+taurine group 9.47±0.15 a 1406±22.5 a 73.9±6.52 a Chlorella+DHA+EPA (comparison group 1) 8.58±0.43 b 1274±63.2 b 51.0±10.3 b Chlorella powder (comparison group 2) 7.02±0.67 c 1042±99.2 c 55.1±9.25 b

[0196] As shown in Table 5, the growth rate and survival rate of the MB group, MB+IMP group, and MB+taurine group significantly increased compared to not only the control group but also the comparative group 1 and comparative group 2. In particular, the survival rate of the MB+taurine group was 73.9%, which was significantly improved compared to the control group.

[0197]

[0198] 1-5. Results of Whiteleg Shrimp Breeding Test - Evaluation of Nonspecific Immune Enhancement

[0199] To evaluate the nonspecific immunity of whiteleg shrimp fed with nutrient-fortified rotifers for 9 days, the relative expression levels of nonspecific immunity-related genes were measured. The results are shown in Table 6 below. Each value is the average of n=4 and is expressed as mean ± standard deviation. Values ​​with different superscripts in the same column indicate a significant difference (P<0.05).

[0200] Dietary LysozymeCrustinLGBPPenaeidin-3aControl1.00±0.11 e 1.00±0.06 f 1.00±1.46 e 1.00±0.88 b MB3.64±0.39 c 6.34±0.28 c 4.12±0.25 b 2.83±1.39 a MB+IMP4.41±0.38 b 11.0±0.64 a 5.85±1.53 a 3.24±1.45 a MB+taurine 5.38±0.93 a 7.39±0.26 b 3.26±0.23 c 2.53±1.16 a Chlorella+DHA+EPA (comparison group 1) 2.20±0.18 d 4.59±0.57 d 2.35±0.37 d 2.65±0.82 aChlorella powder (comparison group 2) 4.68±0.29 b 2.20±0.04 e 0.78±0.17 e 0.91±0.19 b

[0201] As shown in Table 6, Lysozyme expression in the hepatopancreas of White shrimp was significantly higher than that of the control group in all experimental groups, and the MB+taurine group showed the highest expression level. Crustin expression was significantly higher than that of the control group in all experimental groups, and the MB+IMP group showed the highest expression level. LGBP expression was significantly higher than that of the control group in all experimental groups except the Chlorella powder administration group (comparative group 2), and the MB+IMP experimental group showed the highest expression level. Penaeidin-3a expression was significantly higher than that of the control group in all experimental groups except the Chlorella powder administration group (comparative group 2), and the MB+IMP experimental group showed the highest expression level.

[0202] In this way, it was confirmed that MB, MB + IMP, and MB + taurine not only have the effect of promoting the growth of whiteleg shrimp, but also have the effect of enhancing non-specific immunity.

[0203]

[0204] Example 2: Effect of rearing through nutritional enhancement using Artemia microalgae biomass in the postlarvae stage of Whiteleg shrimp.

[0205] In this example, the raw material to be tested was microalgae biomass dried powder (MB), and as comparative raw materials, commercially available products, Chlorella, DHA and EPA mixed product (comparative group 1) and Chlorella powder (comparative group 2) were selected, and inosine monophosphate (IMP) and taurine were selected as functional additives.

[0206]

[0207] 2-1. Test to determine the amount of added microalgae biomass dried powder (MB)

[0208] Before conducting the Artemia nutritional enrichment experiment, the following experiment was conducted to determine the appropriate amount of microalgae biomass dry powder (MB) to be used for nutritional enrichment.

[0209] Artemia cysts were stocked at a rate of 1 g per liter using products from SEP-Art Technology (USA). Microalgal biomass dry powder (MB) was supplied at concentrations of 0.25, 0.5, 1.0, 1.5, and 2.0% (w / w), respectively, and nutritional enrichment was performed for 2 hours after hatching (24 hours) and yolk absorption (22 hours). After 2 hours of nutritional enrichment, the nutritional enrichment status of each experimental group was confirmed using a microscope. Microscopic examination revealed that the amount of MB in the intestines of Artemia supplied with 0.25% MB was less than that of the experimental groups supplied with 0.5% or more. Therefore, the nutritional enrichment experiment of Artemia was conducted by feeding 0.5% of the content of MB in the Artemia rearing water.

[0210]

[0211] 2-2. Feed production and breeding conditions

[0212] 2-2-1. Artemia Nutrition Fortification

[0213] In order to confirm the rearing effect through nutritional enrichment of Artemia, Artemia that had not undergone nutritional enrichment were used as the control group, and the experimental groups were set as i) a group with added microalgae biomass powder (MB group), ii) a group with added microalgae biomass powder and inosine monophosphate (IMP) (MB+IMP group), iii) a group with added microalgae biomass powder and taurine (MB+taurine group), iv) a group with added commercially available Chlorella+DHA+EPA as a comparison group (comparison group 1), and v) a group with added commercially available Chlorella powder as a comparison group (comparison group 2). The components of each dietary group are shown in Table 1. MB or the commercial product was dissolved in the rearing water at a concentration of 0.5% for each test group and used as a nutritional enrichment agent. For the MB+IMP group and MB+taurine group, MB was used at 99.9% (w / w), and IMP or taurine was used at 0.1% (w / w), respectively.

[0214] Artemia, used as food for the postlarvae of Whiteleg shrimp, were hatched for 24 hours using an Artemia incubator (ZH-2000, Ziss aqua, Korea) at a water temperature of 30 ± 0.5℃ and a salinity of 30 ± 0.5 ppt, and the eggshells were removed using a magnetic bar. After confirming that the mouths of Artemia larvae were opened, a nutrient fortifier was added at 0.5% (w / w) based on the culture tank, and after 2 hours, the Artemia were separated using a strainer and washed with fresh water to remove salt and foreign substances.

[0215]

[0216] 2-2-2. Whiteleg shrimp breeding test

[0217] The shrimp for rearing experiments, postlarvae of Whiteleg shrimp, had an average body length of 9.12±0.38 mm and body weight of 3.67±0.23 mg. 100 shrimp were randomly distributed into 28 acrylic tanks (50 L each), and the experiment was repeated four times. To supply sufficient dissolved oxygen to the test tanks, an aeration generator was installed, and the water temperature was maintained at 29.8±0.89°C, dissolved oxygen at 7.87±0.21 mg / L, and ammonia (NH3) at approximately 0.02 ppm.

[0218]

[0219] 2-2-3. Experimental Procedure

[0220] Feeding was provided three times a day (08:00, 14:00, 20:00 h) for 12 days. The daily feed amount was started at 300 Artemia and increased by 10% every day according to the method of Alday-Sanz (2010) and Xie et al. (2021). Each experimental group was observed for nutritional enrichment using an optical microscope every time before feeding (Fig. 2), and the remaining Artemia were collected daily for general composition analysis and fatty acid investigation. At the end of the rearing test, the weight and body length of each late-stage larva of P. vannamei were measured to determine the growth rate and survival rate.

[0221]

[0222] 2-2-4. Analysis of Artemia components and measurement of body length

[0223] The general composition of Artemia was analyzed according to the AOAC (2005) method. Moisture was analyzed by atmospheric drying (125°C, 3 h), protein by an automatic crude protein analyzer (Kjeltec system 2300, Sweden), and lipid by Soxhlet extraction device (Soxhlet heater system C-SH6, Korea). The fatty acid composition in Artemia was analyzed by gas chromatography (6800GC; Agilent, San Francisco, CA, USA) according to the method of Garces and Mancha (1993). The body length of the fortified Artemia was measured by an optical microscope (ICC50, Leica, Germany), and the pH was measured according to the method of Meneguz et al. (2018).

[0224]

[0225] 2-2-5. Nonspecific immune analysis of whiteleg shrimp

[0226] To evaluate the non-specific immunity of whiteleg shrimp fed with fortified Artemia for 12 days, the relative expression levels of non-specific immunity-related genes were analyzed using the same method as that shown in Example 1-2-6 described above.

[0227]

[0228] 2-3. Results of Artemia Nutrition Fortification - Microscopic Observation and Artemia Component Analysis

[0229] The results of measuring Artemia body length (μm) before and after nutritional enrichment are shown in Table 7 below. Each value is the average of n=4 and is expressed as mean ± standard deviation. Values ​​with different superscripts in the same column indicate significant differences (P<0.05).

[0230] Diet Length (μm) Before fortification 910±18.0 d Control group 956±11.9 c MB group 970±6.42 bc MB+IMP group 990±11.3 a MB+taurine group 982±10.9ab Chlorella+DHA+EPA (comparison group 1)970±5.59 bc Chlorella powder (comparison group 2) 967±10.6 bc

[0231] As shown in Table 7, after nutritional enrichment, the body length of all experimental groups significantly increased compared to the control group, indicating that nutritional enrichment was successful. In particular, the MB+IMP group showed the highest value.

[0232] - Dietary control group MB group MB + IMP group MB + Taurine group Chlorella + DHA + EPA (comparative group 1) Chlorella powder (comparative group 2) Composition ratio (weight % of dry matter) Crude protein 60.160.459.261.661.761.6 Crude lipids 17.822.027.521.423.518.1 Fatty acid (crude fat) % wt. C14N / DN / DN / DN / D3.63N / DC1614.620.120.018.915.813.5C16:14.783.764.134.033.954.39C1811.39.409.599.809.7310.2C18:1n9c24.619.719.720.62 7.428.5C18:2n6c7.335.976.396.397.949.14C18:3n-333.726.927.728.328.7 31.3C20:5n-33.153.313.503.523.092.80C22:6n-30.6510.88.968.483.350.10

[0233] N / D: As shown in Table 8, the MB+taurine group had higher crude protein and crude fat contents than not only the control group but also the comparative group 2, and in particular, the MB group, MB+IMP group, and MB+taurine group contained higher amounts of omega-3 fatty acids (C20:5n-3 and C22:6n-3), which are essential fatty acids of shrimp, than not only the control group but also the comparative group 1 and the comparative group 2, showing a lipid nutrition enhancement effect.

[0234]

[0235] 2-4. Results of Whiteleg Shrimp Breeding Test - Growth Rate and Survival Rate Evaluation

[0236] After a total of 12 days of rearing experiment, the average weight, body length, and number of late-stage whiteleg shrimp larvae were measured in each tank, and the growth rates (body weight increase rate and body length increase rate) and survival rates were calculated based on these results, which are shown in Table 9 below. Each value is the average of n=4 and is expressed as mean ± standard deviation. Values ​​with different superscripts in the same column indicate significant differences (P<0.05).

[0237] The calculation formulas for weight gain rate, body length gain rate, and survival rate are as follows.

[0238] Weight gain (WG; %) = 100 × [Final body weight - Initial body weight] / Initial body weight

[0239] Length gain (LG; %) = 100 × [Final body length - Initial body length] / Initial body length

[0240] Survival rate (Shrimp survival; %) = 100 × [final number of shrimp / initial number of shrimp]

[0241] After the end of the feeding experiment with Artemia, the results of growth rate (%) and survival rate (%) were measured. Dietary growth Survival rate (%) Final body weight (g) Body weight increase rate (%) Body length increase rate (%) Control group 26.5±0.45 c 622±12.3 d 75.9±7.08 b 94.8±3.10MB group 30.4±3.17 ab727±86.3 abc 83.4±6.26 ab 97.0±1.00MB+IMP group 31.8±1.47 a 767±39.9 a 91.3±2.87 a 97.5±2.65MB+Taurine group 30.9±2.29 a 741±62.3 ab 88.1±6.91 a 97.8±0.96 Chlorella+DHA+EPA (comparison group 1) 27.4±1.57 bc 647±42.8 cd 82.4±7.25 ab 96.8±2.06 Chlorella powder (comparison group 2) 28.8±2.11 abc 659±32.1 bcd 76.6±5.11 b 94.0±5.16

[0242] As shown in Table 9, it was found that the body length and body weight in the MB group, MB+IMP group, and MB+taurine group all increased compared to the control group. The body length increase rate in the MB+IMP group and MB+taurine group was significantly higher than that in the control group. The body weight increase rate was significantly higher in the MB group, MB+IMP group, and MB+taurine group than in the control group, and overall, the MB+IMP group showed the highest growth rate. As such, it was found that when MB, MB+IMP, or MB+taurine of the present invention was administered, the nutritional enhancement efficiency was excellent.

[0243]

[0244] 2-5. Results of Whiteleg Shrimp Breeding Test - Evaluation of Nonspecific Immune Enhancement

[0245] To evaluate the nonspecific immunity of whiteleg shrimp fed with enriched Artemia for 12 days, the relative expression levels of nonspecific immunity-related genes were measured. The results are shown in Table 10 below. Each value is the average of n=4 and is expressed as mean ± standard deviation. Values ​​with different superscripts in the same column indicate significant differences (P<0.05).

[0246] Dietary LysozymeCrustinLGBPPenaeidin-3aControl1.00±0.23 c 1.00±0.06 c 1.00±0.13 c 1.00±0.10 b MB group 1.31±0.56 bc 1.05±0.06 c 1.50±0.21 c 1.15±0.32 b MB+IMP group 1.80±0.39 ab 1.56±0.12 a 3.28±0.50 b 1.81±0.13 a MB+taurine group 2.05±0.50 a 1.33±0.03 b 6.36±2.11 a 1.06±0.07 b Chlorella+DHA+EPA (comparison group 1) 1.47±0.41 abc 1.01±0.03 c 1.56±0.30 c 1.11±0.03 b Chlorella powder (comparison group 2) 1.11±0.26 c 0.97±0.07 c 0.79±0.19 c 0.53±0.03 c

[0247] As shown in Table 10, non-specific immune-related genes of L. vannamei were all increased in the MB group, MB + IMP group, and MB + taurine group. Lysozyme expression was significantly higher in the MB + taurine group than in the control group, and crustin expression was significantly higher in the MB + IMP group and MB + taurine group than in the control group, with the MB + IMP group having the highest expression level. LGBP expression was significantly higher in the MB + IMP group and MB + taurine group than in the control group, with the MB + taurine group having the highest expression level. Penaeidin-3a expression was significantly higher in the MB + IMP group than in the control group. Thus, it was confirmed that MB, MB + IMP, or MB + taurine not only has the effect of promoting the growth of L. vannamei but also has the effect of enhancing non-specific immunity.

[0248]

[0249] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

[0250]

[0251] [Accession number]

[0252] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0253] Accession number: KCTC15006BP

[0254] Date of acceptance: 20220620

[0255]

[0256]

Claims

1. A feed composition for zooplankton, comprising biomass derived from microalgae of the genus Schizochytrium (Schizochytrium sp.).

2. A feed composition for zooplankton, wherein the microalgae-derived biomass in paragraph 1 comprises at least one selected from the group consisting of microalgae, a culture of the microalgae, a dried product of the culture, and a crushed product of the dried product.

3. A feed composition for zooplankton, wherein the microalgae-derived biomass of paragraph 1 contains 40 to 95 wt% of protein.

4. A feed composition for zooplankton, wherein the microalgae-derived biomass of paragraph 1 contains 3 to 30 wt% of fat.

5. A feed composition for zooplankton, wherein the microalgae-derived biomass in paragraph 1 contains 0.05 to 4.5 parts by weight of eicosapentaenoic acid based on 100 parts by weight of fat.

6. A feed composition for zooplankton, wherein the microalgae-derived biomass in paragraph 1 contains 0.01 to 2 parts by weight of docosapentaenoic acid based on 100 parts by weight of fat.

7. A feed composition for zooplankton, wherein the microalgae-derived biomass in paragraph 1 contains 20 to 50 parts by weight of docosahexaenoic acid based on 100 parts by weight of fat.

8. A feed composition for zooplankton, further comprising inosine monophosphate (IMP) in the first paragraph.

9. A feed composition for zooplankton, wherein in the 8th paragraph, the inosinic monophosphate is included in an amount of 0.05% (w / w) to 1% (w / w) of the mixture of the microalgae-derived biomass and inosinic monophosphate in the feed composition.

10. A feed composition for zooplankton, further comprising taurine, according to claim 1.

11. A feed composition for zooplankton, wherein the taurine is included in an amount of 0.05% (w / w) to 1% (w / w) of the mixture of the microalgae-derived biomass and taurine in the feed composition.

12. A feed composition for zooplankton, wherein the Schizochytrium genus strain in paragraph 1 contains a DNA fragment of sequence number 1 in its genomic DNA.

13. A feed composition for zooplankton, wherein the Schizochytrium genus strain in paragraph 1 is CD03-7004 strain (accession number KCTC15006BP).

14. A feed composition for zooplankton, wherein the zooplankton in paragraph 1 is at least one species selected from the group consisting of rotifers, artemia, and water fleas.

15. A feed composition for zooplankton having a nutritional strengthening effect on zooplankton according to any one of claims 1 to 14.

16. A method for culturing zooplankton, comprising a step of feeding zooplankton with a feed composition for zooplankton according to any one of claims 1 to 14.

17. A method for enhancing the nutrition of zooplankton, comprising a step of feeding the zooplankton feed composition of any one of claims 1 to 14.

18. A method for cultivating fish or crustaceans, comprising a step of feeding zooplankton that has consumed the zooplankton feed composition of any one of clauses 1 to 14 to fish or crustaceans.

19. A method for enhancing non-specific immunity in fish or crustaceans, comprising a step of feeding zooplankton that has consumed the zooplankton feed composition of any one of claims 1 to 14 to fish or crustaceans.

Images