Generating human-specific arcuate nucleus cell types of the hypothalamus and their applications
The ARC differentiation protocol addresses the challenge of heterogeneous neural cultures by using timed BMP addition and 3D conditions to produce specific arcuate nucleus progenitors and mature cells, enhancing drug testing and appetite regulation studies.
Patent Information
- Application Number
- PCT/EP2025/055473
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-28
- Filing Date
- 2025-02-28
- Publication Date
- 2025-09-04
AI Technical Summary
Current in vitro protocols for generating hypothalamic neural subtypes from stem cells result in high heterogeneity due to unclear lineage relationships and complex anatomical folding, making it challenging to produce accurate cultures of arcuate nucleus neuronal cell populations.
A novel ARC differentiation protocol using timed addition of BMP and 3D culture conditions to generate arcuate nucleus progenitors and specific mature cell types, such as arcuate nucleus neuronal subtypes and tanycytes, by modeling early tuberal hypothalamic patterning and fine-tuning lineage enrichment.
Enables a high yield of arcuate nucleus progenitors and mature cell types, providing a well-characterized human in vitro model for drug testing and studying appetite regulation at a molecular and cellular level.
Smart Images

Figure 00000089_0000 
Figure 00000089_0001 
Figure 00000089_0002
Abstract
Description
[0001] Generating human-specific arcuate nucleus cell types of the hypothalamus and their applications
[0002] Technical field
[0003] The present invention relates to methods for differentiating cells into arcuate nucleus (ARC) cell progenitors, and mature arcuate nucleus neurons and tanycytes. The methods of the invention are for instance useful to enhance specification and maturation of arcuate nucleus neuronal cell populations, in particular of human-specific arcuate nucleus neuronal cell populations derived from pluripotent stem cells. The invention also relates to populations of arcuate nucleus cell progenitors expressing specific transcription factors, which can be further matured into arcuate nucleus neurons and tanycytes. Said cell populations can find useful applications for instance in drug discovery and disease modelling in the field of metabolic diseases research.
[0004] Background
[0005] Neuronal dysregulation of the melanocortin-associated nuclei in the hypothalamus is coupled to metabolic diseases such as obesity and type 2 diabetes (Bruning and Fenselau, 2023). In line with this, recent appetite-lowering drugs for obesity targeting the glucagon-like peptide 1 receptor (GLP1R), such as Semaglutide and Liraglutide, are hypothesised to act on hypothalamic circuits, the mechanism of which are only partially resolved (Rupp et al., 2023; Sisley et al., 2014). As such, access to functional in vitro derived human hypothalamic neurons is a promising tool to study the molecular pathways involved in appetite regulation, obesity and type 2 diabetes as well as for targeted drug discovery (Chen et al., 2023).
[0006] However, generating accurate cultures of hypothalamic neural subtypes from stem cells remains a challenge, as the lineage relationship between each neural progenitor and its corresponding neuronal subtype is unclear. This is largely due to the high complexity of the hypothalamic nuclei, the complex anatomical folding of the hypothalamus during development and the limited number of lineage fate mapping studies (Ma et al., 2021). Consequently, current in vitro protocols produce a high degree of heterogeneity of neuronal populations and cell types (Sarrafha et al., 2023). However, recent advances in temporal single cell RNA sequencing (scRNAseq) of human fetal tissue has allowed to bioinformatically simulate hypothalamic lineage specification (Zhou et al., 2022), giving rise to new hypotheses on the earliest hypothalamic patterning events. For the efficient generation of individual hypothalamic nuclei from human embryonic stem cells (hESCs), the correct developmental cues of the developing neural tube must be recapitulated. From studies in animal models, it is known that the hypothalamus is subdivided sagittally into the anterior, tuberal, and mammillary regions. The tuberal hypothalamus is a region of high interest, as it is postulated to give rise to the key appetite-regulating neurons expressing POMC and AGRP, as well as to tanycytes, which are highly specialized radial glial like cells of the hypothalamus (Burbridge et al., 2016). Tanycytes line the third ventricle of the brain, and have been shown to coordinate metabolic influx through the cerebrospinal fluid (CSF) and regulate energy metabolism (Bolborea and Langlet, 2021). Studies in chick have shown that the role of BMP in transcriptional downregulation of sonic hedgehog (SHH) signalling is essential for correct tuberal hypothalamic induction, and that this occurs via members of the T-Box family transcription factors TBX2 / 3 (Manning et al., 2006). In line with this, discoveries in the developing chick, have identified a dynamic ‘wave’ of BMP signalling underlying the spatial formation of anterior to posterior progenitor pools, specifically within the tuberal region (Chinnaiya et al., 2023). Taken together, this indicates that there is a temporal dependency of BMP during specification of tuberal cell types. Whilst sequential addition of BMP has been employed to study neural tube patterning of the dorsal ventral axis in an in vitro mouse ESC differentiation system, its application in human ARC-oriented differentiation remains unexplored (Lehr et al., 2023).
[0007] Summary
[0008] In the present invention, the inventors developed a novel ARC differentiation protocol from pluripotent stem cells, such as hESCs, by modelling early tuberal hypothalamic patterning. The inventors found combinations of compounds and timing of their addition during differentiation which enable a high yield of arcuate nucleus progenitors, and specific mature arcuate nucleus cell types, such as arcuate nucleus neuronal subtypes and tanycytes. In particular, the inventors found that the timed addition of BMP was crucial for obtaining posterior tuberal NKX2-1+ / RAX+ / TBX3+ progenitors. Analysis of these posterior tuberal cultures scRNAseq during later time points of maturation indicated that these progenitors had capacity to generate POMC, AGRP and tanycyte lineages, but that alternative POMC subtypes could also be derived from anterior progenitors. Furthermore, the inventors found that 3D culture conditions of prepatterned progenitors increased AGRP yield whilst favouring neuronal over tanycytic lineages. Finally, the inventors demonstrate that the fine-tuned timing and duration of exposure of BMP during the Patterning phase could in turn enable fine-tuning of the lineage enrichment of tanycytes, AGRP- or POMC-expressing neurons in the mature ARC fates.
[0009] In summary, a well characterized, human in vitro model of the ARC such as the one described herein will have high value for example, but not limited to, drug testing and for studying regulation of appetite at a molecular and cellular level.
[0010] A first aspect of the present invention relates to a method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells, said method comprising a cell patterning and expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of one or more sonic hedgehog pathway activator and, b. Culturing the cells from step a. in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3), thereby obtaining arcuate nucleus progenitor cells.
[0011] A second aspect of the present invention relates to a population of arcuate nucleus progenitor cells obtained by the method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells as described herein.
[0012] A third aspect of the present invention relates to a population of arcuate nucleus progenitor cells wherein said cells are positive for RAX, TBX3 and / or NKX2-1.
[0013] A fourth aspect of the present invention relates to a method for differentiating arcuate nucleus progenitor cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a maturation phase comprising the step of: i. Culturing said arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes. A fifth aspect of the present invention relates to a method for differentiating pluripotent stem cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a cell patterning and expansion phase comprising the steps of the method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells as described herein, and further comprising a maturation phase comprising the step of: i. Culturing the obtained arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes.
[0014] A sixth aspect of the present invention relates to a kit-of-parts comprising:
[0015] - One or more sonic hedgehog pathway activator, preferably wherein the one or more sonic hedgehog pathway activator is selected from the group consisting of a naturally occurring sonic hedgehog pathway activator and a synthetic sonic hedgehog pathway agonist, even more preferably wherein the one or more sonic hedgehog pathway activator is SHH or a Smoothened agonist, such as SAG or purmorphamine, yet even more preferably wherein the one or more sonic hedgehog activator is SHH;
[0016] - BMP4 and / or BMP7;
[0017] - IGFBP3;
[0018] - One or more SMAD inhibitors, preferably wherein the one or more SMAD inhibitors are selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP), even more preferably wherein the one or more SMAD inhibitors are SB413542 and Noggin;
[0019] - An activator of the WNT signalling pathway, preferably wherein the WNT signalling pathway activator is a GSK3P inhibitor, even more preferably wherein the activator of the WNT signalling pathway is CHIR99021 ;
[0020] - Optionally, a ROCK inhibitor, preferably wherein the ROCK inhibitor is Y-27632; and
[0021] - Optionally, a medium supporting the growth of neural progenitor cells.
[0022] A seventh aspect of the present invention relates to a kit-of-parts comprising:
[0023] - The population of arcuate nucleus progenitors cells as described herein, and
[0024] - Instructions for use Description of Drawings
[0025] Figure 1
[0026] A. qRT-PCR expression data of day 16 of differentiation of paraventricular nucleus (PVN) and ARC differentiations with and without BMP4 (BMP), including also a ventral forebrain (vFB) control. The order of the conditions on the legend above the graph is the same as the order of the bars on the graph, for each of the markers NKX2-1, TBX3, RAX, SHH, F0XD1 and F0XG1. mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0027] B. Combinatorial staining by ICC (NKX2-1) and ISH (RAX and TBX3) on day 16 progenitors differentiated with (lower panel) and without (upper panel) BMP treatment. Scale Bar: lOOpm
[0028] C. Single cell RNA sequencing on optimized day 16 progenitor cultures generated with an ARC or a PVN protocol.
[0029] D. Feature plots of the ARC and PVN scRNAseq data highlighting important posterior tuberal markers in the SOX2+ progenitor population: RAX, TBX3 and NKX2-1, and also showing expression of IGFBP3 in the early postmitotic population as a potential enhancer of ARC specific fates. Max= maximum scaled expression, Min= minimum scaled expression.
[0030] Figure 2
[0031] A. Schematic representation of experimental design used to stimulate BMP temporal patterning in vitro. Arrows represent different time points of addition of BMP4 tested.
[0032] B. Combinatorial staining by ICC (NKX2-1) and ISH (RAX and TBX3) on day 16 progenitors cultures produced with timed addition of BMP4. Scale Bar: lOOpm
[0033] C. qRT-PCR analysis of day 16 ARC progenitors differentiated with different starting days of BMP4 treatment. One-way ANOVA followed by a Tukey’s multiple comparisons test. p<0.05
[0034] D. qRT-PCR analysis of day 16 ARC progenitors differentiated with either BMP4 or BMP7. Ns= non-significant. E. Combinatorial staining by ICC (NKX2-1) and ISH (RAX and TBX3) on day 16 progenitors cultures produced with either BMP4 or BMP7. Scale Bar: 100pm
[0035] F. qRT-PCR analysis of day 50 ARC cultures differentiated with different starting days of BMP4 treatment.
[0036] G. qRT-PCR of mature day 50 ARC cultures. Pairwise analysis of AGRP and POMC expression within the same differentiation experiment, with and without IGFBP3 treatment. Paired t-test AGRP p=0.555, POMC p=0.0818.
[0037] H. ICC of day 50 ARC cultures for POMC, AGRP and MAP2. Scale bar: 100pm mRNA expression is for all graphs shown as fold change relative to undifferentiated hESCs.
[0038] Figure 3
[0039] A. Schematic of ARC differentiation protocol version 2 (V2) using addition of BMP4 at day 5 of differentiation (i.e. following initiation of the cell patterning phase). SB = SB413542, NOG = Noggin.
[0040] B. Cluster annotations based on Leiden clustering and gene expression of each cluster in the day 16 dataset.
[0041] C. mRNA expression levels of key ARC markers. Max= maximum expression, Min= minimum expression. mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0042] D. % of RAX, TBX3, NKX2-1 expressing cells within day 16 ARC cultures across 4 batches determined by scRNAseq.
[0043] E. % of RAX / TBX3 / NKX2.1 co-expressing cells within day 16 ARC cultures across 4 batches determined by scRNAseq.
[0044] F. LIMAP projections of scRNAseq of the same 4 ARC batches analysed at day 25.
[0045] G. Heatmap indicating the expression levels of cluster-specific and ARC-relevant markers from the day 25 scRNAseq analysis. Represented as mean expression level in cluster.
[0046] H. Feature plots for important markers of the day 25 ARC dataset. Max= maximum expression, Min= minimum expression.
[0047] Figure 4
[0048] A. Schematic overview of 2D and 3D (spheroid) in vitro maturation as well as in vivo maturation after transplantation of ARC progenitors into the striatum of nude rats. B. qRT-PCR data of day 50 arc cultures with and without BMP7 added in maturation medium from day 25-50. mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0049] C. LIMAP of snRNASeq data of all day 50 and 70 2D and spheroid cells with low resolution clustering.
[0050] D. Feature plots for key markers defining neurons (STMN2), tanycytes (DI02) and POMC neurons (POMC). Max= maximum expression, Min= minimum expression
[0051] E. Human neural cell adhesion molecule (hNCAM) stain of graft site in the striatum 4 months after engraftment of ARC cells. Scale bar: 100pm. HuNu : Human nuclei, Tx: transplant.
[0052] F. ICC of AGRP, NPY and POMC at high magnification to observe entire graft site. Scale bar: 25pm. H=POMC neuron area higher magnified in panel G, lower panel “H”.
[0053] G. Higher magnification images of neuropeptide expression of AGRP, POMC, NPY, OTP and TRH at graft site. H=High magnification insert of POMC neuron from panel F, lower image, “H”. Scale bar: 25pm.
[0054] Figure 5
[0055] A. Heatmap of expression of important markers for different ARC neuronal subtypes at day 50 and 70 of differentiation represented as mean expression in cluster.
[0056] B. ICC images of day 50 2D cultures detecting AGRP, GHRH, TRH, TH and POMC, SST and OTP at a protein level. Scale bar- 50pm
[0057] C. The percentage of cells positive for key ARC neuronal subtypes within each batch, expressed as a percentage of the STMN2+ / RAX- / LHX8- population.
[0058] D. ELISA of secreted AGRP (pg / ml) in the media of controls (H9=hESC line, VM org. d160: ventral midbrain organoids day 160, vFB d50=ventral forebrain day 50) and ARC batches 2-4 (at days 30, 40, 50, 60, 70 of differentiation)
[0059] Figure 6
[0060] A. ICC images of day 50 spheroid cultures also detecting AGRP, GHRH, POMC and TRH levels.
[0061] B. The percentage of important ARC neuronal subtypes in total snRNAseq dataset from day 50+70 cultures of ARC2-ARC4, comparing 2D to 3D (Spheroid) C. Differential abundance analysis of neuronal subtypes across 2D and spheroid conditions showing cell types enriched (positive log-fold change) and depleted (negative log-fold change) in spheroid condition.
[0062] Figure 7
[0063] A. qRT-PCR expression data of day 16 ARC protocol with addition of BMP4 (BMP) between days 5-14 (ARC V2 protocol), days 5-11 or days 5-9. mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0064] B. ICC of day 16 progenitors comparing FOXG1 expression between cultures differentiated with different duration of BMP4 exposure. Scale Bars: 100pm
[0065] Figure 8
[0066] A. qRT-PCR data of day 16 in vitro derived cells. Samples are exposed to increasing durations of BMP to show that using BMP4 from days 5-14 is the best to generate RAX+ / NKX2-1+ / TBX3+ / FGF10+ ARC progenitors. Validated in 3 different cell lines (squares= KOLF2.1J, circles=RC17, triangles=BION). mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0067] B. qRT-PCR data of day 50 in vitro derived cells. Samples are exposed to increasing durations of BMP to show that using BMP from days 5-14 is best to generate AGRP+ neurons and day 5-11 favors POMC+ lineages. Validated across 3 different cell lines (squares= KOLF2.1J, circles=RC17, triangles=BION). mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0068] C. qRT-PCR data of day 50 in vitro derived cells. Samples are exposed to different durations of BMP to show that using BMP from days 5-14 is best to generate DIO2+CRYM+ tanycytes. Experiment performed across 3 different cell lines (squares= KOLF2.1J, circles=RC17, triangles=BION). mRNA expression is shown as fold change relative to undifferentiated hESCs.
[0069] Figure 9
[0070] A. qRT-PCR data of day 50 in vitro derived ARC cells. Cultures have either been exposed to IGFBP3 during patterning phase (+IGFBP3), between the days 6 and 14, (for a minimum or maximum of 6 to 8 days exposure, respectively) or have not received IGFBP3 at all (Control). Normal distribution of the 2 groups was determined by Shapiro-Wilks test. Difference in AGRP and POMC expression was determined by a Wilcoxon matched-pairs signed rank test POMC p=0,0312, AGRP p=0.5625
[0071] B. qRT-PCR data of day 50 in vitro derived ARC cells. Cultures have either been exposed to BMP7 during maturation phase (+BMP7) between the days 25 and 50 or have not (Control). Normal distribution of the 2 groups was determined by Shapiro-Wilks test. Difference in POMC (p=0,0154) , AGRP (p=0,4100) and TBX3 (p=0,0043) expression was determined by paired t-test.
[0072] Detailed description
[0073] Definitions
[0074] As used herein “progenitor cells” refers to cells capable of differentiating into a certain type of cells.
[0075] “Arcuate nucleus progenitor cells” or “ARC progenitor cells” as used herein refer to immature or partially undifferentiated cells capable of differentiating to mature arcuate nucleus cell types such as mature arcuate nucleus progenitor neurons and / or to tanycytes. In some embodiments the arcuate nucleus progenitor cells of the invention are defined by specific marker(s) expression, or combinations thereof, as described herein. The term also includes progenitor cells with molecular characteristics of the arcuate nucleus of the hypothalamus, including stem-cell derived in vitro populations of neural progenitor cells.
[0076] As used herein “positive for X” and “X-positive” are used interchangeably when referring to a specific marker “X”. A cell positive for a marker as used herein refers to a cell in which the presence of said marker can be detected. The positivity of the cells to a marker “X” is typically expressed as a percentage of cells positive for marker “X” within the cell population on which the determination of the marker expression is performed, unless otherwise indicated.
[0077] As used herein "inhibitor" of a signalling molecule or pathway, such as an inhibitor of SMAD signalling, refers to a compound or molecule (e.g., small molecule, peptide, peptidomimetic, natural compound, protein, siRNA, antisense oligonucleotide, aptamer, or antibody) that interferes with (i.e. reduces or suppresses or eliminates or blocks) the signalling function of the molecule or pathway. Similarly, as used herein “activator” of a signalling molecule or pathway, refers to a compound or molecule (e.g., small molecule, peptide, peptidomimetic, natural compound, protein, siRNA, antisense oligonucleotide, aptamer, or antibody) that interferes with (i.e. enhances or activates or stimulates) the signalling function of the molecule or pathway.
[0078] As used herein “SHH” refers to the Sonic HedgeHog protein of the Hedgehog (Hh) family of proteins and covers for instance human and / or recombinant versions of said protein.
[0079] As used herein, “BMP4” refers to the Bone Morphogenic Protein 4 and covers for instance human and / or recombinant versions of said protein.
[0080] As used herein, “BMP7” refers to the Bone Morphogenic Protein 7 and covers for instance human and / or recombinant versions of said protein.
[0081] As used herein “IGFBP3” or “IGFBP-3” refers to Insulin-like growth factor binding protein-3 and covers for instance human and / or recombinant versions of said protein.
[0082] As used herein “CHIR” refers to the aminopyridine compound inhibitor of Glycogen synthase kinase-3 beta (GSK3P) CHIR99021 , also referred to as CHIR-99021.
[0083] As used herein “BDNF” refers to the brain-derived neurotrophic factor and covers for instance human and / or recombinant versions of said protein
[0084] As used herein “AA” refers to ascorbic acid.
[0085] As used herein “GDNF” refers to the glial cell-derived neurotrophic factor and covers for instance human and / or recombinant versions of said protein.
[0086] Human protein and gene nomenclature used herein are according to the nomenclature guidelines established by the National Center for Biotechnology Information (NCBI), unless otherwise specified. As used herein “AGRP” or “AgRP” refers to the Agouti-related protein, also called agouti-related peptide, or agouti-related neuropeptide, such as produced by AgRP / NPY neurons, “GHRH” refers to the growth hormone-releasing hormone, “TRH” refers to thyrotropin-releasing hormone, “TH” refers to tyrosine hydroxylase, “OTP” refers to the homeodomain transcription factor orthopedia, “SST” refers to somatostatin, “PNOC” refers to prepronociceptin, “PRDM12” refers to the transcription factor PR domain zinc finger protein 12, or PR / SET domain 12, “POMC” refers to proopiomelanocortin, “DIO2” refers to Type II iodothyronine deiodinase, or lodothyronine Deiodinase 2, “CRYM” refers to crystallin mu, or NADP-regulated thyroid-hormone-binding protein (THBP), and cover genes, transcripts of genes, and encoded proteins.
[0087] Differentiation methods
[0088] Directed differentiation is a process used to guide the development of stem cells into specific mature cell types, such as neurons, in a controlled and predictable manner. It involves mimicking the natural signalling cues and environmental conditions that cells experience during normal organismal development.
[0089] The skilled person will appreciate that cell differentiation methods may comprise sequential phases from initiating the differentiation of cells, such as pluripotent stem cells, to obtaining partially- or fully-differentiated cells.
[0090] In some embodiments, the method steps of the present invention may be comprised in or consist in one or more of the three following general phases of the differentiation method:
[0091] Phase I, preferably spanning between day 0 and day 11 of differentiation, and referred to herein as a cell Patterning phase.
[0092] Phase II, preferably spanning between day 11 day 16 of differentiation, and referred to herein as a cell Expansion phase.
[0093] Phase III, preferably spanning from day 16 of differentiation, and referred to herein as a cell Maturation phase.
[0094] In some preferred embodiments of the present invention, day 0 of differentiation, corresponding to the day of initiation of the Patterning phase, is the day on which the step of culturing pluripotent stem cells in the presence of one or more inhibitors of the SMAD signalling pathway is initiated.
[0095] The skilled person will appreciate that once the differentiation is initiated, following initiation of the Patterning phase, pluripotent stem cells start differentiating and can be generally referred to as pluripotent stem cell-derived cells, or pluripotent stem cell- derived cultures, obtained from said pluripotent stem cells.
[0096] Methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells
[0097] Patterning and Expansion phase
[0098] In the present invention, the inventors provide methods enabling the generation of region-specific neural progenitor cells of the arcuate nucleus of the hypothalamus. Said methods combine timing and serial addition of compounds enabling the differentiation of pluripotent stem cells into arcuate nucleus progenitor cells.
[0099] In the Patterning phase of the present invention, Sonic Hedgehog pathway activators supports the induction of ventral (ventral region of the hypothalamus) identity, and ventral forebrain orientation, in the differentiating cells (e.g. stem cells).
[0100] The inventors further found that BMP signalling activation, such as mediated by BMP4 and / or BMP7 at specific timepoints is crucial for correct Arcuate nucleus (ARC) patterning, and in generating bona fide ARC progenitor cells {RAX, TBX3 and NKX2-1 positive) during patterning and expansion phase, as well as for subsequent fates of the anterior and posterior tuberal hypothalamus regions during the subsequent maturation phase. In particular, the timepoints of addition and duration of exposure to BMP4 (and / or BMP7), such as the ones of the ARC V2 protocol (Figure 3A), were also found by the inventors to be important for maintaining SHH down-regulation, and avoid the loss of important markers of posterior tuberal fate, i.e. TBX3 and DIO2 as well as an increased contamination of the cultures with F0XG1+ telencephalic fates, thereby improving accurate ARC patterning in vitro (See Example 5).
[0101] In addition, the inventors identified that IGFBP3 addition during the patterning and expansion phase was important in increasing ARC cell types markers expression (e.g. AGRP and POMC) at later stages of differentiation, such as during the maturation phase. The inventors further found that fine-tuning the length culture of the stem cells in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7) enabled the fine tuning of tanycyte and / or AGRP neuron generation compared to POMC neurons.
[0102] A first aspect of the invention therefore relates to a method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells, said method comprising a cell patterning and expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of one or more sonic hedgehog pathway activator(s); b. Culturing the cells from step a. in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3), thereby obtaining arcuate nucleus progenitor cells.
[0103] Optionally, the methods of the present invention may further include a step of culturing the pluripotent stem cells in the presence of a Rho kinase (ROCK) inhibitor, preferably wherein the ROCK inhibitor is Y-27632. The presence of the ROCK inhibitor supports cell viability, and said step is preferably performed after plating (subculturing) cells, such as after plating the cells for the step of initiating the Patterning phase, and / or after plating cells for the step of initiating the cell expansion phase, and / or after plating cells for the initiation of the maturation phase.
[0104] Initiation of the differentiation of the pluripotent stem cells to neuroectodermal lineages is typically triggered by contacting said cells with one or more inhibitor(s) of the SMAD signalling pathway.
[0105] Therefore, in preferred embodiments of the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells of the present invention, step a. further comprises a step of culturing the pluripotent stem cells in the presence of one or more inhibitor(s) of the SMAD signalling pathway, said step initiating the Patterning phase, preferably initiated simultaneously with step a., and preferably wherein the inhibitors of the SMAD signalling pathway are SB413542 and Noggin. In some embodiments of the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells of the present invention, step a. further comprises a step of culturing the pluripotent stem cells in the presence of an activator of the WNT signalling pathway, preferably said step is initiated 2 days after initiating the Patterning phase, and for 7 days, and preferably the activator of the WNT signalling pathway is CHIR99021.
[0106] Said step aims to mimic the control of anterior to posterior orientation controlled by a gradient of WNT signalling activation in the developing neural tube.
[0107] In some embodiments of the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells of the present invention, step a. further comprises a step of culturing the pluripotent stem cells in the presence of BMP4 wherein said step is initiated 5 days after initiating the cell patterning phase, and continues for 2 days. Said step is therefore initiated prior to the step of culturing cells in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3), i.e. prior to IGFBP3 addition to the cell medium.
[0108] Following the Patterning phase, it may be beneficial to support the expansion phase of neural progenitor cells, such as ARC progenitor cells, by providing compounds supporting their survival, proliferation and / or differentiation. Thus, in some embodiments of the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells of the present invention, step b. further comprises a step of culturing the pluripotent stem cells in the presence of one or more components selected from the group consisting of : Brain-derived neurotrophic factor (BDNF) and ascorbic acid (AA). Said step is preferably initiated 11 days after initiating the Patterning phase, thereby initiating the cell expansion phase, and continues for 5 days.
[0109] Therefore, in preferred embodiments, the methods comprise the ARC V2 protocol (or v2 ARC protocol or ARC differentiation protocol version 2 (V2)) found by the inventors in the present invention, wherein the method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells comprise a cell Patterning and Expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 7 days; g. Culturing the cells of step f. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and h. Optionally culturing the cells of step g. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day, thereby obtaining arcuate nucleus progenitor cells.
[0110] The person of skill in the art is aware that the precise concentration of compounds and the precise duration of exposure to these as well as the relative timing of the steps can be varied according to the guidance given in the present disclosure.
[0111] Further suitable compounds and concentrations
[0112] The skilled person will appreciate that the sonic hedgehog pathway may be activated using not only the Sonic Hedgehog protein (SHH), but also SHH mimetics, or with Smoothened agonists targeting the downstream Smoothened receptor. In some embodiments of the methods of the present invention, it may also be preferable that more than one sonic hedgehog pathway activators are used.
[0113] In some embodiments of the methods of the present invention, the one or more sonic hedgehog pathway activator(s) is a naturally occurring sonic hedgehog pathway activator or a synthetic sonic hedgehog pathway agonist.
[0114] In other preferred embodiments, the one or more sonic hedgehog pathway activator(s) is the Sonic hedgehog protein (SHH) and / or a Smoothened agonist such as (SAG or purmorphamine). Said SHH may for instance be human recombinant SHH C24II.
[0115] In some embodiments, the one or more sonic hedgehog pathway activator(s) is used at a concentration in the range of 1-1000ng / mL, such as 50-500ng / mL, such as 100- 300ng / mL, for instance 100ng / mL, for instance 125ng / mL, for instance 150ng / mL, for instance 200ng / mL, for instance 300ng / mL, preferably the one or more sonic hedgehog pathway activator(s) is used at a concentration of 100ng / mL or 300ng / mL, even more preferably the one or more sonic hedgehog pathway activator(s) is used at a concentration of 300ng / mL.
[0116] In some embodiments wherein the one or more sonic hedgehog pathway activator(s) is a Smoothened agonist, said Smoothened agonist is used at a concentration in the range of 0.1-1 OOpM, such as in the range of 1-5pM, for instance 1 M, for instance 2pM, for instance 3pM, for instance 4pM, for instance 5pM.
[0117] In preferred embodiments, BMP4 and / or BMP7 is used at concentration in the range of 1-1000ng / mL, such as in the range of 1-500ng / mL, such as in the range of 1- 200ng / mL, such as in the range of 25-200ng / mL, such as in the range of 50-150ng / mL for instance 15ng / mL, for instance 20ng / mL, for instance 25ng / mL, for instance 30ng / mL, for instance 35ng / mL, for instance 40ng / mL, for instance 45ng / mL, for instance 50ng / mL, for instance 55ng / mL, for instance 60ng / mL, for instance 65ng / mL, for instance 70ng / mL, for instance 75ng / mL, for instance 80ng / mL, for instance 85ng / mL, for instance 90ng / mL, for instance 95ng / mL, for instance 100ng / mL, for instance 110ng / mL, for instance 120ng / mL, for instance 130ng / mL, for instance 140ng / mL, for instance 150ng / mL, for instance 160ng / mL, for instance 170ng / mL, for instance 180ng / mL, for instance 190ng / mL, for instance 200ng / mL, preferably wherein BMP4 and / or BMP7 is used at concentration in the range of 50-150ng / mL, even more preferably wherein BMP4 and / or BMP7 is used at concentration of 50ng / mL.
[0118] I other embodiments, IGFBP3 is used at concentration in the range of 1-2000ng / mL, such as in the range of 50-1500ng / mL, such as in the range of 50-800ng / mL, such as in the range of 100-800ng / mL, such as in the range of 200-600ng / mL, for instance 100ng / mL, for instance 150ng / mL, for instance 200ng / mL, for instance 250ng / mL, for instance 300ng / mL, for instance 350ng / mL, for instance 400ng / mL, for instance 450ng / mL, for instance 500ng / mL, for instance 550ng / mL, for instance 600ng / mL, for instance 650ng / mL, for instance 700ng / mL, for instance 750ng / mL, for instance 800ng / mL, preferably wherein IGFBP3 is used at concentration of 400ng / mL.
[0119] In preferred embodiments, the ROCK inhibitor is used at a concentration in the range of 1-100pM, preferably the ROCK inhibitor is used at a concentration of 10pM.
[0120] In some embodiments of the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells of the present invention, the one or more inhibitor(s) of the SMAD signalling pathway are preferably selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP) pathway.
[0121] In some embodiments, the inhibitor of the transforming growth factor (TGF-P) pathway is selected from the group consisting of: SB413542, A83-01, SB505124, LY364947, R268712, preferably the inhibitor of the transforming growth factor (TGF-P) pathway is SB413542.
[0122] In other embodiments, the inhibitor of the TGF-p pathway is used at a concentration in the range of 0.1-100pM, such as in the range of 1-75pM, such as in the range of 5- 50pM, for instance 7.5pM, for instance 10pM, for instance 15pM, for instance 20pM, for instance 25pM, for instance 30pM, for instance 35pM, for instance 45pM, for instance 50pM, preferably wherein the inhibitor of the TGF-p pathway is used at a concentration of 10pM. In some embodiments, the inhibitor of the bone morphogenetic protein (BMP) pathway is a protein inhibitor of BMP, preferably said protein inhibitor of BMP is Noggin, or a small molecule inhibitor of BMP, more preferably said small molecule inhibitor of BMP is selected from the group consisting of: LDN193189 and dorsomorphin.
[0123] In embodiments where the inhibitor of the BMP pathway is a protein inhibitor of BMP, said inhibitor is preferably used at a concentration in the range of 0.1-1000ng / mL, such as in the range of 1-500ng / mL, such as in the range of 10-250ng / mL, for instance at 50ng / mL, for instance at 75ng / mL, for instance at 100ng / mL, more preferably said inhibitor is used at a concentration of 100ng / mL.
[0124] In embodiments where the inhibitor of the BMP pathway is a small molecule inhibitor of BMP, said inhibitor is preferably used at a concentration in the range of 1-500nM, such as in the range of 50-200nM, such as in the range of 75-150nM, for instance 80nM, for instance 90nM, for instance 100nM, for instance 110nM, for instance 120nM, for instance 130nM, for instance 140nM, for instance 150nM, more preferably said inhibitor is used at 100nM.
[0125] In preferred embodiments, the WNT signalling pathway activator is a glycogen synthase kinase 3p (GSK3P) inhibitor, even more preferably the glycogen synthase kinase 3p inhibitor is CHIR99021 (CHIR).
[0126] In some embodiments, the WNT signalling pathway activator is used at a concentration in the range of 0.1-10pM, such as in the range of 0.2-5pM, such as 0.3pM, such as 0.5pM, such as 1 M, such as 2pM, preferably the WNT signalling pathway activator is used at a concentration of 0.3pM.
[0127] Arcuate nucleus progenitor cell markers
[0128] One advantage of the methods of the present invention is the reproducible generation of arcuate nucleus-specific progenitor cells, with high (gene or protein) percentages of expression of retinal homeobox protein / retina and anterior neural fold homebox (RAX), T-Box transcription factor 3 (TBX3), and / or NK2 Homeobox 1 (NKX2-1 or NKX2.1), as also further described in the Patterning and Expansion phase section herein. Thus, in some embodiments of the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells of the present invention, the methods further comprise a step of determining the expression of the markers RAX, TBX3, and / or NKX2-1 in the cells obtained, such as in the pluripotent stem cell-derived cells obtained during the differentiation methods described herein.
[0129] Said step can be performed throughout the differentiation process, preferably said step is performed during and / or after the step b. of culturing the cells from step a. in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3).
[0130] In order to monitor the quality of the cell population obtained throughout the differentiation protocol, for instance the homogeneity of expression of said specific ARC progenitors markers expression in the cells, it may be preferable to determine the expression of said markers in the cells at the end of the Patterning phase, such as 11 days after initiating the Patterning phase, and / or at the end of the expansion phase, such as 16 days after initiating the Patterning phase, and / or during maturation phase, such as when BMP7 is added, such as 25 days after initiating the Patterning phase.
[0131] Thus, in some embodiments, the step of determining the expression of the markers RAX, TBX3, and / or NKX2-1 in the cells is performed at the latest 11 to 25 days, for example 16 days, after initiating the Patterning phase.
[0132] The skilled person will appreciate that methods for bulk or single-cell approaches may be used to determine the markers expression, for example marker gene and / or protein expression.
[0133] In some embodiments of the present invention, determination of the expression is performed by quantitative reverse transcription PCR (qRT-PCR), single-cell RNA sequencing (scRNAseq), immunocytochemistry (ICC), flow cytometry, enzyme-linked immunosorbent assay (ELISA) and / or in s / tu-hybridization (ISH). For example, combinations of ICC and ISH, can be used to determine markers expression, either of the same or different markers in both methods. Details of the methods for determining gene or protein markers expression, such as the approaches mentioned hereinabove, are known to the skilled person, and further exemplified in the Examples herein.
[0134] The skilled person will appreciate that the detection of markers within cells, and hence positivity for said markers is based for example on the expression level above a certain threshold of the target gene in individual cells, or cell populations, to a reference or control condition, such as a reference “housekeeping” gene, in qRT-PCR approaches, on RNA transcript detection in scRNAseq approaches, detection (e.g. fluorescence or colorimetric signals) of labelled complementary nucleic acid probes that hybridize to the target RNA sequence of the marker of interest within the cells in ISH approaches, on detection of labelled binding members, such as detection of antibodies e.g. using fluorescently labelled secondary antibodies, or direct or indirect enzyme-substrate reactions) that bind specifically to the target protein of interest within the cells in ICC approaches, ELISA approaches, or flow cytometry approaches.
[0135] In some embodiments, the cells obtained, such as the pluripotent stem cell-derived cells, are positive for RAX, TBX3 and / or NKX2-1. In preferred embodiments, said cells are obtained after at the most 16 days from initiation of the Patterning phase.
[0136] In some embodiments, at least 40% of the cells obtained are RAX positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 74% of the cells obtained are RAX positive.
[0137] In other embodiments, at least 1% of the cells obtained are TBX3 positive, such as at least 5%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 34%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92% of the cells obtained are TBX3 positive.
[0138] In further embodiments, at least 40% of the cells obtained are NKX2-1 positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 66%, such as at least 69%, such as at least 70%, such as at least 72% of the cells obtained are NKX2-1 positive. In some embodiments, it is preferred that the cells obtained are bona fide arcuate nucleus progenitor cells as characterized by the inventors in the present invention i.e. being triple positive for RAX, TBX3 and NKX2-1. Therefore, in preferred embodiments of the methods of the present invention, the cells are arcuate nucleus progenitor cells positive for RAX, TBX3 and NKX2-1. In preferred embodiments, said cells are obtained after at the most 16 days from initiation of the Patterning phase.
[0139] In some embodiments, at least 40% of the cells obtained are RAX positive, at least 1% of the cells obtained are TBX3 positive and / or at least 40% of the cells obtained are NKX2-1 positive, preferably wherein at least 57% of the cells obtained are RAX positive, at least 34% are TBX3 positive and / or at least 66% are NKX2-1 positive.
[0140] In preferred embodiments, at least 10% of the cells, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the cells obtained are positive for RAX, TBX3, and NKX2-1.
[0141] In preferred embodiments, the percentages of cells positive for the markers described hereinabove are determined using scRNAseq, for example by detection of the presence of the RNA transcript of said single marker in the cell, or by detection of the presence of three transcripts in the same cell for percentages of triple-positive cells, such as cells positive for RAX, TBX3, and NKX2-1.
[0142] Timings of additions of the compounds during differentiation
[0143] The inventors have optimized the combination of compounds, and the timings and durations of their addition in the methods of differentiation to ARC progenitor cells as exemplified in the ARC V2 protocol described hereinabove.
[0144] In some embodiments, such as wherein the ARC V2 protocol is used, the differentiation of pluripotent stem cells into arcuate nucleus progenitor cells is achieved in 16 days or less from the initiation of the Patterning phase. The timings and durations of the methods of the present invention may in some embodiments deviate from those exemplified by the ARC V2 protocol.
[0145] Thus, in some embodiments of the methods of the present invention, the step a. of culturing the pluripotent stem cells in the presence of one or more sonic hedgehog pathway activator(s) is initiated simultaneously with the initiation of the Patterning phase.
[0146] In other embodiments, the step of culturing the pluripotent stem cells in the presence of one or more sonic hedgehog pathway activator(s) and / or the step of culturing the pluripotent stem cells in the presence of one or more inhibitor(s) of the SMAD signalling pathway is performed for 3 to 9 days, for example 7 to 9 days, such as 7 days, such as 8 days, such as 9 days.
[0147] In further embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of an activator of the WNT signalling pathway is initiated at the latest 2 days, such as 2 days after initiating the Patterning phase.
[0148] In some embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of an activator of the WNT signalling pathway is performed for 1 to 12 days, for instance of 5 to 10 days, such as 5 days, such as 6 days, such as 7 days, such as 8 days, such as 9 days, such as 10 days.
[0149] In further embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of BMP4 and / or BMP7 is initiated at the latest 3 to 6 days, such as 3 days, such as 4 days, such as 5 days, such as 6 days after initiating the Patterning phase. In other embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of BMP4 and / or BMP7 is initiated 7 days after initiating the Patterning phase.
[0150] In some embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of BMP4 and / or BMP7 is performed for 1 to 6 days, such as for 2 days, such as for 5 days. In preferred embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of BMP4 and / or BMP7, and IGFBP3, is initiated at the latest 5 to 7 days, such as 5 days, such as 6 days, such as 7 days, after initiating the Patterning phase.
[0151] In some embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of BMP4 and / or BMP7, and IGFBP3, is performed for 8 to 15 days, such as 8 days, such as 9 days, such as 10 days, such as 11 days, such as 12 days, such as 13 days, such as 14 days, such as 15 days.
[0152] In some embodiments, BMP4 and / or BMP7, and IGFBP3 are withdrawn simultaneously at the end of said step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of BMP4 and / or BMP7, and IGFBP3.
[0153] As described herein, the inventors have found that the duration of the exposure of the cells to BMP4 and / or BMP7 in particular has an important impact on correct ARC patterning (see Example 5). Therefore, in other embodiments, BMP4 and / or BMP7 are withdrawn after one of the durations described herein, and IGFBP3 may be withdrawn after another of said durations. For example, BMP4 and / or BMP7 may be withdrawn after one of the durations described herein, such as between day 3 to day 15 after initiating the Patterning phase, such as at day 11 , or day 14 after initiating the Patterning phase, while IGFBP3 may be kept in the medium for instance until day 14 after initiating the Patterning phase, preferably from day 7 to day 14 after initiating the Patterning phase.
[0154] As described herein, the inventors showed that fine-tuning of the length of the step of culturing the stem cells in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), alone and / or in the presence of IGFBP3 could favor the generation of tanycytes and / or AGRP neurons, or the generation of POMC neurons.
[0155] In particular, culturing the stem cells in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7) alone and / or in the presence of IGFBP3 from day 5 to day 14 after initiating the Patterning phase favored tanycytes and / or AGRP neurons generation, as described for example in the ARC V2 protocol described herein.
[0156] On the other hand, culturing the stem cells in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7) alone and / or in the presence of IGFBP3 for shorter periods, such as for 1 day, such as for 2 days, such as for 3 days, such as for 4 days, such as for 5 days, such as for 6 days, for example between day 5 to day 7, preferably day 5 to day 9, even more preferably day 5 to day 11 after initiating the Patterning phase, favored POMC neurons generation.
[0157] Thus in some embodiments, the method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells comprise a cell Patterning and Expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 1 to 4 days, such as 2 days, such as 3 days; g. Culturing the cells from step f. in the presence of IGFBP3 at 400ng / mL, until 14 days after initiating the Patterning phase; h. Culturing the cells of step g. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and i. Optionally culturing the cells of step h. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day, thereby obtaining arcuate nucleus progenitor cells.
[0158] Said method may be used to favor the generation of POMC-expressing neurons. Preferably, said method is followed by the Maturation phase as described in the present disclosure.
[0159] In other embodiments of the method, to favor the generation of POMC-expressing neurons, the steps e. and f. together comprise culturing the stem cells in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7) alone or in the presence of IGFBP3 for shorter periods, such as for 1 day, such as for 2 days, such as for 3 days, such as for 4 days, such as for 5 days, such as for 6 days, for example between day 5 to day 7, preferably day 5 to day 9, even more preferably day 5 to day 11 after initiating the Patterning phase, while IGFBP3 is kept in the medium for instance until day 14 after initiating the Patterning phase, preferably from day 7 to day 14 after initiating the Patterning phase.
[0160] In such embodiments, the stem cells may thus be cultured in BMP4 and / or BMP7 for example only between days 5 and 7 following initiation of the Patterning phase.
[0161] In other embodiments, the methods comprise the ARC V2 protocol (or v2 ARC protocol or ARC differentiation protocol version 2 (V2)) found by the inventors in the present invention, wherein the method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells comprise a cell Patterning and Expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021 , at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 7 days; g. Culturing the cells of step f. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and h. Optionally culturing the cells of step g. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day, thereby obtaining arcuate nucleus progenitor cells.
[0162] Said method may be used to favor the generation of tanycytes and / or AGRP- expressing neurons. Preferably, said method is followed by the Maturation phase as described in the present disclosure.
[0163] The components BDNF and AA may be added to cell culture medium at the earliest at the beginning of the cell expansion phase, 11 days after initiating the Patterning phase. Said components may also be present in the cell culture medium simultaneously with the steps wherein BMP4 and / or BMP7 is present.
[0164] Thus, in some embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF) and ascorbic acid is initiated 5 to 16 days, such as 6 days, such as 7 days, such as 8 days, such as 9 days, such as 10 days, such as 11 days, such as 12 days, such as 13 days, such as 14 days, such as 15 days, after initiating the Patterning phase.
[0165] In preferred embodiments, the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells thereof, in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF) and ascorbic acid is performed for at least 3 days, preferably for 3 to 14 days, even more preferably performed for 3 to 5 days, such as for 4 to 5 days.
[0166] Arcuate nucleus progenitor cell populations
[0167] Another aspect of the invention relates to a population of arcuate nucleus progenitor cells obtained by the methods described herein.
[0168] In some embodiments of the method and population of cells according to the present invention, the arcuate nucleus progenitor cells are posterior tuberal arcuate nucleus progenitor cells.
[0169] In preferred embodiments, said cells are positive for RAX, TBX3 and / or NKX2-1.
[0170] The positivity of the cells for the markers can be determined as described herein in the section Arcuate nucleus progenitor cell markers.
[0171] In other embodiments, at least 40% of the cells are RAX positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 74% of the cells are RAX positive.
[0172] In some embodiments, at least 1 % of the cells are TBX3 positive, such as at least 5%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 34%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 91 %, such as at least 92% of the cells are TBX3 positive.
[0173] In other embodiments, at least 20% of the cells are NKX2-1 positive, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 66%, such as at least 69%, such as at least 70%, such as at least 72% of the cells are NKX2-1 positive.
[0174] In further embodiments, at least 40% of the cells obtained are RAX positive, at least 1 % of the cells obtained are TBX3 positive and / or at least 20% of the cells obtained are NKX2-1 positive, preferably at least 57% of the cells obtained are RAX positive, at least 34% are TBX3 positive and / or at least 66% are NKX2-1 positive.
[0175] In preferred embodiments, at least 10%, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the cells are positive for RAX, TBX3, and NKX2-1.
[0176] In other preferred embodiments, said cells are human arcuate nucleus progenitor cells.
[0177] The ARC progenitor cells of the present invention may be cultured as 2D cultures, or 3D cultures, such as spheroid aggregates, for example enhance cell to cell signalling and promote maturation of in vitro neuronal cultures during subsequent differentiation phases.
[0178] Thus, in some embodiments, the population of cells is in a 2D cell culture format or in a 3D cell culture format.
[0179] The arcuate nucleus progenitor cells generated may be further expanded and frozen, while maintaining their identity. Due to their high purity and region-specificity, said cells may be useful in establishing in vitro models of the arcuate nucleus of the hypothalamus, for example in studying the effects of drugs interacting with said cells, such as drugs targeting appetite and metabolic disorders (e.g. appetite-lowering drugs for obesity targeting the glucagon-like peptide 1 receptor (GLP1 R)).
[0180] Methods for differentiating arcuate nucleus progenitor cells, or for differentiating pluripotent stem cells, to mature arcuate nucleus neurons and / or tanycytes
[0181] Further to the initial patterning and expansion factors described hereinabove, the inventors have identified novel factors promoting the further specification and maturation of arcuate nucleus progenitor populations to mature arcuate cell types, such as mature arcuate nucleus neurons and / or tanycytes. Thus, in some embodiments, the methods for differentiating arcuate nucleus progenitor cells to mature arcuate nucleus neurons and / or tanycytes are comprised in-, or consist in- the cell maturation phase as described in the Differentiation methods section herein.
[0182] Another aspect of the present invention therefore relates to a method for differentiating arcuate nucleus progenitor cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a maturation phase comprising the step of: i. Culturing said arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes.
[0183] In some embodiments, the methods for differentiating pluripotent stem cells to mature arcuate nucleus neurons and / or tanycytes as described herein may comprise or consist in the cell Patterning, Expansion and Maturation phases as described hereinabove in the Differentiation methods section.
[0184] A further aspect of the present invention therefore relates to a method for differentiating pluripotent stem cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a cell patterning and expansion phase as described herein, and further comprising a maturation phase comprising the step of: i. Culturing the obtained arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes.
[0185] The methods for differentiating arcuate nucleus progenitor cells to mature arcuate nucleus neurons and / or tanycytes as described herein may be performed on the arcuate nucleus progenitor cells obtained from the methods for differentiating pluripotent stem cells into arcuate nucleus progenitor cells described herein.
[0186] Accordingly, in some embodiments, at least 10%, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the arcuate nucleus progenitor cells are positive for RAX, TBX3, and NKX2-1. The ARC progenitor cells are preferably maintained in a medium supporting the growth of the ARC progenitor cells and their maturation.
[0187] Thus, in some embodiments, the methods further comprise a step of culturing the arcuate progenitor cells in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP.
[0188] It is typically preferable to shorten the duration of differentiation protocols as much as possible (e.g. to limit production costs), while still obtaining the cells of interest.
[0189] Thus, in preferred embodiments, the step of culturing the arcuate nucleus progenitor cells in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP is initiated at the latest 30 days, such as 16 days, such as 25 days after initiating the Patterning phase.
[0190] In other embodiments the step of culturing the arcuate nucleus progenitor cells in the presence of one or more component(s) selected from the group consisting of: Brain- derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), Y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP is initiated up to 9 days, such as 9 days, before initiating the step of culturing the arcuate nucleus progenitor cells in the presence of BMP7.
[0191] In preferred embodiments, the step of culturing the arcuate nucleus progenitor cells in the presence of one or more components selected from the group consisting of: Brain- derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), Y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP is performed for at least 5 days, such as for in the range of 5 to 50 days, for instance for in the range of 5 to 40 days, for instance for in the range of 5 to 38 days, for instance for in the range of 5 to 34 days, such as for 34 days.
[0192] In other preferred embodiments, the step i. of culturing the arcuate nucleus progenitor cells in the presence of BMP7 is initiated at the latest 30 days, such as 16 days, such as 17 days, such as 18 days, such as 19 days, such as 20 days, such as 21 days, such as 22 days, such as 23 days, such as 24 days, such as 25 days, such as 26 days, such as 27 days, such as 28 days, such as 29 days after initiating the Patterning phase.
[0193] In other embodiments, the step i. of culturing the arcuate nucleus progenitor cells in the presence of BMP7 is performed for in the range of 5 to 50 days, such as for in the range of 10 to 40 days, such as for in the range of 20 to 30 days, for instance for at the most 25 days, such as for 25 days, such as for at the most 20 days, such as for at the most 10 days.
[0194] In some embodiments, BMP7 is used at a concentration in the range of 1-1000ng / mL, such as in the range of 50-250ng / mL, such as 50ng / mL, such as 75ng / mL, such as 100ng / mL, such as 150ng / mL, such as 200ng / mL, such as 250ng / mL, preferably BMP7 is used at a concentration of 100ng / mL.
[0195] In other embodiments, BDNF is used at 20pg / mL, AA is used at 0.2mM, dibutyryl- cAMP is used at 500pM, DAPT is used at 1pM, and / or GDNF is used at 10ng / mL.
[0196] The maturation may be performed in 2D or 3D format. A 3D format, such as spheroids, may be beneficial for instance in applications wherein a 3D model of the ARC reproducing the complexity of the ARC cell types and structure is useful. Such applications may include drug screening or cell / drug interaction studies.
[0197] Thus, in some embodiments, the steps of culturing are performed in a 2D cell culture format or in a 3D cell culture format.
[0198] Mature arcuate nucleus neurons markers
[0199] The inventors have shown that culturing the ARC progenitor cells in the optimized cell maturation phase conditions described herein leads to the generation of AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12 and / or POMC-positive arcuate nucleus neurons, and / or tanycytes (DIO2-positive). In particular, POMC, AGRP and tanycyte lineages can be generated. Thus, in some embodiments, the methods further comprise a step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 in the cells.
[0200] The positivity of the cells for the markers can be determined as described herein in the section Arcuate nucleus progenitor cell markers.
[0201] In some embodiments, determining the expression is performed during the cell maturation phase, such as at least 14 days, preferably 14 to 54 days, even more preferably 34 days, after initiating the step i. of culturing said arcuate nucleus progenitor cells in the presence of BMP7.
[0202] In other embodiments, determining the expression is performed in the range of 30 to 200 days, such as in the range of 50 to 100 days, such as in the range of 50 to 70 days, such as 50 days, after initiating the Patterning phase.
[0203] The markers expression may be determined on the total cell population obtained. It may be preferable in some cases to determine the markers expression in subtype(s) of the cells obtained during the maturation, and / or to report it as a percentage of cells expressing the markers within said cell subtype(s).
[0204] For example, it may be preferable to determine the expression of markers of subtypes of neurons in a population of cells specifically expressing neuron markers, such as in a population of cells expressing arcuate nucleus neurons markers.
[0205] Therefore, in some embodiments, the expression of said markers may be calculated in arcuate nucleus neurons, defined by being positive for the markers STMN2 (Stathmin- 2) and negative for the markers RAX and LHX8 (LIM Homeobox 8).
[0206] In some embodiments, the determination of the expression is performed by quantitative reverse transcription PCR (qRT-PCR), single-cell RNA sequencing (scRNAseq), single-nucleus RNA sequencing (snRNA-seq), ELISA, immunocytochemistry (ICC), flow cytometry and / or in s / tu-hybridization (ISH). In preferred embodiments, the cells express one or more markers selected from the group consisting of: AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and DIO2.
[0207] In other preferred embodiments, the step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 is performed at least 14 days, preferably 14 to 54 days, even more preferably 34 days, after initiating the step i. of culturing said arcuate nucleus progenitor cells in the presence of BMP7.
[0208] Following differentiation, at least 0.25%, such as at least 1%, such as at least 2%, such as at least 3%, such as at least 6% of the arcuate nucleus neurons may be AGRP- positive; at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 48% of the arcuate nucleus neurons may be POMC-positive; at least 7.5%, such as at least 10%, such as at least 12.5% of the arcuate nucleus neurons may be PRDM 12-positive; at least 5%, such as at least 7.5%, such as at least 10%, such as at least 12.5% of the arcuate nucleus neurons may be PNOC-positive; at least 5%, such as at least 10%, such as at least 15%, such as at least 20%, such as at least 25% of the arcuate nucleus neurons may be TRH-positive; at least 10%, such as at least 20%, such as at least 30% of the arcuate nucleus neurons may be SST- positive; at least 7.5%, such as at least 10% of the arcuate nucleus neurons may be OTP-positive; at least 1 %, such as at least 1.5%, such as at least 2% of the arcuate nucleus neurons may be GHRH-positive; at least 10%, such as at least 15%, such as at least 2%, such as at least 30%, such as at least 40% of the arcuate neurons may be TH-positive; and at least 2%, such as at least 2.5%, such as at least 3%, such as at least 5%, such as at least 12.5% of the arcuate neurons may be both POMC and GPR149-positive.
[0209] In some embodiments, following differentiation, at least 5%, such as at least 9% such as at least 10% of the cells obtained are DIO2+tanycytes.
[0210] In preferred embodiments, said expression percentages may be calculated as a percentage of the arcuate nucleus neurons population, defined by being positive for the markers STMN2 (Stathmin-2) and negative for the markers RAX and LHX8 (LIM Homeobox 8). In some embodiments, the step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 is performed in the range of 30 to 200 days, such as in the range of 50 to 100 days, such as in the range of 50 to 70 days, such as 50 days, after initiating the Patterning phase.
[0211] In preferred embodiments of the methods and cell populations of the present invention, the arcuate nucleus progenitor cells, the mature arcuate nucleus neurons and / or the tanycytes are human arcuate nucleus progenitor cells, mature arcuate nucleus neurons and / or tanycytes.
[0212] Basal cell media
[0213] The skilled person within the field of neural cell culture and differentiation will appreciate that various basal media formulations are available to support differentiation protocols and growth of neuronal cells, including but not limited to Neurobasal, DMEM / F12, MACS Neuromedium or BrainPhys. The skilled person will also appreciate that further components like B27 supplement, N2 supplement, or NeuroBrew-21 (NB21) supplement designed to support neuronal growth in vitro may be used to supplement basal media.
[0214] In some embodiments, each of the culturing steps is performed in a medium comprising a basal medium identical or different.
[0215] In other embodiments, the culturing steps are performed in a medium supporting the growth of neural stem cells, for example a neurobasal medium.
[0216] In preferred embodiments, the culturing steps are performed in a medium comprising a supplement selected from the group consisting of: N2, B27 and NB21.
[0217] In some embodiments, compounds used during the Patterning phase, such as the sonic hedgehog pathway activator, the bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3), the one or more inhibitors of the SMAD signalling pathway, and / or the activator of the WNT signalling pathway, may be diluted in the basal medium used to support the culture of the differentiating cells during Patterning phase, preferably wherein the medium is N2-supplemented basal medium.
[0218] In preferred embodiments, NB21-supplemented basal medium is used for culturing cells during the expansion and maturation phase.
[0219] In other preferred embodiments, the cell culture medium is replaced by fresh medium every other day.
[0220] Stem Cells
[0221] The Patterning phase of the differentiation protocol can be initiated on pluripotent stem cells, such as embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs).
[0222] In preferred embodiments, the pluripotent stem cells are human pluripotent stem cells, such as human embryonic stem cells (hESCs) or human induced pluripotent stem cells (hiPSCs). In even preferred embodiments, the hESCs are of the cell line RC-17 (RRID:CVCL_L206), also known as RCeO21-A.
[0223] Kits
[0224] For some applications, it may be beneficial to provide the compounds that can be used to perform the methods of differentiation of pluripotent stem cells into arcuate nucleus progenitor cells as described herein under the form of a kit, optionally with instructions for performing said method.
[0225] Another aspect of the invention thus relates to a kit-of-parts comprising:
[0226] - One or more sonic hedgehog pathway activator, preferably wherein the one or more sonic hedgehog pathway activator is selected from the group consisting of a naturally occurring sonic hedgehog pathway activator and a synthetic sonic hedgehog pathway agonist, even more preferably wherein the one or more sonic hedgehog pathway activator is SHH or a Smoothened agonist, such as SAG or purmorphamine, yet even more preferably wherein the one or more sonic hedgehog activator is SHH;
[0227] - BMP4 and / or BMP7;
[0228] - IGFBP3; - One or more SMAD inhibitors, preferably wherein the one or more SMAD inhibitors are selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP), even more preferably wherein the one or more SMAD inhibitors are SB413542 and Noggin;
[0229] - An activator of the WNT signalling pathway, preferably wherein the WNT signalling pathway activator is a GSK3P inhibitor, even more preferably wherein the activator of the WNT signalling pathway is CHIR99021 ;
[0230] - Optionally, a ROCK inhibitor, preferably wherein the ROCK inhibitor is Y-27632; and
[0231] - Optionally, a medium supporting the growth of neural progenitor cells.
[0232] For other applications, it may be beneficial to provide the arcuate progenitor cells obtained by the methods described herein, or the arcuate progenitor cells as defined in the present invention under the form of a kit. For example, said cells may be provided frozen, and the remainder of the differentiation protocol, such as the cell maturation step may be performed at an end-user. This may be very helpful in order to generate hypothalamus specific cell types functioning together developmentally and physiologically in vivo. The kits may also find interesting applications to generate a developmental human model of the arcuate nucleus, for applications such as drug discovery and disease modelling.
[0233] Thus, a further aspect of the present invention relates to a kit-of-parts comprising:
[0234] - The population of ARC progenitor cells as described herein; and
[0235] - Instructions for use
[0236] In some embodiments, the kit of parts further comprises:
[0237] - Maturation medium comprising BMP7; and
[0238] - Optionally, cell culture plates suitable for supporting the culture of neural progenitor cells. Examples
[0239] Example 1 : BMP induces patterning of posterior tuberal progenitors
[0240] Material and methods
[0241] Cell culturing and neuronal differentiation hESC line RC17 (Roslin Cells, hESC line, RCeO21-A) and was maintained on 1 pg / cm2 laminin-521 (Biolamina, #LN521-02) in IPS-Brew (Miltenyi, #130-104-368). Cells were kept to 70-90% confluency before passaging with 75 pL / cm2 of 0.5 mM EDTA (Thermo Fisher Scientific, #15575020) for approx. 7 min before detachment and replated for 24 hours with 10 pM Y-27632 (ROCK inhibitor, Miltenyi, cat. # 130-106- 538) with daily media changes thereafter. For differentiation into regionalized hypothalamic progenitors, the inventors adapted protocols from Nolbrant et al., 2017. hESCs are kept until 70-90% confluent then dissociated with 0.5mM EDTA and plated at 10K / cm2 in 2 pg / cm2 laminin-111 (Biolamina, #LN111-02) coated plates. All day 0 cells, regardless of regionality, received 10 pM Y-2763 for 24 hours and neuroectodermal lineages were initiated using 10 pM SB413542 (Miltenyi, #130-106- 543), and 100 ng / mL Noggin (Miltenyi, #130-103-456), diluted in N2 basal medium from day 0 to 9. For the PVN v1 CHIR is added to the N2 medium from day 0 to 9 at 0.3 pM whilst a low concentration and delayed addition of 150ng / ml of SHH is added from day 6 to 14 to enhance dorsal identity of the cells. For the v1 ARC protocol cells were ventralized with high SHH of 300 ng / mL from day 0 to 9. Rostral diencephalic positional identify was encouraged with 0.3 pM CHIR between day 2 to 9 and tuberal induction was incurred by 50 ng / mL BMP4 from day 6 to 14 (Figure 1). ARC v2 protocol found the use of BMP4 at day 5 to be optimal for ARC patterning and the inventors identified IGFBP3 as an enhancer of mature ARC fates. All protocols receive media change every 2 days. By day 11, early progenitors are very confluent, cells were dissociated in 75 pL / cm2 accutase (ThermoFisher, #A11105-01) for 10 minutes at 37 and transferred at a density of 800k / cm2 in B27 medium, containing 0.2 mM ascorbic acid (Sigma-Merck, #A4403-100MG), 20 pg / mL BDNF (Miltenyi, #130-096-286), and 10 pM 69Y-27632 and plated into onto Lam111 coated plates. Day 16 of the differentiation, regionalised progenitors are replated one final time at 700k / cm2 to Lam521 coated plates for maturation and long term culturing in B27 containing 0.2 mM ascorbic acid, 20 pg / mL BDNF, 500 pM dibutyryl-cAMP (Sigma-Merck, #D0627-1G), 1 pM DAPT (Miltenyi, #130-110-489), 10 ng / mL GDNF (Miltenyi, #130-098-449), and 10 pM Y-27632. For the generation for spheroids, patterned day 16 hypothalamic progenitors were thawed and diluted in pre-warmed DMEM / F12 with 5% KOSR. Cells were counted, centrifuged at 400 xg for 5 min and resuspended in maturation medium (B27 medium [MACS Neuromedium containing 2% NB21 , 1% Glutamax, Penicillin / Streptomycin] complemented with 10 pM Y- 27632 (ROCKi), 20 ng / mL BDNF, 0.2 mM ascorbic acid, 500 pM Db-cAMP and 1 pM DAPT) at 250 000 cells / mL. The cell suspension was transferred to an ultralow attachment Il-bottom 96-well plate (Costar) at 200 pL / well, centrifuged at 100g for 5 min and maintained at 37 °C with 5% CO2. 75% of maturation medium without ROCKi was changed every 2-3 days until termination of the experiment.
[0242] RNA extraction and quantification and analysis
[0243] The gene expression profiles of hESC-derived neuronal cultures were analysed via RTqPCR. Approx 300-500K cells were lysed at either day 16 progenitor stage or mature stage using 350 pL of RLT buffer (QIAGEN, #74034) containing 0.5 mM betamercaptoethanol (ThermoFisher, #31350010). RNA isolation was performed using a QIAcube using the RNeasy plus micro kit (Qiagen, #74034). Approx 1ug of RNA was used for cDNA synthesis using Maxima first strand cDNA synthesis kit (ThermoFisher, #K1642) using random hexamer primers. cDNA was diluted in 250ul EB buffer (Qiagen, #19086) and stored at -20°C degrees. Due to the high-throughput primer panel and large number of differentiations, SYBR green
[0244] (Roche, #04887352001), forward (FWD) and reverse (REV) primers (SEQ ID NOs. 1 to 36) and subsequent cDNA sample were pipetted and mixed using iDOT liquid handler and analysed by Light Cycler 480 II instrument (Roche, #05015243001) with a 40 cycles program - 60°C for 60 s annealing / elongation step and 95°C, 30s denaturation. The average CT of technical duplicates was used to finalize the relative expression and this is normalized to a reference consisting of the average expression of 3 replicates of undifferentiated H9 and RC17 cells. Genes of interest we normalised to both GAPDH and ACTB.
[0245] Immunocytochemistry (ICC)
[0246] All 2D cultured cells were fixed in 4% PFA for 15 min at 37°C followed by 3 X washes with phosphate-buffered saline PBS- / - and stored at 4°C until required. For ICC, cells are blocked at room temperature for 1-3 h in blocking buffer (PBS- / - 0.1%, Triton X-100 and 5% (vol / vol) donkey serum). Primary antibodies (Table 3) we diluted in blocking buffer and incubated overnight at 4°C. Following incubation, cells were washed 3 X in PBS - / - before incubation with 1:200 secondary conjugated fluorophores (Table 2) and DAPI 1ng / ml for 2 hr room temperature on a shaker. A final 3 X PBS wash was performed before microscopic analysis. Spheroids were fixed with 4% Paraformaldehyde for 30 min at room temperature, washed twice with phosphate- buffered saline (PBS) and blocked for 6 h at 4°C with blocking buffer. Then, they were incubated with primary antibodies diluted in blocking buffer (200pL / tube) on a shaker at 4°C for 48 h. The primary antibody solution was removed and the samples were washed with 300 pL blocking buffer, once for 2 min and then at 4°C for 6 h. All subsequent steps were performed under the exclusion of light. The secondary antibodies and 2 pg / mL DAPI for nuclear counterstaining were diluted in 200 pL blocking buffer and added to the tissues. The samples were again incubated on a shaker at 4°C for 48 h. Subsequently, the tissues were washed for 2 min and then at 4°C for 6 h on a shaker. After two more washes in PBS, the tissues were transferred to 18-well ibidi chambers and stored at 4°C until visualisation.
[0247] RNA scope
[0248] Cells for RNA scope were fixed for 30 min at room temperature. RNA-scope analysis was performed using the RNAscope Multiplex Fluorescent Kit v2 (Biotechne, #323100) following the instructions. In short, cells were dehydrated by incubation of 50%, 70% and 100% ethanol for 1 min followed by rehydration by incubation of 70% and 50% ethanol for 1 min and 1x PBS for 10 min. Next, cells were incubated with hydrogen peroxide for 10 min, washed with distilled water and incubated with protease solution at RT for 10 min. After washing with 1x PBS, diluted probes targeting RAX" and TBX3 transcripts were added to the well and incubated at 40C for 2h, followed by washing steps with wash buffer. Cells were kept in 5x SSC at RT ON. The next day, the probe signal was amplified by 3 rounds of hybridization with amplification solution for 30 min at 40°C. Next, the signal of each channel was developed, which involved incubation with HRP solution for 15 min at 40°C, TSA Plus fluorescein for 30 min at 40°C and HRP blocker for 15 min at 40°C.
[0249] Imaging and quantification
[0250] Imaging of ICC of in vitro-derived cells was performed on the Leica AF600 widefield epifluorescence microscope using Leica LAS-X software and for the main figures, the confocal microscope LSM 880 Airyscan, Zeiss. All imaging of staining was also performed using the LSM 880 Airyscan. Images were processed using Fiji (version 2.1.0). Images of transplantations (single and stacks) were acquired by confocal fluorescence (Stellaris, Plan-fluotar 10x / 0.30 Dry or Plan-apochromat 40x / 1.25 GLYC, Leica Microsystems, Wetzlar, Germany), widefield fluorescence (AF6000, plan-fluotar 10x / 0.30 Dry or plan-fluotar 7320x / 0.40 Dry, Leica Microsystems, Wetzlar, Germany) or widefield brightfield microscopy (Leica DM5500, plan-apochromatic 10x / 0.40, DFC450 color camera). The images were processed using Imaged and brightness / contrast were adjusted using Adobe Photoshop 2024.
[0251] Pseudobulk Differential Expression
[0252] For differential gene expression analysis, a pseudo-bulk gene expression matrix was generated by summing the transcript counts for all cells within the same cell type, differentiation, and treatment combination. The pseudo-bulk gene expression matrix was then filtered and normalized. We used a generalized linear model (DESeq2) to test for differential expression including both treatment group and differentiation batch as variables in the design matrix.
[0253] Statistical analysis
[0254] All statistical methods appointment a significance level of alpha=0.05. All quantitative values are shown as mean SEM and asterisks denotes the level of significance based on statistical test. Normality of data was assessed using Shapiro-Wilk test. For statistical analysis between 2 groups a Student t-test was used. One way ANOVA was performed by either Dunnett’s or Tukey’s multiple comparison test.
[0255] Sequence alignment and sample assignment
[0256] The raw cDNA libraries from all single-cell / nuclei samples were processed using CellRanger count pipeline v7.1.0 (Zheng et al., 2017) by aligning the day 16 reads against the human reference genome GRCh38-2020-A, and the day 25, 50, and 70 reads against a recently published reference with optimized genome annotations (Pool et al., 2023). The obtained gene count matrices were corrected with CellBender v0.3.0 (Fleming et al., 2023) to remove ambient RNA. The CellRanger BAM file for D16 data was processed with STARsolo v2.7.10b (Kaminow et al., 2021) to generate intronic and exonic counts required for RNA velocity. CITE-seq-Count v1.45 was used to identify the hashtag oligo (HTO) tags from the cell / nucleus hashing FASTQ files. To assign the sample-of-origin for each cell the HTO and RNA count matrices, generated as described above, were further processed in R. For D16 data HTODemux function from Seurat v4.1.0 (Hao et al., 2021) was used for sample assignment, whereas for the remaining timepoints the HTO demultiplexing was done with an optimized cell classification strategy implemented in COMUNEQAID pipeline (https: / / github.com / CBMR-Single-Cell-OmicsPlatform / COMUNEQAID).
[0257] Single-cell / nuclei data processing and cluster annotation
[0258] The cells classified as doublets or negatives were excluded from the further analysis. The resulting count matrices were filtered and processed with Scanpy v1.9.5 (Wolf et al., 2018). Genes occurring in less than three cells, and cells with high mitochondrial content or outliers in gene counts, were removed from each batch individually by manually adjusted thresholds. Furthermore, to address bias arising from metabolism- related factors ribosomal (RPS / RPL genes) and mitochondrial genes (MT- genes) were excluded from downstream analysis. The resulting data was log-normalized, and the day 25 batches and the day 50 and 70 batches were concatenated together. Leading to three different datasets referred to as d16, d25, and d50_d70, each of them processed and analyzed separately. The top 2000 variable genes were identified using batch-aware feature selection (d16 batch_key=None, d25 and d50_d70 batch_key = reaction ID).
[0259] The d16 data underwent count depth regression, scaling, and dimensionality reduction (PCA and UMAP). The cells sharing transcriptional similarities were clustered together with the Leiden algorithm (resolution^.85). The F0XG1+ cells, corresponding to forebrain contamination, not captured by the initial clustering, were distinguished from the clusters corresponding to anterior tuberal progenitors, ARC precursors, and neuronal precursors. To annotate the maturing neurons with higher resolution the cells in STMN2+ clusters were extracted and re-clustered (resolution^.7). The d25 batches and d50_d70 batches were integrated with FastMNN implemented in batchelor package v1.14.0 (Haghverdi et al., 2018) using sequencing lane (reactionlD) as a batch key. After excluding an outlier cluster containing cells with high total counts and few differentially expressed genes, the d25 data was clustered (resolution 0.95). Followed by extraction and re-clustering of OTP+ clusters to distinguish an OTP- cell population. The integrated d50_d70 dataset was clustered (resolution^ .025) and annotated with two different annotation resolutions low and high. To further investigate the cellular heterogeneity in d50_d70 data the RAX- / LHX8- clusters corresponding to ARC neurons and DIO2+ clusters corresponding to tanycytes were extracted. For both datasets, the top 2000 highly variable genes were computed (batch_key=reactionlD) followed by FastMNN batch integration and clustering (neurons resolution^.292 and tanycytes resolution^.14). From the neuronal dataset cluster containing the AGRP+ cells was further divided into two clusters through re-clustering to achieve an AGRP- specific population. An STMN2+ outlier cluster was excluded from the tanycyte dataset before downstream analysis. Unless for tanycyte data, which was not annotated, the resulting clusters in all the described datasets were identified and annotated based on our previous knowledge and markers described in the literature. Clusters deemed to be transcriptionally similar were merged. These processed datasets (d16, d25, d50_d70, d50_d70_tanycytes, d50_d70_neurons) formed the basis of the rest of the analysis.
[0260] Day 16 data developmental analysis
[0261] To unravel the differentiation direction of day 16 cells RNA, velocity analysis was conducted using the stochastic model from scVelo vO.2.5 (Bergen et al., 2020) Python package. The resulting velocity stream was visualized on UMAP embedding (Fig. 3B). The difference between anterior tuberal progenitors and posterior tuberal progenitors was investigated using pySCENIC vO.12.1 (Van De Sande et al., 2020) to find the regulons driving development in these two developmental lineages. For this analysis, 150 cell cycle genes were removed, and the highly variable features were re-defined by identifying the top 9000 most variable genes. PySCENIC was run using log-normalized counts and following the standard SCENIC workflow (GRNBoost2, cisTarget, and AUCell).
[0262] Differential gene expression analysis
[0263] All differential gene expression analysis present in this paper was performed using the Wilcoxon test from the FindAIIMarkers function implemented in Seurat. The min.diff.pct (0.25-0.4) parameter was specified to exclude widely expressed genes from the test. Non-significant genes (significance level p_val_adj < 0.05) were excluded and top differentially expressed genes were visualized on a heatmap.
[0264] Cellular heterogeneity in ARC differentiation protocols
[0265] Three different compositional analyses were performed to reveal differences between ARC differentiation protocols and to compare cellular patterning on 2D and 3D conditions. In cell type proportion analysis clusters of interest were selected, and the relative abundance of the clusters within each differentiation batch was computed. The cell type proportion analysis was performed for d16 data and the results were visualized using stacked bar plots (data not shown). Since the cell type compositions vary between 2D and spheroid conditions we performed a differential cell type abundance test with Milo implemented in pertpy package v0.6.0 (Dann et al., 2022) to study the differences between the conditions (da_nhoods design="~dimensionality", model_contrasts= 'dimensionalityspheroid-dimensionality2D'). Before running the test, the nearest neighbors were re-computed on the FastMNN integrated embedding by setting the n_neighbors to 100. Additionally, for the count_nhoods function the dimensionality (2D or spheroid) information was specified together with the batch key (reactionlD) to account for the variation arising from the two conditions. The log-Fold Change (logFC) returned by the differential abundance test was visualized on a beeswarm plot (Fig 6C). To further study the differences in cellular composition between batches or between the two conditions (2D and spheroids), the inventors computed the percentage of cells expressing or coexpressing the gene(s) of interest. The gaussian mixture model (GaussianMixture, sklearn vO.O.postl) was used to determine an expression cutoff from the log-normalized counts to classify whether a cell is positive for the gene. The percentage of cells (co) expressing gene(s) of interest was computed relative to the number of cells in the batch or condition. The results were visualized using bar plots (Fig 5C, 3E).
[0266] Results
[0267] In the developing neural tube, anterior to posterior orientation is controlled by a gradient of WNT signalling, whereas SHH and BMPs control dorso-ventral patterning, and a secondary BMP signalling center in the diencephalon is involved in hypothalamic patterning. Based on this developmental knowledge, the inventors performed a predicted optimal PVN differentiation of pluripotent human embryonic stem cells (hESCs), with SHH added on day 6 for mild ventralisation and CHIR added on day 0 for posteriorisation to caudal diencephalon, as well as an ARC-directed differentiation protocol with early addition of SHH (dO), delayed addition of CHIR (d2), and with or without BMP4 stimulation on day 6 (Figure 1A). The inventors compared these ARC and PVN cultures to a control ventral forebrain (vFB) population differentiated only with 100ng / ml SHH (dO-9). qRT-PCR analysis of day 16 in vitro differentiations showed high NKX2-1 expression in all protocols, but with the telencephalic F0XG1 marker expressed mainly in the vFB cultures (Figure 1A). The presence of BMP4 in the ARC protocol strongly induced RAX and TBX3 while also suppressing the expression of SHH. In contrast, the PVN protocol was highly enriched for F0XD1 and SHH with only minor RAX expression (Figure 1A). Combined immunocytochemistry ICC and in situ hybridisation (ISH) confirmed widespread and efficient induction of triple-positive RAXVTBX37NKX2.1+progenitors in the ARC+BMP condition (Figure 1B). To further understand the composition of our cultures, the inventors performed scRNAseq of both PVN and ARC+BMP patterned day 16 progenitors (referred to as “ARC” on Figures 1 and 2) (Figure 1C). The presence of NKX2-1+ / TBX3+ / RAX+posterior tuberal progenitors in the ARC protocol was confirmed (Figure 1D). From this analysis, the inventors also identified insulin like binding protein 3 (IGFBP3) expressed specifically at the junction of S0X2+ARC progenitors and STMN2 neuronal population (Figure 1D).
[0268] Example 2: BMP addition at day 5 of the ARC protocol combined with IGFBP3 is optimal for generating POMC and AGRP neurons.
[0269] Material and methods
[0270] Material and methods are as described above in Example 1.
[0271] Results
[0272] BMP plays a significant role in dorsalization of the neural tube, but is also expressed, specifically at the rostral diencephalon during early development. The inventors investigated if the newly proposed tuberal BMP signalling wave identified in the chick (Chinnaiya et al. 2023) might also be involved in the specification of anterior (POMC+ / SIX6+ / SHH+) versus posterior (FGF10+ / TBX3+ / RAX+) tuberal progenitors from hESCs. Using their ARC v1 in vitro protocol (Figure 1), the inventors initiated BMP4 treatment at different days from day 3 to 6 to recapitulate the wave of BMP signalling occurring in vivo (Figure 2A). They found that while RAX was highly expressed in all conditions, the later addition of BMP4 on day 5 to 6 significantly increased posterior hypothalamic markers TBX3 and FGF10 (Figure 2B and C). In contrast, early BMP4 addition at day 3 caused a profound patterning shift in the cultures, with a loss of NKX2.1 expression concomitant with strong induction of eye field markers PAX6 and VSX2 (Figure 2C). This finding was confirmed by combinatorial ICC / ISH for NKX2.1, RAX" and TBX3 (Figure 2B). To investigate the importance for subtype of BMP signalling in ARC patterning, the inventors studied if BMP7 could also induce ARC specification to a similar degree as BMP4. No significant difference was found in the gene expression of RAX, TBX3, ISL1 and FGF10 when substituting BMP4 with BMP7 from day 6 to 14 of the protocol, suggesting that these two factors can act redundantly in tuberal hypothalamic development (Figure 2D). This finding was confirmed by ICC / ISH for NKX2.1, RAX and TBX3 of day 16 progenitors of both BMP4 and BMP7 treated cells (Figure 2E). By day 50, both qPCR and ICC showed high expression of POMC and AGRP in cultures with BMP4 added on days 4- 6, whilst cultures with BMP4 added on day 3 retained optic identity with high expression of the eye field markers VSX2 and SP9 at day 50 (Figure 2F). Collectively, this data informed that the optimal BMP4 timing for posterior tuberal hypothalamic induction was between day 4-5, and the inventors selected BMP4 addition at day 5 for subsequent ARC differentiations. For further protocol optimisation, the inventors returned to their ARC progenitor scRNAseq data and tested the addition of IGFBP3 to their in vitro differentiations between days 7 and 14 of differentiation. Whilst IGFBP3 did not appear to affect the early patterning of the tuberal progenitors. Here, the inventors observed a consistent increase in important mature ARC markers such as AGRP and POMC at later stages of differentiation when added IGFBP3 to the cultures (Figure 2G-H).
[0273] Example 3: Single cell analysis of early stem cell-derived ARC progenitors reveals cellular heterogeneity and early tuberal specification events.
[0274] Material and methods
[0275] Material and methods are as described above in Example 1.
[0276] Results
[0277] After establishing an optimised v2 ARC protocol from hESCs, the inventors produced 4 batches of day 16 progenitors and performed single cell RNA sequencing analysis of all 4 batches in a single 10X experiment using CiteSeq Hashtagging (Stoeckius et al., 2017) (Figure 3A). From analysis of the 10X data, cell clusters were annotated (Figure 3B and C). Whilst all batches showed high expression of RAX and NKX2-1, ARC1 progenitors displayed lower expression of TBX3 and FGF10 and higher expression of SHH compared to ARC2-4 batches (Figure 3D and E). When comparing the percentages of NKX2-1 / TBX3 / RAX co-expressing cells (as defined by presence of all 3 transcripts in the same cell) within each batch of day 16 cultures, indicative of authentic “bona fide" ARC progenitor, the inventors found that ARC1 contained only 18.43% triple-positive progenitors whilst ARC 2-4 contained 49.04%, 49.00% and 48.83%, respectively (Figure 3E). These expression patterns indicated correct posterior tuberal hypothalamic patterning to NKX2-1+ / TBX3+ / RAX+ / FGF10+fates in batches ARC2-4, while ARC1 generated more anterior tuberal fates of SHH7FGF10' phenotype (Chinnaiya et al., 2023), presumably due to insufficient down-regulation of SHH by BMP4 in this batch. Next, the inventors studied scRNAseq data from day 25 of the same batches to allow greater resolution of the bifurcation amongst maturing STMN2+neurons, as well as clear delineation of the tanycyte lineage as marked by DIO2 (Figure 3F-H). The inventors observed that the OTP lineage progressed towards SST- expressing neurons as previously described, however they also highly expressed NR5A2, a marker associated with early KISS1 expression (Huisman et al., 2019) (Figure 3F-G). Other NR5A2 cells began to specifically express ONECUT1 / 3 and cluster separately (Figure 3F and G). PO / WC-expressing neurons were also identified in the day 25 dataset (Figure 3H). Conclusively, the inventors were able to capture early transitioning states of human ARC neurons and tanycytes in their day 16 and 25 scRNAseq data.
[0278] Example 4: Comparative analysis of maturation conditions of day 16 ARC progenitors in 2D, 3D and in vivo
[0279] Material and methods
[0280] Material and methods are as described above in Example 1 , in particular as in the section Cell culturing and neuronal differentiation and section ICC for 3D / spheroid format.
[0281] Transplantations of ARC progenitors
[0282] All procedures were conducted in accordance with the European Union Directive (2010 / 63 / EU), and had approval by the local ethical committee at Lund University and the Swedish Department for Agriculture (Jordbruksverket). Adult, female, athymic nude rats (Hsd:RH-Foxn1rnu) were purchased from Envigo, and were housed on a 12: 12-hr light:dark cycle with ad libitum access to food and water. For all surgical procedures, rats (>225 g) were anesthetized via intraperitoneal injection of a 20:1 mixture of fentanyl-Domitor (Apoteksbolaget), according to their weight. Transplantation of ARC progenitors was performed thawing day 16 cryopreserved progenitors using a wash buffer of 0.5% human serum albumin (HSA) in HBSS- / -. Following centrifugation, cells were reconstituted to a final density of 167,000 cells / pL cells suspension in Neurobasal, 20 ll / mL pulmozyme, 1:50 B27 supplement, 1 :1000 ROCKi + 1:1000 ascorbic acid + 1:1,000 BDNF. Seven adult female nude rats Hsd:RH-Foxn1rnu were transplanted unilaterally in the striatum. Before injection, the needle was firstly moved to D1 / V1 -0.2, to thereafter be adjusted to the correct DV coordinates. Cells were infused by 0.1 pL increments every 12 sec, with a 2 min diffusion time per deposit. A total of 1.5 pL of cell suspension was infused per deposit (250,000 cells). Step 3 was repeated for tract 2, i.e. total infusion volume is 3 pL (500,000 cells in total). Spatial direction Tract 1 Tract 2 A / P +0.9 +1.4 M / L -3.0 -2.6 D1 / V1 -5.0 -5.0.
[0283] Multiplexed immunohistochemistry
[0284] The nude rats were anaesthetized with Sodium Pentobarbital (250-350 mg / kg, 1.4 mL of 60mg / mL per rat, Apotek, Sweden) and transcardially perfused with 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer. The brains were removed, postfixed in 4% PFA for 24h at room temperature (RT), and immersed in 25% sucrose solution until fully dehydrated. For sectioning, the brains were cut into 35 pM coronal sections using a cryostat (CM1950 cryostat, Leica Microsystems, Germany), and systematically sampled in series of eight. The sections were stored in cryoprotectant at -20 °C until use. Sections from the striatum (site of transplant), and ARC / PVH (endogenous positive controls) were used for immunostainings. For immunostainings, the sections were initially rinsed in PBS, and subjected to antigen retrieval in preheated (80°C) TRIS-EDTA buffer (10 mM Tris Base, 1 mM EDTA Solution, 0.05% Tween-20, pH 9) for 30 min, and left to cool to RT before rinsing in PBS. For SG chromogenic staining (Vector Laboratories, CA, USA), endogenous peroxidase activity was blocked by incubation in 1% hydrogen peroxidase (H2O2) in PBS for 20 min at RT, prior to pre-incubation in blocking buffer (5% donkey or goat serum, 1% bovine serum albumin, 0.3% Triton X 100 (TX) (0.1% TX for SG chromogenic staining) in PBS) for 30 min at RT. Next, the sections were incubated overnight (2 hrs for anti- hNCAM) at RT in primary antibodies diluted in blocking buffer. After primary antibody incubation, the sections were rinsed in washing buffer (0.25% bovine serum albumin, 0.1% Triton X-100 in PBS) or 0.1% TX-PBS for SG chromogenic staining, followed by incubation for 1 h at RT in flurophore-conjugated or biotin-coupled secondary antibodies diluted in washing buffer.
[0285] For immunofluorescence, the sections were thereafter rinsed once in washing buffer and twice in PBS, mounted on glass slides, and coverslipped using FluorSaveTM (Millipore, #345789). For SG chromogenic staining, the sections were rinsed in TX- PBS, incubated for 1 h at RT in avidin-biotin complex solution (#AK-5000, Vector Laboratories, Burlingame, CA, USA) diluted in TX-PBS according to manufacturer’s instructions. After incubation, the sections were rinsed once in TX-PBS and twice in PBS before color development for 10 min in ImmPACT Vector SG Substrate chromogen solution (#AK 4705, Vector Laboratories, CA, USA) without H2O2, and for additional 2 min with H2O2. The sections were next mounted on gelatin-coated microscope glass slides, dehydrated in a series of ethanol (70%, 96%, 99%), cleared in xylene, immediately coverslipped using DPX New mountant (#1.00579, Merck, Germany), and left to dry overnight.
[0286] AGRP ELISA
[0287] To measure the concentration of secreted AGRP in the media of developing arcuate nucleus neurons we used the AGRP Quantikine ELISA kit (R&D Systems) which employs a solid phase sandwich ELISA that contains Sf 21- expressed recombinant human AgRP that has previously been shown to quantitate the recombinant factor. Cell culture supernatants were measured in duplicates with an assay range of 7.5- 500pg / mL.
[0288] Results
[0289] To assess the maturation of cell type specific lineage trajectories of the patterned day 16 hESC-derived ARC progenitor cells, the inventors comparatively assessed neuronal maturation in both 2D and 3D cultures, using 10X single nuclear RNAseq (snRNAseq), as well as in vivo maturation through transplantation to the striatum of immunodeficient nude rats (Figure 4A). Firstly, to optimize the 2D culture conditions, the inventors identified through in silico ligand-receptor analysis of GW7 human fetal scRNAseq BMP7 as a potential factor involved in maturation of ARC neurons (data not shown). BMP7 was tested on the cultures between day 25 and d50 of the maturation protocol and was found to modestly increase both AGRP and POMC expression at day 50 on maturation when normalized to the control (Figure 4B). Single nucleus RNAseq analysis of ARC cultures at day 50 and 70 showed the presence of ARC-derived neurons (STMN2+, including also the P0MC+ subtype) and ARC-derived tanycytes (D / O2+) (Figure 4C and D). Upon 4-month engraftment of ARC progenitors into the striatum of nude rats, neurons expressing TRH, AGRP, OTP and POMC were found within the graft (Figure 4E, F and G). Furthermore, the inventors observed a strong innervation of NPY-positive neurites in the graft, reminiscent of the NPY innervation found in the endogenous ARC region (Figure 4F and G). All antibodies used for staining were verified for specificity in the endogenous hypothalamus of the rat. The neuronal population from the snRNAseq analysis of ARC cultures at day 50 and 70 (STMN2+ / RAX- / LHX8- population from Figure 4C) was isolated and subjected to subclustering, revealing various ARC-specific neuronal subtypes such as P0MC+ neurons, TRH+ neurons, GHRH+ neurons and AGRP+ neurons (Figure 5A). The presence of these neuronal subtypes in the cultures was further confirmed by immunocytochemistry (Figure 5B). The snRNAseq analysis at day 50+70 further revealed a higher proportion of A GRP expressing neurons in posterior ARC batches (ARC2-4) compared to ARC1 , where no significant expression of AGRP was observed (Figure 5C). The presence of functional AGRP neurons in the ARC2-4 cultures was validated through increased detection of AGRP peptide in the culture medium over time through ELISA (Figure 5D). As 3D culturing is known to enhance cell to cell signalling and promote maturation of in vitro neuronal cultures (Eichmuller and Knoblich, 2022), the inventors also tested parallel maturation of our day 16 ARC progenitors in spheroid aggregates (schematic in Figure 4A). From immunocytochemistry, the presence of POMC+, TRH+ and GHRH+ neurons was confirmed also in the 3D spheroid cultures (Figure 6A). Interestingly, the inventors observed from snRNAseq on day 50 and day 70 cultures that culturing of the cells in 3D spheroids produced a higher proportion of AGRP+ neurons, GHRH+ neurons and PNOC+ neurons compared to 2D cultures (Figure 6B and C).
[0290] Example 5: Duration of BMP exposure is important for correct ARC patterning.
[0291] Material and methods
[0292] Material and methods are as described above in Example 1.
[0293] Results
[0294] Using the v2 ARC protocol they developed, the inventors further studied the importance of the duration of the BMP treatment. To test this, they performed withdrawal of BMP4 at either day 14 (= v2 ARC protocol control), day 11 or day 9. Early withdrawal of BMP at day 9 or 11 was found to greatly enhance SHH expression, presumably due to insufficient down-regulation of SHH by BMP signalling (Figure 7A) (Chinnaiya et al., 2023). Early withdrawal was also associated with a loss of important markers of posterior tuberal fate, i.e. TBX3 and DIO2 as well as an increased contamination of the cultures with FOXG1+ telencephalic fates (Figure 7A and B). Taken together, it was concluded that both the time point of BMP addition as well as the length of BMP exposure is important for accurate ARC patterning in vitro.
[0295] Example 6: Fine-tuning the enrichment of ARC neuronal lineages.
[0296] Material and methods
[0297] Material and methods are derived from Example 1 , with modifications as described hereafter:
[0298] Cell culturing and neuronal differentiation hESC line RC17 (Roslin Cells, hESC line, RCeO21-A), KOLF21-J (The Jackson Laboratory, hiPSC line) and BioN (Bioneer, hiPSC line) (Figure 9) and was maintained on 1 pg / cm2 laminin-521 (Biolamina, #LN521-02) in IPS-Brew (Miltenyi, #130-104-368). Cells were kept to 70-90% confluency before passaging with 75 pL / cm2 of 0.5 mM EDTA (Thermo Fisher Scientific, #15575020) for approx. 7 min before detachment and replated for 24 hours with 10 pM Y-27632 (ROCK inhibitor, Miltenyi, cat. # 130-106-538) with daily media changes thereafter. For differentiation into regionalized hypothalamic progenitors, the inventors adapted protocols from Nolbrant et al., 2017. hESCs are kept until 70-90% confluent then dissociated with 0.5mM EDTA and plated at 10K / cm2 in 2 pg / cm2 laminin- 111 (Biolamina, #LN111-02) coated plates. All day 0 cells, regardless of regionality, received 10 pM Y-2763 for 24 hours and neuroectodermal lineages were initiated using 10 pM SB413542 (Miltenyi, #130-106-543), and 100 ng / mL Noggin (Miltenyi, #130-1 OS- 456), diluted in N2 basal medium from day 0 to 9. For the PVN v1 CHIR is added to the N2 medium from day 0 to 9 at 0.3 pM whilst a low concentration and delayed addition of 150ng / ml of SHH is added from day 6 to 14 to enhance dorsal identity of the cells. For the v1 ARC protocol cells were ventralized with high SHH of 300 ng / mL from day 0 to 9. Rostral diencephalic positional identify was encouraged with 0.3 pM CHIR between day 2 to 9 and tuberal induction was incurred by 50 ng / mL BMP4 from day 6 to 14 (Figure 1). ARC v2 protocol found the use of BMP4 from day 5 following initiation of the Patterning phase to be optimal for the induction of ARC patterning.
[0299] The inventors also identified IGFBP3 as an enhancer of mature ARC fates (Figure 1 D and Figure 9A) and used IGFBP3 from day 7-14 for final protocol optimisation of ARCv2 cells. All protocols receive media change every 2 days. By day 11 , early progenitors are very confluent, cells were dissociated in 75 pL / cm2 accutase (ThermoFisher, #A11105-01) for 10 minutes at 37 and transferred at a density of 800k / cm2 in B27 medium, containing 0.2 mM ascorbic acid (Sigma-Merck, #A4403-100MG), 20 pg / mL BDNF (Miltenyi, #130- 096-286), and 10 pM 69Y-27632 and plated into onto Lam111 coated plates.
[0300] Day 16 of the differentiation, regionalised progenitors are replated one final time at 700k / cm2 to Lam521 coated plates for maturation and long term culturing in B27 containing 0.2 mM ascorbic acid, 20 pg / mL BDNF, 500 pM dibutyryl-cAMP (Sigma- Merck, #D0627-1G), 1 pM DAPT (Miltenyi, #130-110-489), 10 ng / mL GDNF (Miltenyi, #130-098-449), and 10 pM Y-27632. For the generation for spheroids, patterned day 16 hypothalamic progenitors were thawed and diluted in pre-warmed DMEM / F12 with 5% KOSR. Cells were counted, centrifuged at 400 xg for 5 min and resuspended in maturation medium (B27 medium [MACS Neuromedium containing 2% NB21 , 1% Glutamax, Penicillin / Streptomycin] complemented with 10 pM Y- 27632 (ROCKi), 20 ng / mL BDNF, 0.2 mM ascorbic acid, 500 pM Db-cAMP and 1 pM DAPT) at 250 000 cells / mL. The cell suspension was transferred to an ultralow attachment Il-bottom 96- well plate (Costar) at 200 pL / well, centrifuged at 100g for 5 min and maintained at 37 °C with 5% CO2. 75% of maturation medium without ROCKi was changed every 2-3 days until termination of the experiment. Testing of BMP7 in maturation phase between days 25-50 was done so using 100 ng / mL BMP-7 (R&D systems, #354-BP-500 / CF).
[0301] Results
[0302] ARC v2 protocol found the use of BMP4 from day 5 following initiation of the Patterning phase to be optimal for the induction of ARC patterning and was used as a starting point for the further tests in Figures 8 and 9.
[0303] The inventors also identified IGFBP3 (between days 7 to 14, according to ARCv2 protocol) as an enhancer of mature ARC fates (Figure 9A).
[0304] Additionally, the withdrawal of BMP4 was thoroughly tested such that cultures were either exposed to BMP4 between days 5-7, 5-9, 5-11 , 5-14 after initiating the Patterning phase, or without BMP4 (Figure 8).
[0305] Conclusions
[0306] It was found that lineage enrichment of AGRP or POMC in the mature ARC fates could be fine-tuned by BMP4 addition between days 5 to 14 following initiation of the Patterning phase for AGRP, or between days 5 to 7, 5 to 9, or 5 to 11 following initiation of the Patterning phase for POMC.
[0307] It was further found that both BMP7 (between days 25 an 50 following initiation of the Patterning phase, i.e. in the maturation phase) and IGFBP3 in the Patterning phase, also drive enrichment of the POMC lineages. However they were found to have minor effects on AGRP lineage enrichment specifically (Figure 9).
[0308] Sequence overview
[0309] SEQ ID NO.: 1
[0310] ACTB_v2 (Actin beta) FWD primer
[0311] ATGTGGCCGAGGACTTTGATTG
[0312] SEQ ID NO.: 2
[0313] ACTB_v2 (Actin beta) REV primer
[0314] ATGGCAAGGGACTTCCTGTAAC
[0315] SEQ ID NO.: 3
[0316] AGRP (Agouti related neuropeptide) FWD primer
[0317] TCCCTGTCCTGTGGAAATTTGT
[0318] SEQ ID NO.: 4
[0319] AGRP (Agouti related neuropeptide) REV primer
[0320] TCTCCAATTTGGGGTGAGGTTT
[0321] SEQ ID NO.: 5
[0322] DIO2 (lodothyronine Deiodinase 2) FWD primer
[0323] GTTATAAGGCAACCCCCGGTAT
[0324] SEQ ID NO.: 6
[0325] DIO2 (lodothyronine Deiodinase 2) REV primer
[0326] AACCTCAGCTAATGGGACCAAG
[0327] SEQ ID NO.: 7
[0328] FGF10 (Fibroblast growth factor 10) FWD primer GTTGCTGTTCTTGGTGTCTTCC
[0329] SEQ ID NO.: 8
[0330] FGF10 (Fibroblast growth factor 10) REV primer
[0331] TGACACCATGTCCTGACCAAG
[0332] SEQ ID NO.: 9
[0333] FOXD1 (Forkhead box D1) FWD primer
[0334] CCTGTCCAGTGTCGAGAACTTT
[0335] SEQ ID NO.: 10
[0336] FOXD1 (Forkhead box D1) REV primer
[0337] AACCACCAAGACGAGAAAAGGA
[0338] SEQ ID NO.: 11
[0339] FOXG1_v2 (Forkhead box G1) FWD primer
[0340] TCAACGGCATCTACGAGTTCAT
[0341] SEQ ID NO.: 12
[0342] FOXG1_v2 (Forkhead box G1) REV primer
[0343] AAGCACTTGTTGAGGGACAGAT
[0344] SEQ ID NO.: 13
[0345] GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) FWD primer
[0346] TTGAGGTCAATGAAGGGGTC
[0347] SEQ ID NO.: 14
[0348] GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) REV primer
[0349] GAAGGTGAAGGTCGGAGTCA
[0350] SEQ ID NO.: 15
[0351] ISL1 (ISL LIM homeobox 1) FWD primer
[0352] AAGCGCAGGAAGAGAGACTG
[0353] SEQ ID NO.: 16 ISL1 (ISL LIM homeobox 1) REV primer
[0354] CCAAGAGACCCAGGATTTCA
[0355] SEQ ID NO.: 17
[0356] NKX2.1 (NK2 homeobox 1) FWD primer
[0357] AGGGCGGGGCACAGATTGGA
[0358] SEQ ID NO.: 18
[0359] NKX2.1 (NK2 homeobox 1) REV primer
[0360] GCTGGCAGAGTGTGCCCAGA
[0361] SEQ ID NO.: 19
[0362] PAX6 (Paired box 6) FWD primer
[0363] TGGTATTCTCTCCCCCTCCT
[0364] SEQ ID NO.: 20
[0365] PAX6 (Paired box 6) REV primer
[0366] TAAGGATGTTGAACGGGCAG
[0367] SEQ ID NO.: 21
[0368] POMC (Proopiomelanocortin) FWD primer
[0369] TTTCATGACCTCCGAGAAGAGC
[0370] SEQ ID NO.: 22
[0371] POMC (Proopiomelanocortin) REV primer
[0372] GATGATGGCGTTTTTGAACAGC
[0373] SEQ ID NO.: 23
[0374] PRDM12 (PR / SET domain 12) FWD primer
[0375] GTGGGAGGTGTTCAATGAGGAT
[0376] SEQ ID NO.: 24
[0377] PRDM12 (PR / SET domain 12) REV primer
[0378] GTTCGTTACGTGCACACTTGAT SEQ ID NO.: 25
[0379] RAX (Retina and anterior neural fold homebox) FWD primer
[0380] CCTCTCAGTTCACCAAGCAGAT
[0381] SEQ ID NO.: 26
[0382] RAX (Retina and anterior neural fold homebox) REV primer
[0383] TGATCAACCTTGGGTGTTAGGG
[0384] SEQ ID NO.: 27
[0385] SHH (Sonic hedgehog) FWD primer
[0386] CCAATTACAACCCCGACATC
[0387] SEQ ID NO.: 28
[0388] SHH (Sonic hedgehog) REV primer
[0389] AGTTTCACTCCTGGCCACTG
[0390] SEQ ID NO.: 29
[0391] SP9 (SP9 transcription factor) FWD primer
[0392] TCTGGCCCCAACGACTCTTAG
[0393] SEQ ID NO.: 30
[0394] SP9 (SP9 transcription factor) REV primer
[0395] CTCGTTCGTTCTCGGTGTCTC
[0396] SEQ ID NO.: 31
[0397] TBX3 (T-box transcription factor 3) FWD primer
[0398] GGGGGTAGGAGTTCCAACATTT
[0399] SEQ ID NO.: 32
[0400] TBX3 (T-box transcription factor 3) REV primer
[0401] GCACTGAGGGAGATGTCTTTGA
[0402] SEQ ID NO.: 33
[0403] TRH (Thyrotropin releasing hormone) FWD primer
[0404] TCCTGGATGACCTGAGTAGGAG SEQ ID NO.: 34
[0405] TRH (Thyrotropin releasing hormone) REV primer
[0406] TCAGGGAAAACTGGGTTCACTC
[0407] SEQ ID NO.: 35
[0408] VSX2 (llnc-5 netrin receptor D) FWD primer
[0409] CCTCTGCCCTCTGTAAATGTGT
[0410] SEQ ID NO.: 36
[0411] VSX2 (llnc-5 netrin receptor D) REV primer
[0412] AGAGACCTCTGCGAGAACTTTG
[0413] References
[0414] Bergen V, Lange M, Peidli S, Wolf FA, Theis FJ. (2020) Generalizing RNA velocity to transient cell states through dynamical modeling. Nat Biotechnol. 2020;38(12):1408- 1414. doi: 10.1038 / s41587-020-0591-3
[0415] Bolborea, M., and Langlet, F. (2021). What is the physiological role of hypothalamic tanycytes in metabolism? American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 320, R994-R1003. https: / / doi.Org / 10.1152 / ajpregu.00296.2020.
[0416] Bruning, J.C., and Fenselau, H. (2023). Integrative neurocircuits that control metabolism and food intake. Science 381 , eabl7398. https: / / doi.org / 10.1126 / science.abl7398.
[0417] Burbridge, S., Stewart, I., and Placzek, M. (2016). Development of the neuroendocrine hypothalamus. Comprehensive Physiology 6, 623-643. https: / / doi.org / 10.1002 / cphy.c150023.
[0418] Chen, H.-J.C., Yang, A., Mazzaferro, S., Mali, I., Cahn, O., Kentistou, K., Rowley, C., Stewart, N., Seah, J.W.E., Pisupati, V., et al. (2023). Profiling human hypothalamic neurons reveals a candidate combination drug therapy for weight loss (Neuroscience). Chinnaiya, K., Burbridge, S., Jones, A., Kim, D.W., Place, E., Manning, E., Groves, I., Sun, C., Towers, M., Blackshaw, S., et al. (2023) Title: A neuroepithelial wave of BMP signalling drives anteroposterior specification of the tuberal hypothalamus. https: / / doi.Org / 10.1101 / 2022.08.31.506043.
[0419] Dann E, Henderson NC, Teichmann SA, Morgan MD, Marioni JC. (2022) Differential abundance testing on single-cell data using k-nearest neighbor graphs. Nat Biotechnol. 2022;40(2):245-253. doi: 10.1038 / s41587-021 -01033-z
[0420] Eichmuller, O.L., and Knoblich, J.A. (2022). Human cerebral organoids — a new tool for clinical neurology research. Nat Rev Neurol 18, 661-680. https: / / doi.org / 10.1038 / s41582-022-00723-9.
[0421] Fleming SJ, Chaffin MD, Arduini A, et al. (2023). Unsupervised removal of systematic background noise from droplet-based single-cell experiments using CellBender. Nat Methods. 2023;20(9):1323-1335. doi: 10.1038 / s41592-023-01943-7
[0422] Haghverdi L, Lun ATL, Morgan MD, Marioni JC. (2018) Batch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors. Nat Biotechnol. 2018;36(5):421-427. doi:10.1038 / nbt.4091
[0423] Hao Y, Hao S, Andersen-Nissen E, et al. (2021) Integrated analysis of multimodal single-cell data. Cell. 2021 ;184(13):3573-3587.e29. doi:10.1016 / j.cell.2021.04.048
[0424] Huisman, C., Cho, H., Brock, O., Lim, S.J., Youn, S.M., Park, Y., Kim, S., Lee, S.K., Delogu, A., and Lee, J.W. (2019). Single cell transcriptome analysis of developing arcuate nucleus neurons uncovers their key developmental regulators. Nature Communications 10. https: / / doi.org / 10.1038 / s41467-019-11667-y.
[0425] Kaminow, B., Yunusov, D., and Dobin, A. (2021). STARsolo: accurate, fast and versatile mapping / quantification of single-cell and single-nucleus RNA-seq data bioRxiv 2021.05.05.442755; doi: https: / / doi.org / 10.1101 / 2021.05.05.442755 Lehr, S., Bruckner, D.B., Greunz-Schindler, M., Minchington, T., Merrin, J., Hannezo, E., and Kicheva, A. (2023). Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signalling (Developmental Biology).
[0426] Ma, T., Wong, S.Z.H., Lee, B., Ming, G. li, and Song, H. (2021). Decoding neuronal composition and ontogeny of individual hypothalamic nuclei. Neuron 109, 1150- 1167. e6. https: / / doi.Org / 10.1016 / j.neuron.2021.01.026.
[0427] Manning, L., Ohyama, K., Saeger, B., Hatano, O., Wilson, S.A., Logan, M., and Placzek, M. (2006). Regional Morphogenesis in the Hypothalamus: A BMP-Tbx2 Pathway Coordinates Fate and Proliferation through Shh Downregulation. Developmental Cell 11 , 873-885. https: / / doi.Org / 10.1016 / J.DEVCEL.2006.09.021.
[0428] Nolbrant S, Heuer A, Parmar M, Kirkeby A. (2017) Generation of high-purity human ventral midbrain dopaminergic progenitors for in vitro maturation and intracerebral transplantation. Nat Protoc. 2017;12(9):1962-1979. doi:10.1038 / nprot.2017.078
[0429] Pool AH, Poldsam H, Chen S, Thomson M, Oka Y. (2023) Recovery of missing singlecell RNA-sequencing data with optimized transcriptomic references. Nat Methods.
[0430] 2023;20(10) : 1506-1515. doi: 10.1038 / s41592-023-02003-w
[0431] Rupp, A.C., Tomlinson, A. J., Affinati, A.H., Yacawych, W.T., Duensing, A.M., True, C., Lindsley, S.R., Kirigiti, M.A., MacKenzie, A., Polex-Wolf, J., et al. (2023). Suppression of food intake by Glp1r / Lepr-coexpressing neurons prevents obesity in mouse models. Journal of Clinical Investigation 133, e157515. https: / / doi.org / 10.1172 / JCI157515.
[0432] Sarrafha, L., Neavin, D.R., Parfitt, G.M., Kruglikov, I. A., Whitney, K., Reyes, R., Coccia, E., Kareva, T., Goldman, C., Tipon, R., et al. (2023). Novel human pluripotent stem cell-derived hypothalamus organoids demonstrate cellular diversity. iScience 26, 107525. https: / / doi.Org / 10.1016 / j.isci.2023.107525.
[0433] Sisley, S., Gutierrez-Aguilar, R., Scott, M., D’Alessio, D.A., Sandoval, D.A., and Seeley, R.J. (2014). Neuronal GLP1 R mediates liraglutide’s anorectic but not glucose-lowering effect. J. Clin. Invest. 124, 2456-2463. https: / / doi.org / 10.1172 / JCI72434. Stoeckius, M., Hafemeister, C., Stephenson, W., Houck-Loomis, B., Chattopadhyay, P.K., Swerdlow, H., Satija, R., and Smibert, P. (2017). Simultaneous epitope and transcriptome measurement in single cells. Nat Methods 14, 865-868. https: / / doi.org / 10.1038 / nmeth.4380.
[0434] Van de Sande B, Flerin C, Davie K, et al. (2020) A scalable SCENIC workflow for single-cell gene regulatory network analysis. Nat Protoc. 2020;15(7):2247-2276. doi: 10.1038 / S41596-020-0336-2
[0435] Wolf FA, Angerer P, Theis FJ. (2018) SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 2018; 19(1 ): 15. Published 2018 Feb 6. doi : 10.1186 / s 13059-017- 1382-0
[0436] Zheng GX, Terry JM, Belgrader P, et al. (2017). Massively parallel digital transcriptional profiling of single cells. Nat Commun. 2017;8:14049. Published 2017 Jan 16. doi:10.1038 / ncomms14049
[0437] Zhou, X., Lu, Y., Zhao, F., Dong, J., Ma, W., Zhong, S., Wang, M., Wang, B., Zhao, Y., Shi, Y., et al. (2022). Deciphering the spatial-temporal transcriptional landscape of human hypothalamus development. Cell Stem Cell 29, 328-343. e5. https: / / doi.Org / 10.1016 / j. stem.2021.11.009.
[0438] Items
[0439] 1. A method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells, said method comprising a cell patterning and expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in in the presence of one or more sonic hedgehog pathway activator(s) and, b. Culturing the cells from step a. in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3), thereby obtaining arcuate nucleus progenitor cells. 2. The method according to item 1 , wherein the one or more sonic hedgehog pathway activator(s) is a naturally occurring sonic hedgehog pathway activator or a synthetic sonic hedgehog pathway agonist.
[0440] 3. The method according to any one of the preceding items, wherein the one or more sonic hedgehog pathway activator(s) is the Sonic hedgehog protein (SHH) and / or a Smoothened agonist such as (SAG or purmorphamine).
[0441] 4. The method according to any one of the preceding items, wherein the one or more sonic hedgehog pathway activator(s) is used at a concentration in the range of 1-1000ng / mL, such as 50-500ng / mL, such as 100-300ng / mL, for instance 100ng / mL, for instance 125ng / mL, for instance 150ng / mL, for instance 200ng / mL, for instance 300ng / mL, preferably wherein the one or more sonic hedgehog pathway activator is used at a concentration of 100ng / mL or 300ng / mL, even more preferably wherein the one or more sonic hedgehog pathway activator(s) is used at a concentration of 300ng / mL.
[0442] 5. The method according to any one of the preceding items, wherein the Smoothened agonist is used at a concentration in the range of 0.1-100pM, such as in the range of 1-5pM, for instance 1 M, for instance 2pM, for instance 3pM, for instance 4pM, for instance 5pM.
[0443] 6. The method according to any one of the preceding items wherein BMP4 and / or BMP7 is used at concentration in the range of 1-1000ng / mL, such as in the range of 1-500ng / mL, such as in the range of 1-200ng / mL, such as in the range of 25-200ng / mL, such as in the range of 50-150ng / mL for instance 15ng / mL, for instance 20ng / mL, for instance 25ng / mL, for instance 30ng / mL, for instance 35ng / mL, for instance 40ng / mL, for instance 45ng / mL, for instance 50ng / mL, for instance 55ng / mL, for instance 60ng / mL, for instance 65ng / mL, for instance 70ng / mL, for instance 75ng / mL, for instance 80ng / mL, for instance 85ng / mL, for instance 90ng / mL, for instance 95ng / mL, for instance 100ng / mL, for instance 110ng / mL, for instance 120ng / mL, for instance 130ng / mL, for instance 140ng / mL, for instance 150ng / mL, for instance 160ng / mL, for instance 170ng / mL, for instance 180ng / mL, for instance 190ng / mL, for instance 200ng / mL, preferably wherein BMP4 and / or BMP7 is used at concentration in the range of 50-150ng / mL, even more preferably wherein BMP4 and / or BMP7 is used at concentration of 50ng / mL.
[0444] 7. The method according to any one of the preceding items, wherein IGFBP3 is used at concentration in the range of 1-2000ng / mL, such as in the range of 50- 1500ng / mL, such as in the range of 50-800ng / mL, such as in the range of 100- 800ng / mL, such as in the range of 200-600ng / mL, for instance 100ng / mL, for instance 150ng / mL, for instance 200ng / mL, for instance 250ng / mL, for instance 300ng / mL, for instance 350ng / mL, for instance 400ng / mL, for instance 450ng / mL, for instance 500ng / mL, for instance 550ng / mL, for instance 600ng / mL, for instance 650ng / mL, for instance 700ng / mL, for instance 750ng / mL, for instance 800ng / mL, preferably wherein IGFBP3 is used at concentration of 400ng / mL.
[0445] 8. The method according to any one of the preceding items, further comprising a step of culturing the pluripotent stem cells, or pluripotent stem cell-derived cells obtained thereof, in the presence of a Rho kinase (ROCK) inhibitor, preferably wherein the ROCK inhibitor is Y-27632.
[0446] 9. The method according to any one of the preceding claims, wherein the ROCK inhibitor is used at a concentration in the range of 1-100pM, preferably wherein the ROCK inhibitor is used at a concentration of 10pM.
[0447] 10. The method according to any one of the preceding items, wherein step a. further comprises a step of culturing the pluripotent stem cells in the presence of one or more inhibitor(s) of the SMAD signalling pathway, said step initiating the Patterning phase, preferably wherein the one or more inhibitor(s) of the SMAD signalling pathway are selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP) pathway.
[0448] 11. The method according to any one of the preceding items, wherein the inhibitor of the transforming growth factor (TGF-P) pathway is selected from the group consisting of: SB413542, A83-01 , SB505124, LY364947, R268712, preferably wherein the inhibitor of the transforming growth factor (TGF-P) pathway is SB413542.
[0449] 12. The method according to any one of the preceding items, wherein the inhibitor of the TGF-p pathway is used at a concentration in the range of 0.1-100pM, such as in the range of 1-75pM, such as in the range of 5-50pM, for instance 7.5pM, for instance 10pM, for instance 15pM, for instance 20pM, for instance 25pM, for instance 30pM, for instance 35pM, for instance 45pM, for instance 50pM, preferably wherein the inhibitor of the TGF-p pathway is used at a concentration of 10pM.
[0450] 13. The method according to any one of the preceding items, wherein the inhibitor of the bone morphogenetic protein (BMP) pathway is a protein inhibitor of BMP, preferably wherein said protein inhibitor of BMP is Noggin, or a small molecule inhibitor of BMP, more preferably wherein said small molecule inhibitor of BMP is selected from the group consisting of: LDN193189 and dorsomorphin.
[0451] 14. The method according to any one of the preceding items, wherein the inhibitor of the BMP pathway is a protein inhibitor of BMP, and wherein said inhibitor is used at a concentration in the range of 0.1-1000ng / mL, such as in the range of 1-500ng / mL, such as in the range of 10-250ng / mL, for instance at 50ng / mL, for instance at 75ng / mL, for instance at 100ng / mL, preferably wherein said inhibitor is used at a concentration of 100ng / mL.
[0452] 15. The method according to any one of the preceding items, wherein the inhibitor of the BMP pathway is a small molecule inhibitor of BMP, and wherein said inhibitor is used at a concentration in the range of 1-500nM, such as in the range of 50-200nM, such as in the range of 75-150nM, for instance 80nM, for instance 90nM, for instance 100nM, for instance 110nM, for instance 120nM, for instance 130nM, for instance 140nM, for instance 150nM, preferably wherein said inhibitor is used at 100nM.
[0453] 16. The method according to any one of the preceding items, wherein step a. further comprises a step of culturing the pluripotent stem cells, or pluripotent stem cell-derived cells obtained thereof, in the presence of an activator of the WNT signalling pathway. The method according to any one of the preceding items, wherein the WNT signalling pathway activator is a glycogen synthase kinase 3p (GSK3P) inhibitor. The method according to any one of the preceding items, wherein the glycogen synthase kinase 3p inhibitor is CHIR99021 (CHIR). The method according to any one of the preceding items, wherein the WNT signalling pathway activator is used at a concentration in the range of 0.1-10pM, such as in the range of 0.2-5pM, such as 0.3pM, such as 0.5pM, such as 1 M, such as 2pM, preferably wherein the WNT signalling pathway activator is used at a concentration of 0.3pM. The method according to any one of the preceding items, wherein the step a. further comprises a step of culturing the pluripotent stem cells, or pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7. The method according to any one of the preceding items, wherein the step b. further comprises a step of culturing the pluripotent stem cells, or pluripotent stem cell-derived cells obtained thereof, in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF) and ascorbic acid (AA). The method according to any one of the preceding items, further comprising a step of determining the expression of the markers RAX, TBX3, and / or NKX2-1 in the cells obtained, such as in the pluripotent stem cell-derived cells, preferably wherein said step is performed during and / or after the step b. of culturing the cells from step a. in in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3). The method according to any one of the preceding items, wherein the step of determining the expression of the markers RAX, TBX3, and / or NKX2-1 in the cells is performed at the latest 11 to 25 days, for example 16 days, after initiating the Patterning phase. The method according to any one of the preceding items, wherein the determination of the expression is performed by quantitative reverse transcription PCR (qRT-PCR), single-cell RNA sequencing (scRNAseq), immunocytochemistry (ICC), flow cytometry, enzyme-linked immunosorbent assay (ELISA) and / or in situ-hybridization (ISH). The method according to any one of the preceding items, wherein the cells obtained, such as the pluripotent stem cell-derived cells, are positive for RAX, TBX3 and / or NKX2-1 . The method according to any one of the preceding items, wherein at least 40% of the cells obtained are RAX positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 74%of the cells obtained are RAX positive. The method according to any one of the preceding items, wherein at least 1 % of the cells obtained are TBX3 positive, such as at least 5%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 34%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92% of the cells obtained are TBX3 positive. The method according to any one of the preceding items, wherein at least 40% of the cells obtained are NKX2-1 positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 66%, such as at least 69%, such as at least 70%, such as at least 72% of the cells obtained are NKX2-1 positive. The method according to any one of the preceding items, wherein at least 40% of the cells obtained are RAX positive, at least 1 % of the cells obtained are TBX3 positive and / or at least 40% of the cells obtained are NKX2-1 positive, preferably wherein at least 57% of the cells obtained are RAX positive, at least 34% are TBX3 positive and / or at least 66% are NKX2-1 positive.
[0454] 30. The method according to any one of the preceding items, wherein at least 10% of the cells, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the cells obtained are positive for RAX, TBX3, and NKX2-1.
[0455] 31. The method according to any one of the preceding items, wherein the step a. of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of one or more sonic hedgehog pathway activator(s) is initiated simultaneously with the initiation of the Patterning phase.
[0456] 32. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of one or more sonic hedgehog pathway activator(s) and / or the step of culturing the pluripotent stem cells in the presence of one or more inhibitor(s) of the SMAD signalling pathway is performed for 3 to 9 days, for example 7 to 9 days, such as 7 days, such as 8 days, such as 9 days.
[0457] 33. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of an activator of the WNT signalling pathway is initiated at the latest 2 days, such as 2 days after initiating the Patterning phase.
[0458] 34. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of an activator of the WNT signalling pathway is performed for 1 to 12 days, for instance of 5 to 10 days, such as 5 days, such as 6 days, such as 7 days, such as 8 days, such as 9 days, such as 10 days. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7 is initiated at the latest 3 to 6 days, such as 3 days, such as 4 days, such as 5 days, such as 6 days after initiating the Patterning phase. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7 is initiated 7 days after initiating the Patterning phase. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7 is performed for 1 to 6 days, such as for 2 days, such as for 5 days. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7, and IGFBP3, is initiated at the latest 5 to 7 days, such as 5 days, such as 6 days, such as 7 days, after initiating the Patterning phase. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7, and IGFBP3, is performed for 8 to 15 days, such as 8 days, such as 9 days, such as 10 days, such as 11 days, such as 12 days, such as 13 days, such as 14 days, such as 15 days. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF) and ascorbic acid is initiated 5 to 16 days, such as 6 days, such as 7 days, such as 8 days, such as 9 days, such as 10 days, such as 11 days, such as 12 days, such as 13 days, such as 14 days, such as 15 days, after initiating the Patterning phase. The method according to any one of the preceding items, wherein the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF) and ascorbic acid is performed for at least 3 days, preferably for 3 to 14 days, even more preferably performed for 3 to 5 days, such as for 4 to 5 days. The method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells according to any one of the preceding items, said method comprising a cell patterning and expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 1 to 4 days, such as 2 days, such as 3 days; g. Culturing the cells from step f. in the presence of IGFBP3 at 400ng / mL, until 14 days after initiating the Patterning phase; h. Culturing the cells of step g. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and i. Optionally culturing the cells of step h. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day, thereby obtaining arcuate nucleus progenitor cells.
[0459] 43. The method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells according to any one of the preceding items, said method comprising a cell patterning and expansion phase together comprising the steps of: a. Culturing said pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 7 days; g. Culturing the cells of step f. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and h. Optionally culturing the cells of step g. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day, thereby obtaining arcuate nucleus progenitor cells.
[0460] 44. A population of arcuate nucleus progenitor cells obtained by the method according to any one of the preceding items.
[0461] 45. A population of arcuate nucleus progenitor cells wherein said cells are positive for RAX, TBX3 and / or NKX2-1.
[0462] 46. The population of arcuate nucleus progenitor cells according to any one of the preceding items, wherein at least 40% of the cells are RAX positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 74% of the cells are RAX positive.
[0463] 47. The population of arcuate nucleus progenitor cells according to any one of the preceding items, wherein at least 1% of the cells are TBX3 positive, such as at least 5%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 34%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92% of the cells are TBX3 positive.
[0464] 48. The population of arcuate nucleus progenitor cells according to any one of the preceding items, wherein at least 20% of the cells are NKX2-1 positive, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 66%, such as at least 69%, such as at least 70%, such as at least 72% of the cells are NKX2-1 positive.
[0465] 49. The population of arcuate nucleus progenitor cells according to any one of the preceding items, wherein at least 40% of the cells obtained are RAX positive, at least 1% of the cells obtained are TBX3 positive and / or at least 20% of the cells obtained are NKX2-1 positive, preferably wherein at least 57% of the cells obtained are RAX positive, at least 34% are TBX3 positive and / or at least 66% are NKX2-1 positive. The population of arcuate nucleus progenitor cells according to any one of the preceding items, wherein at least 10%, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the cells are positive for RAX, TBX3, and NKX2-1. The population of arcuate nucleus progenitor cells according to any one of the preceding items, wherein said cells are human arcuate nucleus progenitor cells. The population of cells according to any one of the preceding items, wherein the population of cells is in a 2D cell culture format or in a 3D cell culture format. A method for differentiating arcuate nucleus progenitor cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a maturation phase comprising the step of: i. Culturing said arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes. A method for differentiating pluripotent stem cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a cell Patterning and Expansion phase comprising the steps of any one of items 1 to 43, and further comprising a maturation phase comprising the step of: i. Culturing the obtained arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes. The method according to any one of items 53 to 54, wherein at least 10%, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the arcuate nucleus progenitor cells are positive for RAX, TBX3, and NKX2- 1. The method according to any one of items 53 to 55, further comprising a step of culturing the arcuate progenitor cells in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP. The method according to anyone of the preceding items, wherein the step of culturing the arcuate nucleus progenitor cells in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP is initiated at the latest 30 days, such as 16 days, such as 25 days after initiating the Patterning phase. The method according to anyone of the preceding items, wherein the step of culturing the arcuate nucleus progenitor cells in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP is initiated up to 9 days, such as 9 days, before initiating the step of culturing the arcuate nucleus progenitor cells in the presence of BMP7. The method according to anyone of the preceding items, wherein the step of culturing the arcuate nucleus progenitor cells in the presence of one or more components selected from the group consisting of: Brain-derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GDNF), y-secretase inhibitor (DAPT), ascorbic acid (AA), and dibutyryl cyclic AMP is performed for at least 5 days, such as for in the range of 5 to 50 days, for instance for in the range of 5 to 40 days, for instance for in the range of 5 to 38 days, for instance for in the range of 5 to 34 days, such as for 34 days. 60. The method according to any one of the preceding items, wherein each of the culturing steps is performed in a medium comprising a basal medium identical or different.
[0466] 61. The method according to any one of the preceding items, wherein the culturing steps are performed in a medium supporting the growth of neural stem cells, for example a neurobasal medium.
[0467] 62. The method according to any one of the preceding items, wherein the culturing steps are performed in a medium comprising a supplement selected from the group consisting of: N2, B27 and NB21.
[0468] 63. The method according to any one of the preceding items, wherein BMP7 is used at a concentration in the range of 1-1000ng / mL, such as in the range of 50-250ng / mL, such as 50ng / mL, such as 75ng / mL, such as 100ng / mL, such as 150ng / mL, such as 200ng / mL, such as 250ng / mL, preferably wherein BMP7 is used at a concentration of 100ng / mL.
[0469] 64. The method according to anyone of the preceding items, wherein the step i. of culturing the arcuate nucleus progenitor cells in the presence of BMP7 is initiated at the latest 30 days, such as 16 days, such as 17 days, such as 18 days, such as 19 days, such as 20 days, such as 21 days, such as 22 days, such as 23 days, such as 24 days, such as 25 days, such as 26 days, such as 27 days, such as 28 days, such as 29 days after initiating the Patterning phase.
[0470] 65. The method according to anyone of the preceding items, wherein the step i. of culturing the arcuate nucleus progenitor cells in the presence of BMP7 is performed for in the range of 5 to 50 days, such as for in the range of 10 to 40 days, such as for in the range of 20 to 30 days, for instance for at the most 25 days, such as for 25 days, such as for at the most 20 days, such as for at the most 10 days.
[0471] 66. The method according to any one of the preceding items, wherein the steps of culturing are performed in a 2D cell culture format or in a 3D cell culture format. 67. The method according to any one of items 53 to 66, further comprising a step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 in the cells.
[0472] 68. The method according to item 67, wherein said cells consist of arcuate nucleus neurons, defined by being positive for the markers STMN2 and negative for the markers RAX and LHX8.
[0473] 69. The method according to any one of items 67 and 68, wherein the determination of the expression is performed by quantitative reverse transcription PCR (qRT-PCR), single-cell RNA sequencing (scRNAseq), singlenucleus RNA sequencing (snRNA-seq), ELISA, immunocytochemistry (ICC), flow cytometry and / or in situ-hybridization (ISH).
[0474] 70. The method according to any one of the preceding items, wherein the cells express one or more markers selected from the group consisting of: AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and DIO2.
[0475] 71. The method according to any one of the preceding items, wherein the step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 is performed at least 14 days, preferably 14 to 54 days, even more preferably 34 days, after initiating the step i. of culturing said arcuate nucleus progenitor cells in the presence of BMP7.
[0476] 72. The method according to any one of the preceding items, wherein the step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 is performed in the range of 30 to 200 days, such as in the range of 50 to 100 days, such as in the range of 50 to 70 days, such as 50 days, after initiating the patterning phase.
[0477] 73. The method according to any one of the preceding items, wherein:
[0478] - at least 0.25%, such as at least 1%, such as at least 2%, such as at least 3%, such as at least 6% of the mature arcuate nucleus neurons are AGRP-positive; - at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 48% of the mature arcuate nucleus neurons are POMC-positive;
[0479] - at least 7.5%, such as at least 10%, such as at least 12.5% of the mature arcuate nucleus neurons are PRDM 12-positive;
[0480] - at least 5%, such as at least 7.5%, such as at least 10%, such as at least 12.5% of the mature arcuate nucleus neurons are PNOC-positive;
[0481] - at least 5%, such as at least 10%, such as at least 15%, such as at least 20%, such as at least 25% of the mature arcuate nucleus neurons are TRH- positive;
[0482] - at least 10%, such as at least 20%, such as at least 30% of the mature arcuate nucleus neurons are SST-positive;
[0483] - at least 7.5%, such as at least 10% of the mature arcuate nucleus neurons are OTP-positive;
[0484] - at least 1%, such as at least 1.5%, such as at least 2% of the mature arcuate nucleus neurons are GHRH-positive;
[0485] - at least 10%, such as at least 15%, such as at least 2%, such as at least 30%, such as at least 40% of the arcuate neurons are TH-positive; and / or
[0486] - at least 2%, such as at least 2.5%, such as at least 3%, such as at least 5%, such as at least 12.5% of the arcuate neurons are POMC and GPR149- positive. The method according to any one of the preceding items, wherein the pluripotent stem cells are human pluripotent stem cells, such as human embryonic stem cells (hESCs) or human induced pluripotent stem cells (hiPSCs). The method according to any one of the preceding items, wherein the arcuate nucleus progenitor cells are posterior tuberal arcuate nucleus progenitor cells. The method according to any one of the preceding items, wherein the arcuate nucleus progenitor cells, the mature arcuate nucleus neurons and / or the tanycytes are human arcuate nucleus progenitor cells, mature arcuate nucleus neurons and / or tanycytes. The method according to any one of the preceding items, wherein the mature arcuate nucleus neurons are human POMC-expressing neurons. The method according to any one of the preceding items, wherein the mature arcuate nucleus neurons are human tanycytes and / or AGRP-expressing neurons. The method according to any one of the preceding items, wherein the mature arcuate nucleus neurons are human POMC-expressing neurons, and wherein said method comprises a cell Patterning and Expansion phase comprising the steps of: a. Culturing pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 1 to 4 days, such as 2 days, such as 3 days; g. Culturing the cells from step f. in the presence of IGFBP3 at 400ng / mL, until 14 days after initiating the Patterning phase; h. Culturing the cells of step g. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and i. Optionally culturing the cells of step h. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day.
[0487] 80. The method according to any one of the preceding items, wherein the mature arcuate nucleus neurons and / or tanycytes are human AGRP-expressing neurons and / or tanycytes, and wherein said method comprising a cell Patterning and Expansion phase comprising the steps of: a. Culturing pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b. Optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c. Culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d. Culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e. Culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f. Culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 7 days; g. Culturing the cells of step f. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and h. Optionally culturing the cells of step g. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day. A kit-of-parts comprising:
[0488] - One or more sonic hedgehog pathway activator(s), preferably wherein the one or more sonic hedgehog pathway activator is selected from the group consisting of a naturally occurring sonic hedgehog pathway activator and a synthetic sonic hedgehog pathway agonist, even more preferably wherein the one or more sonic hedgehog pathway activator(s) is SHH or a Smoothened agonist, such as SAG or purmorphamine, yet even more preferably wherein the sonic hedgehog activator is SHH.
[0489] - BMP4 and / or BMP7
[0490] - IGFBP3
[0491] - One or more SMAD inhibitors, preferably wherein the one or more SMAD inhibitors are selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP), even more preferably wherein the one or more SMAD inhibitors are SB413542 and Noggin.
[0492] - An activator of the WNT signalling pathway, preferably wherein the WNT signalling pathway activator is a GSK3P inhibitor, even more preferably wherein the activator of the WNT signalling pathway is CHIR99021.
[0493] - Optionally, a ROCK inhibitor, preferably wherein the ROCK inhibitor is Y-27632
[0494] - Optionally, a medium supporting the growth of neural progenitor cells. A kit-of-parts comprising:
[0495] - The population of cells according to any one of items 44 to 52
[0496] - Instructions for use The kit-of-parts according to claim 82, further comprising :
[0497] - Maturation medium comprising BMP7
[0498] - Optionally, cell culture plates suitable for supporting the culture of neural progenitor cells. An in vitro population of mature arcuate nucleus neurons, wherein
[0499] - at least 0.25%, such as at least 1%, such as at least 2%, such as at least 3%, such as at least 6% of the mature arcuate nucleus neurons are AGRP-positive; - at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 48% of the mature arcuate nucleus neurons are POMC-positive;
[0500] - at least 7.5%, such as at least 10%, such as at least 12.5% of the mature arcuate nucleus neurons are PRDM 12-positive;
[0501] - at least 5%, such as at least 7.5%, such as at least 10%, such as at least 12.5% of the mature arcuate nucleus neurons are PNOC-positive;
[0502] - at least 5%, such as at least 10%, such as at least 15%, such as at least 20%, such as at least 25% of the mature arcuate nucleus neurons are TRH- positive;
[0503] - at least 10%, such as at least 20%, such as at least 30% of the mature arcuate nucleus neurons are SST-positive;
[0504] - at least 7.5%, such as at least 10% of the mature arcuate nucleus neurons are OTP-positive;
[0505] - at least 1%, such as at least 1.5%, such as at least 2% of the mature arcuate nucleus neurons are GHRH-positive;
[0506] - at least 10%, such as at least 15%, such as at least 2%, such as at least 30%, such as at least 40% of the arcuate neurons are TH-positive; or
[0507] - at least 2%, such as at least 2.5%, such as at least 3%, such as at least 5%, such as at least 12.5% of the arcuate neurons are POMC and GPR149- positive.
Claims
Claims1 . A method for differentiating pluripotent stem cells into arcuate nucleus progenitor cells, said method comprising a cell Patterning and Expansion phase together comprising the steps of: a) culturing said pluripotent stem cells, in the presence of one or more sonic hedgehog pathway activator(s), preferably wherein the one or more sonic hedgehog pathway activator(s) is a naturally occurring sonic hedgehog pathway activator or a synthetic sonic hedgehog pathway agonist, even more preferably wherein the one or more sonic hedgehog pathway activator(s) is the Sonic hedgehog protein (SHH) and / or a Smoothened agonist such as SAG or purmorphamine; and b) culturing the cells from step a. in the presence of bone morphogenetic protein 4 (BMP4) and / or bone morphogenetic protein 7 (BMP7), and Insulin-like growth factor-binding protein 3 (IGFBP3), thereby obtaining arcuate nucleus progenitor cells.
2. The method according to claim 1 , wherein step a) further comprises: i. a step of culturing the pluripotent stem cells in the presence of one or more inhibitor(s) of the SMAD signalling pathway, said step initiating the Patterning phase, preferably wherein the one or more inhibitor(s) of the SMAD signalling pathway are selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP) pathway, even more preferably wherein the inhibitor of the transforming growth factor (TGF-P) pathway is selected from the group consisting of: SB413542, A83-01 , SB505124, LY364947, R268712 and / or wherein the inhibitor of the bone morphogenetic protein (BMP) pathway is a protein inhibitor of BMP, preferably wherein said protein inhibitor of BMP is Noggin, or a small molecule inhibitor of BMP, more preferably wherein said small molecule inhibitor of BMP is selected from the group consisting of: LDN193189 and dorsomorphin;ii. a step of culturing the pluripotent stem cells, or pluripotent stem cell-derived cells obtained thereof, in the presence of an activator of the WNT signalling pathway, preferably wherein the WNT signalling pathway activator is a glycogen synthase kinase 3p (GSK3P) inhibitor, even more preferably wherein the glycogen synthase kinase 3p inhibitor is CHIR99021 (CHIR); and / or iii. a step of culturing the pluripotent stem cells, or pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7.
3. The method according to any one of the preceding claims, wherein the arcuate nucleus progenitor cells obtained are positive for RAX, TBX3 and / or NKX2-1.
4. The method according to any one of the preceding claims, wherein: i. the step a) of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of one or more sonic hedgehog pathway activator(s) is initiated simultaneously with the initiation of the Patterning phase; ii. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of an activator of the WNT signalling pathway is initiated at the latest 2 days, such as 2 days after initiating the Patterning phase; iii. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7 is initiated at the latest 3 to 6 days, such as 3 days, such as 4 days, such as 5 days, such as 6 days after initiating the Patterning phase; iv. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7, and IGFBP3, is initiated at the latest 5 to 7 days, such as 5 days, such as 6 days, such as 7 days, after initiating the Patterning phase; v. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of oneor more sonic hedgehog pathway activator(s) and / or the step of culturing the pluripotent stem cells in the presence of one or more inhibitor(s) of the SMAD signalling pathway is performed for 3 to 9 days, for example 7 to 9 days, such as 7 days, such as 8 days, such as 9 days; vi. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of an activator of the WNT signalling pathway is performed for 1 to 12 days, for instance of 5 to 10 days, such as 5 days, such as 6 days, such as 7 days, such as 8 days, such as 9 days, such as 10 days; vii. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7 is performed for 1 to 6 days, such as for 2 days, such as for 5 days; and / or viii. the step of culturing the pluripotent stem cells, or the pluripotent stem cell-derived cells obtained thereof, in the presence of BMP4 and / or BMP7, and IGFBP3, is performed for 7 to 15 days, such as 8 days, such as 9 days, such as 10 days, such as 11 days, such as 12 days, such as 13 days, such as 14 days, such as 15 days.
5. The method according to any one of the preceding claims, wherein said method comprises the steps of: a) culturing said pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b) optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c) culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL respectively, thereby initiating the cell Patterning phase, simultaneously with step a., for 9 days;d) culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the cell patterning phase, for 7 days; e) culturing the cells of step d., in the presence of BMP4, at 50ng / mL, 5 days after initiating the cell patterning phase, and for 2 days; f) culturing the cells from step e. in the presence of BMP4 and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the cell patterning phase, for 7 days; g) culturing the cells of step f. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the cell patterning phase, for 5 days; and h) optionally culturing the cells of step g. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day, thereby obtaining arcuate nucleus progenitor cells.
6. A population of arcuate nucleus progenitor cells obtained by the method according to any one of the preceding claims.
7. A population of arcuate nucleus progenitor cells wherein said cells are positive for RAX, TBX3 and / or NKX2-1.
8. The population of arcuate nucleus progenitor cells according to any one of claims 6 and 7, wherein: i. at least 40% of the cells are RAX positive, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 74% of the cells are RAX positive; ii. at least 1 % of the cells are TBX3 positive, such as at least 5%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 34%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92% of the cells are TBX3 positive;iii. at least 20% of the cells are NKX2-1 positive, such as at least 25%, such as at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 66%, such as at least 69%, such as at least 70%, such as at least 72% of the cells are NKX2-1 positive; iv. at least 40% of the cells obtained are RAX positive, at least 1% of the cells obtained are TBX3 positive and / or at least 20% of the cells obtained are NKX2-1 positive, preferably wherein at least 57% of the cells obtained are RAX positive, at least 34% are TBX3 positive and / or at least 66% are NKX2-1 positive; and / or v. at least 10%, such as at least 18%, such as at least 19%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 45%, such as at least 46%, such as at least 47%, such as at least 48%, such as at least 49%, such as at least 50% of the cells are positive for RAX, TBX3, and NKX2-1.
9. A method for differentiating arcuate nucleus progenitor cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a maturation phase comprising the step of: i. culturing said arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes.
10. A method for differentiating pluripotent stem cells to mature arcuate nucleus neurons and / or tanycytes, said method comprising a cell Patterning and Expansion phase comprising the steps of any one of claims 1 to 5, and further comprising a maturation phase comprising the step of: i. culturing the obtained arcuate nucleus progenitor cells in the presence of BMP7; thereby obtaining mature arcuate nucleus neurons and / or tanycytes.
11. The method according to any one of claims 1 to 5 and 9 to 10, wherein:i. the step i. of culturing the arcuate nucleus progenitor cells in the presence of BMP7 is initiated at the latest 30 days, such as 16 days, such as 17 days, such as 18 days, such as 19 days, such as 20 days, such as 21 days, such as 22 days, such as 23 days, such as 24 days, such as 25 days, such as 26 days, such as 27 days, such as 28 days, such as 29 days after initiating the patterning phase; and / or ii. the step i. of culturing the arcuate nucleus progenitor cells in the presence of BMP7 is performed for in the range of 5 to 50 days, such as for in the range of 10 to 40 days, such as for in the range of 20 to 30 days, for instance for at the most 25 days, such as for 25 days, such as for at the most 20 days, such as for at the most 10 days.
12. The method according to any one of claims 1 to 5 and 9 to 11 , further comprising a step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 in the cells, and wherein the cells express one or more markers selected from the group consisting of: AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and DIO2.
13. The method according to any one of claims 1 to 5 and 9 to 12, wherein- the step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 is performed at least 14 days, preferably 14 to 54 days, even more preferably 34 days, after initiating the step i. of culturing said arcuate nucleus progenitor cells in the presence of BMP7; or,- wherein the step of determining the expression of the markers AGRP, GHRH, TRH, TH, OTP, SST, PNOC, PRDM12, POMC and / or DIO2 is performed in the range of 30 to 200 days, such as in the range of 50 to 100 days, such as in the range of 50 to 70 days, such as 50 days, after initiating the Patterning phase.
14. The method according to any one of claims 1 to 5 and 9 to 13, wherein:- at least 0.25%, such as at least 1%, such as at least 2%, such as at least 3%, such as at least 6% of the mature arcuate nucleus neurons are AGRP-positive;- at least 30%, such as at least 35%, such as at least 40%, such as at least 45%, such as at least 48% of the mature arcuate nucleus neurons are POMC-positive;- at least 7.5%, such as at least 10%, such as at least 12.5% of the mature arcuate nucleus neurons are PRDM 12-positive;- at least 5%, such as at least 7.5%, such as at least 10%, such as at least 12.5% of the mature arcuate nucleus neurons are PNOC-positive;- at least 5%, such as at least 10%, such as at least 15%, such as at least 20%, such as at least 25% of the mature arcuate nucleus neurons are TRH- positive;- at least 10%, such as at least 20%, such as at least 30% of the mature arcuate nucleus neurons are SST-positive;- at least 7.5%, such as at least 10% of the mature arcuate nucleus neurons are OTP-positive;- at least 1%, such as at least 1.5%, such as at least 2% of the mature arcuate nucleus neurons are GHRH-positive;- at least 10%, such as at least 15%, such as at least 2%, such as at least 30%, such as at least 40% of the arcuate neurons are TH-positive; and / or- at least 2%, such as at least 2.5%, such as at least 3%, such as at least 5%, such as at least 12.5% of the arcuate neurons are POMC and GPR149- positive.
15. The method according to any one of claims 10 to 14, wherein the mature arcuate nucleus neurons are human POMC-expressing neurons, and wherein said method comprises a cell Patterning and Expansion phase comprising the steps of: a) culturing pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b) optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day;c) culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and 100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d) culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e) culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f) culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 1 to 4 days, such as 2 days, such as 3 days; g) culturing the cells from step f. in the presence of IGFBP3 at 400ng / mL, until 14 days after initiating the Patterning phase; h) culturing the cells of step g. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and i) optionally culturing the cells of step h. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day.
16. The method according to any one of claims 10 to 14, wherein the mature arcuate nucleus neurons and / or tanycytes are human AGRP-expressing neurons and / or tanycytes, and wherein said method comprises a cell Patterning and Expansion phase comprising the steps of: a) culturing pluripotent stem cells in the presence of the sonic hedgehog pathway activator SHH, at 300ng / mL, for 9 days; b) optionally, culturing said pluripotent stem cells in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step a., for 1 day; c) culturing said pluripotent stem cells in the presence of the inhibitors of the SMAD signalling pathway SB413542 and Noggin at 10pM and100ng / mL, respectively, thereby initiating the Patterning phase, simultaneously with step a., for 9 days; d) culturing the cells of step c. in the presence of the activator of the WNT signalling pathway CHIR99021, at 0.3pM, 2 days after initiating the Patterning phase, for 7 days; e) culturing the cells of step d., in the presence of BMP4 and / or BMP7, at 50ng / mL, 5 days after initiating the Patterning phase, for 2 days; f) culturing the cells from step e. in the presence of BMP4 and / or BMP7, and IGFBP3, at 50ng / mL and 400ng / mL, respectively, 7 days after initiating the Patterning phase, for 7 days; g) culturing the cells of step f. in the presence of Brain-derived neurotrophic factor (BDNF) and ascorbic acid, at 20pg / mL and 0.2mM, respectively, thereby initiating the cell expansion phase, 11 days after initiating the Patterning phase, for 5 days; and h) optionally culturing the cells of step g. in the presence of a ROCK inhibitor, preferably wherein said ROCK inhibitor is Y-27632, simultaneously with the initiation of step g., for 1 day.
17. A kit-of-parts comprising:- one or more sonic hedgehog pathway activator(s), preferably wherein the one or more sonic hedgehog pathway activator(s) is selected from the group consisting of a naturally occurring sonic hedgehog pathway activator and a synthetic sonic hedgehog pathway agonist, even more preferably wherein the one or more sonic hedgehog pathway activator(s) is SHH or a Smoothened agonist, such as SAG or purmorphamine, yet even more preferably wherein the one or more sonic hedgehog activator is SHH;- BMP4 and / or BMP7;- IGFBP3;- one or more SMAD inhibitor(s), preferably wherein the one or more SMAD inhibitor(s) are selected from the group consisting of: an inhibitor of the transforming growth factor (TGF-P) pathway, and an inhibitor of the bone morphogenetic protein (BMP), even more preferably wherein the one or more SMAD inhibitor(s) are SB413542 and Noggin;- an activator of the WNT signalling pathway, preferably wherein the WNT signalling pathway activator is a GSK3P inhibitor, even more preferably wherein the activator of the WNT signalling pathway is CHIR99021 ;- optionally, a ROCK inhibitor, preferably wherein the ROCK inhibitor is Y- 27632; and,- optionally, a medium supporting the growth of neural progenitor cells.
Citation Information
Patent Citations
Differentiation induction from human pluripotent stem cells into hypothalamic neurons
EP3406709A1