FUS aptamers and uses thereof

Abstract

The invention concerns single-stranded RNA aptamers and uses thereof. Pharmaceutical compositions comprising such aptamers and uses thereof in the medical field, particularly in the treatment of neurodegenerative diseases, are also described.

Description

[0001] FUS APTAMERS AND USES THEREOF

[0002] ★ ★★★★ ★★★★★ ★★★★★

[0003] DESCRIPTION

[0004] FIELD OF THE INVENTION

[0005] The invention concerns single-stranded RNA aptamers and uses thereof. Pharmaceutical compositions comprising such aptamers and uses thereof in the medical field, particularly in the treatment of neurodegenerative diseases, are also described.

[0006] STATE OF THE ART

[0007] FUsed in Sarcoma (FUS), also known as Translocated in LipoSarcoma (TLS), is a multifunctional DNA- and RNA-binding protein primarily associated with RNA processing and regulation, including transcription, splicing, and transport. Mutations or dysregulation of FUS have been linked to several neurological disorders, particularly neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). In these diseases, the physiological functions of FUS are impaired by the accumulation of this protein in toxic aggregates, which go from a liquid to a solid state. This aggregation, or liquid-to- solid phase transition (LSPT), is thought to significantly contribute to disease pathogenesis.

[0008] The molecular mechanism underlying FUS aggregation and its correlation with disease development are the subject matter of ongoing research: factors such as genetic mutations, alteration of protein quality control mechanisms, and RNA metabolism disruption are thought to play a crucial role.

[0009] The complexity of developing molecules capable of targeting the multi-structural diversity of FUS has represented a significant challenge. The FUS protein, in fact, is made of several distinct domains, including a low complexity domain responsible for aggregation behavior, an RNA recognition motif (RRM), a zinc finger domain, and RGG-rich regions. These features contribute to the diverse functions of FUS, including interaction with RNA, but also make it a difficult target for conventional therapeutic approaches.

[0010] The use of RNA aptamers targeting the FUsed in Sarcoma (FUS) protein represents a significant advance in the field of neurodegeneration and molecular medicine.

[0011] The purpose of the present invention is to develop and provide anti-aggregation therapies for FUS-associated neurodegenerative diseases, including ALS and FTLD, by targeting the pathological aggregation of FUS and stabilizing its soluble conformation.

[0012] SUMMARY OF THE INVENTION

[0013] For the purpose of the present invention, the inventors have focused on the development of molecules called “aptamers” - short single-stranded RNA or DNA oligonucleotides that fold into a specific three-dimensional structure (stem-loop) and bind to a target molecule with high specificity. Aptamers offer several advantages over other classes of drugs in terms of tissue penetration, chemical stability, and solubility properties. Their nature (DNA or RNA) makes them non-immunogenic, chemically versatile, and synthetically accessible.

[0014] The present invention therefore focuses on the development of isolated singlestranded RNA aptamers targeting the FUS protein with high precision, on the base of the structural aspects of the protein as well as its specific RNA-binding properties. In a first aspect, the present invention concerns an isolated single-stranded RNA aptamer, which comprises a nucleotide sequence having affinity for FUsed in Sarcoma (FUS) protein, said nucleotide sequence having a stem-loop structure and a GGU triplet in a single-stranded free tail downstream of said stem-loop structure. In a second aspect, the invention concerns the use as a medicament of the isolated single-stranded RNA aptamer as described herein.

[0015] In a third aspect, the use of the isolated single-stranded RNA aptamer according to the invention in the treatment of a neurodegenerative disease, preferably a muscle neurodegenerative disease, is described.

[0016] In a fourth aspect, a pharmaceutical composition comprising an isolated singlestranded RNA aptamer according to the present invention, and pharmaceutically acceptable excipients is described herein.

[0017] In a fifth aspect, the invention concerns the use of the pharmaceutical composition comprising the isolated single-stranded RNA aptamer as a medicament.

[0018] In a sixth aspect, the use of the pharmaceutical composition comprising the isolated single-stranded RNA aptamer in the treatment of a neurodegenerative disease is described. Preferably, said neurodegenerative disease is a muscle neurodegenerative disease.

[0019] Technical advantages of the aptamers according to the present invention include easy and scalable in vitro synthesis, high binding affinity and selectivity towards FUS, and the ability to prevent FUS aggregation. This technology may serve as a basis for the development of RNA-based therapies for neurodegenerative diseases associated with FUS proteinopathies.

[0020] The aptamers described in this invention may be used to treat neurodegenerative diseases such as ALS. These diseases are associated with the abnormal accumulation of FUS. Aptamers can specifically recognize and bind to FUS, helping to prevent or reduce the damage caused by these toxic deposits.

[0021] By optimizing their formulation and delivery strategy, these aptamers could be exploited as RNA-based therapeutics. Their ability to specifically recognize and bind to the target protein FUS could stabilize the physiological structure thereof. This stabilization would be decisive in preventing the conversion of FUS into misfolded forms, ultimately preventing the formation of insoluble deposits. This innovative therapeutic approach offers a promising route to fight these devastating diseases at the molecular level.

[0022] The dependent claims describe specific embodiments of the invention.

[0023] DESCRIPTION OF THE FIGURES

[0024] The invention will now be described in detail and with reference to the attached Figures.

[0025] Figure 1 : Aptamers generation. A) Check of reproducibility of FUS binding sites through different PAR-CLIP and eCLIP experiments. B) Selection of aptamers based on their structural features.

[0026] Figure 2: The aptamer PSD-95 GQ2 demonstrates binding affinity to FUS269-454 with a Kd of 0.22 uM, while Apt_3 (SEQ ID NO: 1 ) shows a tighter binding affinity with a Kd of 0.023 uM.

[0027] Figure 3: Applying the 2'-Fluoro (2'F) modification to the nucleotides guanine (G), cytosine (C) and uracil (U) keeps Apt_2 within a similar affinity range as the unmodified one, with a Kd of 0.19.

[0028] Figure 4: Aggregation kinetics of FUS269-454 in the absence and presence of selected RNA aptamers. Light gray: FUS:aptamer=1 :0; medium gray: FUS:aptamer=1 :0.5; dark gray: FUS:aptamer=1 :1 ; very dark gray: FUS:aptamer=1 :2. A) FUS with Apt_1 (SEQ ID NO: 3); B) FUS with Apt_2 (SEQ ID NO: 2); C) FUS with Apt_3 (SEQ ID NO: 1 ); D) FUS with Neg_1 (SEQ ID NO: 8). Figure 5: Determination of the effect of selected aptamers on FUS solubility. A) Quantification of the protein remaining in solution after the aggregation assay, in the absence or presence of selected aptamers at different proteimRNA molar ratios. B) SDS-PAGE stained with Prouty to show the amount of soluble protein at the end of the aggregation assay, in the absence or presence of different proteimRNA molar ratios. From left to right in A) and B): FUS269-454 without RNA. FUS269-454 with Apt_1 (SEQ ID NO: 3); FUS269-454 with Apt_2 (SEQ ID NO: 2); FUS269-454 with Apt_3 (SEQ ID NO: 1 ); FUS269-454 with Neg_1 (SEQ ID NO: 8). Darker shades indicate higher RNA concentrations.

[0029] Figure 6: Reduction of FUS aggregation in cells by aptamers. A) Immunostaining performed with anti-FUS antibody for soluble and insoluble proteins extracted from cells transfected with 1 pg / ml of FUS-eGFP plasmid alone or co-transfected with 0.5, 1 or 2 pg / ml of Apt_3 aptamer (SEQ ID NO: 1 ). The visible bands refer to endogenous FUS or FUS-eGFP. Lower bands show the housekeeping protein actin, used as an internal standard. B-C) Quantification of band intensity in each condition tested. The data reported are normalized using the intensity of actin bands in the same sample and are represented as a ratio of insoluble / soluble protein. B) Analysis performed on FUS-eGFP bands; C) Analysis performed on endogenous FUS bands.

[0030] Figure 7: Importance of aptamer design to optimize FUS protein binding and maximize the anti-aggregation effect thereof. A) Minimum free energy (MFE) secondary structures of aptamers Apt_1 , Apt_1 -Rearranged, Apt_X and Apt_X_Rearranged which highlight how variations in their configuration influence the binding affinity to FUS. B) Analysis of the FUS269-454 protein aggregation kinetics, both in the absence of aptamers (indicated by black circles) and in the presence of Apt_X_Rearranged at different molar ratios. Different experimental conditions are represented with shades of gray: dark gray indicates a FUS269- 454:Apt_X_Rearranged molar ratio of 1 :0.5, light gray corresponds to a ratio of 1 :1 , while white represents the condition with a ratio of 1 :2.

[0031] DETAILED DESCRIPTION OF THE INVENTION

[0032] The invention presented herein is focused around the development and application of single-stranded RNA aptamers specifically designed to bind to FUS protein.

[0033] In the present invention, when the term “FUsed in Sarcoma protein” or “FUS” is used, it is intended to comprise a DNA- or RNA-binding protein, of 526 amino acids, also identified with the name “heterogeneous nuclear ribonucleoprotein P2”. “FUS269-454” is intended to comprise the fragment spanning from amino acid 269 to amino acid 454 of FUS protein.

[0034] In a first aspect, the present invention concerns an isolated single-stranded RNA aptamer, which comprises a nucleotide sequence having affinity for FUsed in Sarcoma (FUS) protein, said nucleotide sequence having a stem-loop structure and a GGU triplet in a free single-stranded tail downstream of said stem-loop structure. In particular, “GGU triplet in a free single-stranded tail” is intended to comprise a free terminal single-stranded sequence downstream of the stem-loop structure, which includes a triplet having the GGU sequence.

[0035] FUS is a multifunctional DNA / RNA binding protein and it is associated with crucial roles in RNA processing and regulation, including transcription, splicing, and transport. FUS protein mutations or dysregulations have been linked to various neurological disorders including, in particular, amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), and other related diseases.

[0036] Surprisingly, the isolated single-stranded RNA aptamer according to the invention, has a nucleotide sequence with a length in the range of 15 to 50 nucleotides, preferably in the range of 21 to 41 , wherein said aptamer binds to said FUS protein at amino acids 280-377 and amino acids 418-451 .

[0037] Aptamers are short, single-stranded RNA or DNA oligonucleotides that can fold into specific three-dimensional structures and bind to target molecules with high selectivity. These aptamers, designed to interact with the FUS protein, exhibit an unprecedented binding affinity. The small size of the selected aptamers of the present invention have extraordinary chemical properties, and their non- immunogenic nature make them extremely advantageous for therapeutic applications.

[0038] The RNA aptamer of the invention has a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, preferably said aptamer has the sequence shown in SEQ ID NO: 1 .

[0039] The RNA aptamers described in the present invention exhibit several technical features that make them effective for binding to FUS protein.

[0040] The inventors designed the aptamer to bind to segments of the protein spanning amino acids 280 to 377 and amino acids 418 to 451 . These segments are part of a larger region of the FUS protein, identified by numbers 269 to 454 and referred to as FUS269-454 in the invention.

[0041] The RNA aptamers described herein are targeted to these specific FUS regions and have shown an unprecedented binding affinity, with Kd values in the range of about 25 nM to about 1.5 pM. The aptamers were tested in vitro and, as shown in the example data, have the ability to slow down or abrogate FUS aggregation.

[0042] The sequences of RNA aptamers described herein can be modified through chemical modifications such as 2'-Fluoro (2'F) and 2'OMe modifications.

[0043] In a second aspect, the invention concerns the use as a medicament of the isolated single-stranded RNA aptamer as described herein.

[0044] RNA aptamers according to the present invention have been rigorously validated both in vitro and in mammalian cells. They demonstrate the ability to abrogate FUS aggregation, stabilize its soluble conformations, and reduce the FUS insoluble fraction in cellular environments. This invention has the potential to open the door to several applications, including targeted therapy, biomarker detection, and research methodologies, that could significantly benefit patients suffering from neurodegenerative diseases caused by FUS, such as ALS and FTLD.

[0045] The aptamers described herein offer several advantages over traditional drug classes, including high specificity, reduced immunogenicity, and the ability to target a broad range of molecules, including proteins. These attributes make aptamers a viable option for precision medicine and targeted therapies. In a third aspect, the use of the isolated single-stranded RNA aptamer according to the invention in the treatment of a neurodegenerative disease, preferably a muscle neurodegenerative disease, is described.

[0046] In a preferred form, the use of the single-stranded RNA aptamer in the treatment of a neurodegenerative disease, wherein said neurodegenerative disease is characterized by pathological protein aggregates of FUS protein, is described.

[0047] The main challenge addressed by the present invention is pathological FUS protein aggregation, which significantly contributes to the development of neurodegenerative diseases. FUS aggregation involves the transition from a liquid state into a solid form, which impacts its functional role in RNA processing. Previous efforts to prevent or dissolve FUS protein aggregates and restore normal cellular functions have encountered complexity due to FUS structural diversity.

[0048] Indeed, aptamers described herein were evaluated in mammalian cells and were found to reduce the insoluble fraction of FUS protein, providing a potential therapeutic approach for neurodegenerative diseases associated with FUS aggregation.

[0049] In particular, the RNA aptamer was surprisingly found to have an unexpected activity in the treatment of several neurodegenerative diseases, including Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Lobar Degeneration (FTLD).

[0050] In a fourth aspect, a pharmaceutical composition comprising an isolated singlestranded RNA aptamer according to the present invention and pharmaceutically acceptable excipients, is described herein.

[0051] Advantageously, the single-stranded RNA aptamer of the invention is provided in the form of a pharmaceutical composition comprising, in addition to the active ingredient, one or more pharmaceutically acceptable excipients, vehicles or diluents, whose selection and use are within the capabilities of the person skilled in the art.

[0052] The pharmaceutical composition can be optimized by modulating its formulation and the release strategy of aptamers, which could be exploited as RNA-based drugs.

[0053] In an advantageous aspect, the composition can be in a liquid, solid or semi-solid form suitable for administration by oral, systemic or inhalation routes.

[0054] In a fifth aspect, the invention concerns the use as a medicament of the pharmaceutical composition comprising the isolated single-stranded RNA aptamer. In a sixth aspect, the use of the pharmaceutical composition comprising the isolated single-stranded RNA aptamer in the treatment of a neurodegenerative disease is described. Preferably said neurodegenerative disease is a muscular neurodegenerative disease.

[0055] In a preferred form, the use of the pharmaceutical composition according to the invention in the treatment of a neurodegenerative disease, wherein said neurodegenerative disease is characterized by pathological protein aggregates of the FUS protein is described.

[0056] In particular, it has been surprisingly found that the pharmaceutical composition has an unexpected activity in the treatment of several neurodegenerative diseases, including Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Lobar Degeneration (FTLD).

[0057] A method for the treatment of a neurodegenerative disease, comprising the step of administering a therapeutically effective dose of an isolated single-stranded RNA aptamer according to the present invention to a patient with a neurodegenerative disease, is also described.

[0058] For the purposes of the present invention, the single-stranded RNA aptamers are represented in the attached sequence listing, where the uracil “u” base is represented as a thymine “t”, in line with the requirements of the WIPO standard ST26 Annex 1 .

[0059] Table 1 reports the sequences of the single-stranded RNA aptamers:

[0060]

[0061] RNA aptamers described in the present invention are not only effective but also convenient to produce. They can be easily synthesized in vitro, making them accessible for various laboratory applications. Furthermore, their scalability enables large-scale production, which is advantageous for experiments requiring large amounts of aptamers. The ease of synthesis and scalability enhance practicality and versatility of these aptamers.

[0062] In addition, the RNA aptamers were designed to have a remarkable combination of high binding affinity and selectivity toward the FUS protein, particularly FUS269- 454. Their strong affinity ensures robust binding interactions, while their selectivity ensures target specificity. This unique combination is critical to accurately study FUS-related processes and diseases and provides the basis for potential therapeutic applications.

[0063] One of the most promising technical features of the present invention is the ability of the single-stranded RNA aptamers described herein to abrogate FUS aggregation, as demonstrated in both test tube and mammalian cell experiments. This ability has profound implications for the prevention and therapeutic treatment of FUS proteinopathies. By preventing or reducing FUS aggregation, these aptamers open the door to novel therapeutic interventions, potentially able to attenuate the detrimental effects associated with FUS protein misfolding and aggregation.

[0064] In summary, the RNA aptamers developed in this invention offer a comprehensive set of technical advantages: easy in vitro synthesis, high binding affinity and selectivity toward FUS protein, and remarkable ability to counteract FUS aggregation. These features collectively position these aptamers as valuable tools for research into FUS-related processes and open the door to novel therapeutic strategies to address FUS proteinopathies.

[0065] The following are Examples of embodiments of single-stranded RNA aptamers of the present invention provided for illustrative purposes.

[0066] EXAMPLES

[0067] Example 1 : Aptamer Generation

[0068] The identified aptamers were selected based on the following criteria:

[0069] - hairpin score;

[0070] - presence of the GGU triplet in a free single-stranded tail downstream of the stemloop; and

[0071] - ability to interact with FUS protein at amino acids 269-454 (FUS269-454), a portion of FUS protein known to be involved in interactions with RNA and essential for studying the specificity of FUS binding.

[0072] In particular, regions characterized by a hairpin followed by a linear segment containing at least one GGU motif were taken into consideration. This approach allowed us to introduce the binding specificity to FUS in the selection of RNA aptamers (Figure 1 ).

[0073] Table 2. List of preferred aptamer sequences, predicted interaction strength, and affinity experimental validation.

[0074] Predicted interaction propensities between the RNA aptamers in Table 2 and FUS were calculated, and the predicted interaction propensities (propensity to interact) were validated by comparing them with experimentally measured Kd (dissociation constant) values.

[0075] Negative controls, including unstructured RNAs lacking GGU triplets and predicted to have negative interaction values with FUS protein (Neg_1 and Neg_2), were used to confirm specific binding.

[0076] Experimental validation of the selected aptamers was performed using Bio-layer interferometry (BLI) to measure Kd values.

[0077] As reported in Table 2, the experimentally determined Kd values ranged from about 25 nM to 1.5 pM for aptamers predicted to bind FUS, demonstrating their strong binding affinity. The introduction of the 2'F modification to the aptamers maintains the interaction with FUS within a similar affinity range as unmodified aptamers (Figure 3).

[0078] Furthermore, the aptamer Apt_3 (SEQ ID NO: 1 ) surprisingly displays a Kd of about 25 nM. Therefore, Kd values of aptamers described herein compete with the best affinities identified in the literature for the whole FUS protein, indicating their strong binding affinity.

[0079] Example 2: Effect of RNA aptamers on the slowing down of FUS269-454 aggregation kinetics

[0080] In this experiment, the ability of aptamers to influence FUS protein aggregation behavior was evaluated in a controlled in vitro environment. The aggregation protocol was optimized to understand the aggregation kinetics. When FUS protein was co-incubated with the three RNA aptamers that showed the lowest Kd (strongest binding) and a negative control Neg_1 , a significant impact on the aggregation kinetics was observed. In contrast to the negative control, which had no effect, the RNA aptamers showed varying degrees of efficacy. Apt_1 (SEQ ID NO: 3), with a Kd of 150 nM, substantially prolonged the lag phase and slowed the exponential phase of aggregation when used in excess (protein:RNA=1 :2). Apt_2 (SEQ ID NO: 2), with a Kd=140 nM showed similar effects at lower ratios (protein:RNA=1 :0.5) and completely stopped aggregation at a 1 :1 ratio. Apt_3 (SEQ ID NO: 1 ), with a Kd=25 nM, effectively prevented aggregation at all concentrations tested. This experiment demonstrates the potential of aptamers to influence FUS aggregation dynamics (Figure 4).

[0081] Example 3: Effect of RNA aptamers on reducing the amount of insoluble FUS

[0082] The impact of RNA aptamers on the solubility of FUS269-454 was studied in an aggregation assay. The amount of soluble FUS, with respect to the protein precipitating as an insoluble aggregate, was determined. The results were evaluated quantitatively and qualitatively. When FUS269-454 was allowed to aggregate alone up to the plateau, only about 5% remained soluble. However, the presence of aptamers had a profound impact. Apt_1 (SEQ ID NO: 3) (protein:RNA=1 :2) resulted in 84% recovery of soluble FUS269-454. Apt_2 (SEQ ID NO: 2) (protein:RNA=1 :0.5) increased solubility from 5% to 55%, reaching 100% solubility at a 1 :2 ratio. Apt_3 (SEQ ID NO: 1 ) allowed 98-100% recovery of all proteins from the soluble fraction at all ratios tested. In contrast, the negative control aptamer achieved only 1 ,5%-5% protein recovery, even at higher RNA concentrations. This demonstrates the ability of aptamers to maintain FUS solubility, as a function of their binding affinity (Figure 5).

[0083] Example 4: Effect of RNA aptamers in reducing insoluble FUS protein in mammalian cells

[0084] To validate the potential of aptamers in a more complex biological system, HEK 293T cells were used to assess their impact on the reduction of insoluble FUS protein. FUS aggregation was induced in these cells, and the extent of aggregation in the presence of aptamers was compared with respect to a negative control. Examining both endogenous FUS and FUS-eGFP fusion protein, the aptamer Apt_3 (SEQ ID NO: 1 ), used at appropriate concentrations, significantly reduced the insoluble FUS-eGFP portion by about 41 % and insoluble endogenous FUS by about 48%. In contrast, the negative control aptamer did not produce the same effect. This experiment highlights the potential of aptamers to reduce insoluble FUS protein in a cellular context, thus demonstrating their suitability for therapeutic applications (Figure 6).

[0085] These examples collectively provide compelling evidence for the efficacy of aptamers in influencing FUS protein aggregation kinetics and enhancing protein solubility, both in controlled in vitro environments and in mammalian cells. These data underscore the potential utility of aptamers of the present invention in addressing FUS-dependent proteinopathies.

[0086] Example 5: The importance of aptamer design to ensure stronger FUS binding and maximal anti-aggregation effect

[0087] Comparison data between sequences with the same nucleotide composition, but different positioning thereof (rearranged versions) are reported to highlight how the sequence design of aptamers directed against FUS is fundamental to obtain the optimal effect, and avoid FUS aggregation.

[0088] Apt_1 and Apt_1 Rearranged have an identical nucleotide composition, but different final sequence.

[0089] Apt_1 : GUCUGGGGGGCGGGUGUGGUA (SEQ ID NO: 3)

[0090] Apt_1 -Rearranged: AUGUGGGGUUGGGGGGCUGCG (SEQ ID NO: 69)

[0091] Apt_1 having affinity for FUsed in Sarcoma (FUS) protein, a stem-loop structure, and a GGU triplet in a free single-stranded tail downstream of said stem-loop structure as defined in the present invention, surprisingly has a perfect hairpin score (Figure 7 A) and shows a Kd against FUS269-454 of 150 nM (Figure 7B).

[0092] Its counterpart Apt_1 Rearranged, which shares the nucleotide composition of Apt_1 , but lacks a stem-loop structure and a GGU triplet in a free single-stranded tail downstream of said stem-loop structure as specified in the present invention (Figure 7 A), shows a Kd against FUS269-454 of 300 nM (Figure 7B), an interaction with the protein target two-fold worse than that of Apt_1 .

[0093] The same was also found for the sequence of Apt_X and Apt_X Rearranged. Apt_X:

[0094] GCGGGCUGGGGGCGCCCGCCGUGGUGGACGGGCUCGGCGGGC (SEQ ID NO: 70)

[0095] Apt_X Rearranged: UUCGCCGGGGGCCCCGGCCCGUGGGGGGGCCGGAUGGGGGCG (SEQ ID NO: 71 )

[0096] In the case of Apt_X, the GGU triplet is involved in the double helix and not available for the interaction with FUS269-454 (Figure 7A). Consequently, the binding to the protein is weak and therefore compromised (Kd = 10 pM).

[0097] Conversely, Apt_X Rearranged, shows the GGU triplet in a single-chain loop (Figure 7A), improving the binding strength by 10-fold (Kd = 1.1 pM).

[0098] Since neither of the two cases (Apt_X and Apt_X Rearranged) has the GGU triplet located downstream of the stem-loop in a single strand, in contrast to what happens for Apt_1 having a stem-loop structure and a GGU triplet in a free single-stranded tail downstream of said stem-loop structure as defined in the present invention, their ability to recognize and bind FUS protein is limited.

[0099] Furthermore, the FUS aggregation assay performed in the presence of increasing concentrations of AptX_Rearranged shows what happens when the stem-loop is missing or when the GGU triplet is not available in a free single-stranded tail downstream of the stem-loop (Figure 7B). Only excess molar ratios of AptX_Rearranged affect the anomalous self-assembly of FUS269-454, thus demonstrating that a limited interaction capacity translates into a reduced potential therapeutic effect.

[0100] These data highlight how the design of aptamers directly influences their efficacy in preventing target protein aggregation, with significant implications for the development of targeted therapeutic strategies.

[0101] Materials and methods

[0102] Quantification of aptamer binding constants (Table 2, Figure 2, Figure 3)

[0103] Bio-layer interferometry experiments were acquired by an Octet Red instrument (ForteBio, Inc., Menlo Park, CA) operating at 25 °C. Binding assays were performed in 20 mM potassium phosphate buffer (pH 7.2) with 150 mM KCI and 0.05% Tween20. Streptavidin-coated biosensors were loaded with 1.5 pg / ml of 3'-end biotin-modified RNA aptamer and exposed to increasing protein concentrations, ranging from 10 nM to 10 pM, based on the binding strength. Kd values were estimated by fitting the response intensity (wavelength shift upon binding) as a function of protein concentration, at steady state. The assay was repeated at least 3 times, each time in triplicate. The reported binding curves are examples of the result from one experiment.

[0104] Protein aggregation assays (Figure 4)

[0105] Samples of purified RRM-RGG-ZnFc (FUS269-454) stored at -80 °C were rapidly thawed and diluted to 15 pM in high salt buffer (10 mM potassium phosphate buffer pH 7.2, 150 mM KCI). Protein aggregation was performed at 37 °C under constant shaking using a double orbital at 200 rpm, in the absence and in the presence of different concentrations of aptamers, obtaining proteimRNA ratios of 1 :0.5, 1 :1 , and 1 :2. Samples were distributed in 3 replicates on a black 96-well plate with a clear bottom, and a single borosilicate glass bead was added to each well to ensure sample homogeneity and reproducibility. The aggregation kinetics of FUS protein was followed by a fluorescent aggregate intercalator (Proteostat Aggresome detection kit, ENZO Life Sciences). The plate was incubated at 37 °C under constant double orbital shaking at 180 rpm for 24 h using a TECAN Fluorescence microplate reader. The excitation wavelength was set to 505 nm, and the emission wavelength was set to 590 nm. Readings were taken every 15 minutes. The aggregation assay was processed and plotted using Tecan Magellan Data Analysis software, and the statistical analysis was performed with Microsoft Excel 16.8.

[0106] Protein quantification (Figure 5)

[0107] After aggregation, individual replicates were transferred from the 96-well plate to 1 .5 mL Eppendorf tubes, and centrifuged at 4°C, 17,000 x g for 30 min. The soluble fraction was transferred to another tube, and the amount of FUS269-454 remaining in solution was determined by both a Bradford protein quantification assay and gel visualization.

[0108] The Bradford protein quantification assay was performed according to the manufacturer's instructions (Sigma Aldrich, Italy). Samples were incubated in cuvettes at room temperature for 5 minutes, and absorbance was measured at 595 nm with a spectrophotometer.

[0109] Protein gel visualization was performed by electrophoresis of samples in 4-12% SDS-PAGE (Invitrogen, USA) and subsequent visualization with SYPRO Ruby staining.

[0110] Western Blot (Figure 6)

[0111] Human embryonic kidney (HEK) 293T cells were cultured in Dulbecco's modified eagle medium (DMEM) supplemented with L-glutamine, and maintained at 37 °C with 5% CO2. For microscopy studies, cells were plated on 24-well plates containing coverslips pretreated with poly-L-lysine. After 24 hours, or when confluence was about 65%, cells were co-transfected with 1 pg / ml of plasmid DNA for FUS overexpression, and different concentrations of RNA aptamer (0.5, 1 , and 2 pg / ml) using the transfection agent Lipofectamine 3000, according to published protocol (Invitrogen). The wild-type FUS gene was cloned downstream of the eGFP gene in a mammalian transfection vector pEGFP C1 ; Apt_3 (SEQ ID NO: 1 ) was purchased with the fluorophore Atto590 at the 3' end. 48 hours after transfection, cells were washed with phosphate-buffered saline (PBS) and lysed in RIPA buffer (10 mM Tris- HCI pH 8.0, 150 mM NaCI, 1 % Triton, 0.1% SDS, 0.1 % NaDeoxycholate, 1 mM EDTA, 1 mM DTT with the addition of protease inhibitors) on ice for 30 minutes. Proteins were quantified using Bradford reagent (Sigma Aldrich, Italy). Samples were separated by electrophoresis on 4-12% SDS-PAGE (Invitrogen, USA) and transferred onto a nitrocellulose membrane (BioRad, USA) by dry blotting for 10 min, 1 .3 A, up to 25 V. Membranes were saturated for 1 h with TBS containing 0.05% Tween-20 and 10% BSA and incubated overnight with mouse monoclonal anti-FUS antibody (1 :500, ~ 23 kDa; Santa Cruz Biotechnology, USA).

[0112] After several washes with TBS-Tween, the membranes were incubated for 1 h with the appropriate secondary antibody conjugated with horseradish peroxidase (HRP) (1 :10000; Thermo Fisher Scientific, USA). The Clarity Western ECL substrate (BioRad) and the ChemiDoc Imager detected the HRP-conjugated secondary antibody. The density of the protein bands was normalized using actin as a housekeeping protein, and then with the control (loading control) using Image J software. Statistical analysis was performed with Microsoft Excel 16.8.

[0113] From the detailed description and the Examples reported above, the advantages achieved by the single-stranded RNA aptamers of the present invention are apparent. Easily and rapidly synthesized in vitro, even on a large scale, the RNA aptamers described in the present invention are not only effective but also practical to produce and easily synthesized in vitro, making them accessible for various laboratory applications. Furthermore, their scalability allows for large-scale production, which is advantageous for experiments requiring large amounts of aptamers.

Claims

CLAIMS1. An isolated single-stranded RNA aptamer comprising a nucleotide sequence having affinity for FUsed in Sarcoma (FUS) protein, said nucleotide sequence having a stem-loop structure and a GGU triplet in a free single-stranded tail downstream of said stem-loop structure.

2. The isolated single-stranded RNA aptamer according to claim 1 , wherein said nucleotide sequence has a length in the range of 15 to 50 nucleotides, preferably in the range of 21 to 41 , wherein said aptamer binds to said FUS protein at amino acids 280-377 and amino acids 418-451 .

3. The isolated single-stranded RNA aptamer according to any one of claims 1 or 2, wherein said sequence is selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

4. The isolated single-stranded RNA aptamer according to any one of claims 1 to 3, wherein said sequence is SEQ ID NO: 1 .

5. The isolated single-stranded RNA aptamer according to any one of claims 1 to 4, wherein said aptamer binds said FUS protein with a binding affinity with Kd values in the range of 25 mM to 1 .5 pM.

6. The isolated single-stranded RNA aptamer according to any one of claims 1 to 5, wherein in said nucleotide sequence chemical modifications selected from the group consisting of 2’-Fluoro (2'F) and 2'OMe are present.

7. An isolated single-stranded RNA aptamer according to any one of claims 1 to 6, for use as a medicament.

8. An isolated single-stranded RNA aptamer according to any one of claims 1 to 6, for use in the treatment of a neurodegenerative disease.

9. The isolated single-stranded RNA aptamer for use, according to claim 8, wherein said neurodegenerative disease is characterized by pathological protein aggregates of the FUS protein.

10. The isolated single-stranded RNA aptamer for use according to any one of claims 7 or 8, wherein said neurodegenerative disease is Amyotrophic Lateral Sclerosis (ALS) or Frontotemporal Lobar Degeneration (FTLD).11 . A pharmaceutical composition comprising an isolated single-stranded RNA aptamer according to any one of claims 1 to 6 and pharmaceutically acceptable excipients.

12. A pharmaceutical composition comprising an isolated single-stranded RNA aptamer according to claim 11 , for use as a medicament.

13. A pharmaceutical composition comprising an isolated single-stranded RNA aptamer according to claim 11 , for use in the treatment of a neurodegenerative disease.

14. The pharmaceutical composition for use according to claim 13, wherein said neurodegenerative disease is characterized by pathological protein aggregates of the FUS protein.

15. The pharmaceutical composition for use according to any one of claims 13 or 14, wherein said neurodegenerative condition is Amyotrophic Lateral Sclerosis (ALS) or Frontotemporal lobar degeneration (FTLD).

Images