Method for preparing enzymatic reaction solution and method for producing enzymatic reaction product
The method extracts enzymes from bacteria or yeast without cell disruption, using specified surfactants and conditions, ensuring enzymatic activity and reducing purification needs, thus enabling efficient and cost-effective enzymatic reactions.
Patent Information
- Application Number
- PCT/JP2025/007324
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-29
- Filing Date
- 2025-02-28
- Publication Date
- 2025-09-04
AI Technical Summary
Existing methods for extracting enzymes from bacteria or yeast disrupt or lyse the cells, leading to contamination by cell wall fragments and nucleic acids, which interfere with purification and can reduce enzyme activity, especially for heat-resistant enzymes.
A method for extracting enzymes from bacteria or yeast without disrupting or lysing the cells, using a 0.05 to 1.0 M buffer containing 0 to 3% nonionic or zwitterionic surfactant, adjusted to a pH of 6 to 11, and treated at 4 to 95°C for 0.1 hour to 4 days, without subsequent purification steps to remove contaminants.
Enzymes are extracted in an active state, allowing direct use in enzymatic reactions with maintained activity and reduced costs, eliminating the need for costly purification steps.
Smart Images

Figure JP2025007324_04092025_PF_FP_ABST
Abstract
Description
Method for preparing enzyme reaction solution and method for producing enzyme reaction product
[0001] The present invention relates to a method for preparing an enzyme reaction solution by extracting a specific enzyme from bacteria or yeast that expresses the enzyme while retaining its enzymatic activity, and a method for preparing an enzyme reaction product by enzymatically reacting a substrate with the enzyme reaction solution obtained by the above method.
[0002] Typically, intracellularly expressed enzymes are extracted extracellularly by disrupting or lysing the cells. When cells are disrupted or lysed, the resulting cell suspension contains the enzyme, but also various contaminants, such as cell wall fragments or lysates and nucleic acids such as DNA, in addition to the target enzyme. Therefore, a commonly used method is to concentrate the enzyme from the cell suspension containing these contaminants, remove as much of the DNA, which interferes with purification due to viscosity, as much as possible using ion chromatography, and then purify the target enzyme by repeated anion chromatography or other methods. In particular, for use of the resulting enzyme in fields involving pharmaceuticals, medical devices, injectable water, and the like, strict control is required to ensure that bacterial hydrophobic lipopolysaccharides (LPS), such as endotoxins, are kept below a certain concentration. This is because LPS and other substances possess various biological activities, such as pyrogenicity and antigenicity.
[0003] When it is desired to extract a heat-resistant enzyme from a cell, one method involves treating the cell at a high temperature such as 90°C to precipitate undesired contaminating proteins through thermal denaturation, and then recovering the supernatant to extract the heat-resistant enzyme. However, there are proteins that do not denature at high temperatures, and this method is also expected to reduce the activity of the enzyme itself.
[0004] Therefore, it would be possible to devise a method to extract the enzymes produced within the cell body through the cell wall without disrupting the cell wall, without relying on disruption or lysis. Unfortunately, however, no such extraction method has yet been established.
[0005] The present inventors have disclosed a method for extracting polypeptides using yeast without disrupting the yeast (see Patent Document 1). However, the extraction of polypeptides mainly focuses on the extraction of the polypeptide itself, and no consideration has been given to maintaining enzymatic activity after extraction. A method for extracting proteins using a combination of Triton X-100 and sodium deoxycholate has also been disclosed, but this method requires lysis using two types of surfactants and lysozyme, an enzyme that dissolves cell walls, as well as tagging the protein and purifying it using a column based on the tag.
[0006] JP 2017-36223 A JP 2011-51943 A
[0007] An object of the present invention is to prepare an enzyme reaction solution by extracting an enzyme contained in bacteria or yeast while retaining its enzymatic activity, without subjecting the bacteria or yeast to a disruption or lysis treatment.
[0008] As a result of intensive research to solve the above-mentioned problems, the inventors discovered a method for extracting enzymes contained in bacteria or yeast and preparing an enzyme reaction solution without crushing or lysing the bacteria or yeast, by using an extracting solution containing a specified surfactant under conditions of specified pH, temperature, and buffer concentration, and completed the present invention.
[0009] That is, the present invention is as follows: [1] A method for preparing an enzyme reaction solution by extracting a predetermined enzyme from bacteria or yeast expressing the enzyme while the enzyme retains its enzymatic activity, comprising a step of treating the bacteria or yeast with an enzyme extract, which is a 0.05 to 1.0 M buffer containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 4 to 95°C for 0.1 hour to 4 days, and does not include a step of disrupting or lysing the bacteria or yeast. [2] The method according to [1] above, characterized in that the enzyme is extracted while retaining its enzymatic activity from transformed bacteria or transformed yeast into which a polynucleotide encoding the predetermined enzyme has been incorporated. [3] The method according to [1] or [2] above, characterized in that the predetermined enzyme is an enzyme localized in the cytoplasm. [4] The method according to any one of [1] to [3] above, characterized in that after the predetermined enzyme has been extracted by treatment with the enzyme extract, the method does not include a purification step of removing bacterial or yeast cell walls or nucleic acids. [5] The method according to any one of [1] to [4] above, wherein the enzyme reaction solution does not contain a surfactant. [6] The method according to [1] above, wherein the enzyme is extracted from bacteria expressing a predetermined enzyme while retaining its enzymatic activity, to prepare an enzyme reaction solution, comprising a step of treating the bacteria with an enzyme extract solution, which is a 0.05 to 1.0 M buffer containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 4 to 95°C for 0.1 hours to 4 days, and wherein the method according to [1] above, wherein the enzyme is extracted from transformed bacteria incorporating a polynucleotide encoding the predetermined enzyme while retaining its enzymatic activity. [8] The method according to [6] or [7] above, wherein the enzyme is extracted from transformed bacteria into which a polynucleotide encoding the predetermined enzyme is incorporated while retaining its enzymatic activity. [9] The method according to any one of [1] to [8] above, wherein the method does not comprise a purification step of removing bacterial cell walls or nucleic acids after extracting the predetermined enzyme by treatment with the enzyme extract solution. [9] A method for producing an enzyme reaction product by enzymatic reaction of a substrate with the enzyme reaction solution obtained by the method according to any one of [1] to [8] above.
[10] The method according to [9] above, wherein the enzyme reaction solution is a DNA polymerase reaction solution prepared by extracting DNA polymerase, and a polymerase chain reaction (PCR) amplification product is prepared by enzymatically reacting a deoxyribonucleoside triphosphate with the DNA polymerase reaction solution as a substrate.
[11] The method according to [9] or
[10] above, wherein the enzyme reaction solution is a kinase reaction solution prepared by extracting kinase, and a phosphate compound is prepared by enzymatically reacting the substrate with the kinase reaction solution.
[0010] The method of the present invention makes it possible to prepare an enzyme reaction solution by extracting an enzyme from bacteria or yeast in an active state without disrupting or lysing the bacteria or yeast. Furthermore, by using the extracted enzyme directly in an enzymatic reaction, it becomes possible to produce a desired enzymatic reaction product by an enzymatic reaction simply and at low cost.
[0011] FIG. 1 shows the results of confirming enzyme extraction by SDS-PAGE in Example 1. FIG. 2 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 1. The upper row of FIG. 3 shows the results of confirming enzyme extraction by SDS-PAGE in Example 2. The upper row of the lower row of FIG. 3 shows the results of confirming whether the obtained enzyme reaction solution has enzymatic activity using the PCR amplification product (EGFP). The lower row of FIG. 3 shows the results of confirming whether the obtained enzyme reaction solution has enzymatic activity using the PCR amplification product (HGF). FIG. 4 shows the results of SDS-PAGE of the enzyme reaction solution obtained in Example 3. FIG. 5 shows the results of SDS-PAGE of the enzyme reaction solution obtained in Example 4. FIG. 6 shows an outline of the reaction from deoxyadenosine to deoxyadenosine triphosphate in Example 5. FIG. 7 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 5. Figure 8A shows the results of microscopic observation of bacterial cells after extraction with 0.1 M Tris-HCl pH 9 + 1% Triton X-100 in Example 6. Figure 8B shows the results of microscopic observation of bacterial cells after extraction with 0.1 M Tris-HCl pH 9 + 1% SDS in Example 6. Figure 8C shows the results of microscopic observation of bacterial cells after disruption with zirconia beads in Example 6. Figure 9 shows the results of SDS-PAGE analysis to confirm enzyme or protein extraction in Example 6. Figure 10 shows the results of agarose electrophoresis analysis to confirm nucleic acid contamination in Example 6. Figure 11 shows the results of confirming the enzymatic activity of the enzyme extracted by amplifying a 711 bp polynucleotide encoding EGFP by PCR in Example 6. Figure 12 shows the results of SDS-PAGE analysis to confirm enzyme extraction in Example 7. Figure 13 shows the results of agarose electrophoresis to confirm the PCR amplification product in Example 7. Fig. 14 shows the results of confirming enzyme extraction by SDS-PAGE in Example 8. Fig. 15 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 8.
[0012] The method for preparing an enzyme reaction solution of the present invention is a method for preparing an enzyme reaction solution by extracting a predetermined enzyme from bacteria or yeast that expresses the enzyme while retaining its enzymatic activity, and includes a step of treating the bacteria or yeast with an enzyme extract that is a 0.05-1.0 M buffer containing 0-3% nonionic surfactant or amphoteric surfactant and adjusted to a pH of 6-11 at 4-95°C for 0.1 hour to 4 days, without any particular limitation, and is hereinafter also referred to as the "method for preparing the enzyme reaction solution of the present invention." Furthermore, the method for preparing an enzyme reaction product of the present invention is hereinafter also referred to as the "method for preparing the enzyme reaction product of the present invention," without any particular limitation, as long as it is a method for producing an enzyme reaction product by enzymatically reacting a substrate with the enzyme reaction solution obtained by the method for preparing the enzyme reaction solution of the present invention.
[0013] (Bacteria or Yeast) In this specification, bacteria are not particularly limited as long as they are taxonomically classified as bacteria, and may be either Gram-negative or Gram-positive bacteria. Examples of Gram-negative bacteria include Escherichia coli, Pseudomonas bacteria, and Streptomyces bacteria. Examples of Gram-positive bacteria include Bacillus bacteria such as Bacillus subtilis, Streptococcus bacteria, Staphylococcus bacteria, Brevibacillus bacteria, Corynebacterium bacteria, Lactobacillus bacteria, and lactic acid bacteria. The above bacteria also include mutant strains of these bacteria. In order to further increase the amount of a specific enzyme in an enzyme reaction solution, it is preferable to use a transformed bacterium or transformed yeast into which a polynucleotide encoding the specific enzyme has been incorporated. The polynucleotide may be a polynucleotide encoding an enzyme derived from the host to be transformed, or a polynucleotide encoding an enzyme derived from a heterologous organism other than the host, or a polynucleotide or mutant polynucleotide whose codons have been optimized for the host.
[0014] As used herein, the yeast is not particularly limited as long as it is taxonomically classified as yeast, and examples thereof include yeasts of the genus Saccharomyces, Kluyveromyces, Candida, and Pichia. Specific examples include Saccharomyces cerevisiae, Kluyveromyces lactis, Candida utilis, and Pichia pastoris. Furthermore, the yeast of the present invention also includes mutant strains of these yeasts.
[0015] (Enzyme Extract and Treatment Conditions Thereof) Examples of surfactants used herein include nonionic surfactants, amphoteric surfactants, and salts thereof. Examples of nonionic surfactants include ether-based nonionic surfactants such as Triton X-100 and NP40. Examples of amphoteric surfactants include MEGA-10 and CHAPS. The above nonionic surfactants may be used in combination with the above amphoteric surfactants or salts thereof. It is also preferable that the surfactant does not contain a cationic surfactant and / or anionic surfactant or a salt thereof. Examples of cationic surfactants include sulfonic acid surfactants such as 1-dodecanesulfonic acid and cetyltrimethylammonium bromide (CTAB), and examples of anionic surfactants include sodium dodecyl sulfate (SDS), lauryltrimethylammonium (Lauryltrimethylammonium Cl), and sodium deoxycholate. It should be noted that this does not preclude the addition of a surfactant, preferably a nonionic surfactant or a bipolar surfactant, to the enzyme reaction solution obtained by the method for preparing the enzyme reaction solution of the present invention for the purpose of stabilizing the enzyme.
[0016] In this specification, the concentration of the nonionic surfactant or amphoteric surfactant in the enzyme extract can be adjusted appropriately depending on the molecular weight of the enzyme to be extracted and the type of bacteria or yeast, and can be 0 to 3%, 0 to 0.01%, 0 to 0.1%, 0 to 0.25%, 0 to 0.5%, or even 0.1 to 2%, 0.5 to 1.5%, or 0.8 to 1.2%. Note that the above concentrations are in % (v / v) when the nonionic surfactant or amphoteric surfactant is in liquid form, and in % (w / v) when it is prepared by dissolving a powder.
[0017] In this specification, the pH of the enzyme extract can be appropriately adjusted depending on the stability of the enzyme to be extracted, and can be, for example, a pH of 6 to 11, preferably a pH of 6.3 to 10.5, more preferably a pH of 6.5 to 10.2, even more preferably a pH of 7 to 10, and particularly preferably a pH of 8 to 9.
[0018] In this specification, the enzyme extract may contain a buffer solution to suppress pH fluctuations. The concentration of such a buffer solution may be 0.05 to 1.0 M, preferably 0.1 to 0.6 M. The buffer solution is not particularly limited, but examples thereof include Tris ((hydroxymethyl)aminomethane) hydrochloric acid buffer solution, phosphate buffer solution, borate buffer solution, carbonate buffer solution, MES (2-morpholinoethanesulfonic acid) buffer solution, HEPES (4-(2-hydroxyethyl)-1-piperazineethane sulfonic acid) buffer solution, MOPS (3-(N-morpholino)propanesulfonic acid) buffer solution, TEA (Tris-acetate-EDTA) buffer solution, and Tricine buffer solution.
[0019] The temperature during treatment with the enzyme extract can be adjusted appropriately depending on the heat resistance of the enzyme to be extracted, but examples of the temperature include 4 to 95°C, and preferably 25 to 90°C or 40 to 60°C.
[0020] The time for treatment with the enzyme extract is not particularly limited, but is preferably 0.1 hour or more, for example, 0.5 hours to 4 days, may be 1 hour to 2 days, or may be 3 hours to 24 hours.
[0021] (Disruption or lysis) The present method for preparing an enzyme reaction solution does not include a step of disrupting or lysing bacteria or yeast. Here, disruption or lysis of bacteria or yeast means physically treating the bacteria or yeast with ultrasound, beads such as zirconia beads or glass beads, or a pressure homogenizer, or chemically treating the bacteria or yeast with an acid or base, alkaline SDS treatment, or enzyme treatment with lysozyme or lyticase, to remove any remaining cell structure. Whether or not the cell structure remains can be confirmed by observing the bacteria or yeast under a microscope.
[0022] (Enzymes and Enzyme Treatment) In this specification, the enzyme to be extracted may be any enzyme having a predetermined enzymatic activity, but from the viewpoint of extraction efficiency, an enzyme localized in the cytoplasm is preferred. The molecular weight of the enzyme is not particularly limited, but may be 1,000 to 500,000, preferably 5,000 to 100,000, more preferably 10,000 to 80,000, and even more preferably 20,000 to 60,000.
[0023] In the present specification, the type of enzyme to be extracted is not particularly limited, and examples thereof include DNA polymerase, RNA polymerase, kinase, nuclease, and DNA ligase. Examples of DNA polymerase include Tth DNA polymerase, Taq DNA polymerase, Pfu DNA polymerase, Pph DNA polymerase, KOD DNA polymerase, Bst DNA polymerase, and mutants thereof. Examples of kinases include deoxyribonucleoside kinases or ribonucleoside kinases that phosphorylate deoxyribonucleosides or ribonucleosides, deoxyribonucleoside monophosphate kinases or ribonucleoside monophosphate kinases that phosphorylate deoxyribonucleoside monophosphates or ribonucleoside monophosphates, deoxyribonucleoside diphosphate kinases or ribonucleoside diphosphate kinases that phosphorylate deoxyribonucleoside diphosphates or ribonucleoside diphosphates, pyruvate kinase, hexokinase, and the like, or mutants thereof. Examples of deoxyribonucleoside kinases or ribonucleoside kinases include deoxyadenosine kinases or adenosine kinases such as ADO1 and rbsK that phosphorylate deoxyadenosine or adenosine; deoxyguanosine kinases or guanosine kinases such as gsk and rbsK that phosphorylate deoxyguanosine or guanosine; deoxycytidine kinases or cytidine kinases such as URK1, UDK and DCK that phosphorylate deoxycytidine or cytidine; deoxythymidine kinases or thymidine kinases such as tdk that phosphorylate deoxythymidine or thymidine; and mutants thereof.Examples of deoxyribonucleoside monophosphate kinases or ribonucleoside monophosphate kinases include deoxyadenosine monophosphate kinases or adenosine monophosphate kinases such as ADK1 or adk that phosphorylate deoxyadenosine monophosphate or adenosine monophosphate; deoxyguanosine monophosphate kinases or guanosine monophosphate kinases such as GUK1 or gmk that phosphorylate deoxyguanosine monophosphate or guanosine monophosphate; deoxycytidine monophosphate kinases or cytidine monophosphate kinases such as URA6 or cmk that phosphorylate deoxycytidine monophosphate or cytidine monophosphate; deoxythymidine monophosphate kinases or thymidine monophosphate kinases such as CDC8 or tmk that phosphorylate deoxythymidine monophosphate or thymidine monophosphate; and mutants thereof. Examples of enzymes that phosphorylate deoxyribonucleoside diphosphates or ribonucleoside diphosphates include deoxyribonucleoside diphosphate kinases such as Ynk1 or ribonucleoside diphosphate kinases, or mutants thereof. Examples of pyruvate kinases include CDC19, pykA, pykF, or mutants thereof. Examples of nucleases include exonucleases, endonucleases, or mutants thereof. Examples of ligases include DNA ligases such as T4 DNA ligase, T7 DNA ligase, and Escherichia coli ligase, RNA ligases such as T4 RNA ligase, or mutants thereof.
[0024] Whether or not the enzyme in the obtained enzyme reaction solution retains its enzymatic activity can be confirmed by adding the enzyme reaction solution to the substrate of the enzyme and determining whether or not an enzyme reaction product is obtained.
[0025] The present method for preparing an enzyme reaction solution preferably does not include a purification step for removing contaminants after treatment with an enzyme extract to extract the enzyme. Conventionally, when bacteria or yeast are disrupted or lysed to extract an enzyme, a purification step using a commercially available nucleic acid purification kit or a method such as precipitation using polyethyleneimine is required to remove contaminants such as disrupted or lysed cell walls and nucleic acids such as DNA and RNA. In contrast, the present method for preparing an enzyme reaction solution does not require a purification step for removing the contaminants because the enzyme is extracted without disrupting or lysing the bacteria or yeast. Note that, in this specification, the step of separating undisrupted or unlysed bacteria or yeast by centrifugation or the like is not included in the purification step for removing the contaminants. Furthermore, the purification step does not include the step of removing the contaminants and polypeptides other than the target enzyme by chromatography (e.g., affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography), ultrafiltration, or the like after treatment with an enzyme extract to remove substances that inhibit the enzymatic activity of the target enzyme.
[0026] In the present method for preparing an enzyme reaction solution, when the enzyme reaction solution obtained by treatment with an enzyme extract is used directly for an enzyme reaction, there may be cases where it is not necessary to obtain only the desired enzyme. In this case, a peptide can be prepared that does not contain modifications, such as a tag sequence, that are necessary to obtain only the desired enzyme.
[0027] (Enzyme Reaction Product) In the method for preparing the present enzyme reaction product, the enzyme reaction product is not particularly limited. For example, by using a deoxyribonucleoside triphosphate as a substrate and performing a PCR reaction using a DNA polymerase reaction solution prepared by extracting a DNA polymerase using the present method for preparing an enzyme reaction solution as the enzyme reaction solution, a PCR amplification product can be obtained as the enzyme reaction product. Furthermore, by using a compound that causes the desired phosphorylation as a substrate and performing an enzyme reaction using a phosphorylating enzyme reaction solution prepared by extracting a phosphorylating enzyme using the present method for preparing an enzyme reaction solution as the enzyme reaction solution, a phosphorylated compound in which the substrate is phosphorylated can be obtained as the enzyme reaction product.
[0028] The PCR reaction solution may contain template DNA, primers, probes, and a buffer solution in addition to the substrate and enzyme reaction solution. The enzyme reaction solution may be used as the buffer solution.
[0029] In the method for preparing the present enzyme reaction product, the solution in which the enzyme reaction is carried out can contain 0.1 to 20% (v / v) of the enzyme reaction solution prepared by the method for preparing the present enzyme reaction solution.
[0030] The contents of all patent and non-patent literature cited herein are hereby incorporated by reference in their entirety.
[0031] The present invention will be explained in more detail below with reference to examples, but the technical scope of the present invention is not limited to these examples.
[0032] [Example 1] Extraction of enzyme (DNA polymerase) from Escherichia coli (1) First, DNA polymerase was extracted from Escherichia coli that highly expresses DNA polymerase.
[0033] (Culturing E. coli expressing DNA polymerase) E. coli was used as a host and transformed using the following method. A Pfu DNA polymerase-containing plasmid was prepared by incorporating a polynucleotide (optimized for E. coli codons) encoding Pfu DNA polymerase in place of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)). Pfu DNA polymerase is a thermostable DNA polymerase derived from Pyrococcus furiosus.
[0034] 1 μL of the Pfu DNA polymerase-containing plasmid was added to 30 μL of competent E. coli cells in an ice bath, stirred for 1 second, and then transformed by ice bathing for 10 minutes and then at 42°C for 45 seconds to obtain Pfu DNA polymerase-expressing E. coli. Next, 50 μL of sterile water was added, and the Pfu DNA polymerase-expressing E. coli was plated on agar medium containing glucose, yeast extract, peptone, and ampicillin, spread with beads, and cultured at 37°C for 1 day. Approximately 3 cm of colonies growing on the agar medium were scraped off with a loop, inoculated into AB medium (Yamaguchi TLO), and cultured at 37°C for 1 day with gentle stirring. 500 mL of AB medium was added to a 1 L beaker. The beaker was covered with aluminum foil and sterilized.
[0035] (Extraction of DNA polymerase) The culture solution obtained by culturing E. coli in the above AB medium was dispensed into ten 50 mL tubes at 50 mL each, centrifuged at 12,000 rpm for about 5 minutes, and the supernatant was removed. Next, the sample was suspended in 5 mL of extraction solution prepared by adding surfactants (Triton X-100, MEGA-10 (348-05093: Dojindo Laboratories), CHAPS, SDS, 1-Dodecanesulfonic Acid, lauryltrimethylammonium (Lauryltrimethylammonium Cl)) to a final concentration of 1% in 0.1 M or 0.6 M Tris-HCl adjusted to pH 7, 8, 9, or 10, and treated at 50°C for 1 hour to extract Pfu DNA polymerase. Thereafter, the mixture was centrifuged at 12,000 rpm for about 5 minutes, and the supernatant was used as an enzyme reaction solution (pH 7, 8, 9 or 10) for the enzyme reaction (PCR reaction) described below.
[0036] (Confirmation of enzyme extraction by SDS-PAGE) Whether or not the enzyme was extracted into the enzyme reaction solution was confirmed by SDS-PAGE. 10 μL of the DNA polymerase extract treated at 50°C for 1 hour was transferred to a 0.2 mL 8-tube PCR tube, and 2 μL of 6x sample buffer for SDS-PAGE (product code 09499-14: Nacalai Tesque) was added and mixed well. The tube was placed in a 95°C heat block for 5 minutes, and then applied to the gel at 1.2 μL / lane. A 10-20% precast gel (Supersep: Wako Pure Chemical Industries, Ltd.) was used.
[0037] The results of confirming enzyme extraction by SDS-PAGE are shown in Figure 1. The position of the arrow on the right side of the figure indicates the molecular weight of Pfu DNA polymerase. A band was observed at the molecular weight position corresponding to Pfu DNA polymerase at all pH values, confirming that Pfu DNA polymerase can be extracted without disrupting or lysing E. coli. Furthermore, it was confirmed that Pfu DNA polymerase was extracted in large quantities with surfactants, particularly Triton X-100, MEGA10, CHAPS, SDS, and 1-Dodecanesulfonic Acid.
[0038] (Confirmation of polymerase activity of enzyme by PCR) Whether or not the Pfu DNA polymerase in the obtained enzyme reaction solution has enzymatic activity was confirmed by PCR reaction.
[0039] The PCR reaction solution was as follows: 1 M Tris-HCl pH 8.5 1.5 μL Enzyme reaction solution (pH 7, 8, 9, 10) 0.2 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO 4 (50mM) 0.5μL dNTP solution mix (10mM NEB) 0.5μL Distilled water 5.3μL Total 10.0μL
[0040] The PCR reaction was carried out for 30 cycles of 98°C for 5 seconds and 68°C for 5 seconds. The pAmp-srlAp-eEGFP plasmid described in the above-mentioned Nakamura et al. publication was used as template DNA, and a 711-bp polynucleotide encoding EGFP was amplified using eEGFP+1 (35) (SEQ ID NO: 1) as the forward primer and eEGFP+711c (35) (SEQ ID NO: 2) as the reverse primer. If DNA is amplified by the PCR reaction, it indicates that the DNA polymerase has enzymatic activity.
[0041] Forward primer eEGFP+1(35): atggtgagcaaaggtgaagaactgtttaccggtgt (SEQ ID NO: 1) Reverse primer eEGFP+711c(35): ttattcatccatacccagggtaatacctgctgcgg (SEQ ID NO: 2)
[0042] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 2. As shown in Figure 2, when extraction was performed using Triton X-100, MEGA10, or CHAPS as a surfactant, PCR amplification products were confirmed at all pH values of 7 to 10, confirming that the extracted DNA polymerase maintained its enzymatic activity. Furthermore, when extraction was performed using Lauryltrimethylammonium Cl, PCR amplification products were confirmed at pH 7, confirming that the extracted DNA polymerase maintained its enzymatic activity. On the other hand, when extraction was performed using SDS or dodecanesulfonic acid as a surfactant, no PCR amplification products were confirmed, and the extracted DNA polymerase had lost its enzymatic activity. Therefore, when extraction was performed using Triton X-100, MEGA10, or CHAPS at pH 7 to 10, or when extraction was performed using Lauryltrimethylammonium at pH 7, it was revealed that the enzyme was extracted in a state where its activity was maintained. Note that Figure 2 shows the results when 0.1 M Tris-HCl adjusted to pH 7, 8, 9, or 10 was used in preparing the enzyme reaction solution, but bands were also detected when 0.6 M Tris-HCl was used, similar to when 0.1 M Tris-HCl was used (not shown).
[0043] Example 2 Extraction of Enzyme (DNA Polymerase) from Escherichia coli (2) The surfactants used in Example 1, Triton X-100, MEGA10, and CHAPS, were used in the extraction solution with varying surfactant concentrations.
[0044] The following extracts were used: (1) 0.1 M Tris-HCl pH 7 (no surfactant) (2) 0.1 M Tris-HCl pH 8 (no surfactant) (3) 0.1 M Tris-HCl pH 9 (no surfactant) (4) 0.1 M Tris base pH 10 (no surfactant) (5) 0.1 M Tris-HCl pH 9 + 0.25% Triton X-100 (6) 0.1 M Tris-HCl pH 9 + 0.5% Triton X-100 (7) 0.1 M Tris-HCl pH 9 + 1% Triton X-100 (8) 0.1 M Tris-HCl pH 9 + 2% Triton X-100 (9) 0.1 M Tris-HCl pH 9 + 0.25% MEGA10 (10) 0.1 M Tris-HCl pH 9 + 0.5% MEGA10 (11) 0.1 M Tris-HCl pH 9+1% MEGA10 (12) 0.1 M Tris-HCl pH 9+2% MEGA10 (13) 0.1 M Tris-HCl pH 9+0.25% CHAPS (14) 0.1 M Tris-HCl pH 9+0.5% CHAPS (15) 0.1 M Tris-HCl pH 9+1% CHAPS (16) 0.1 M Tris-HCl pH 9+2% CHAPS
[0045] (Extraction of DNA polymerase) 1 mL of AB medium was added to 24 wells, and Pfu-expressing E. coli obtained by the same method as in Example 1 was gently cultured overnight at 37°C. The resulting culture solution was centrifuged at 12,000 rpm for approximately 5 minutes, and the supernatant was removed. Next, the cells were suspended in 100 μL of each of the above extracts and treated at 50°C for 1 hour to extract DNA polymerase. After that, the cells were centrifuged at 12,000 rpm for approximately 5 minutes, and the supernatant was used as an enzyme reaction solution.
[0046] 10 μL of the enzyme reaction solution was transferred to a 0.2 mL 8-tube PCR tube, and 2 μL of 6x sample buffer for SDS-PAGE (product code 09499-14: Nacalai Tesque) was added and mixed well. The tube was then placed in a 95°C heat block for 5 minutes, and 1.2 μL / lane of the solution was applied to the gel for SDS-PAGE. The results are shown in the upper panel of Figure 3.
[0047] In the upper panel of Figure 3, the position of the arrow on the right indicates the molecular weight of the DNA polymerase. In all lanes, a band was observed at the molecular weight corresponding to the DNA polymerase, confirming that DNA polymerase could be extracted without disrupting or lysing E. coli. Furthermore, it was confirmed that DNA polymerase could be extracted at any pH between 7 and 9 without using a surfactant, and that it was extracted at concentrations of 0 to 2% when Tris-HCl, MEGA10, or CHAPS was used as the surfactant.
[0048] Next, the enzymatic activity of the resulting enzyme reaction solution was confirmed by PCR. PCR reactions were carried out in the same manner as in Example 1, except that the enzyme reaction solutions extracted with the above extract solutions (1) to (16) were used as the enzyme reaction solutions. The results are shown in the upper part of the lower row of Figure 3.
[0049] As shown in the upper part of the bottom row of Figure 3, PCR amplification products were confirmed in all lanes, confirming that all of the extracted DNA polymerases maintained their enzymatic activity.
[0050] Furthermore, PCR was performed under the same conditions as in Example 1 using the pcDNA3-CMVp-hHGF-BGHpA plasmid containing a 3137-bp polynucleotide encoding HGF as template DNA, eCMV-600(35) (SEQ ID NO: 3) as the forward primer, and BGHpA+225c(35) (SEQ ID NO: 4) as the reverse primer, and the results of amplification of the 3137-bp polynucleotide encoding HGF are shown in the lower part of the lower panel of Figure 3. Not only the 711-bp EGFP but also the 3137-bp HGF was amplified by PCR, confirming that the extracted DNA polymerase maintained its enzymatic activity even in the amplification of enzymes other than EGFP.
[0051] Forward primer eCMV-600(35): gtaatcaattacggggtcattagttcatagcccat (SEQ ID NO: 3) Reverse primer BGHpA+225c(35): ccatagagcccaccgcatccccagcatgcctgcta (SEQ ID NO: 4)
[0052] Furthermore, the above results confirmed that an enzyme reaction product can be produced by directly enzymatically reacting the enzyme reaction solution obtained by the present method for preparing an enzyme reaction solution with a substrate.
[0053] [Example 3] Extraction of enzymes (phosphorylation enzymes) from Escherichia coli In Examples 1 and 2 above, DNA polymerase was extracted, but the extraction of other enzymes was also attempted.
[0054] Plasmids were prepared by incorporating a polynucleotide (SEQ ID NO: 5) encoding the E. coli-derived kinase (adenosine monophosphate kinase) Ecadk or a polynucleotide (SEQ ID NO: 6) encoding the E. coli-derived kinase (pyruvate kinase) ECpykF in place of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)). E. coli was then transformed with these plasmids in the same manner as in Example 1. Ecadk is an enzyme that phosphorylates deoxyadenosine monophosphate to produce deoxyadenosine diphosphate, and ECpykF is an enzyme that phosphorylates deoxyadenosine diphosphate to produce deoxyadenosine triphosphate. The transformed E. coli was then cultured in AB medium in the same manner as in Example 1.
[0055] Next, the sample was suspended in 5 mL of an extract prepared by adding a surfactant (Triton X-100) to a final concentration of 1% in 0.1 M Tris-HCl adjusted to pH 9, and an enzyme reaction solution was prepared in the same manner as in Example 1. The results of SDS-PAGE of the obtained enzyme reaction solution are shown in Figure 4.
[0056] The enzymatic activities of the kinase Ecadk and kinase ECpykF in the obtained enzyme reaction solution will be demonstrated by obtaining reaction products by PCR reaction in the Examples described later.
[0057] Example 4 Extraction of Enzyme (Phosphatase) from Yeast (1) In Examples 1 to 3, enzymes were extracted from Escherichia coli, but extraction of enzymes from yeast was also attempted.
[0058] (Culturing of yeast expressing kinase) Yeast (Saccharomyces cerevisiae) was transformed using the following method. A polynucleotide (SEQ ID NO: 7) encoding the kinase ScADO1 of Saccharomyces cerevisiae was incorporated into the YHp plasmid (Misumi et al., Yeast Volume 36, Issue 5 Special Issue: May 2019 Pages 249-257) instead of yEmRFP to prepare an ScADO1-containing plasmid. ScADO1 is an enzyme that phosphorylates deoxyadenosine to produce deoxyadenosine monophosphate.
[0059] The ScADO1-containing plasmid was added to 30 μL of yeast competent cells, and the cells were transformed by treating on a heat block at 42°C for approximately 30 minutes. Then, 100 μL of sterile water was added, and the transformed yeast was plated on uracil-deficient synthetic medium, spread with beads, and cultured at 30°C for 3 days. The resulting colonies were scraped and inoculated into 50 mL of YPD medium in a 250 mL baffled Erlenmeyer flask and cultured with shaking at 30°C for 1 day. The cells were then suspended in 5 mL of extract solution prepared by adding surfactant (Triton X-100) to a final concentration of 1% in 0.1 M Tris-HCl adjusted to pH 9, and allowed to stand in an incubator at 30°C for 1 day to extract ScADO1. The cells were then centrifuged at 12,000 rpm for approximately 5 minutes, and the supernatant was used as the enzyme reaction solution (pH 9) for SDS-PAGE and the enzyme reaction described below. The results of SDS-PAGE of the obtained enzyme reaction solution are shown in Figure 5. The enzymatic activity of the kinase ScADO1 in the obtained enzyme reaction solution will be shown in the Examples below. Note that the above surfactant treatment did not destroy the yeast cell walls or cause lysis.
[0060] [Example 5] Activity of extracted enzymes (kinases) The enzyme activities of the kinases Ecadk and ECpykF extracted in Example 3 and the kinase ScADO1 extracted in Example 4 were examined by the reaction from deoxyadenosine to deoxyadenosine triphosphate. The reaction from deoxyadenosine to deoxyadenosine triphosphate is outlined in Figure 6.
[0061] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dATP, which was used as a dATP solution: 2 μL of 1 M Tris-HCl pH 8, 2 μL of 0.5 M KCl, and 100 mM MgCl. 2 2 μL 300 mM PEP (phosphoenolpyruvic acid) 2 μL 1 mM dATP 2 μL 100 mM dAd 2 μL Enzyme reaction solution prepared in Example 4 (ScADO1: pH 9) 2 μL Enzyme reaction solution prepared in Example 3 (ECadk: pH 9) 2 μL Enzyme reaction solution prepared in Example 3 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL
[0062] Next, PCR was carried out using the following reaction solution: 0.2 μL of the enzyme reaction solution (Pfu: pH 9) prepared in Example 1, 1.5 μL of 1 M Tris-HCl pH 8.5, 0.5 μL of the above dATP solution, 1.0 μL of template DNA (1 ng / μL), 0.5 μL of forward primer (10 μM), and 0.5 μL of reverse primer (10 μM) MgSO. 4 (50 mM) 0.5 μL dGTP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL
[0063] The PCR reaction was carried out for 30 cycles, each cycle consisting of 98°C for 5 seconds and 68°C for 5 seconds. Using the pAmp-srlAp-eEGFP plasmid as template DNA, eEGFP+1(35) (SEQ ID NO: 1) as the forward primer and eEGFP+711c(35) (SEQ ID NO: 2) as the reverse primer, a 711-bp polynucleotide encoding EGFP was amplified. If DNA is amplified by the PCR reaction, the added dATP solution contains dATP, i.e., the kinases Ecadk and ECpykF extracted in Example 3 and the kinase ScADO1 extracted in Example 4 possess enzymatic activity. In the dATP synthesis reaction, an initial concentration of 0.1 mM dATP was added to initiate the reaction. In addition, the initial concentration of dATP was 0.1 mM, and 0.5 μL of dATP solution was added to the total 10 μL PCR reaction solution, so the concentration of dATP initially added to the PCR reaction solution was 0.005 mM. Since the concentration of each dNTP required for PCR is about 0.5 mM, it can be said that the progress of the PCR reaction was not due to the dATP added initially, but was essentially due to the dATP synthesized from the 10 mM dAd substrate.
[0064] The results of confirming the PCR amplification products by agarose electrophoresis are shown in Figure 7. In Figure 7, the left lane is the marker, and the right lane is the lane to which the PCR amplification products were applied. As is clear from Figure 7, PCR amplification products were obtained, confirming that the kinases Ecadk and ECpykF extracted in Example 3 and the kinase ScADO1 extracted in Example 4 have enzymatic activity. Therefore, it was revealed that the above-mentioned method for preparing an enzyme reaction solution makes it possible to extract enzymes from both bacteria and yeast while retaining their enzymatic activity, and that the enzyme reaction solution can be used as is as an enzyme without undergoing purification to remove impurities.
[0065] The enzyme reaction solution is prepared without disruption or lysis as in the conventional method. Therefore, it can be used for the enzyme reaction without a purification step. Furthermore, if the solution from which the enzyme is extracted is used directly for the enzyme reaction, it is possible to simplify the process from the enzyme reaction solution to the production of an enzyme reaction product by the enzyme reaction.
[0066] Example 6: Microscopic Observation of Bacteria, and Confirmation of Extraction and Enzyme Activity Microscopic observation of bacteria after extraction was performed when the enzyme was extracted using the present enzyme reaction solution preparation method, conventional SDS alkali treatment, and bead crushing treatment. 250 mL of AB medium (Yamaguchi TLO) was placed in a 500 mL beaker, and Pfu DNA polymerase-expressing E. coli prepared in Example 1, scraped and suspended in 15% glycerol and stored at -80°C, was inoculated. Culture was performed at 37°C for one day with gentle stirring to avoid foaming. 1 mL of the culture medium was dispensed into two 1.5 mL tubes (a) and (b) and two 2 mL screw-cap tubes (c) and (d) and centrifuged. The supernatant was then discarded, and 1 mL of sterile water was added to each tube for washing. Further centrifugation was performed to remove the supernatant, leaving only the bacterial precipitate. The enzyme was then extracted or bead crushed using the following method.
[0067] (a) 0.1 M Tris-HCl pH 9 + 1% Triton X-100 (b) 0.1 M Tris-HCl pH 9 + 1% SDS 100 μL each of (a) or (b) was added to the bacterial cells in a 1.5 ml tube, vortexed, and extracted for 1 hour at 50°C. (c) 10 zirconia beads (3 mm) (c) was added to the bacterial cells in a 2 ml screw-cap tube and stirred for 10 minutes at room temperature using a ballerina shaker, 100 μL of sterilized water was added, and the mixture was lightly centrifuged to recover the disrupted solution.
[0068] The results of microscopic observation of bacterial cells are shown in Figures 8A to 8C. In the case of extraction with Triton X-100 (a), the bacterial cells were neither disrupted nor lysed. On the other hand, in the case of SDS treatment (b), the boundaries of the E. coli cells became unclear and the cells were in a lysed state. Furthermore, in the case of bead-crushing treatment (c), the E. coli cells themselves were no longer visible. Therefore, it was confirmed that when the method for preparing the enzyme reaction solution of this invention is used, the treatment of the enzyme extract does not result in disruption or lysis of bacteria or yeast.
[0069] Next, (a) to (c) above were analyzed by SDS-PAGE in the same manner as in Example 1 to confirm the extraction of the enzyme or protein. 5 μL / lane of the extract (a) or (b) or the disrupted solution (c) was applied to the gel. The results are shown in FIG. 9.
[0070] In both cases, a band for Pfu DNA polymerase (Pfu enzyme) was confirmed. Furthermore, it was confirmed that in the case of (a) extraction with Triton X-100, the amount of contaminating proteins other than Pfu enzyme was smaller than in (b) and (c).
[0071] Furthermore, the extract (a) or (b) or the disrupted solution (c) was analyzed by agarose electrophoresis to confirm the presence of nucleic acid contamination. The results are shown in Figure 10.
[0072] When extracted with Triton X-100 (a), the extract contained almost no nucleic acids. On the other hand, when extracted with SDS (b), chromosome bands were observed at the top, as well as bands thought to be rRNA or tRNA at around 1.5 kb and 1 kb, and staining of 0.5 kb or less, thought to be broken RNA, was also observed. Furthermore, when beads were crushed (c), no chromosome bands were visible, the chromosomes themselves were destroyed, and staining of broken nucleic acids was observed widely. Therefore, it was confirmed that when the method for preparing the enzyme reaction solution of this invention is used, bacteria or yeast are not crushed or lysed by the treatment of the enzyme extract, and therefore almost no nucleic acid is extracted.
[0073] Furthermore, the enzymatic activity of the extracted enzyme was confirmed by amplifying a 711-bp polynucleotide encoding EGFP by PCR in the same manner as in Example 1. The results are shown in Figure 12.
[0074] In the case of (a) extraction with Triton X-100, PCR amplification products were confirmed. Therefore, this result also confirmed that the present method for preparing an enzyme reaction solution can prepare an enzyme reaction solution that retains enzyme activity without including a step of disrupting or lysing bacteria or yeast, and that an enzyme reaction product can be obtained by reacting the enzyme reaction solution with a substrate and carrying out the enzymatic reaction as is.
[0075] Example 7 Extraction of Enzyme from Escherichia coli and Confirmation of Activity In Example 1 above, DNA polymerase was extracted at pH 7, 8, 9, or 10, and further extraction of the enzyme at pH 5 and 6 and confirmation of its activity were carried out.
[0076] 50 μL of sterilized water was added to the Pfu DNA polymerase-expressing E. coli obtained by the method of Example 1, and the mixture was plated on an agar medium containing glucose, yeast extract, peptone, and ampicillin, spread with beads, and cultured for 1 day at 37° C. Approximately 3 cm of colonies that had grown on the agar medium were scraped off with a loop, inoculated into 200 mL of AB medium (Yamaguchi TLO), and cultured with shaking at 37° C. and 150 rpm for 20 hours.
[0077] The culture medium was dispensed into 12 1.5 mL tubes (1 mL each) and centrifuged at 12,000 rpm for 2 minutes to remove bacterial cells. The supernatant was discarded, and 1 mL of water was added to each tube. After stirring, the tubes were centrifuged at 12,000 rpm for 2 minutes to remove bacterial cells, and the supernatant was completely removed. 100 μL of each of the 12 extract solutions was added to each tube, stirred, and extracted at 50°C for 1 hour.
[0078] 5 μL of extract (0.1 M MOPS adjusted to pH 5, 6, or 7, or 0.1 M Tris-HCl adjusted to pH 7, 8, or 9, to which surfactant (Triton X-100) was added to a final concentration of 1%) was mixed with 1 μL of 6x sample buffer, placed on a heat block at 95°C for 5 minutes, and the entire volume was loaded. 3 μL of Precision Plus Protein Two-Color Standard (#1610374, Bio-Rad) was loaded as a protein marker, and SDS-PAGE was performed at 400 V for 32 minutes. The results are shown in Figure 12.
[0079] In Figure 12, the position of the arrow on the right side indicates the molecular weight position of Pfu DNA polymerase. A band was observed at the molecular weight position corresponding to Pfu DNA polymerase in all of the extracts from MOPS at pH 7 and Tris-HCl at pH 7, 8, and 9, confirming that Pfu DNA polymerase can be extracted without disrupting or lysing E. coli. On the other hand, almost no band was observed at the molecular weight position corresponding to Pfu DNA polymerase in MOPS at pH 5 and 6, confirming that it is difficult to extract Pfu DNA polymerase from MOPS at pH 5 and 6 without disrupting or lysing E. coli.
[0080] Furthermore, whether or not the Pfu DNA polymerase in the resulting enzyme reaction solution has enzymatic activity was confirmed by PCR reaction.
[0081] The PCR reaction solution was as follows: Enzyme reaction solution (pH 5, 6, 7, 8, 9) 0.2 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL 2×HC buffer (Helix Extension) 5.0 μL Deionized water 2.8 μL Total 10.0 μL
[0082] PCR reactions were performed for 30 cycles of 94°C for 10 seconds and 68°C for 150 seconds. RAK30647 (pCMVp-hHGF-BGHpA), in which the coding sequence of human hepatocyte growth factor (HGF) was inserted between the CMV promoter and BGH terminator, was used as template DNA, and a 3167-bp HGF expression region was amplified using eCMV-600 (35) (SEQ ID NO: 8) as the forward primer and BGHpA+225 (35) (SEQ ID NO: 9) as the reverse primer. DNA amplification by PCR indicates that the DNA polymerase has enzymatic activity.
[0083] Forward primer eCMV-600(35): GTAATCAATTACGGGGTCATTAGTTCATAGCCCAT (SEQ ID NO: 8) Reverse primer BGHpA+225c(35): CCATAGAGCCCACCGCATCCCCAGCATGCCTGCTA (SEQ ID NO: 9)
[0084] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 13. As shown in Figure 13, PCR amplification products were confirmed in all cases where PCR was performed using enzyme reaction solutions extracted at pH 7 to 10, confirming that the extracted DNA polymerase maintained its enzymatic activity. On the other hand, no PCR amplification products were confirmed when PCR was performed using enzyme reaction solutions extracted at pH 5 or 6. Therefore, it was revealed that at least when Pfu DNA polymerase was extracted at pH 7 to 9, the enzyme was extracted in a state where its activity was maintained, but that extraction at pH 5 or 6 was insufficient, or even if extraction was possible, the enzyme activity was not at a detectable level.
[0085] [Example 8] Extraction of enzyme (kinase) from yeast (2) In Example 4, an enzyme was extracted from yeast expressing the kinase ScADO1 while retaining its enzymatic activity to prepare an enzyme reaction solution. Next, it was investigated whether enzyme reaction solutions could be prepared for other enzymes using the same method for preparing an enzyme reaction solution.
[0086] Transformation was performed using yeast (Saccharomyces cerevisiae) as a host by the following method: An ScADK1-containing plasmid was prepared by incorporating a polynucleotide (SEQ ID NO: 10) encoding the Saccharomyces cerevisiae kinase ScADK1 in place of yEmRFP in the YHp plasmid (Misumi et al., Yeast Volume 36, Issue 5 Special Issue: May 2019 Pages 249-257), and an ScADK1-containing plasmid was prepared by incorporating a polynucleotide (SEQ ID NO: 11) encoding ScCDC19.
[0087] The ScADK1-containing plasmid and ScCDC19-containing plasmid were added to 30 μL of competent yeast cells, and the cells were transformed by heating at 42°C for approximately 30 minutes on a heat block. Then, 100 μL of sterile water was added, and the transformed yeast was plated on uracil-deficient synthetic medium, spread with beads, and cultured at 30°C for 3 days. The resulting colonies were scraped and inoculated into 10 mL of YPD medium in a 125 mL baffled Erlenmeyer flask, followed by shaking culture at 30°C for 1 day. The cells were then suspended in 5 mL of extraction solution prepared by adding a surfactant (Triton X-100) to a final concentration of 1% to 0.1 M Tris-HCl adjusted to pH 8 (used for ScADK1 extraction) or 0.1 M Tris-HCl adjusted to pH 9 (used for ScCDC19 extraction). The cells were then left to stand in an incubator at 30°C for 1 day, allowing ScADK1 or ScCDC19 to be extracted. The mixture was then centrifuged at 12,000 rpm for approximately 5 minutes, and the supernatant was used as an enzyme reaction solution (pH 8 or 9) for SDS-PAGE and the enzyme reaction described below. The results of SDS-PAGE of the resulting enzyme reaction solution are shown in Figure 14. Bands were observed at the positions corresponding to the molecular weights of ScADK1 and ScCDC19, confirming that ScADK1 and ScCDC19 could be extracted without destroying or lysing the yeast. The above surfactant treatment did not destroy the yeast cell wall or lyse the yeast.
[0088] The reaction from deoxyadenosine monophosphate (dAMP) to deoxyadenosine triphosphate (dATP) was examined using the ScADK1 enzyme reaction solution and the ScADK1 enzyme reaction solution extracted above.
[0089] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about a day to synthesize dATP, which was used as a dATP solution: 2 μL of 1 M Tris-HCl pH 8, 2 μL of 2.0 M KCl, and 2 μL of 100 mM MgCl. 2 2 μL 250 mM PEP (phosphoenolpyruvic acid) 4 μL 1 mM dATP 2 μL 100 mM dAMP 2 μL Enzyme reaction solution (ScADK1) prepared above: pH 8 2 μL Enzyme reaction solution (ScCDC19) prepared above: pH 9 2 μL Distilled water 2 μL Total 20 μL
[0090] Next, PCR was carried out using the following reaction solution: Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL, 1 M Tris-HCl pH 8.5 1.5 μL, the above dATP solution 0.5 μL, template DNA (1 ng / μL) 1.0 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, MgSO 4 (50 mM) 0.5 μL dGTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL
[0091] The PCR reaction was carried out in the same manner as in Example 5.
[0092] The results of PCR amplification products confirmed by agarose electrophoresis are shown in Figure 15. In Figure 15, each lane represents the case where a dATP solution was used in which dATP was synthesized by diluting the enzyme reaction solution (ScCDC19) at 1, 1 / 2, 1 / 4, or 1 / 8 dilutions. As is clear from Figure 15, PCR amplification products were obtained, confirming that the kinases ScADK1 and ScCDC19 extracted above have enzymatic activity. Furthermore, it was confirmed that deoxyadenosine triphosphate (dATP) was synthesized from deoxyadenosine monophosphate (dAMP).
[0093] If a specific enzyme is prepared using the enzyme reaction solution obtained by the present method for preparing an enzyme reaction solution, the specific enzyme can be used for enzymatic conversion of substances, test reagents, protein phosphorylation, phosphorylation of sugars such as glucose, conversion of NAD and NADH by dehydrogenase, acetylation, lipid loading, methylation, enzymatic cleavage, restriction enzyme production, polyphosphorylation, polyA addition, mRNA Cap addition, dephosphorylation, ligase, synthesis of amino acid metabolic enzymes, base modification, Cas9 production, etc.
Claims
1. A method for preparing an enzyme reaction solution by extracting a specific enzyme from bacteria or yeast that expresses the enzyme while retaining the enzyme's enzymatic activity, the method comprising the step of treating the bacteria or yeast with an enzyme extract, which is a 0.05-1.0 M buffer solution containing 0-3% of a nonionic surfactant or amphoteric surfactant and adjusted to a pH of 6-11, at 4-95°C for 0.1 hours to 4 days, and which does not include a step of crushing or lysing the bacteria or yeast.
2. The method according to claim 1, characterized in that the enzyme is extracted while retaining its enzymatic activity from a transformed bacterium or transformed yeast into which a polynucleotide encoding the predetermined enzyme has been incorporated.
3. The method according to claim 1 or 2, wherein the predetermined enzyme is an enzyme localized in the cytoplasm.
4. The method according to any one of claims 1 to 3, characterized in that it does not include a purification step of removing bacterial or yeast cell walls or nucleic acids after treatment with the enzyme extract to extract the specified enzyme.
5. The method according to any one of claims 1 to 4, wherein the enzyme reaction solution does not contain a surfactant.
6. A method for preparing an enzyme reaction solution by extracting a specific enzyme from bacteria expressing the enzyme while retaining the enzyme activity, comprising the step of treating the bacteria with an enzyme extract, which is a 0.05 to 1.0 M buffer solution containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 4 to 95°C for 0.1 hours to 4 days, and characterized in that the method does not include a step of crushing or lysing the bacteria.
7. The method according to claim 6, wherein the enzyme is extracted while retaining its enzymatic activity from a transformed bacterium into which a polynucleotide encoding the enzyme has been incorporated.
8. The method according to claim 6 or 7, characterized in that it does not include a purification step of removing bacterial cell walls or nucleic acids after treatment with the enzyme extract to extract the specified enzyme.
9. A method for producing an enzyme reaction product by enzymatically reacting a substrate with an enzyme reaction solution obtained by the method according to any one of claims 1 to 8.
10. The method according to claim 9, wherein the enzyme reaction solution is a DNA polymerase reaction solution prepared by extracting DNA polymerase, and a polymerase chain reaction (PCR) amplification product is prepared by enzymatically reacting the DNA polymerase reaction solution with deoxyribonucleoside triphosphates as substrates.
11. The method according to claim 9 or 10, wherein the enzyme reaction solution is a kinase reaction solution prepared by extracting a kinase, and the substrate and the kinase reaction solution are subjected to an enzymatic reaction to prepare a phosphate compound.
Citation Information
Patent Citations
Rapid expression and purification of thermostable proteins including TAQ polymerase
WO2023019197A1