Novel mutant l-threonine export protein and method for producing l-threonine by using same
A mutant L-threonine efflux protein with specific amino acid substitutions enhances L-threonine production by up to 47% in recombinant strains, addressing the efficiency limitations of wild-type proteins.
Patent Information
- Application Number
- PCT/KR2025/002522
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-29
- Filing Date
- 2025-02-24
- Publication Date
- 2025-09-04
AI Technical Summary
Existing L-threonine production methods in microorganisms are limited by the efficiency of wild-type L-threonine efflux proteins, leading to suboptimal yields.
Introduction of a mutant L-threonine efflux protein with specific amino acid substitutions at position 71, such as arginine, lysine, asparagine, and others, enhancing the protein's efflux ability.
The mutant L-threonine efflux protein significantly increases L-threonine production capacity in recombinant strains, achieving yields up to 47% higher than wild-type strains.
Abstract
Description
Novel mutant L-threonine excretion protein and method for producing L-threonine using the same
[0001] The present application relates to a mutant L-threonine excretion protein, an L-threonine-producing microorganism modified to express the protein, and a method for producing L-threonine using the same.
[0002]
[0003] L-threonine is an essential amino acid and has been widely used as a feed additive, a pharmaceutical raw material such as an infusion solution, and a health food material.
[0004] Microorganisms used for L-threonine production were initially mainly selected strains that exhibited resistance to analogues through chemical or physical mutations. However, with the rapid development of genetic recombination technology in the 1990s and the elucidation of molecular-level regulatory mechanisms, recombinant strains using genetic engineering techniques are now mainly used.
[0005] Meanwhile, expression of specific amino acid efflux genes has been observed to enhance the productivity of that amino acid in microorganisms. Enhanced expression of the L-lysine efflux gene (lysE) in a Corynebacterium spp. enhanced lysine productivity (WO9723597A2). Furthermore, enhancement of the rhtC gene in Escherichia coli enhanced resistance to L-threonine, while simultaneously enhancing the productivity of L-homoserine, L-threonine, and L-leucine (EP1013765A1).
[0006]
[0007] The present inventors completed the present application by confirming that when culturing a microorganism producing L-threonine using a mutant of an L-threonine efflux protein, high yield L-threonine production is possible compared to a microorganism having an existing wild-type efflux protein.
[0008]
[0009] One object of the present application is to provide a mutant L-threonine efflux protein comprising a substitution of an amino acid corresponding to position 71 of the amino acid sequence of SEQ ID NO: 1 with another amino acid.
[0010] Another object of the present application is to provide a polynucleotide encoding the protein.
[0011] Another object of the present application is to provide a vector comprising the polynucleotide.
[0012] Another object of the present application is to provide a microorganism comprising the protein, polynucleotide, or vector.
[0013] Another object of the present application is to provide a method for producing L-threonine, comprising a step of culturing the microorganism in a medium.
[0014] Another object of the present application is to provide a composition for producing L-threonine comprising the protein, polynucleotide, vector, microorganism, culture of microorganism or a combination of two or more thereof.
[0015]
[0016] When a microorganism producing L-threonine is cultured using a mutant of the L-threonine efflux protein of the present application, high yield L-threonine production is possible compared to a microorganism having an existing wild-type efflux protein.
[0017]
[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.
[0019]
[0020] One aspect of the present application provides a mutant L-threonine efflux protein comprising a substitution of an amino acid corresponding to position 71 of the amino acid sequence of SEQ ID NO: 1 with another amino acid.
[0021] The mutant L-threonine excretion protein of the present application may have an amino acid at position 71 in the amino acid sequence of SEQ ID NO: 1 substituted with an amino acid different from the amino acid before substitution.
[0022] The above "substitution with another amino acid" is not limited to an amino acid different from the amino acid prior to substitution. Furthermore, when the present application expresses that "a specific amino acid has been substituted," it is self-evident that the amino acid has been substituted with an amino acid different from the amino acid prior to substitution, even if it is not specifically stated that it has been substituted with another amino acid.
[0023] Specifically, the mutant L-threonine excretion protein may be one in which the amino acid corresponding to position 71 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of arginine, lysine, asparagine, aspartic acid, glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, glutamic acid, and glutamine, but is not limited thereto.
[0024] More specifically, the mutant L-threonine excretion protein may be one in which the amino acid corresponding to position 71 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of arginine, lysine, aspartic acid, glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, glutamic acid, and glutamine.
[0025] More specifically, the mutant L-threonine excretion protein may be one in which the amino acid corresponding to position 71 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of arginine, tyrosine, asparagine, tryptophan, glutamic acid, isoleucine, proline, phenylalanine, serine, methionine, glycine, valine, and aspartic acid.
[0026] More specifically, the mutant L-threonine excretion protein may be one in which the amino acid corresponding to position 71 in the amino acid sequence of sequence number 1 is substituted with an amino acid selected from the group consisting of arginine, tyrosine, asparagine, tryptophan, glutamic acid, isoleucine, proline, phenylalanine, serine, and methionine.
[0027] The mutant L-threonine efflux protein of the present application may have, comprise, consist of, or consist essentially of an amino acid sequence set forth in any one of SEQ ID NOs: 3 to 21.
[0028] The protein to be subjected to mutation introduction in the present application may be a protein having L-threonine excretion activity. Specifically, the protein may comprise the amino acid sequence of SEQ ID NO: 1 and have threonine excretion activity, but is not limited thereto.
[0029] In addition, it does not exclude meaningless sequence additions before and after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and if it has the same or corresponding activity as a protein including the amino acid sequence of SEQ ID NO: 1, it may correspond to a protein that is the target of mutation introduction of the present application. For example, the protein that is the target of mutation introduction of the present application may be a protein composed of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. In addition, if it is an amino acid sequence that has such homology or identity and exhibits an effect corresponding to the protein, it is obvious that a protein that has an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the protein that is the target of mutation of the present application.
[0030] The mutant L-threonine efflux protein of the present application may include an amino acid sequence in which the amino acid corresponding to position 71 of the amino acid sequence of SEQ ID NO: 1 is an amino acid other than histidine, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence described in SEQ ID NO: 1. In addition, it is obvious that a mutant L-threonine efflux protein having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the mutant L-threonine efflux protein of the present application.
[0031] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the mutant L-threonine efflux protein of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.
[0032] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
[0033] For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; and amino acids having uncharged side chains include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
[0034] As used herein, the term "variant protein" or "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The term "variant protein" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. For the purpose of the present application, the variant may be a polypeptide in which the amino acid corresponding to position 71 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. Specifically, the variant may be a polypeptide comprising any one of the amino acid sequences set forth in SEQ ID NOs: 3 to 21, but is not limited thereto.
[0035] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.
[0036] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.
[0037] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.
[0038] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information database.
[0039] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a unitary matrix (containing values of 1 for identity and 0 for non-identity) and (2) a matrix of 1s for identity and 0 for non-identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0040] As an example of the present application, the mutant L-threonine efflux protein of the present application may have improved efflux ability compared to a wild-type polypeptide having L-threonine efflux protein activity.
[0041] As another example of the present application, the mutant L-threonine efflux protein of the present application may have an activity that increases L-threonine production ability compared to a wild-type polypeptide having L-threonine efflux protein activity.
[0042] In this application, the term "L-threonine efflux protein" refers to a membrane protein having L-threonine efflux activity, and may be used interchangeably with RhtC. The amino acid sequence of RhtC can be obtained from a known database such as NCBI's Genebank.
[0043] For example, RhtC of the present application may be of microbial origin, specifically, may be of prokaryotic microbial origin, and more specifically, may be of Escherichia coli or the like, but may be a protein having L-threonine excretion activity of various origins. In the amino acid sequence before modification of RhtC to be mutated in the present application, the amino acid before modification corresponding to position 71 of SEQ ID NO: 1 may be histidine (H).
[0044] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.
[0045] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).
[0046] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.
[0047]
[0048] In one embodiment, the variant L-threonine efflux protein of the present application may additionally include a substitution of an amino acid corresponding to position 62 of the amino acid sequence of SEQ ID NO: 1 with another amino acid. For example, the 62nd amino acid may be substituted with an amino acid selected from serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid, or tryptophan. For example, the 62nd amino acid may be serine. For example, the variant L-threonine efflux protein of the present application may have, include, consist of, or consist essentially of the amino acid sequence set forth in SEQ ID NO: 72.
[0049] In one embodiment, the variant L-threonine efflux protein of the present application may have an amino acid corresponding to position 62 of the amino acid sequence of SEQ ID NO: 1 as leucine or serine.
[0050]
[0051] Another aspect of the present application provides a polynucleotide encoding a mutant L-threonine efflux protein of the present application.
[0052] The rhtC gene of the present application may include any gene known to encode a protein having RhtC activity.
[0053] Specifically, the rhtC gene of the present application may be a rhtC gene derived from Escherichia coli. For example, the rhtC gene of the present application may be a polynucleotide encoding WP_000928824.1 derived from Escherichia coli.
[0054] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the mutant L-threonine efflux protein.
[0055] The polynucleotide encoding the mutant L-threonine efflux protein of the present application may include a base sequence encoding a mutant L-threonine efflux protein in which the amino acid corresponding to position 71 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, or may include a base sequence in which the codon corresponding to positions 211 to 213 in the nucleotide sequence of SEQ ID NO: 2 is substituted with a codon encoding a different amino acid. Specifically, the polynucleotide of the present application may include a base sequence encoding the amino acid sequence set forth in SEQ ID NOs: 3 to 21.
[0056] For example, the polynucleotide encoding the mutant L-threonine efflux protein may include a base sequence encoding the mutant L-threonine efflux protein that additionally includes a substitution of an amino acid corresponding to position 62 in the amino acid sequence of SEQ ID NO: 1 with another amino acid, or may include a base sequence in which a codon corresponding to positions 184 to 186 in the nucleotide sequence of SEQ ID NO: 2 is substituted with a codon encoding another amino acid. Specifically, the polynucleotide of the present application may include a base sequence encoding an amino acid sequence set forth in SEQ ID NO: 72.
[0057] The polynucleotide of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the mutant L-threonine efflux protein of the present application, taking into account the degeneracy of the codon or the preferred codon of the organism to which the mutant L-threonine efflux protein of the present application is to be expressed. Specifically, the polynucleotide encoding the mutant L-threonine efflux protein of the present application may have, include, consist of, or consist essentially of a base sequence having a homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% with the sequence of SEQ ID NO: 2, but is not limited thereto. At this time, in the sequence having the above homology or identity, the codon encoding the amino acid corresponding to the 71st position of sequence number 1 may be one of the codons encoding an amino acid other than histidine.
[0058] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1YSSC, 0.1% SDS, specifically 60°C, 0.1YSSC, 0.1% SDS, and more specifically 68°C, 0.1YSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.
[0059] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.
[0060] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.
[0061] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).
[0062]
[0063] Another aspect of the present application provides a vector comprising a polynucleotide encoding a mutant L-threonine efflux protein of the present application. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a host cell.
[0064] The vector of the present application may comprise a DNA construct comprising the base sequence of the target polynucleotide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polynucleotide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome, and may be integrated into the genome itself.
[0065] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.
[0066] For example, a target polynucleotide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.
[0067] The term "transformation" in this application refers to introducing a target polynucleotide or a vector containing the same into a host cell or microorganism so that the polynucleotide can be expressed within the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
[0068] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target mutant L-threonine efflux protein of the present application.
[0069]
[0070] Another aspect of the present application provides a microorganism comprising a mutant L-threonine efflux protein of the present application; a polynucleotide encoding the mutant L-threonine efflux protein; or a vector comprising the polynucleotide.
[0071] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.
[0072] The strain of the present application may be a strain that naturally has L-threonine production ability, or a microorganism in which L-threonine production ability is conferred on a strain that does not have L-threonine production ability. For example, it may be a microorganism in which the mutant L-threonine excretion protein of the present application or a polynucleotide encoding the same is introduced, thereby enhancing L-threonine excretion ability, but is not limited thereto.
[0073] The strain of the present application may be a microorganism having increased L-threonine production capacity compared to a parent strain or a wild-type Corynebacterium strain that does not include the variant of the present application. The microorganism may have an increased L-threonine production capacity due to an increased L-threonine excretion capacity caused by the introduction of the variant of the present application.
[0074] For example, the target strain for comparing the increase in L-threonine production ability, the L-threonine efflux protein unmodified microorganism, may be, but is not limited to, the L-threonine producing strain Corynebacterium glutamicum CA09-0903 strain (Accession No. KCCM12502P, US 2022-0356480 A1), Corynebacterium glutamicum KFCC10881-THR (Accession No. KCCM11222P, US 10590446 B2), and Corynebacterium glutamicum KCCM12485P (US 2022-0170059 A1).
[0075] For example, the recombinant strain with increased productivity may have an L-threonine productivity of about 1% or more, specifically, about 1% or more, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 32.5% or more, about 35% or more, about 37.5% or more, about 40% or more, about 42.5% or more, about 45% or more, about 46% or more, or about 47% or more (the upper limit is not particularly limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less) increased compared to the L-threonine productivity of the parent strain or the non-mutated microorganism before mutation. As long as there is a positive increase in the production capacity of L-threonine efflux protein compared to that of an unmodified microorganism, it is not limited thereto. In another example, the recombinant strain with increased L-threonine productivity may have an L-threonine productivity increased by about 1.01 times or more, about 1.05 times or more, about 1.10 times or more, about 1.15 times or more, about 1.20 times or more, about 1.25 times or more, about 1.30 times or more, about 1.325 times or more, about 1.35 times or more, about 1.375 times or more, about 1.40 times or more, about 1.425 times or more, about 1.45 times or more, about 1.46 times or more, or about 1.47 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less), but is not limited thereto.
[0076] In the present application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. In addition, the term "unmodified L-threonine efflux protein microorganism" in the present application may refer to a strain that is not introduced or before the L-threonine efflux protein variant described herein is introduced. The unmodified L-threonine efflux protein microorganism in the present application does not exclude a strain that contains a modification of a protein or another gene other than a modification of the L-threonine efflux protein or a polynucleotide encoding the same.
[0077] In this application, the term “unmodified microorganism” may be used interchangeably with “pre-modified strain”, “pre-modified microorganism”, “unmodified strain”, “unmodified microorganism”, or “reference microorganism”.
[0078] The microorganism of the present application may be, but is not limited to, a microorganism comprising a mutant L-threonine efflux protein or a polynucleotide encoding the same; or a microorganism genetically modified to include a mutant L-threonine efflux protein or a polynucleotide encoding the same (e.g., a recombinant microorganism). The term "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by a parent strain, wild type, or unmodified microorganism before a change in phenotype, when the phenotype is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification."
[0079] In another example of the present application, the microorganism of the present application is Corynebacterium stationis, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.
[0080] As another example, the recombinant microorganism of the present application may be a microorganism with enhanced L-threonine production ability by further enhancing the activity of a portion of a protein in the L-threonine biosynthesis pathway or by further weakening the activity of a portion of a protein in the L-threonine degradation pathway.
[0081] Specifically, in order to enhance the biosynthetic pathway of the L-threonine, the expression of, for example, the thrC gene encoding threonine synthetase, the ppc gene encoding phosphoenolpyruvate carboxylase, the galP gene involved in glucose uptake, the lysC gene encoding lysine-sensitive aspartokinase 3, the hom gene encoding homoserine dehydrogenase, or the pyc gene inducing an increase in the oxaloacetate pool can be enhanced or increased in the microorganism.
[0082] To relieve the feedback inhibition of L-threonine, a genetic mutation can be introduced, for example, into the lysC gene, the hom gene, or the thrA gene, which has the dual function of aspartokinase and homoserine dehydrogenase 1.
[0083] In order to inactivate genes that weaken the biosynthetic pathway of L-threonine, for example, the expression of the pckA gene involved in converting oxaloacetate (OAA), an intermediate of L-threonine biosynthesis, into phosphoenolpyruvate (PEP), the tyrR gene that represses the lysC gene, the galR gene that represses the expression of the galP gene involved in glucose uptake, or the mcbR gene, a DNA-binding transcriptional dual regulator, can be weakened or inactivated in the microorganism.
[0084] In order to increase the activity of the above L-threon, a plasmid containing a threonine operon composed of genes encoding aspartokinase, homoserine dehydrogenase, homoserine kinase, and threonine synthase, or a threonine operon derived from Escherichia coli, etc., can be introduced into a microorganism (TURBA E, et al, Agric. Biol. Chem. 53:2269~2271, 1989), thereby increasing the expression of the threonine operon in the microorganism.
[0085] Additionally, it may confer resistance to L-threonine analogs such as α-amino-β-hydroxyvaleric acid or D,L-threonine hydroxamate.
[0086] In addition, the dapA (dihydrodipicolinate synthase), lysA (diaminopimelate decarboxylase), and ddh (diaminopimelate dehydrogenase) genes, which are genes that act in the biosynthetic pathway of L-lysine, which has a common precursor with L-threonine, can be weakened.
[0087] However, without limitation thereto, L-threonine production can be enhanced by any gene expression control method known in the art.
[0088] In this application, the term "attenuation" of the activity of a polypeptide (including, for example, proteins specified by the name of each enzyme) includes both a decrease in activity or absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0089] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The fact that the activity of the polypeptide is “inactivated, deficient, reduced, downregulated, reduced, attenuated” compared to the intrinsic activity means that the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation is lowered.
[0090] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
[0091]
[0092] Specifically, the weakening of the activity of the polypeptide of the present application is
[0093] 1) Deletion of all or part of a gene encoding a polypeptide;
[0094] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;
[0095] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;
[0096] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);
[0097] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0098] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;
[0099] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;
[0100] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE);
[0101] 9) Control of cellular localization of proteins (polypeptides); or
[0102] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0103] for example,
[0104] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.
[0105] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0106] The modification of the amino acid sequence or polynucleotide sequence of the above 3) and 4) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of the gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.
[0107] The above 5) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0108] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0109] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.
[0110] In addition, the addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0111] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.
[0112] Such attenuation of polypeptide activity may be, but is not limited to, attenuation of the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of the product produced from the polypeptide.
[0113]
[0114] In this application, the term "enhancement" of the activity of a polypeptide means that the activity of the polypeptide is increased compared to the intrinsic activity. The term "enhancement" may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or the activity before modification. "Enhancement," "up-regulation," "overexpression," or "increase" of the activity of a polypeptide compared to the intrinsic activity means that the activity and / or concentration (expression amount) of a specific polypeptide is enhanced compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had before the transformation.
[0115] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.
[0116] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0117] Specifically, the enhancement of the activity of the polypeptide of the present application is
[0118] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;
[0119] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;
[0120] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0121] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;
[0122] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);
[0123] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;
[0124] 7) Codon optimization of a polynucleotide encoding a polypeptide;
[0125] 8) Analysis of the tertiary structure of the polypeptide to select the exposed portion and modify or chemically modify it;
[0126] 9) Control of cellular localization of proteins (polypeptides); or
[0127] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0128] More specifically,
[0129] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.
[0130] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.
[0131] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.
[0132] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0133] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.
[0134] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0135] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.
[0136] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0137] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.
[0138] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0139] In the microorganism of the present application, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.
[0140] In the microorganism of the present application, the mutant L-threonine excretion protein, polynucleotide, and L-threonine, etc. are as described in the other aspects above.
[0141]
[0142] Another aspect of the present application provides a method for producing L-threonine, comprising the step of culturing a microorganism in a medium, the microorganism comprising a mutant L-threonine efflux protein of the present application; a polynucleotide encoding the mutant L-threonine efflux protein; or a vector comprising the polynucleotide.
[0143] In this application, the term "cultivation" refers to growing the microorganism of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected microorganism. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0144] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the microorganism of this application, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.
[0145] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0146] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0147] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0148] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.
[0149] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.
[0150] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.
[0151] L-threonine produced by the culture of the present invention may be secreted into the medium or remain within the cells.
[0152]
[0153] The method for producing L-threonine of the present application may additionally include a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, before the culturing step.
[0154] The method for producing L-threonine of the present application may further include a step of recovering L-threonine from the culture medium (medium in which culture is performed) or the Corynebacterium glutamicum strain according to the above-described cultivation. The recovering step may be additionally included after the culturing step.
[0155] The above recovery may be performed by collecting the target L-threonine using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target L-threonine may be recovered from the medium or microorganism using a suitable method known in the art.
[0156] Additionally, the L-threonine production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the L-threonine production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0157] In the method of the present application, the mutant L-threonine efflux protein, polynucleotide, vector, strain, etc. are as described in the other embodiments above.
[0158]
[0159] Another aspect of the present application provides a composition for producing L-threonine, comprising a mutant L-threonine excretion protein of the present application, a polynucleotide encoding the same, a vector comprising the polynucleotide, or a microorganism comprising the polynucleotide of the present application; a medium for culturing the same; or a combination of two or more thereof.
[0160] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing L-amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.
[0161]
[0162] Another aspect of the present application provides a use of a mutant L-threonine efflux protein of the present application, a polynucleotide encoding the same, a vector comprising the polynucleotide, or a microorganism comprising the polynucleotide of the present application for producing L-threonine.
[0163] The above L-threonine efflux protein, mutant L-threonine efflux protein, polynucleotide, vector, strain, medium, and L-threonine, etc. are as described in the other embodiments above.
[0164] Another aspect of the present application provides a use of the mutant L-threonine efflux protein of the present application for producing L-threonine.
[0165]
[0166] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following examples.
[0167]
[0168] Example 1: Construction and Screening of a Library of L-Threonine Excretion Protein Mutants
[0169] Example 1-1: Production of a library of L-threonine efflux protein mutants
[0170]
[0171] To prepare a template for error-prone PCR, a wild-type rhtC sequence fragment (SEQ ID NO: 2) encoding an L-threonine efflux protein was obtained by PCR from Escherichia coli W3110 genomic DNA using Primers 1 and 2. In addition, to obtain the rhtC promoter from E. coli W3110 genomic DNA, a PrhtC sequence fragment (SEQ ID NO: 22) was obtained by PCR using Primers 3 and 4.
[0172]
[0173] Primer base sequencePrimer 1 (rhtC F)TTCCCCCGCGAGTCAAATGTATGTTGATGTTATTTCTCACPrimer 2 (rhtC R)GAATTCGAGCTCGGTACCCTCACCGCGAAATAATCAAATPrimer 3 (PrhtC F)GTCGACTCTAGAGGATCCCCGATCGCAAACTGTTCGCCAAPrimer 4 (PrhtC R)GTGAGAAATAACATCAACATACATTTGACTCGCGGGGGAA
[0174] Cloning was performed using the Gibson assembly method using the DNA fragments obtained above and pCL1920 (Nucleic Acids Rersearch, 18, (1990) 4631) digested with SmaI restriction enzyme. Specifically, cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and storing it at 50°C for 1 hour, and as a result, the recombinant plasmid pCL1920-Pn_rhtC was obtained.
[0175]
[0176] Error-prone PCR was performed to induce random mutagenesis in the wild-type rhtC polynucleotide encoding L-threonine efflux protein. The diversify PCR random mutagenesis kit (Takara) was used for error-prone PCR. Error-prone PCR was performed under two conditions depending on the MnSO4 concentration to select the mutation rate condition, and the composition of the composition according to each condition is shown in Table 2. The pCL1920-Pn_rhtC constructed above was used as a DNA template to introduce mutations, and primer 1 and primer 2 were used as primers. Error-prone PCR conditions are as follows. A series of processes of denaturation at 95°C for 30 seconds, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and DNA polymerization at 68°C for 30 seconds were repeated 25 times, and then DNA polymerization reaction was performed at 68°C for 60 seconds.
[0177]
[0178] case #1 (μl)2 (μl)10X Titanium taq Buffer55MnSO4(8mM)12dGTP (2mM)1150
[0179] The error-induced PCR product performed under the conditions of Table 2 above was treated with DpnI to remove the template plasmid, and the DNA was cloned using the Gibson assembly method into pCL1920-PrhtC digested with SmaI restriction enzyme to obtain a recombinant mutant plasmid library (pCL1920-Pn_rhtC(mt)).
[0180]
[0181] Example 1-2: Construction of strains for screening L-threonine efflux protein mutant library
[0182]
[0183] Escherichia coli W3110 (ΔrhtABC) was constructed to screen the recombinant mutant plasmid library constructed above.
[0184] To remove the rhtBC gene in E. coli, the genomic DNA of Escherichia coli W3110 was used as a template, and the base sequence was amplified by PCR using Primer 5 and Primer 6 and Primer 7 and Primer 8 for the upper and lower homologous region fragments of rhtBC, respectively.
[0185]
[0186] Primer base sequencePrimer 5GCTGCAGGAATTCGATCCGCCAGATCATCAACATAPrimer 6TTTTTTGTCTCTCGATATCCCCAGCCAAATCAAGTAPrimer 7ACTTGATTTGGCTGGGGATATCGAGAGACAAAAAAGPrimer 8AGGTCGACTAGCGTGATAGGAGCCGTGCGGGAAC
[0187] The two fragments obtained through the above PCR process and the chromosomal transformation vector pSKH130 digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named pSHK130ΔrhtBC. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and then storing it at 50°C for 1 hour.
[0188] Similarly to the above method, to remove the rhtA gene in E. coli, the genomic DNA of the W3110 strain was used as a template, and the base sequences of the upper and lower homologous region fragments of rhtA were amplified using Primer 9 and Primer 10, and Primer 11 and Primer 12, respectively.
[0189]
[0190] Primer base sequencePrimer 9TGCAGGAATTCGATAAAGAACCGATCACACCCAGCGGPrimer 10AGAGCGGTCGAGAGAATAGATATCTCCTTTCTCCCAPrimer 11TGGGAGAAAGGAGATATCTATTCTCTCGACCGCTCTPrimer 12AGCTAGGTCGACTAGCGTGATGGCTATGTGTTCCG
[0191] The two fragments obtained through the above PCR process and the chromosomal transformation vector pSKH130 digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named pSHK130ΔrhtA. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and then storing it at 50°C for 1 hour.
[0192] The constructed pSHK130ΔrhtA and pSHK130ΔrhtBC vectors were transformed into E. coli W3110 by electroporation, and the E. coli W3110 (ΔrhtABC) strain was obtained on the chromosome through a second crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using primers of sequence numbers Primer 13 and Primer 14, and Primer 15 and Primer 16, which can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, respectively.
[0193]
[0194] Primer base sequencePrimer 13GATTTAACTAATTTAGCGGPrimer 14CCGCTTCTAATCACTTTGGPrimer 15GGCTGAACCTCCTGCTGCCPrimer 16CAGCAATACCAGACGACGG
[0195]
[0196] Example 1-3: Productivity screening of a library of L-threonine efflux protein mutants.
[0197]
[0198] The mutant library (pCL1920-Pn_rhtC(mt)), pCL1920-Pn_rhtC(WT), and pCL1920 obtained in the above Example 1-1 were transformed into W3110(ΔrhtABC) strain and plated on LB plate medium containing 50 μg / L spectinomycin. Fifty colonies were selected from W3110(ΔrhtABC) transformed with the mutant library, and sequencing was performed to determine the mutation rate and the presence or absence of mutations at various positions in the selected colonies. The sequencing results showed that the mutation rate under case #1 condition was 1.2 kb-1, and under case #2 condition was 2.0 kb-1. Both cases #1 and #2 were judged to have mutation occurrence rates suitable for securing a mutant library, and a valid mutation screening process was performed using the libraries produced under the above conditions.
[0199] The K12 strains transformed with the pCL-Pn_rhtC(WT) and pCL-Pn_rhtC(mt) libraries obtained in Example 1-1 were each inoculated onto the M9 medium in a 96-Deep Well Plate-Dome (Bioneer) and cultured in a plate shaking incubator (TAITEC) at 35°C and 12,000 rpm for about 15 hours. Approximately 1,000 cultured colonies were serially diluted in a seed medium containing 80 g / L of L-threonine and subjected to an MIC (minimum inhibitory concentration) test. Through this, 19 strains with significantly higher MIC values compared to the comparative strain into which the wild-type rhtC gene was introduced were subjected to sequence confirmation and additional experiments. When the screening force was applied through the MIC test, 7 clones with better growth than the wild type were selected based on the OD value.
[0200] : Selected mutant strains (threonine 80g / L)Strain name ODK12 / pCL1920-Pn_rhtC0.04K12 / pCL1920-Pn_rhtC mutant library (4-1 A3)0.69K12 / pCL1920-Pn_rhtC mutant library (4-1 A5)0.68K12 / pCL1920-Pn_rhtC mutant library (4-1 B3)0.76K12 / pCL1920-Pn_rhtC mutant library (4-2 A2)0.60K12 / pCL1920-Pn_rhtC mutant library (4-2 A3)0.57K12 / pCL1920-Pn_rhtC mutant library (4-2 B9)0.75K12 / pCL1920-Pn_rhtC mutant library (4-2 D5)0.74
[0201] After extracting the pCL1920-Pn_rhtC mutant plasmid from the above-mentioned seven mutant strains, sequencing was performed to confirm the mutation, and it was confirmed that the mutation occurred in the coding sequence (CDS) rather than the promoter region. Then, the mutant plasmids mentioned in Table 6 were named from top to bottom as pCL190-Pn_rhtC(m1), pCL190-Pn_rhtC(m2), pCL190-Pn_rhtC(m3), pCL190-Pn_rhtC(m4), pCL190-Pn_rhtC(m5), pCL190-Pn_rhtC(m6), and pCL190-Pn_rhtC(m7).
[0202]
[0203] Example 2: Production of an L-threonine-producing strain with a mutant L-threonine efflux protein and evaluation of its productivity.
[0204] Example 2-1: Construction of a plasmid for expression of a mutant L-threonine efflux protein
[0205]
[0206] To compare and evaluate the activity of mutant rhtC in Corynebacterium strains, insertion plasmids were constructed using the following method.
[0207] For homologous recombination, the upstream and downstream regions of Ncgl2392 were amplified with Primer 17 and Primer 18, and Primer 19 and Primer 20, respectively. To utilize the gapA promoter as a promoter of mutant rhtC, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and the primers of Primer 21 and Primer 22. To secure fragments of mutant rhtC selected in Table 2, primers of Primer 23 and Primer 24 were used to obtain fragments of rhtC, rhtC(m1), rhtC(m2), rhtC(m3), rhtC(m4), rhtC(m5), rhtC(m6), and rhtC(m7), respectively.
[0208]
[0209] Primer base sequencePrimer 17ATTCGAGCTCGGTACCCATGAAGTCTACCGGCAACPrimer 18CAACTCACACTGGCTTCAACACCCCAATGACATACACPrimer 19GTGTATGTCATTGGGGTGTTGAAGCCAGTGTGAGTTPrimer 20CTGAGAAATAACATCAACATGTGTCTCCTCTAAAGATTGTPrimer 21ACAATCTTTAGAGGAGACACATGTTGATGTTATTTCTCAPrimer 22GTGACCACTTATGCTCATCTCACCGCGAAATAATCAAATGPrimer 23TTTGATTATTTCGCGGTGAGATGAGCATAAGTGGTCACACAPrimer 24CGACTCTAGAGGATCCCCTTAGAGTGCATTGATCTTAT
[0210] Seven wild-type and mutant rhtC recombinant plasmids were obtained by cloning the PCR fragments obtained through the above process and the pDC24 vector (SEQ ID NO: 73) for chromosomal transformation digested with SmaI restriction enzyme using the Gibson assembly method. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and then storing it at 50°C for 1 hour. The constructed plasmids were named pDC24-PgapA_rhtC, pDC24-PgapA_rhtC(m1), pDC24-PgapA_rhtC(m2), pDC24-PgapA_rhtC(m3), pDC24-PgapA_rhtC(m4), pDC24-PgapA_rhtC(m5), pDC24-PgapA_rhtC(m6), and pDC24-PgapA_rhtC(m7), respectively.
[0211]
[0212] Example 2-2: Production of an L-threonine-producing strain with a mutant L-threonine excretion protein and evaluation of L-threonine productivity.
[0213]
[0214] The pDC24-PgapA_rhtC, pDC24-PgapA_rhtC(m1), pDC24-PgapA_rhtC(m2), pDC24-PgapA_rhtC(m3), pDC24-PgapA_rhtC(m4), pDC24-PgapA_rhtC(m5), pDC24-PgapA_rhtCm6), and pDC24-PgapA_rhtC(m7) vectors constructed in Example 2-1 were transformed into the KCCM12485P (US 2022-0170059 A1) strain by electroporation, and then, through a second crossing process, each strain in which the wild-type rhtC and seven mutant rhtC genes were inserted on the chromosome was obtained. The genetic manipulation was confirmed by PCR using Primer 25 and Primer 26, which can amplify external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, respectively, and genome sequencing.
[0215]
[0216] Primer sequencePrimer 25CTGGGCTAGCGGTGTAGACPrimer 26CTGTGGTTCTTTGGCATCA
[0217] The obtained transformed strains were named Cgl-Thr-1, Cgl-Thr-1(m1), Cgl-Thr-1(m2), Cgl-Thr-1(m3), Cgl-Thr-1(m4), Cgl-Thr-1(m5), Cgl-Thr-1(m6), and Cgl-Thr-1(m7), respectively.
[0218]
[0219] Additionally, in order to confirm the effect of introducing mutant rhtC into Corynebacterium strains, the L-threonine production of the resulting transformed strains, Cgl-Thr-1, Cgl-Thr-1(m1), Cgl-Thr-1(m2), Cgl-Thr-1(m3), Cgl-Thr-1(m4), Cgl-Thr-1(m5), Cgl-Thr-1(m6), and Cgl-Thr-1(m7), was compared by culturing them using the following method. Each strain was inoculated into a 250-mL corner-baffle flask containing 25 mL of production medium (70 g of raw sugar, 20 g of (NH4)2SO4, 1.2 g of MgSO47H2O, 1.1 g of KH2PO4, 900 μg of biotin, 4500 μg of thiamine hydrochloride, 4500 μg of calcium-pantothenic acid, 30 g of CaCO3, pH 7.0 (based on 1 L of distilled water)) and cultured at 35°C for 24 hours with shaking at 200 rpm. After completion of culture, the production amount of L-threonine was measured by HPLC, and the results are shown in Table 9.
[0220]
[0221] : L-threonine production of Corynebacterium strains introducing mutant rhtC Strain name L-threonine production (g / L) L-threonine yield (*100 g / g, %) KCCM12485P2.84 Cgl-Thr-19.6 13.7 Cgl-Thr-1(m1) 12.5 17.9 Cgl-Thr-1(m2) 14.9 2 1.3 Cgl-Thr-1(m3) 13.1 18.7 Cgl-Thr-1(m4) 12.3 17.6 Cgl-Thr-1(m5) 11.0 15.7 Cgl-Thr-1(m6) 9.8 14 Cgl-Thr-1(m7) 10.3 14.7
[0222] As shown in Table 9, KCCM12485P showed a production result of 2.8 g / L of L-threonine, and Cgl-Thr-1, into which the PgapA_rhtC wild-type trait was introduced, produced 9.6 g / L of L-threonine. And Cgl-Thr-1(m1), Cgl-Thr-1(m2), Cgl-Thr-1(m3), Cgl-Thr-1(m4), Cgl-Thr-1(m5), Cgl-Thr-1(m6), and Cgl-Thr-1(m7) with the PgapA_rhtC mutant trait inserted produced 12.5 g / L, 14.9 g / L, 13.1 g / L, 12.3 g / L, 11.0 g / L, 9.8 g / L, and 10.3 g / L of L-threonine, respectively.
[0223] In terms of L-threonine fermentation yield, Cgl-Thr-1 showed a 9.7%p increase compared to KCCM12485P, while the Cgl-Thr-1(m1), Cgl-Thr-1(m2), Cgl-Thr-1(m3), Cgl-Thr-1(m4), Cgl-Thr-1(m5), Cgl-Thr-1(m6), and Cgl-Thr-1(m7) strains to which the mutants were applied showed increases of 4.2%p, 7.6%p, 5.0%p, 3.9%p, 2.0%p, 0.3%p, and 1.0%p compared to Cgl-Thr-1, respectively. In particular, Cgl-Thr-1(m3) showed the greatest yield increase.
[0224] The Cgl-Thr-1(m3) strain contained a RhtC coding sequence in which the codon CAT, which codes for histidine (His) at position 71, was changed to the codon CGT, which codes for arginine (Arg).
[0225]
[0226] Example 3: Saturated mutagenesis of histidine, amino acid 71 of L-threonine efflux protein.
[0227]
[0228] As mentioned in Tables 6 and 9, the mutant form of rhtC (H71R) showed a higher yield increase effect than the wild type, so we tried to verify the effectiveness of improving the excretion of L-threonine at position 71 by mutating histidine, the 71st amino acid of rhtC, to other amino acids. In order to mutate histidine to 19 other amino acids other than histidine, site-directed mutagenesis was performed using pDC24-PgapA_rhtC constructed in Example 1 as a template using the method below.
[0229]
[0230] : Composition of PCR reaction composition for site-specific mutagenesis Composition (μl) 10X pfu-X Buffer 5 10 mM dNTP Mix 1 pfu-X Polymerase 1 Mutagenic forward primer (5 pmol) 2 Mutagenic reverse primer (5 pmol) 2 pDC24-PgapA_rhtC (template DNA, 200 ng / μl) 1 dH2O 3 8 Total 50
[0231] : PCR conditions for site-specific mutation generation Number of cycles Temperature Time 1 cycle 95℃ 5 min 20 cycles 95℃ 30 sec 60℃ 1 min 68℃ 10 min
[0232] To replace histidine (H) at position 71 of RhtC with another amino acid, a PCR composition as shown in Table 10 was prepared and PCR was performed under the conditions of Table 11. The mutagenic primer set in Table 12 was used during PCR. After PCR was completed, 1 μl of DpnI restriction enzyme was added and treated at 37°C for 1 hour. The DpnI-treated sequence fragment was assembled into a recombinant mutant plasmid using the Gibson assembly method.
[0233] 3 μl of plasmid DNA was transformed into DH5a competent cells to obtain the pDC24-PgapA_rhtC mutant plasmid, and sequencing confirmed that each mutation was replaced with the mutations listed in Table 12.
[0234]
[0235] : 변이형 rhtC 플라스미드 제작을 위한 돌연변이 생성 프라이머 세트변이형 rhtC 플라스미드프라이머염기서열pDC24-PgapA_rhtC H71APrimer 28CGAAAAAATGGCCTGGCTGGCAACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71CPrimer 29CGAAAAAATGGCCTGGCTGTGCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71DPrimer 30CGAAAAAATGGCCTGGCTGGACACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71EPrimer 31CGAAAAAATGGCCTGGCTGGAAACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71FPrimer 32CGAAAAAATGGCCTGGCTGTTCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71GPrimer 33CGAAAAAATGGCCTGGCTGGGCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71IPrimer 35CGAAAAAATGGCCTGGCTGATCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71KPrimer 36CGAAAAAATGGCCTGGCTGAAGACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71LPrimer 37CGAAAAAATGGCCTGGCTGCTCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71MPrimer38CGAAAAAATGGCCTGGCTGATGACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71NPrimer 39CGAAAAAATGGCCTGGCTGAACACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71PPrimer 40CGAAAAAATGGCCTGGCTGCCAACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71QPrimer 41CGAAAAAATGGCCTGGCTGCAGACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71VPrimer 43CGAAAAAATGGCCTGGCTGGTGACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71SPrimer 44CGAAAAAATGGCCTGGCTGTCCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71TPrimer 45CGAAAAAATGGCCTGGCTGACCACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71WPrimer 46CGAAAAAATGGCCTGGCTGTGGACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAApDC24-PgapA_rhtC H71YPrimer 47CGAAAAAATGGCCTGGCTGTACACGCTGATTATGGTGPrimer 27CAGCCAGGCCATTTTTTCGATAA
[0236] pDC24-PgapA_rhtC H71A, pDC24-PgapA_rhtC H71C, pDC24-PgapA_rhtC H71D, pDC24-PgapA_rhtC H71E, pDC24-PgapA_rhtC H71F, produced as shown in Table 12 above, pDC24-PgapA_rhtC H71G, pDC24-PgapA_rhtC H71I, pDC24-PgapA_rhtC H71K, pDC24-PgapA_rhtC H71L, pDC24-PgapA_rhtC H71M, pDC24-PgapA_rhtC H71N, pDC24-PgapA_rhtC H71P, pDC24-PgapA_rhtC H71Q, The pDC24-PgapA_rhtC H71V, pDC24-PgapA_rhtC H71S, pDC24-PgapA_rhtC H71T, pDC24-PgapA_rhtC H71W, and pDC24-PgapA_rhtC H71Y vectors were transformed into the KCCM12485P (US 2022-0170059 A1) strain by electroporation according to the method of Example 2-1, and then a second crossing process was performed to obtain a strain in which a mutant rhtC gene was inserted on the chromosome. A total of 19 strains were obtained, including pDC24-PgapA_rhtC H71R obtained in Example 2. The genetic manipulation was confirmed by PCR using Primer 25 and Primer 26, which can amplify external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, respectively, and genome sequencing.
[0237] The obtained transformed strains were named as Cgl-Thr-1(H71A), Cgl-Thr-1(H71C), Cgl-Thr-1(H71D), Cgl-Thr-1(H71E), Cgl-Thr-1(H71F), Cgl-Thr-1(H71G), Cgl-Thr-1(H71I), Cgl-Thr-1(H71K), Cgl-Thr-1(H71L), Cgl-Thr-1(H71M), Cgl-Thr-1(H71N), Cgl-Thr-1(H71P), Cgl-Thr-1(H71Q), Cgl-Thr-1(H71V), Cgl-Thr-1(H71R), Cgl-Thr-1(H71S), They were named Cgl-Thr-1(H71T), Cgl-Thr-1(H71W), and Cgl-Thr-1(H71Y).
[0238]
[0239] The 19 strains produced by the above method and the previously produced Cgl-Thr-1 strain were cultured using the L-threonine production flask medium and culture method of Example 2-2, and the amount of L-threonine produced was measured by HPLC after the culture was completed, and is shown in Table 13.
[0240]
[0241] : L-threonine production of the strain introducing the 71st amino acid mutant RhtC Strain name rhtC Form L-threonine production (g / L) L-threonine yield (g / g, %) Yield improvement compared to wild type rhtC (△, %p) KCCM12485P-1.5 2.1 Cgl-Thr-1 rhtC Wild type 7.6 10.9-Cgl-Thr-1 (H71A) rhtC H71A 7.9 11.3 0.4 Cgl-Thr-1 (H71C) rhtC H71C 8.4 12 1.1 Cgl-Thr-1 (H71D) rhtC H71D 8.7 12.4 1.5 Cgl-Thr-1 (H71E) rhtC H71E10.214.63.7Cgl-Thr-1(H71F)rhtC H71F9.1132.1Cgl-Thr-1(H71G)rhtC H71G8.912.71.8Cgl-Thr-1(H71I)rhtC H71I9.313.32.4Cgl-Thr-1(H71K)rhtC H71K8.512.11.2Cgl-Thr-1(H71L)rhtC H71L7.811.10.2Cgl-Thr-1(H71M)rhtC H71M9.012.92.0Cgl-Thr-1(H71N)rhtC H71N11.115.95.0Cgl-Thr-1(H71P)rhtC H71P9.313.32.4Cgl-Thr-1(H71Q)rhtC H71Q8.612.31.4Cgl-Thr-1(H71R)rhtC H71R12.417.76.8Cgl-Thr-1(H71S)rhtC H71S9.113.02.1Cgl-Thr-1(H71T)rhtC H71T8.412.01.1Cgl-Thr-1(H71V)rhtC H71V8.812.61.7Cgl-Thr-1(H71W)rhtC H71W10.515.04.1Cgl-Thr-1(H71Y)rhtC H71Y11.316.15.2
[0242] As shown in Table 13, 19 mutants with mutations at amino acid 71 of the RhtC protein showed improvements in fermentation yield ranging from 1.2%p to 6.8%p compared to Cgl-Thr-1, which had wild-type rhtC inserted. A high level of yield increase was observed compared to wild-type RhtC.
[0243]
[0244] Example 4: Production of an L-threonine-producing strain with an L-threonine excretion protein including a mutation and evaluation of L-threonine productivity.
[0245] Example 4-1: Construction of a plasmid with two mutants of leucine, amino acid 62, and histidine, amino acid 71, of the L-threonine efflux protein.
[0246]
[0247] As mentioned in Table 13, the effectiveness of RhtC(H71R), in which histidine at position 71 of RhtC is modified to arginine, in improving L-threonine excretion was confirmed. Additionally, the effect of combining RhtC(H71R) with RhtC(L62S), a mutant previously confirmed to have an effect of improving L-threonine excretion, was investigated (US 2023-0012923 A1). In order to mutate leucine at position 62 of RhtC to serine and histidine at position 71 to arginine, PCR was performed using pDC24-PgapA_rhtC(H71R) constructed in Example 2 as a template and Primer 48 and Primer 49 and Primer 50 and Primer 51.
[0248]
[0249] Primer base sequencePrimer 48TGAATTCGAGCTCGGTACCCGGTCTGCTGGCGAAGTCACTPrimer 49CAGGCCATTTTTTCGATAATCGAATGCAGGCCAAGCAGCGPrimer 50CGCTGCTTGGCCTGCATTCGATTATCGAAAAAATGGCCTGPrimer 51AGTGACTTCGCCAGCAGACCGGGTACCGAGCTCGAATTCA
[0250] The two fragments obtained through the above PCR process were cloned using the Gibson assembly method to obtain a recombinant plasmid. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and storing it at 50°C for 1 hour. 3 μl of the plasmid DNA was transformed into DH5a competent cells to obtain the pDC24-PgapA_rhtC (L62S, H71R) mutant plasmid.
[0251]
[0252] Example 4-2: Production of an L-threonine-producing strain with an L-threonine excretion protein including a mutation and evaluation of L-threonine productivity.
[0253]
[0254] The constructed pDC24-PgapA_rhtC (L62S, H71R) vector was transformed into the KCCM12485P (US 2022-0170059 A1) strain by electroporation according to the method of Example 2-1, and a strain with a mutant rhtC gene inserted into the chromosome was obtained through a second crossing process. The genetic manipulation was confirmed through PCR using Primer 25 and Primer 26, which can amplify the external regions of the upstream and downstream regions of the homologous recombination region where the gene was inserted, and genome sequencing.
[0255] The obtained transformed strains were named Cgl-Thr-1(L62S, H71R).
[0256]
[0257] The strains produced by the above method and the previously produced Cgl-Thr-1 and Cgl-Thr-1(H71R) strains were cultured using the L-threonine production flask medium and culture method of Example 2-2, and the amount of L-threonine produced was measured by HPLC after the culture was completed, and is shown in Table 15.
[0258]
[0259] Strain name rhtC Form L-threonine production (g / L) L-threonine yield (g / g, %) Yield improvement compared to wild type rhtC (△, %p) KCCM12485P-1.7 2.4 Cgl-Thr-1 rhtC wild type 7.5 10.7 - Cgl-Thr-1 (H71R) rhtC H71R 12.5 17.9 7.2 Cgl-Thr-1 (L62S, H71R) rhtCL62S, H71R 14.6 20.9 10.2
[0260] As shown in Table 15, Cgl-Thr-1 (L62S, H71R), in which amino acids 63 and 71 of the RhtC protein were modified to serine and arginine, respectively (SEQ ID NO: 72), showed a 3%p improvement in fermentation yield compared to Cgl-Thr-1 (H71R), in which amino acids 71 of the wild-type RhtC protein were modified to arginine.
[0261]
[0262] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.
[0263]
[0264] When a microorganism producing L-threonine is cultured using a mutant of the L-threonine efflux protein of the present application, high yield L-threonine production is possible compared to a microorganism having an existing wild-type efflux protein.
Claims
1. A mutant L-threonine efflux protein comprising a substitution of an amino acid corresponding to position 71 of the amino acid sequence of sequence number 1 with another amino acid.
2. A mutant L-threonine excretion protein, wherein the other amino acid in paragraph 1 is an amino acid selected from the group consisting of alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine.
3. In the first paragraph, the protein is a mutant L-threonine efflux protein that additionally includes a substitution of an amino acid corresponding to position 62 of the amino acid sequence of sequence number 1 with another amino acid.
4. A mutant L-threonine excretion protein according to claim 1, wherein the protein has at least 90% identity with the amino acid sequence of sequence number 1.
5. A polynucleotide encoding a mutant L-threonine efflux protein according to any one of claims 1 to 4.
6. A microorganism comprising a mutant L-threonine efflux protein according to any one of claims 1 to 4; a polynucleotide encoding the mutant L-threonine efflux protein; or a vector comprising the polynucleotide.
7. In the 6th paragraph, the microorganism has an increased L-threonine production ability compared to a microorganism comprising an L-threonine excretion protein having an amino acid sequence of sequence number 1; a polynucleotide encoding the L-threonine excretion protein; or a vector comprising the polynucleotide.
8. A microorganism according to claim 6, wherein the microorganism is a microorganism of the genus Corynebacterium.
9. A microorganism according to claim 8, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
10. A method for producing L-threonine, comprising a step of culturing the microorganism of clause 6 in a medium.
11. A method for producing L-threonine, further comprising a step of recovering L-threonine from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium in accordance with paragraph 10.
12. A composition for producing L-threonine, comprising: a mutant L-threonine efflux protein according to any one of claims 1 to 4; a polynucleotide encoding the mutant L-threonine efflux protein; a vector comprising the polynucleotide; a microorganism comprising the mutant L-threonine efflux protein, a polynucleotide encoding the mutant L-threonine efflux protein, or a vector comprising the polynucleotide; a culture of the microorganism; or a combination of two or more thereof.
13. A mutant L-threonine efflux protein according to any one of claims 1 to 4; a polynucleotide encoding the mutant L-threonine efflux protein; a vector comprising the polynucleotide; a microorganism comprising the mutant L-threonine efflux protein, a polynucleotide encoding the mutant L-threonine efflux protein, or a vector comprising the polynucleotide; or use of a culture of the microorganism for producing L-threonine.
Citation Information
Patent Citations
L-threonine overproducing microorganism which constructed by specific genetic modifications and method for preparing l-threonine using the same
KR1020080082880A
Variants of L-threonine efflux protein and methods for producing L-threonine using them
KR102183209B1