Fluorescently-labeled stem cell line with hepatic stellate cell activation markers, and use thereof
A CRISPR/Cas9-transformed human induced pluripotent stem cell line with PDGFR-β labeling enables efficient screening for liver fibrosis-inducing or inhibiting substances by monitoring fluorescent protein expression, addressing the need for a real-time imaging system to discover such substances.
Patent Information
- Application Number
- PCT/KR2024/003631
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-05
- Filing Date
- 2024-03-22
- Publication Date
- 2025-09-11
AI Technical Summary
Current methods lack an effective model or cell line for screening substances that induce or inhibit liver fibrosis, and there is a need for a real-time imaging-based system to discover such substances.
A human induced pluripotent stem cell line is transformed with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein using a CRISPR/Cas9 system, involving a guide RNA and a vector expressing a fluorescent protein, to create a model for screening liver fibrosis inducers or suppressors.
The system allows for efficient screening of liver fibrosis-inducing or inhibiting substances by monitoring fluorescent protein expression changes in hepatic stellate cells, facilitating high-throughput screening and discovery of potential therapeutic agents.
Smart Images

Figure KR2024003631_12092025_PF_FP_ABST
Abstract
Description
Fluorescently labeled stem cell line expressing hepatic stellate cell activation marker and its use
[0001] The present invention relates to a hepatic stellate cell activation marker fluorescently labeled stem cell line and a method for screening for hepatic fibrosis inducing or suppressing factors using the same.
[0002] Fibrosis is a condition in which normal control becomes impossible during the wound healing process after tissues in the human body are damaged by various stresses (infection, chemical stimulation, radiation, etc.). It is a common path in chronic diseases, and its mechanism is very complex and has not been fully elucidated to this day.
[0003] When the liver is stimulated by various harmful environmental factors such as alcohol and viruses, hepatic stellate cells are activated by various cytokines, including transforming growth factor beta (TGF-β) secreted from Kupffer cells. Secreted TGF-β promotes collagen synthesis, accumulating extracellular matrix, and not only causes liver fibrosis through continuously accumulated collagen, but also affects not only hepatic stellate cells themselves but also surrounding hepatocytes, causing epithelial to mesenchymal transition (EMT). Since the process of continuous hepatic fibrosis ultimately leads to cirrhosis, understanding and studying the process of hepatic fibrosis can be said to be the most fundamental step in solving all diseases that can cause cirrhosis.
[0004] Accordingly, there is an urgent need to develop a model or cell line that can discover substances that induce or inhibit liver fibrosis through analysis such as screening for liver fibrosis-inducing substances, and from this, there is a need to develop a real-time imaging-based compound exploration system to screen for liver fibrosis-inducing or inhibiting substances.
[0005] Meanwhile, since the discovery of CRISPR in Escherichia coli by Yoshizumi Ishino, a Japanese scholar, in 1987, a technology has been developed to produce various transformants in a new way using the CRISPR / Cas9 system, which is created by combining it with Cas9, a nuclease that cuts DNA. The system has been widely used as a highly efficient genome editing technology with various applications, and it is an endonuclease splicing technology commonly called gene scissors, and has the advantage of being able to manipulate genes more efficiently and easily than the first-generation zinc-finger nucleases (ZFNs) and the second-generation transcription activator-like effector nucleases (TALENs). This CRISPR / Cas9 system operates on the principle that Cas9 attacks a specific target site within a specific gene by inducing a guide RNA (gRNA) identical to the target site within a specific gene, thereby causing gene insertion and deletion, thereby neutralizing the function of the gene.
[0006] The present invention aims to solve the above-mentioned problems and other problems related thereto.
[0007] The purpose of the present invention is to provide a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors transformed with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
[0008] Another object of the present invention is to provide a method for producing a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors, comprising a step of transforming a human induced pluripotent stem cell line with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
[0009] Another object of the present invention is to provide a method for screening for liver fibrosis inducers or inhibitors using a human induced pluripotent stem cell line for screening for liver fibrosis inducers or inhibitors.
[0010] Another object of the present invention is to provide a vector system for producing a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors, comprising a first vector comprising a gene encoding a guide RNA and a Cas9 protein; and a second vector expressing a fluorescent protein.
[0011] Another object of the present invention is to provide a composition for editing a platelet-derived growth factor receptor β (PDGFR-β) gene, comprising a guide RNA of sequence number 1.
[0012]
[0013] The technical problem to be achieved according to the technical idea of the invention disclosed in this specification is not limited to the problem to solve the above-mentioned problem, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.
[0014] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.
[0015]
[0016] As one aspect for achieving the above object, the present invention provides a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors transformed with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
[0017] In the present invention, the 'induced pluripotent stem cells (iPSC)' are also called induced pluripotent stem cells, and refer to stem cells with pluripotency that are created by introducing four specific genes (Oct3 / 4, Sox2, c-Myc, Klf4) that induce induced differentiation into somatic cells such as adult skin cells without pluripotency and then expressing them, or by extracting induced induced differentiation proteins produced from cells into which the four genes that induce induced induced differentiation have been introduced and injecting them back into somatic cells. The induced pluripotent stem cells solve the ethical problem of existing embryonic stem cell research in which stem cells can only be obtained by destroying an embryo developing from a fertilized egg, and have the advantage of not causing an immune rejection reaction.
[0018] In the present invention, 'platelet-derived growth factor receptor beta (PDGFR-β)' refers to a protein encoded by the PDGFRB gene, and signal transduction of the 'platelet-derived growth factor receptor (PDGFR)' is involved in the proliferation and survival of various cell types. In particular, PDGFR-β is widely expressed in neural cells, mesenchymal stem cells, and vascular smooth muscle cells, and PDGFR-β signal transduction can regulate the proliferation of cardiomyocytes and myocardial regeneration.
[0019] In the present invention, 'fluorescent protein' means a protein that fluoresces, and operates on the principle that general molecules fluoresce by releasing energy in the form of light when they release absorbed energy and return to the ground state.
[0020] The fluorescent protein is at least one selected from the group consisting of mCherry, Green Fluorescent Protein (GFP), enhanced Green Fluorescent Protein (eGFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), luciferase, β-galactosidase, mPlum, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mScarlet, mKate, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. It may be, but is not limited to, mCherry.
[0021] In the present invention, 'hepatic fibrosis', also called liver fibrosis, refers to a disease or symptom in which the process of producing extracellular matrix (ECM) fibers from activated hepatic stellate cells due to continuous destruction of hepatocytes is relatively excessive compared to the process of dissolving the fibers, resulting in abnormal proliferation of ECM and progression of the disease.
[0022] In the present invention, 'transformation' refers to a molecular biological phenomenon in which a DNA chain fragment or plasmid containing a different type of foreign gene than that possessed by the original cell is introduced into the cell, thereby changing the genetic characteristics of the original cell.
[0023] In the present invention, the human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or suppressors may be produced by transfecting a first vector including a guide RNA of sequence number 1 and a gene encoding a Cas9 protein; and a second vector expressing a fluorescent protein.
[0024] The human induced pluripotent stem cell line transfected with the first vector and the second vector to produce the human induced pluripotent stem cell line for screening the above liver fibrosis inducer or inhibitor is not limited as long as it corresponds to a known human induced pluripotent stem cell line or a human induced pluripotent stem cell line produced by a known method. The human induced pluripotent stem cell line can be produced by overexpressing a dedifferentiation inducer (OCT4, SOX2, c-MYC, KLF4) for all somatic cells, including human skin somatic cells.
[0025] In the present invention, the 'guide RNA' refers to a ribonucleic acid that is a short single-stranded RNA, which includes RNA specific to the target DNA among the base sequences encoding the target gene, and serves to guide an endonuclease protein to the target DNA base sequence by complementarily binding to all or part of the target DNA base sequence. The CRISPR / CAS9 system, which is composed of the guide RNA and the Cas9 protein that serves to cut a specific base sequence, is a simple and easy method that can induce mutations at a specific genome locus, and can suppress the function of a specific gene in cells or animals. That is, when the guide RNA recognizes the target gene, the Cas9 protein binds to the guide RNA and acts as a nuclease to recognize and cut two guanine bases (GG) located about 3 bp downstream of the target gene, thereby causing DNA double-strand break (DSB).
[0026] In the present invention, the 'Cas9 protein' is a major protein component of the CRISPR / Cas system and is a protein that can act as an activated endonuclease. The Cas9 protein induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the base sequence of the target DNA and cut the DNA strand, a short base sequence consisting of three bases known as a Protospacer Adjacent Motif (PAM) must be present next to the base sequence of the target DNA, and the Cas9 protein cleaves by inferring between the third and fourth base pairs from the PAM sequence (NGG).
[0027] Cas9 protein or genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). For example, the Cas9 protein may be at least one selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophilus, a Cas9 protein derived from Staphylococcus aureus, and a Cas9 protein derived from Neisseria meningitidis, and preferably a Cas9 protein derived from Streptococcus pyogenes, but is not limited thereto.
[0028] In the present invention, as the basic framework of the 'first vector', one vector framework selected from the group consisting of pX330, pHAtC, pYLCRISPR / Cas9Pubi, pYLCRISPR / Cas9P35s, pUB-Cas9, pCAMBIA1300DM_OsU6_AarI_Cas9, pCAMBIA1300-OsU3(AarI)-Cas9, Binary vector pUB-Cas9-@GL1, Binary vector pUB-Cas9-@BAR, pYLsgRNA-OsU3, pYLsgRNA-OsU6c, pYLsgRNA-OsU6b and pYLsgRNA-OsU6a may be used, and preferably, the pX330 vector framework may be used, but the gRNA and Cas9 protein of the present invention may be successfully expressed to enable transformation of a human induced pluripotent stem cell line by the CRISPR / Cas9 system. Any vector skeleton known in the art is not particularly limited as long as it is a vector skeleton.
[0029] In the present invention, the 'transfection' may be delivered to the cell line by various methods such as microinjection, electroporation, DEAE-dextran treatment, lipofection, nanoparticle-mediated transfection, protein delivery domain-mediated introduction, and PEG-mediated transfection, but is not limited thereto. Specifically, in the present invention, the transfection may be delivered by electroporation.
[0030] In the present invention, the 'second vector expressing a fluorescent protein' may be specifically one in which a fluorescent protein, mCherry, poly A, a phosphoglycerate kinase (PGK) promoter, and a neomycin resistance gene are operably linked, and specifically, a PDGFRB 5' arm, mCherry, poly A, a PGK promoter, a neomycin resistance gene, and a PDGFRB 3' arm structure may be linked to each other, and the linked structure may be introduced by transfection upstream of a stop codon located in the E23 intron of the PDGFRB gene locus of a human induced pluripotent stem cell line.
[0031] The pMCDT-A vector backbone can be used as the basic backbone of the second vector, but any vector backbone known in the art is not particularly limited as long as it enables the successful introduction of a structure including a gene encoding the fluorescent protein of the present invention into a human induced pluripotent stem cell line.
[0032] The 'human induced pluripotent stem cell line for screening liver fibrosis inducers or suppressors' manufactured in the present invention may have increased expression of OCT4 (octamer-binding transcription factor 4), SOX2 (sex determining region Y-box transcription factor 2) or NANOG genes or proteins, compared to a stem cell line that is not transformed with the fluorescent protein-labeled PDGFR-β, and may have increased expression of TRA-1-60 positive cells or TRA-1-81 positive cells.
[0033] In the present invention, the human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors can differentiate into ectoderm, mesoderm, and endoderm. Specifically, when differentiating into ectoderm, the expression levels of PAX6 (Paired box 6) and OTX2 (Orthodenticle homeobox 2) may increase, when differentiating into mesoderm, the expression levels of EOMES (Eomesodermin) and ACTA2 (Actin alpha 2) may increase, and when differentiating into endoderm, the expression levels of AFP (alpha-fetoprotein) and GATA4 (GATA Binding Protein 4) may increase. In addition, when differentiating into ectoderm, the expression levels of TUBB3 (Tubulin Beta 3) and NESTIN may increase, when differentiating into mesoderm, the expression levels of DESMIN and α-SMA (α-smooth muscle actin) may increase, and when differentiating into endoderm, the expression levels of AFP and SOX17 (Sex determining region Y-box transcription factor 17) may increase.
[0034] In the present invention, hepatic stellate cells (HSCs) differentiated from the human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors may have an increased expression of one or more selected from the group consisting of desmin, actin alpha 2 (smooth muscle, ACTA2), platelet-derived growth factor receptor A (PDGFRA), and platelet-derived growth factor receptor B (PDGFRB) compared to an undifferentiated stem cell line.
[0035] In addition, when treating the hepatic stellate cells with a liver fibrosis-inducing substance, the fluorescence intensity of the fluorescent protein or the number of cells expressing the fluorescent protein may increase as the hepatic stellate cells are activated, and when treating the hepatic stellate cells with a liver fibrosis-inhibiting substance, the fluorescence intensity of the fluorescent protein or the number of cells expressing the fluorescent protein may decrease.
[0036]
[0037] As one aspect for achieving the above object, the present invention provides a method for producing a human induced pluripotent stem cell line for screening for a liver fibrosis inducer or inhibitor, comprising a step of transforming a human induced pluripotent stem cell line with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
[0038] The above 'induced pluripotent stem cells', 'fluorescent protein', 'PDGFR-β', 'transformation' and 'liver fibrosis' are as described above.
[0039]
[0040] As one aspect for achieving the above object, the present invention provides a method for screening for liver fibrosis inducing or inhibiting factors using a human induced pluripotent stem cell line for screening for liver fibrosis inducing or inhibiting factors.
[0041] Specifically, in the present invention, the screening method may include (a) a step of differentiating the human induced pluripotent stem cell line for screening for hepatic fibrosis inducing factors of claim 1 into hepatic stellate cells; (b) a step of treating the differentiated hepatic stellate cells with a candidate substance and measuring the expression level of a fluorescent protein; and (c) a step of selecting a candidate substance that significantly changes the expression level of the fluorescent protein in hepatic stellate cells administered the candidate substance compared to a control group that was not administered the candidate substance.
[0042] The above 'induced pluripotent stem cells', 'hepatic stellate cells', 'fluorescent protein' and 'liver fibrosis' are as described above.
[0043] In the present invention, the term 'differentiation' means that a cell changes into a cell with different characteristics.
[0044] In the present invention, the 'hepatic stellate cell' refers to a perivascular cell found in the perisinusoidal space of the liver, and the stellate cell has the function of storing and concentrating vitamin A.
[0045] In the present invention, the step of measuring the expression level of the fluorescent protein in step (b) may include a step of measuring the fluorescence intensity of the fluorescent protein or the number of cells expressing the fluorescent protein.
[0046] In the present invention, after step (c), if the expression level of the fluorescent protein in step (c) significantly increases, a step of identifying the candidate substance as a liver fibrosis inducer may be further included. Furthermore, after step (c), if the expression level of the fluorescent protein in step (c) significantly decreases, a step of identifying the candidate substance as a liver fibrosis inhibitor may be further included.
[0047] In the present invention, the screening method may be performed by high-content screening analysis and live cell imaging analysis, but is not limited thereto.
[0048] As one aspect for achieving the above object, the present invention provides a vector system for producing a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors, comprising: a first vector including a gene encoding a guide RNA and a Cas9 protein; and a second vector expressing a fluorescent protein.
[0049] The above 'guide RNA', 'first vector', 'second vector', 'fluorescent protein', 'liver fibrosis' and 'induced pluripotent stem cell' are as described above.
[0050] As one aspect for achieving the above purpose, the present invention provides a composition for editing a platelet-derived growth factor receptor β (PDGFR-β) gene, comprising a guide RNA of sequence number 1.
[0051] The above 'guide RNA' and 'PDGFR-β' are as described above.
[0052] In the present invention, the 'gene editing' refers to a technology capable of introducing or inducing a targeted mutation in the genome base sequence of animal and plant cells, including human cells, and is a genetic manipulation technology that modifies the function of a specific gene by deletion, insertion, substitution, etc. of one or more nucleic acid molecules through DNA cutting.
[0053]
[0054] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.
[0055] The human induced pluripotent stem cell line for screening for liver fibrosis inducers or inhibitors manufactured according to the present invention can screen for inducers capable of inducing liver fibrosis or substances capable of inhibiting liver fibrosis in a living cell state in hepatic stellate cells derived from the pluripotent stem cell line, and can be utilized for the purpose of exploring imaging-based high-throughput screening (HTS) compounds and discovering liver fibrosis inducers or inhibitors using high content screening equipment.
[0056] Figure 1 shows an overall schematic diagram for producing human induced pluripotent stem cell lines for screening for inducers or suppressors of liver fibrosis transformed with fluorescent protein-labeled platelet-derived growth factor receptor β (PDGFR-β) from the HDF01 human induced pluripotent stem cell line (Figure 1A), the results of PCR analysis to confirm the selected transformed cell lines (Figure 1B), and the results of sequence analysis to confirm targeted integration of the introduced gene (Figure 1C).
[0057] Figure 2 shows the observation of the karyotype (Figure 2A) and morphology (Figure 2B) of a human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors of the present invention.
[0058] Figure 3 shows the results of analyzing whether mycoplasma is detected in a human induced pluripotent stem cell line for screening for liver fibrosis inducers or inhibitors of the present invention.
[0059] Figures 4 and 5 illustrate the results of short tandem repeat (STR) analysis to confirm that the human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors of the present invention is derived from the HDF01 human induced pluripotent stem cell line. Figure 4 illustrates the results of STR analysis for the HDF01 human induced pluripotent stem cell line, and Figure 5 illustrates the results of STR analysis for the human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors of the present invention.
[0060] Figure 6 shows the expression of OCT4, SOX2, and NANOG in the nucleus of a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors of the present invention.
[0061] Figure 7 shows the results of flow cytometry analysis to confirm the expression level of TRA-1-60 positive cells and TRA-1-81 positive cells in a human induced pluripotent stem cell line for screening for liver fibrosis inducers or inhibitors of the present invention.
[0062] Figure 8 shows the differentiation potential into ectoderm, mesoderm, and endoderm from a human induced pluripotent stem cell line for screening liver fibrosis inducers or suppressors of the present invention. Figure 8A shows the expression changes of stem cell markers (OCT4, SOX2, NANOG), ectoderm markers (PAX6, OTX2), mesoderm markers (EOMES, ACTA2), and endoderm markers (AFT, GATA4) in a human induced pluripotent stem cell line for screening liver fibrosis inducers or suppressors and embryoid bodies (EBs) formed therefrom. Figure 8B shows the expression of ectoderm markers (TUBB3, NESTIN), mesoderm markers (DESMIN, α-SMA), and endoderm markers (AFP and SOX17) in embryoid bodies formed from a human induced pluripotent stem cell line for screening liver fibrosis inducers or suppressors.
[0063] Figure 9 shows changes in the expression of hepatic stellate cell marker genes Desmin, ACTA2, PDGFRA, and PDGFRB on the 12th day of differentiation in hepatic stellate cells differentiated from a human induced pluripotent stem cell line for screening hepatic fibrosis inducers or suppressors of the present invention.
[0064] Figure 10 shows a comparison of the expression levels of fluorescent proteins in hepatic stellate cells differentiated from a human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors according to the present invention and hepatic stellate cells derived from the HDF01 human induced pluripotent stem cell line.
[0065] Figure 11 shows the degree of increase in fluorescent protein expression when hepatic stellate cells differentiated from a human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors of the present invention are treated with a hepatic stellate cell activating substance (PDGF-BB), compared to when the activating substance is not treated (Control).
[0066] Figure 12 shows the results of inducing differentiation into hepatic stellate cells from a human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors of the present invention, treating the cells with hepatic fibrosis inducers, and performing live-cell imaging analysis using high-throughput screening (HCS) equipment. Figure 12A shows the overall experimental process, and Figure 12B shows the degree of increase in fluorescent protein intensity and associated cell proliferation upon treatment with the inducer.
[0067] Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.
[0068]
[0069] Example 1. Production of a fluorescently labeled stem cell line expressing a hepatic stellate cell activation marker.
[0070] 1.1. Production of KITi001-A-1, a fluorescently labeled stem cell line expressing a hepatic stellate cell activation marker.
[0071] As a cell model for use in real-time imaging technology-based exploration, a human induced pluripotent stem-cell (hiPS) cell line KITi001-A-1 was constructed using a CRISPR / Cas9-based knock-in system, fluorescently labeled with platelet-derived growth factor receptor beta (PDGFR-β), a marker for hepatic stellate cell activation.
[0072] As shown in Figure 1A, the mCherry-poly A(pA)-phosphoglycerate kinase (PGK)-neomycin resistance gene (neo) construct was introduced immediately upstream of the stop codon of the PDGFRB locus, the gene encoding PDGFR-β. Specifically, the pMCDT-A plasmid was used as the backbone of the knock-in vector, and the knock-in vector consisted of pMCDT-A-PDGFRB 5' arm-mCherry-polyA-PGK promoter-neo-PDGFRB 3' arm. The 5' and 3' homology arms of PDGFRB were cloned from the genomic DNA of HDF01 human induced pluripotent stem cells (iPSCs), and the coding sequences of mCherry and PGK promoter-neo were cloned from the p3E-2A-mCherry and pKJ2 plasmids, respectively. The HDF01 human iPSCs were provided by the KAIST research group, and were established by overexpressing Yamanaka factors (OCT4, SOX2, c-MYC, KLF4) from human skin somatic cells (PLoS ONE 10(7):e0132992).
[0073] To induce homologous recombination, a single guide RNA (sgRNA) of the following SEQ ID NO: 1, which recognizes the E22-E23 intron region of the PDGFRB gene locus, specifically the region immediately upstream of the stop codon, was designed using the CRISPR design tool (crispr.mit.edu) and cloned into the pX330 plasmid encoding Cas9. Subsequently, the knocked-in vector of Figure 1A and the sgRNA / Cas9 expression plasmid were transfected into HDF01 iPSCs by electroporation.
[0074] Sequence number 1: GTGTGTGAAGCCTACGGTGCAGG
[0075] Specifically, a total of 5×10 passages of 30 6Dog stem cells were transfected with 8 μg of each thawed vector and 2 μg of sgRNA / Cas9 vector using the Neon® Transfection System (Thermo Fisher Scientific). The cells were then plated on TeSR™-E8™ containing 10 μM Y27632 (Sigma), and only colonies resistant to the antibiotic (neomycin) were selected for 2 weeks using 50 μg / mL G418 (Thermo Fisher Scientific). The selected colonies were then further cultured.
[0076] After selection of neomycin-resistant clones, genomic DNA was extracted from approximately 5' and 3' of the target region and subjected to PCR and base sequence analysis. Specifically, genomic DNA was isolated using the G-DEX™ Genomic DNA Extraction Kit (iNtRON Biotechnology), and 20 ng of the isolated DNA was amplified using EX-Taq™ Polymerase (Takara). The primer sequences used in this PCR analysis and base sequence analysis are shown in Table 1 below.
[0077] Targeting primer sequence (5'-> 3') Sequence number 5'~ 3' Targeting forward GAGGAGTTTCTGAGGAGTGACCACC2 Reverse CCCCCAGGATGGAAGTTTAGGGTAT3 3' Targeting forward GCGGCCGCGCTCACTGCAACCTCCACCTCCCA4 5' Targeting forward ATTCTAGAGTATTCCAGGTGGTTGCTCGAG5
[0078]
[0079] Through the PCR analysis above, the PDGFRB-mCherry clone (hereinafter referred to as 'KITi001-A-1') into which the gene was introduced was finally selected (Fig. 1B), and the PCR products of the 5' and 3' target regions were sequenced to confirm targeted integration of the introduced gene (Fig. 1C).
[0080]
[0081] 1.2. Stem cell morphology analysis of the KITi001-A-1 cell line
[0082] To analyze the stem cell characteristics of the KITi001-A-1 cell line manufactured in Example 1.1, karyotype analysis, stem cell morphology analysis, mycoplasma detection analysis, and short tandem repeat (STR) analysis were performed. Specifically, 20 single clones were subjected to G-banding karyotype analysis (GenDix, Inc.) at a band resolution of 550, stem cell morphology analysis was observed using a light microscope, mycoplasma contamination was evaluated using the e-Myco™ Mycoplasma PCR detection kit (iNtRON Biotechnology) according to the manufacturer's instructions, and STR analysis was performed using ABI GeneMapper™ software 6 (DowGene). All experiments were performed at passage 36.
[0083] As a result of the analysis, the KITi001-A-1 cell line showed a normal karyotype (Fig. 2A) and a typical pluripotent stem cell (PSC) morphology (Fig. 2B), and was confirmed to be free of mycoplasma contamination (Fig. 3), and short tandem repeat analysis confirmed that the KITi001-A-1 cell line was derived from HDF01 iPSC (Figs. 4 and 5).
[0084]
[0085] 1.3. Analysis of stem cell characteristics of KITi001-A-1 cell line
[0086] To determine whether the KITi001-A-1 cell line exhibits key characteristics as a stem cell, its self-renewal capacity and differentiation potential were analyzed in vitro.
[0087] Specifically, to analyze the expression patterns of OCT4, SOX2, and NANOG, which are markers associated with pluripotency of stem cells, KITi001-A-1 cell line was fixed with 4% paraformaldehyde for 10 minutes, blocked with 4% normal goat serum (Jackson ImmunoResearch) for 1 hour, and then blocked with primary antibody overnight at 4°C. After washing, secondary antibody was added for 1 hour at room temperature, and nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific Cat# D1306, PRID:AB_2629482). All experiments were performed at passage 36, and detailed information on the antibodies used in the present invention is shown in Table 2 below.
[0088] 1차 항체정보Rabbit anti-OCT4Cell Signaling Technology Cat# 2750, PRID: AB_823583Mouse anti-SOX2Santa Cruz Biotechnology Cat# sc-365823, PRID: AB_10842165Rabbit anti-NANOGCell Signaling Technology Cat# 4903, PRID: AB_10559205Mouse anti-TRA-1-60Millipore Cat# MAB4360, PRID:AB_2119183Mouse anti-TRA-1-81Millipore Cat# MAB4381, PRID:AB_177638Rabbit anti-TUBB3BioLegend Cat# 802001, PRID: AB_2564645Mouse anti-NestinMillipore Cat# MAB5326, PRID: AB_2251134Rabbit anti-DesminMillipore Cat# AB907, PRID: AB_2092609Mouse anti-alpha-Smooth Muscle ActinSigma-Aldrich Cat# A5228, PRID: AB_262054Goat anti-SOX17R&D Systems Cat# AF1924, PRID: AB_355060Rabbit anti-AFPDako Cat# A0008, PRID: AB_26504732차 항체정보Alexa Fluor™ 488 goat anti-mouse IgGThermo Fisher Scientific Cat# A-11001, PRID:AB_2534069Alexa Fluor™ 594 goat anti-mouse IgGThermo Fisher Scientific Cat# A-11005, PRID:AB_2534073Alexa Fluor™ 594 goat anti-rabbit IgGThermo Fisher Scientific Cat# A-11012,PRID:AB_2534079Alexa Fluor™ 488 chicken anti-goat IgGThermo Fisher Scientific Cat# A-21467, PRID:AB_2535870,
[0089] Additionally, flow cytometry was performed to identify TRA-1-60- and TRA-1-81-positive cells, another marker of stem cells. Specifically, KITi001-A-1 cells were detached with 0.5 mM EDTA and incubated with 1 μg of each primary antibody for 30 minutes. The cells were then labeled with fluorescein-conjugated secondary antibodies for 30 minutes on ice. Flow cytometry was performed using a Beckman Coulter CytoFLEX instrument and Kaluza analysis software (Beckman Coulter). Similarly, all experiments were performed at passage 36, and the antibodies used are listed in Table 2 above.
[0090] Analysis results showed that pluripotency markers such as OCT4, SOX2, and NANOG were exclusively expressed in the nucleus (Fig. 6), and analysis of TRA-1-60- and TRA-1-81-positive cells (>99%) indicated that these cells were pluripotent (Fig. 7).
[0091]
[0092] In addition, embryoid body (EB) formation assays were performed to confirm the differentiation potential of the KITi001-A-1 cell line into ectoderm, mesoderm, and endoderm. Specifically, KITi001-A-1 cells at passages 34 to 35 were detached with 0.5 mM EDTA and seeded onto AggreWell™ 800 (Stem Cell Technologies). After 24 hours, cell aggregates were transferred to low-attachment plates containing TeSR™-E8™ medium and cultured for 7 days. The formed EBs were cultured on Matrigel®-coated plates for 7 days prior to analysis.
[0093] To determine the expression of ectoderm, mesoderm, and endoderm marker genes, total RNA was isolated using TRIzol™ reagent (Invitrogen) and reverse transcribed using GoScript™ Reverse Transcription Mix (Promega). Quantitative real-time PCR was performed using SYBR™ Green Real-time PCR Master Mix (Promega) on a StepOnePlus™ Real-Time PCR system (Thermo Fisher Scientific). The sequences of the primers used are shown in Table 3.
[0094] Target primer sequence (5'-> 3') Sequence number OCT4 Forward TCGGGGTGGAGAGCAACT6 Reverse GGGTGATCCTCTTCTGCTTC7 SOX2 Forward ACCAGCTCGCAGACCTACAT8 Reverse TGGAGTGGGAGGAAGAGGTA9 NANOG Forward TGATTTGTGGGCCTGAAGA10 Reverse GTTGTTTGCCTTTGGGACTG11 PAX6 Forward GTCCATCTTTGCTTGGGAAA12 Reverse TAGCCAGGGTTGCGAAGAACT13 OTX2 Forward TGCAGGGGTTCTTCTGTGAT14 Reverse AGGGGTCAGAGCAATTGACCA15 EOME S Forward AGCGCAAATAACAACAACAC16 Reverse ATTCAAGTCCTCCACGCCATC17 ACTA2 Forward TGCCTGGGTTCGTCAGAGTC18 Reverse CAGGCAAGTCACTGTGTGGC19 AFP Forward AGCTTGGTGGTGGATGAA20 Reverse TCTGCAATGACAGCTCAAG21 GATA4 Forward TCCAAACCAGAAAACGGAAG22 Reverse CTGTGCCCGTAGTGAGATGA23 GAPDH Forward CATGAGAAGTATGACAACAGCCT24 Reverse AGTCCTTCCACGATACCAAAGT25
[0095] Additionally, to confirm the expression of ectoderm, mesoderm, and endoderm markers by immunocytochemistry analysis, cells were fixed with 4% paraformaldehyde for 10 minutes, washed, and blocked with 4% normal goat serum (Jackson ImmunoResearch) for 1 hour to prevent nonspecific binding of antibodies, and then blocked with primary antibodies overnight at 4°C. Detailed information on the antibodies used is shown in Table 2 above, and after washing, secondary antibodies were added for 1 hour at room temperature. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific Cat# D1306, PRID:AB_2629482).
[0096]
[0097] As a result of the analysis, compared to the KITi001-A-1 cell line (KITi001-A-1-PSC), the expression levels of the pluripotency markers OCT4 (Octamer-binding transcription factor 4), SOX2 (Sex determining region Y-box transcription factor 2), and NANOG were decreased in the induced embryoid body (KITi001-A-1-EB), whereas the expression levels of the ectoderm markers PAX6 (Paired box 6) and OTX2 (Orthodenticle homeobox 2), the mesoderm markers EOMES (Eomesodermin) and ACTA2 (Actin Alpha 2), and the endoderm markers AFP (alpha-fetoprotein) and GATA4 (GATA Binding Protein 4) were increased (Fig. 8A).
[0098] In addition, immunocytochemical analysis results showed that the expression of ectoderm markers TUBB3 (Tubulin Beta 3) and NESTIN, mesoderm markers DESMIN and α-SMA (α-smooth muscle actin), and endoderm markers AFP and SOX17 (Sex determining region Y-box transcription factor 17) increased, confirming the differentiation potential into the three germ layers (Fig. 8B).
[0099] In other words, we demonstrated that the KITi001-A-1 cell line can differentiate into three germ layers: ectoderm, mesoderm, and endoderm.
[0100]
[0101] Example 2. Confirmation of PDGFR-β expression characteristics of fluorescently labeled stem cell lines with hepatic stellate cell activation markers.
[0102] To evaluate whether the KITi001-A-1 cell line prepared in Example 1.1 can express the PDGFRB-mCherry fusion protein, it was differentiated into hepatic stellate cells (HSCs) according to the differentiation protocol. Specifically, PSCs were cultured at 9 × 10 4 cells / cm 2The cells were seeded in cell culture dishes at a density of 100 μg / mL and cultured in mTeSR1 medium (Stem cell technology). After the cells reached 50% confluence after 2-3 days, hepatic stellate cell differentiation began. First, to differentiate into mesoderm, 20 ng / ml of bone morphogenetic protein 4 (BMP4; peprotech) growth factor was added to mTeSR1 (Stem cell technology) medium and differentiated for 4 days. Afterwards, hepatic stellate cell differentiation medium was used, which consisted of 57% DMEM low glucose (Thermo Fisher Scientific), 40% MCDB-201-water (Sigma), 0.25× linoleic acid-bovine serum albumin (Sigma), 0.25× insulin-transferrin-selenium (Sigma), 1% penicillin / streptomycin (Gibco), 104 M L-ascorbic acid (Sigma), 2.5 mM dexamethasone (Sigma), and 50 mM 2-mercaptoethanol (Thermo Fisher Scientific). Growth factors were added as follows during the differentiation of hepatic stellate cells: First, 20 ng / ml of Fibroblast growth factor 1 (FGF1) and Fibroblast growth factor 3 (FGF3) (R&D system) were added from days 4 to 8 of differentiation, and 5 mM retinol (Sigma) and 100 mM palmitic acid (Sigma) were added from days 6 to 12. The plates were kept in an incubator maintained at 5% CO2 during the differentiation process, and the medium was changed every 48 hours.
[0103] To characterize the differentiated hepatic stellate cells, total RNA was isolated from hepatic stellate cells derived from the KITi001-A-1 cell line using TRIzol™ reagent (Invitrogen) and reverse transcribed using GoScript™ Reverse Transcription Mix (Promega). The primer sequences used are listed in Table 4. Quantitative real-time PCR was performed using SYBR™ Green Real-time PCR Master Mix (Promega) on a StepOnePlus™ Real-Time PCR system (Thermo Fisher Scientific).
[0104] Target primer sequence sequence number Desmin Forward GAGACCATCGCGGCTAAGAAC26 Reverse GTGTAGGACTGGATCTGGTGT27 PDGFRA Forward AACCCTGCTGATGAAAGCAC28 Reverse TCCTTTCTAGCATGGGGACA29 PDGFRB Forward TGATGCCGAGGAACTATTCATCT30 Reverse TTTTCTTCTCGTGCAGTGTCAC31
[0105] Compared with pluripotent stem cells (PSCs, D0), KITi001-A-1 cell line-derived hepatic stellate cells expressed significantly higher levels of hepatic stellate cell marker genes, such as Desmin, Actin alpha 2 (ACTA2, smooth muscle), platelet-derived growth factor receptor A (PDGFRA), and platelet-derived growth factor receptor B (PDGFRB), as of differentiation day 12 (D12) (Fig. 9). The proportion of mCherry-expressing cells was higher in KITi001-A-1 cell line-derived hepatic stellate cells than in HDF01 induced pluripotent stem cell (iPSC)-derived hepatic stellate cells (Fig. 10). In addition, it was confirmed that the expression of mCherry was significantly increased in hepatic stellate cells activated by treatment with PDGF-BB, a hepatic stellate cell activating substance, compared to control hepatic stellate cells (Fig. 11).
[0106]
[0107] Example 3. Confirmation of the efficacy of image-based drug screening using a fluorescently labeled stem cell line with a hepatic stellate cell activation marker.
[0108] In order to establish and apply an imaging-based high throughput screening (HTS) compound discovery method, differentiation into hepatic stellate cells was induced from the cell line prepared in Example 1.1 of the present invention using the same method as in Example 2, and the differentiated hepatic stellate cells were re-seeded in a 96-well cell culture dish for image analysis, and then treated with TGF-β1 and PDGF-BB, which are liver fibrosis inducers, and analyzed in real time using HCS (High Content Screening) equipment (Fig. 12A).
[0109] As a result, as shown in Figure 12B, a significant increase in the expression of PDGFR-β, a fluorescently labeled hepatic stellate cell activation marker, was observed, and cell proliferation, a characteristic of activated hepatic stellate cells, was also observed in conjunction with this.
[0110]
[0111] In summary, these results suggest that the PDGFRB-mCherry-transduced human induced pluripotent stem cell line KITi001-A-1 and hepatic stellate cells derived therefrom can be usefully utilized for live cell monitoring and real-time imaging-based compound screening for the identification of liver fibrosis-inducing substances.
[0112]
[0113] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors transformed with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
2. In paragraph 1, The fluorescent protein is one selected from the group consisting of mCherry, Green Fluorescent Protein (GFP), enhanced Green Fluorescent Protein (eGFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), luciferase, β-galactosidase, mPlum, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mScarlet, mKate, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. Human induced pluripotent stem cell line for screening for factors that induce or suppress liver fibrosis.
3. In paragraph 2, The above fluorescent protein is mCherry, a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors.
4. In paragraph 1, A human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors, wherein the human induced pluripotent stem cell line is produced by transfecting a first vector containing a gene encoding a guide RNA of sequence number 1 and a Cas9 protein; and a second vector expressing a fluorescent protein.
5. In paragraph 1, A human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors, wherein the human induced pluripotent stem cell line has increased expression of OCT4, SOX2, NANOG, TRA-1-60 positive cells or TRA-1-81 positive cells compared to a stem cell line that is not transformed with the fluorescent protein-labeled PDGFR-β.
6. A method for producing a human induced pluripotent stem cell line for screening for a liver fibrosis inducer or inhibitor, comprising a step of transforming a human induced pluripotent stem cell line with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
7. In paragraph 6, A manufacturing method, wherein the above transformation step comprises a step of transfecting a first vector including a gene encoding a guide RNA of sequence number 1 and a Cas9 protein; and a second vector expressing a fluorescent protein.
8. In paragraph 6, The fluorescent protein is one selected from the group consisting of mCherry, Green Fluorescent Protein (GFP), enhanced Green Fluorescent Protein (eGFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), luciferase, β-galactosidase, mPlum, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mScarlet, mKate, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. Ideal, manufacturing method. 9.(a) A step of differentiating a human induced pluripotent stem cell line for screening for hepatic fibrosis inducers or inhibitors of paragraph 1 into hepatic stellate cells; (b) a step of treating the differentiated hepatic stellate cells with a candidate substance and measuring the level of expression of a fluorescent protein; and (c) A method for screening for a factor inducing or suppressing liver fibrosis, comprising the step of selecting a candidate substance that significantly changes the expression level of the fluorescent protein in hepatic stellate cells administered with the candidate substance compared to a control group that was not administered with the candidate substance.
10. In paragraph 9, (d) A screening method further comprising a step of determining the candidate substance as a liver fibrosis inducer when the expression level of the fluorescent protein is significantly increased in the step (c).
11. In paragraph 9, (d) A screening method further comprising a step of determining the candidate substance as a liver fibrosis inhibitor when the expression level of the fluorescent protein is significantly reduced in the step (c).
12. In paragraph 9, The fluorescent protein is one selected from the group consisting of mCherry, Green Fluorescent Protein (GFP), enhanced Green Fluorescent Protein (eGFP), enhanced yellow fluorescent protein (EYFP), cyan fluorescent protein (CFP), luciferase, β-galactosidase, mPlum, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mScarlet, mKate, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. Ideal, screening method.
13. In paragraph 9, A screening method wherein the human induced pluripotent stem cell line is produced by transfecting a first vector containing a guide RNA of sequence number 1 and a gene encoding Cas9 protein; and a second vector expressing a fluorescent protein.
14. In paragraph 9, A screening method wherein the differentiated hepatic stellate cells in the above step (a) have increased expression of Desmin, ACTA2, PDGFRA or PDGFRB compared to the undifferentiated human induced pluripotent stem cell line.
15. In paragraph 9, A screening method, wherein the step of measuring the expression level of the fluorescent protein in step (b) includes a step of measuring the fluorescence intensity of the fluorescent protein or the number of cells expressing the fluorescent protein.
16. In paragraph 9, A screening method wherein the above screening method is performed using high-content screening analysis.
17. In paragraph 9, A screening method wherein the above screening method is performed using live cell imaging analysis.
18. A vector system for producing a human induced pluripotent stem cell line for screening for liver fibrosis inducers or suppressors, comprising a first vector comprising a gene encoding a guide RNA of sequence number 1 and a Cas9 protein; and a second vector expressing a fluorescent protein.
19. In paragraph 18, A vector system wherein the human induced pluripotent stem cell line for screening for the above liver fibrosis inducer or inhibitor is transformed with platelet-derived growth factor receptor β (PDGFR-β) labeled with a fluorescent protein.
20. A composition for editing a platelet-derived growth factor receptor β (PDGFR-β) gene, comprising a guide RNA of sequence number 1.
21. In paragraph 20, A composition for gene editing, wherein the guide RNA is used for producing a stem cell line for screening for liver fibrosis inducers or suppressors.
Citation Information
Patent Citations
Composition for prevention and treatment of liver fibrosis or liver cirrhosis comprising of mesenchymal stem cells derived from human embryonic stem cells as an active ingredient
KR1020150009441A
A method for preparing of fibrosis disease models and use of fibrosis disease model
KR1020180016179A
Cooling parasol
KR1020240017294A
Testing machine for pneumatic control
KR102390601B1